-
Notifications
You must be signed in to change notification settings - Fork 0
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
Showing
5 changed files
with
369 additions
and
2 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
|
@@ -47,3 +47,4 @@ test_server/ | |
bugs/ | ||
docs/apidocs/* | ||
docs/api/* | ||
!PxBLAT.ipynb |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,365 @@ | ||
{ | ||
"cells": [ | ||
{ | ||
"cell_type": "code", | ||
"execution_count": 3, | ||
"id": "b8f3f44b-7413-4a13-a69c-29bab549053b", | ||
"metadata": {}, | ||
"outputs": [ | ||
{ | ||
"name": "stdout", | ||
"output_type": "stream", | ||
"text": [ | ||
"/Users/ylk4626/miniforge3/bin/python\n" | ||
] | ||
} | ||
], | ||
"source": [ | ||
"!which python" | ||
] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": 4, | ||
"id": "0aa2f56a-07c3-43e0-956c-587e667c189d", | ||
"metadata": { | ||
"editable": true, | ||
"slideshow": { | ||
"slide_type": "" | ||
}, | ||
"tags": [] | ||
}, | ||
"outputs": [], | ||
"source": [ | ||
"from pathlib import Path" | ||
] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": 5, | ||
"id": "fc656558-7a8d-4328-8660-8a855f24f971", | ||
"metadata": {}, | ||
"outputs": [ | ||
{ | ||
"name": "stdout", | ||
"output_type": "stream", | ||
"text": [ | ||
"\u001b[38;5;4m\u001b[1m fas\u001b[0m test_case1_ground.psl test_ref.fa\n", | ||
" test_bit2fa_tmp.fa test_case2.fa test_ref_for_test.2bit\n", | ||
" test_case1.fa test_ref.2bit test_ref_ground.2bit\n" | ||
] | ||
} | ||
], | ||
"source": [ | ||
"!ls ../tests/data" | ||
] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": 8, | ||
"id": "14366611-affb-4918-aa99-d072b4a09858", | ||
"metadata": {}, | ||
"outputs": [], | ||
"source": [ | ||
"test_fasta = Path(\"../tests/data/test_ref.fa\") \n", | ||
"test_2bit = Path(\"../tests/data/test_ref.2bit\")\n", | ||
"seq_dir = Path(\"../tests/data/\")\n", | ||
"port = 65000\n", | ||
"\n", | ||
"fa_seq1 = \"TGAGAGGCATCTGGCCCTCCCTGCGCTGTGCCAGCAGCTTGGAGAACCCACACTCAATGAACGCAGCACTCCACTACCCAGGAAATGCCTTCCTGCCCTCTCCTCATCCCATCCCTGGGCAGGGGACATGCAACTGTCTACAAGGTGCCAA\"\n", | ||
"fa_seq2 = Path(\"../tests/data/test_case1.fa\")" | ||
] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": 27, | ||
"id": "b93c6aaa-4609-478b-b289-6627a2083e39", | ||
"metadata": {}, | ||
"outputs": [], | ||
"source": [ | ||
"def print_query(results):\n", | ||
" for idx, res in enumerate(results):\n", | ||
" print(f\"\\n{idx} query: \\n {res}\")\n", | ||
" if res is not None:\n", | ||
" for idh, hsp in enumerate(res.hsps):\n", | ||
" print(f\"\\n{idh} hit: \\n {hsp}\")" | ||
] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": 9, | ||
"id": "bebb5e94-5f62-4e17-ab96-3dda912597f0", | ||
"metadata": {}, | ||
"outputs": [], | ||
"source": [ | ||
"from pxblat import Server, Client" | ||
] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": 31, | ||
"id": "c209cefc-4ec9-4eb8-9fa2-36a93ebb1f2b", | ||
"metadata": {}, | ||
"outputs": [ | ||
{ | ||
"name": "stdout", | ||
"output_type": "stream", | ||
"text": [ | ||
"\n", | ||
"0 query: \n", | ||
" Program: blat (v.37x1)\n", | ||
" Query: /var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmp5_hjp7s_ (151)\n", | ||
" <unknown description>\n", | ||
" Target: <unknown target>\n", | ||
" Hits: ---- ----- ----------------------------------------------------------\n", | ||
" # # HSP ID + description\n", | ||
" ---- ----- ----------------------------------------------------------\n", | ||
" 0 1 chr1 <unknown description>\n", | ||
"\n", | ||
"0 hit: \n", | ||
" Query: /var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmp5_hjp7s_ <un...\n", | ||
