chore: bump up the version to 1.1.0 (#63)

zavolanlab · Feb 14, 2022 · b1ec280 · b1ec280
1 parent 0b37619
commit b1ec280
Show file tree

Hide file tree

Showing 31 changed files with 686 additions and 393 deletions.
diff --git a/.github/ISSUE_TEMPLATE/bug_report.md b/.github/ISSUE_TEMPLATE/bug_report.md
@@ -23,16 +23,5 @@ A clear and concise description of what you expected to happen.
 **Screenshots**
 If applicable, add screenshots to help explain your problem.
 
-**Desktop (please complete the following information):**
- - OS: [e.g. iOS]
- - Browser [e.g. chrome, safari]
- - Version [e.g. 22]
-
-**Smartphone (please complete the following information):**
- - Device: [e.g. iPhone6]
- - OS: [e.g. iOS8.1]
- - Browser [e.g. stock browser, safari]
- - Version [e.g. 22]
-
 **Additional context**
 Add any other context about the problem here.
diff --git a/.github/workflows/ATtRACT.yml b/.github/workflows/ATtRACT.yml
@@ -0,0 +1,56 @@
+name: ATtRACT
+
+on: push
+
+jobs:
+
+  ATtRACT-db-test:
+    runs-on: ${{ matrix.os }}
+    strategy:
+      matrix:
+        os: [macos-10.15, ubuntu-20.04]
+
+    steps:
+
+      - name: Checkout Repository
+        uses: actions/checkout@v2
+
+      - name: Setup miniconda & conda env
+        uses: conda-incubator/setup-miniconda@v2
+        with:
+          python-version: 3.7.4
+          miniconda-version: 4.7.12
+          auto-update-conda: false
+          environment-file: envs/main.yml
+          activate-environment: bindz-rbp
+          auto-activate-base: false
+
+      - name: Display all miniconda & env info
+        shell: bash -l {0}
+        run: |
+          conda info -a
+          conda list
+
+      - name: Install md5sum with brew
+        shell: bash -l {0}
+        if: matrix.os == 'macos-10.15'
+        run: brew install md5sha1sum
+
+      - name: Extract db backup
+        run: |
+          mkdir ATtRACT_backup_26082020
+          unzip resources/ATtRACT_backup_26082020.zip -d ATtRACT_backup_26082020
+
+      - name: Extract hsa motifs
+        shell: bash -l {0}
+        run: |
+          mkdir tests/unit/format-ATtRACT-motifs/ATtRACT_hsa
+          python scripts/format-ATtRACT-motifs.py --pwms tests/unit/format-ATtRACT-motifs/ATtRACT/pwm.txt --names tests/unit/format-ATtRACT-motifs/ATtRACT/ATtRACT_db.txt --organism Homo_sapiens --outdir tests/unit/format-ATtRACT-motifs/ATtRACT_hsa
+          md5sum --check tests/unit/format-ATtRACT-motifs/expected_output_hsa.md5
+
+      - name: Extract mmu motifs
+        shell: bash -l {0}
+        run: |
+          mkdir tests/unit/format-ATtRACT-motifs/ATtRACT_mmu
+          python scripts/format-ATtRACT-motifs.py --pwms tests/unit/format-ATtRACT-motifs/ATtRACT/pwm.txt --names tests/unit/format-ATtRACT-motifs/ATtRACT/ATtRACT_db.txt --organism Mus_musculus --outdir tests/unit/format-ATtRACT-motifs/ATtRACT_mmu
+          md5sum --check tests/unit/format-ATtRACT-motifs/expected_output_mmu.md5
diff --git a/.github/workflows/test-conda.yml b/.github/workflows/test-conda.yml
@@ -0,0 +1,194 @@
+name: test-conda
+
+on: push
+
+jobs:
+
+  dev-env:
+    runs-on: ${{ matrix.os }}
+    strategy:
+      matrix:
+        os: [macos-10.15, ubuntu-20.04]
+
+    steps:
+
+      - name: Checkout Repository
+        uses: actions/checkout@v2
+
+      - name: Setup miniconda & conda env
+        uses: conda-incubator/setup-miniconda@v2
+        with:
+          python-version: 3.7.4
+          miniconda-version: 4.7.12
+          auto-update-conda: false
+          environment-file: envs/dev.yml
+          activate-environment: bindz-rbp-dev
+          auto-activate-base: false
+
+      - name: Display all miniconda & env info
+        shell: bash -l {0}
+        run: |
+          conda info -a
+          conda list
+
+  plot-seq-logos:
+    runs-on: ${{ matrix.os }}
+    strategy:
+      matrix:
+        os: [macos-10.15, ubuntu-20.04]
+
+    steps:
+
+      - name: Checkout Repository
+        uses: actions/checkout@v2
+
+      - name: Setup miniconda & conda env
+        uses: conda-incubator/setup-miniconda@v2
+        with:
+          python-version: 3.7.4
+          miniconda-version: 4.7.12
+          auto-update-conda: false
+          environment-file: workflow/envs/plot_sequence_logos.yml
+          activate-environment: bindz-plot-sequence-logos
+          auto-activate-base: false
+
+      - name: Display all miniconda & env info
+        shell: bash -l {0}
+        run: |
+          conda info -a
+          conda list
+
+      - name: Install md5sum with brew
+        shell: bash -l {0}
+        if: matrix.os == 'macos-10.15'
+        run: brew install md5sha1sum
+
+      - name: Run script tests
+        shell: bash -l {0}
+        run: |
+          python workflow/scripts/sequence_logos.py --input_file tests/unit/plot_sequence_logos/motif_HNRNPF_820 --output_location tests/unit/plot_sequence_logos
+          python workflow/scripts/sequence_logos.py --input_file tests/unit/plot_sequence_logos/motif_HNRNPF_821 --output_location tests/unit/plot_sequence_logos
+          python workflow/scripts/sequence_logos.py --input_file tests/unit/plot_sequence_logos/motif_HNRNPF_822 --output_location tests/unit/plot_sequence_logos
+          python workflow/scripts/sequence_logos.py --input_file tests/unit/plot_sequence_logos/motif_HNRNPF_823 --output_location tests/unit/plot_sequence_logos
+          python workflow/scripts/sequence_logos.py --input_file tests/unit/plot_sequence_logos/motif_HNRNPF_824 --output_location tests/unit/plot_sequence_logos
+
+      - name: MD5SUM check
+        shell: bash -l {0}
+        run: md5sum --check tests/unit/plot_sequence_logos/expected_output.md5
+
+  combine-MotEvo-results:
+    runs-on: ${{ matrix.os }}
+    strategy:
+      matrix:
+        os: [macos-10.15, ubuntu-20.04]
+
+    steps:
+
+      - name: Checkout Repository
+        uses: actions/checkout@v2
+
+      - name: Setup miniconda & conda env
+        uses: conda-incubator/setup-miniconda@v2
+        with:
+          python-version: 3.7.4
+          miniconda-version: 4.7.12
+          auto-update-conda: false
+          environment-file: workflow/envs/combine-motevo-results.yml
+          activate-environment: bindz-combine-motevo-results
+          auto-activate-base: false
+
+      - name: Display all miniconda & env info
+        shell: bash -l {0}
+        run: |
+          conda info -a
+          conda list
+
+      - name: Install md5sum with brew
+        shell: bash -l {0}
+        if: matrix.os == 'macos-10.15'
+        run: brew install md5sha1sum
+
+      - name: Run script tests
+        shell: bash -l {0}
+        run: python workflow/scripts/combine-motevo-results.py --input_directories tests/unit/combine_results/motif_HNRNPF_820 tests/unit/combine_results/motif_HNRNPF_821 tests/unit/combine_results/motif_HNRNPF_822 tests/unit/combine_results/motif_HNRNPF_823 tests/unit/combine_results/motif_HNRNPF_824 --filename posterior_sites --outfile tests/unit/combine_results/combined_MotEvo_results.tsv
+
+      - name: MD5SUM check
+        shell: bash -l {0}
+        run: md5sum --check tests/unit/combine_results/expected_output.md5
+
+  plot-heatmap:
+    runs-on: ${{ matrix.os }}