" Hit: chr1 <unknown description>\n", | ||
"Query range: [0:151] (1)\n", | ||
" Hit range: [12699:12850] (1)\n", | ||
"Quick stats: evalue ?; bitscore ?\n", | ||
" Fragments: 1 (? columns)\n", | ||
"\n", | ||
"0 query: \n", | ||
" Program: blat (v.37x1)\n", | ||
" Query: /var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmpno6grxt8 (151)\n", | ||
" <unknown description>\n", | ||
" Target: <unknown target>\n", | ||
" Hits: ---- ----- ----------------------------------------------------------\n", | ||
" # # HSP ID + description\n", | ||
" ---- ----- ----------------------------------------------------------\n", | ||
" 0 1 chr1 <unknown description>\n", | ||
"\n", | ||
"0 hit: \n", | ||
" Query: /var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmpno6grxt8 <un...\n", | ||
" Hit: chr1 <unknown description>\n", | ||
"Query range: [0:151] (1)\n", | ||
" Hit range: [12699:12850] (1)\n", | ||
"Quick stats: evalue ?; bitscore ?\n", | ||
" Fragments: 1 (? columns)\n", | ||
"\n", | ||
"1 query: \n", | ||
" Program: blat (v.37x1)\n", | ||
" Query: case1 (151)\n", | ||
" <unknown description>\n", | ||
" Target: <unknown target>\n", | ||
" Hits: ---- ----- ----------------------------------------------------------\n", | ||
" # # HSP ID + description\n", | ||
" ---- ----- ----------------------------------------------------------\n", | ||
" 0 1 chr1 <unknown description>\n", | ||
"\n", | ||
"0 hit: \n", | ||
" Query: case1 <unknown description>\n", | ||
" Hit: chr1 <unknown description>\n", | ||
"Query range: [0:151] (1)\n", | ||
" Hit range: [12699:12850] (1)\n", | ||
"Quick stats: evalue ?; bitscore ?\n", | ||
" Fragments: 1 (? columns)\n" | ||
] | ||
} | ||
], | ||
"source": [ | ||
"client = Client(\n", | ||
" host=\"localhost\",\n", | ||
" port=port,\n", | ||
" seq_dir=seq_dir,\n", | ||
" min_score=20,\n", | ||
" min_identity=90,\n", | ||
")\n", | ||
"server_option = Server.create_option().withCanStop(True).withStepSize(5).build()\n", | ||
"\n", | ||
"with Server(\"localhost\", port, test_2bit, server_option) as server:\n", | ||
" server.wait_ready()\n", | ||
" assert server.is_ready()\n", | ||
" status = server.status(instance=True)\n", | ||
" ret1 = client.query(fa_seq1)\n", | ||
" ret2 = client.query([fa_seq1, fa_seq2])\n", | ||
" \n", | ||
" print_query(ret1)\n", | ||
" print_query(ret2)" | ||
] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": 32, | ||
"id": "93b2a02b-3c9c-45da-a1e8-c1cc49858db3", | ||
"metadata": {}, | ||
"outputs": [ | ||
{ | ||
"data": { | ||
"text/plain": [ | ||
"Server(localhost, 65000, ready: False open: False\n", | ||
"ServerOption(canStop: true, log: , logFacility: , mask: false, maxAaSize: 8000, maxDnaHits: 100, maxGap: 2, maxNtSize: 40000, maxTransHits: 200, minMatch: 2, repMatch: 2252, seqLog: false, ipLog: false, debugLog: false, tileSize: 11, stepSize: 5, trans: false, syslog: false, perSeqMax: , noSimpRepMask: false, indexFile: , timeout: 90, genome: , genomeDataDir: , threads: 1, allowOneMismatch: false))" | ||
] | ||
}, | ||
"execution_count": 32, | ||
"metadata": {}, | ||
"output_type": "execute_result" | ||
} | ||
], | ||
"source": [ | ||
"server" | ||
] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": 22, | ||
"id": "cf765aa2-4516-4573-9394-d3834efb6d6c", | ||
"metadata": {}, | ||
"outputs": [ | ||
{ | ||
"data": { | ||
"text/plain": [ | ||
"[QueryResult(id='/var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmpege3hbu1', 1 hits)]" | ||
] | ||
}, | ||
"execution_count": 22, | ||
"metadata": {}, | ||
"output_type": "execute_result" | ||
} | ||
], | ||
"source": [ | ||
"ret1" | ||
] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": 21, | ||