+    strategy:
+      matrix:
+        os: [macos-10.15, ubuntu-20.04]
+
+    steps:
+
+      - name: Checkout Repository
+        uses: actions/checkout@v2
+
+      - name: Setup miniconda & conda env
+        uses: conda-incubator/setup-miniconda@v2
+        with:
+          miniconda-version: 4.7.12
+          auto-update-conda: false
+          environment-file: workflow/envs/plot_heatmap_of_MotEvo_results.yml
+          activate-environment: bindz-plot-heatmap-of-MotEvo-results
+          auto-activate-base: false
+
+      - name: Display all miniconda & env info
+        shell: bash -l {0}
+        run: |
+          conda info -a
+          conda list
+
+      - name: Run script tests
+        shell: bash -l {0}
+        run: Rscript workflow/scripts/heatmap.r --input_tsv tests/unit/Plot-heatmap-for-motifs/combined_MotEvo_results.tsv --input_sequence ATGTGAGTGAAGTGTGGGAAAGATGACTCGATATATCTGGATGCTAGGGATCGGATGGCGATACG --outfile tests/unit/Plot-heatmap-for-motifs/ProbabilityvsSequences.pdf --sequence_logos_directory tests/unit/Plot-heatmap-for-motifs/sequence_logos
+
+  pipeline-exec:
+    needs: [plot-seq-logos, combine-MotEvo-results, plot-heatmap]
+    runs-on: ${{ matrix.os }}
+    strategy:
+      matrix:
+        os: [macos-10.15, ubuntu-20.04]
+
+    steps:
+
+      - name: Checkout Repository
+        uses: actions/checkout@v2
+
+      - name: Setup miniconda & conda env
+        uses: conda-incubator/setup-miniconda@v2
+        with:
+          python-version: 3.7.4
+          miniconda-version: 4.7.12
+          auto-update-conda: false
+          environment-file: envs/main.yml
+          activate-environment: bindz-rbp
+          auto-activate-base: false
+
+      - name: Display all miniconda & env info
+        shell: bash -l {0}
+        run: |
+          conda info -a
+          conda list
+
+      - name: Install md5sum with brew
+        shell: bash -l {0}
+        if: matrix.os == 'macos-10.15'
+        run: brew install md5sha1sum
+
+      - name: Snakemake Rulegraph
+        shell: bash -l {0}
+        run: bash tests/integration/execution/snakemake_rulegraph_run.sh
+
+      - name: Snakemake DAG
+        shell: bash -l {0}
+        run: bash tests/integration/execution/snakemake_dag_run.sh
+
+      - name: Snakemake local run w/ conda envs
+        shell: bash -l {0}
+        run: |
+          bash tests/integration/execution/snakemake_local_run_conda_environments.sh
+          md5sum --check tests/integration/expected_output.md5
diff --git a/.github/workflows/test-singularity.yml b/.github/workflows/test-singularity.yml
@@ -0,0 +1,38 @@
+name: test-singularity
+
+on: push
+
+jobs:
+
+  pipeline-exec:
+    runs-on: ubuntu-20.04
+
+    steps:
+
+      - name: Checkout Repository
+        uses: actions/checkout@v2
+
+      - name: Setup miniconda & conda env
+        uses: conda-incubator/setup-miniconda@v2
+        with:
+          python-version: 3.7.4
+          miniconda-version: 4.7.12
+          auto-update-conda: false
+          environment-file: envs/main.yml
+          activate-environment: bindz-rbp
+          auto-activate-base: false
+
+      - name: Install Singularity
+        shell: bash -l {0}
+        run: conda install -c conda-forge singularity=3.5.2
+
+      - name: Display all miniconda & env info
+        shell: bash -l {0}
+        run: |
+          conda info -a
+          conda list
+
+      - name: Snakemake local run w/ singularity containers
+        shell: bash -l {0}
+        run: |
+          bash tests/integration/execution/snakemake_local_run_singularity_containers.sh