"id": "ddce6b47-28a3-4d92-962a-9e26c323c66f", | ||
"metadata": {}, | ||
"outputs": [ | ||
{ | ||
"data": { | ||
"text/plain": [ | ||
"[QueryResult(id='/var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmpu1629f8l', 1 hits),\n", | ||
" QueryResult(id='case1', 1 hits)]" | ||
] | ||
}, | ||
"execution_count": 21, | ||
"metadata": {}, | ||
"output_type": "execute_result" | ||
} | ||
], | ||
"source": [ | ||
"ret2" | ||
] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": 17, | ||
"id": "9da9c6af-95b6-4b94-90ec-ee4a46bcc9b1", | ||
"metadata": {}, | ||
"outputs": [ | ||
{ | ||
"name": "stdout", | ||
"output_type": "stream", | ||
"text": [ | ||
" Query: case1 <unknown description>\n", | ||
" Hit: chr1 <unknown description>\n", | ||
"Query range: [0:151] (1)\n", | ||
" Hit range: [12699:12850] (1)\n", | ||
"Quick stats: evalue ?; bitscore ?\n", | ||
" Fragments: 1 (? columns)\n" | ||
] | ||
} | ||
], | ||
"source": [ | ||
"print(ret2[1].hsps[0])" | ||
] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": 30, | ||
"id": "e4583d99-d0a1-4427-9a35-742d5977bc1c", | ||
"metadata": {}, | ||
"outputs": [ | ||
{ | ||
"name": "stdout", | ||
"output_type": "stream", | ||
"text": [ | ||
"\n", | ||
"0 query: \n", | ||
" Program: blat (v.37x1)\n", | ||
" Query: /var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmpu1629f8l (151)\n", | ||
" <unknown description>\n", | ||
" Target: <unknown target>\n", | ||
" Hits: ---- ----- ----------------------------------------------------------\n", | ||
" # # HSP ID + description\n", | ||
" ---- ----- ----------------------------------------------------------\n", | ||
" 0 1 chr1 <unknown description>\n", | ||
"\n", | ||
"0 hit: \n", | ||
" Query: /var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmpu1629f8l <un...\n", | ||
" Hit: chr1 <unknown description>\n", | ||
"Query range: [0:151] (1)\n", | ||
" Hit range: [12699:12850] (1)\n", | ||
"Quick stats: evalue ?; bitscore ?\n", | ||
" Fragments: 1 (? columns)\n", | ||
"\n", | ||
"1 query: \n", | ||
" Program: blat (v.37x1)\n", | ||
" Query: case1 (151)\n", | ||
" <unknown description>\n", | ||
" Target: <unknown target>\n", | ||
" Hits: ---- ----- ----------------------------------------------------------\n", | ||
" # # HSP ID + description\n", | ||
" ---- ----- ----------------------------------------------------------\n", | ||
" 0 1 chr1 <unknown description>\n", | ||
"\n", | ||
"0 hit: \n", | ||
" Query: case1 <unknown description>\n", | ||
" Hit: chr1 <unknown description>\n", | ||
"Query range: [0:151] (1)\n", | ||
" Hit range: [12699:12850] (1)\n", | ||
"Quick stats: evalue ?; bitscore ?\n", | ||
" Fragments: 1 (? columns)\n" | ||
] | ||
} | ||
], | ||
"source": [ | ||
"print_query(ret2)" | ||
] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": null, | ||
"id": "b92da0eb-9b79-42c1-b2e0-d1b9323a6408", | ||
"metadata": {}, | ||
"outputs": [], | ||
"source": [] | ||
}, | ||
{ | ||
"cell_type": "code", | ||
"execution_count": null, | ||
"id": "814c3678-8dab-42bf-8ea7-0b5df3f0b538", | ||
"metadata": {}, | ||
"outputs": [], | ||
"source": [] | ||
} | ||
], | ||
"metadata": { | ||
"kernelspec": { | ||
"display_name": "Python 3 (ipykernel)", | ||
"language": "python", | ||
"name": "python3" | ||
}, | ||
"language_info": { | ||
"codemirror_mode": { | ||
"name": "ipython", | ||
"version": 3 | ||
}, | ||
"file_extension": ".py", | ||
"mimetype": "text/x-python", | ||
"name": "python", | ||
"nbconvert_exporter": "python", | ||
"pygments_lexer": "ipython3", | ||
"version": "3.9.16" | ||
} | ||
}, | ||
"nbformat": 4, | ||
"nbformat_minor": 5 | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters