add notebook as example

ylab-hi · Sep 1, 2023 · c66cc41 · c66cc41
1 parent 80e1634
commit c66cc41
Show file tree

Hide file tree

Showing 5 changed files with 369 additions and 2 deletions.
diff --git a/.gitignore b/.gitignore
@@ -47,3 +47,4 @@ test_server/
 bugs/
 docs/apidocs/*
 docs/api/*
+!PxBLAT.ipynb
diff --git a/scripts/PxBLAT.ipynb b/scripts/PxBLAT.ipynb
@@ -0,0 +1,365 @@
+{
+ "cells": [
+  {
+   "cell_type": "code",
+   "execution_count": 3,
+   "id": "b8f3f44b-7413-4a13-a69c-29bab549053b",
+   "metadata": {},
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "/Users/ylk4626/miniforge3/bin/python\n"
+     ]
+    }
+   ],
+   "source": [
+    "!which python"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 4,
+   "id": "0aa2f56a-07c3-43e0-956c-587e667c189d",
+   "metadata": {
+    "editable": true,
+    "slideshow": {
+     "slide_type": ""
+    },
+    "tags": []
+   },
+   "outputs": [],
+   "source": [
+    "from pathlib import Path"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 5,
+   "id": "fc656558-7a8d-4328-8660-8a855f24f971",
+   "metadata": {},
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "\u001b[38;5;4m\u001b[1m fas\u001b[0m                  test_case1_ground.psl   test_ref.fa\n",
+      " test_bit2fa_tmp.fa   test_case2.fa           test_ref_for_test.2bit\n",
+      " test_case1.fa        test_ref.2bit           test_ref_ground.2bit\n"
+     ]
+    }
+   ],
+   "source": [
+    "!ls ../tests/data"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 8,
+   "id": "14366611-affb-4918-aa99-d072b4a09858",
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "test_fasta = Path(\"../tests/data/test_ref.fa\") \n",
+    "test_2bit = Path(\"../tests/data/test_ref.2bit\")\n",
+    "seq_dir = Path(\"../tests/data/\")\n",
+    "port = 65000\n",
+    "\n",
+    "fa_seq1 = \"TGAGAGGCATCTGGCCCTCCCTGCGCTGTGCCAGCAGCTTGGAGAACCCACACTCAATGAACGCAGCACTCCACTACCCAGGAAATGCCTTCCTGCCCTCTCCTCATCCCATCCCTGGGCAGGGGACATGCAACTGTCTACAAGGTGCCAA\"\n",
+    "fa_seq2 = Path(\"../tests/data/test_case1.fa\")"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 27,
+   "id": "b93c6aaa-4609-478b-b289-6627a2083e39",
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "def print_query(results):\n",
+    "    for idx, res in enumerate(results):\n",
+    "            print(f\"\\n{idx} query: \\n {res}\")\n",
+    "            if res is not None:\n",
+    "                for idh, hsp in enumerate(res.hsps):\n",
+    "                    print(f\"\\n{idh} hit: \\n {hsp}\")"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 9,
+   "id": "bebb5e94-5f62-4e17-ab96-3dda912597f0",
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "from pxblat import Server, Client"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 31,
+   "id": "c209cefc-4ec9-4eb8-9fa2-36a93ebb1f2b",
+   "metadata": {},
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "\n",
+      "0 query: \n",
+      " Program: blat (v.37x1)\n",
+      "  Query: /var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmp5_hjp7s_ (151)\n",
+      "         <unknown description>\n",
+      " Target: <unknown target>\n",
+      "   Hits: ----  -----  ----------------------------------------------------------\n",
+      "            #  # HSP  ID + description\n",
+      "         ----  -----  ----------------------------------------------------------\n",
+      "            0      1  chr1  <unknown description>\n",
+      "\n",
+      "0 hit: \n",
+      "       Query: /var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmp5_hjp7s_ <un...\n",
+      "        Hit: chr1 <unknown description>\n",
+      "Query range: [0:151] (1)\n",
+      "  Hit range: [12699:12850] (1)\n",
+      "Quick stats: evalue ?; bitscore ?\n",
+      "  Fragments: 1 (? columns)\n",
+      "\n",
+      "0 query: \n",
+      " Program: blat (v.37x1)\n",
+      "  Query: /var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmpno6grxt8 (151)\n",
+      "         <unknown description>\n",
+      " Target: <unknown target>\n",
+      "   Hits: ----  -----  ----------------------------------------------------------\n",
+      "            #  # HSP  ID + description\n",
+      "         ----  -----  ----------------------------------------------------------\n",
+      "            0      1  chr1  <unknown description>\n",
+      "\n",
+      "0 hit: \n",
+      "       Query: /var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmpno6grxt8 <un...\n",
+      "        Hit: chr1 <unknown description>\n",
+      "Query range: [0:151] (1)\n",
+      "  Hit range: [12699:12850] (1)\n",
+      "Quick stats: evalue ?; bitscore ?\n",
+      "  Fragments: 1 (? columns)\n",
+      "\n",
+      "1 query: \n",
+      " Program: blat (v.37x1)\n",
+      "  Query: case1 (151)\n",
+      "         <unknown description>\n",
+      " Target: <unknown target>\n",
+      "   Hits: ----  -----  ----------------------------------------------------------\n",
+      "            #  # HSP  ID + description\n",
+      "         ----  -----  ----------------------------------------------------------\n",
+      "            0      1  chr1  <unknown description>\n",
+      "\n",
+      "0 hit: \n",
+      "       Query: case1 <unknown description>\n",
+      "        Hit: chr1 <unknown description>\n",
+      "Query range: [0:151] (1)\n",
+      "  Hit range: [12699:12850] (1)\n",
+      "Quick stats: evalue ?; bitscore ?\n",
+      "  Fragments: 1 (? columns)\n"
+     ]
+    }
+   ],
+   "source": [
+    "client = Client(\n",
+    "    host=\"localhost\",\n",
+    "    port=port,\n",
+    "    seq_dir=seq_dir,\n",
+    "    min_score=20,\n",
+    "    min_identity=90,\n",
+    ")\n",
+    "server_option = Server.create_option().withCanStop(True).withStepSize(5).build()\n",
+    "\n",
+    "with Server(\"localhost\", port, test_2bit, server_option) as server:\n",
+    "    server.wait_ready()\n",
+    "    assert server.is_ready()\n",
+    "    status = server.status(instance=True)\n",
+    "    ret1 =  client.query(fa_seq1)\n",
+    "    ret2 = client.query([fa_seq1, fa_seq2])\n",
+    "    \n",
+    "    print_query(ret1)\n",
+    "    print_query(ret2)"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 32,
+   "id": "93b2a02b-3c9c-45da-a1e8-c1cc49858db3",
+   "metadata": {},
+   "outputs": [
+    {
+     "data": {
+      "text/plain": [
+       "Server(localhost, 65000, ready: False open: False\n",
+       "ServerOption(canStop: true, log: , logFacility: , mask: false, maxAaSize: 8000, maxDnaHits: 100, maxGap: 2, maxNtSize: 40000, maxTransHits: 200, minMatch: 2, repMatch: 2252, seqLog: false, ipLog: false, debugLog: false, tileSize: 11, stepSize: 5, trans: false, syslog: false, perSeqMax: , noSimpRepMask: false, indexFile: , timeout: 90, genome: , genomeDataDir: , threads: 1, allowOneMismatch: false))"
+      ]
+     },
+     "execution_count": 32,
+     "metadata": {},
+     "output_type": "execute_result"
+    }
+   ],
+   "source": [
+    "server"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 22,
+   "id": "cf765aa2-4516-4573-9394-d3834efb6d6c",
+   "metadata": {},
+   "outputs": [
+    {
+     "data": {
+      "text/plain": [
+       "[QueryResult(id='/var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmpege3hbu1', 1 hits)]"
+      ]
+     },
+     "execution_count": 22,
+     "metadata": {},
+     "output_type": "execute_result"
+    }
+   ],
+   "source": [
+    "ret1"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 21,
+   "id": "ddce6b47-28a3-4d92-962a-9e26c323c66f",
+   "metadata": {},
+   "outputs": [
+    {
+     "data": {
+      "text/plain": [
+       "[QueryResult(id='/var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmpu1629f8l', 1 hits),\n",
+       " QueryResult(id='case1', 1 hits)]"
+      ]
+     },
+     "execution_count": 21,
+     "metadata": {},
+     "output_type": "execute_result"
+    }
+   ],
+   "source": [
+    "ret2"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 17,
+   "id": "9da9c6af-95b6-4b94-90ec-ee4a46bcc9b1",
+   "metadata": {},
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "      Query: case1 <unknown description>\n",
+      "        Hit: chr1 <unknown description>\n",
+      "Query range: [0:151] (1)\n",
+      "  Hit range: [12699:12850] (1)\n",
+      "Quick stats: evalue ?; bitscore ?\n",
+      "  Fragments: 1 (? columns)\n"
+     ]
+    }
+   ],
+   "source": [
+    "print(ret2[1].hsps[0])"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 30,
+   "id": "e4583d99-d0a1-4427-9a35-742d5977bc1c",
+   "metadata": {},
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "\n",
+      "0 query: \n",
+      " Program: blat (v.37x1)\n",
+      "  Query: /var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmpu1629f8l (151)\n",
+      "         <unknown description>\n",
+      " Target: <unknown target>\n",
+      "   Hits: ----  -----  ----------------------------------------------------------\n",
+      "            #  # HSP  ID + description\n",
+      "         ----  -----  ----------------------------------------------------------\n",
+      "            0      1  chr1  <unknown description>\n",
+      "\n",
+      "0 hit: \n",
+      "       Query: /var/folders/s3/vs6nrrg52sdfjk3z90p7ndt94gg4tq/T/tmpu1629f8l <un...\n",
+      "        Hit: chr1 <unknown description>\n",
+      "Query range: [0:151] (1)\n",
+      "  Hit range: [12699:12850] (1)\n",
+      "Quick stats: evalue ?; bitscore ?\n",
+      "  Fragments: 1 (? columns)\n",
+      "\n",
+      "1 query: \n",
+      " Program: blat (v.37x1)\n",
+      "  Query: case1 (151)\n",
+      "         <unknown description>\n",
+      " Target: <unknown target>\n",
+      "   Hits: ----  -----  ----------------------------------------------------------\n",
+      "            #  # HSP  ID + description\n",
+      "         ----  -----  ----------------------------------------------------------\n",
+      "            0      1  chr1  <unknown description>\n",
+      "\n",
+      "0 hit: \n",
+      "       Query: case1 <unknown description>\n",
+      "        Hit: chr1 <unknown description>\n",
+      "Query range: [0:151] (1)\n",
+      "  Hit range: [12699:12850] (1)\n",
+      "Quick stats: evalue ?; bitscore ?\n",
+      "  Fragments: 1 (? columns)\n"
+     ]
+    }
+   ],
+   "source": [
+    "print_query(ret2)"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": null,
+   "id": "b92da0eb-9b79-42c1-b2e0-d1b9323a6408",
+   "metadata": {},
+   "outputs": [],
+   "source": []
+  },
+  {
+   "cell_type": "code",
+   "execution_count": null,
+   "id": "814c3678-8dab-42bf-8ea7-0b5df3f0b538",
+   "metadata": {},
+   "outputs": [],
+   "source": []
+  }
+ ],
+ "metadata": {
+  "kernelspec": {
+   "display_name": "Python 3 (ipykernel)",
+   "language": "python",
+   "name": "python3"
+  },
+  "language_info": {
+   "codemirror_mode": {
+    "name": "ipython",
+    "version": 3
+   },
+   "file_extension": ".py",
+   "mimetype": "text/x-python",
+   "name": "python",
+   "nbconvert_exporter": "python",
+   "pygments_lexer": "ipython3",
+   "version": "3.9.16"
+  }
+ },
+ "nbformat": 4,
+ "nbformat_minor": 5
+}
diff --git a/src/pxblat/server/client.py b/src/pxblat/server/client.py
@@ -548,4 +548,4 @@ def query(self, in_seqs: INSEQS | list[str] | list[Path] | INSEQ):
             )
 
         group = Pool(1)
-        yield from group.imap(self._query, in_seqs)
+        return list(group.imap(self._query, in_seqs))
diff --git a/src/pxblat/server/server.py b/src/pxblat/server/server.py
@@ -350,7 +350,7 @@ def create_option() -> ServerOption:
 
     def __str__(self) -> str:
         """Return server option as a string."""
-        return f"Server({self.host}, {self.port}, ready: {self.is_ready()} open: {self.is_open()}\n {self.option})"
+        return f"Server({self.host}, {self.port}, ready: {self.is_ready()} open: {self.is_open()}\n{self.option})"
 
     __repr__ = __str__
 

diff --git a/tests/test_server.py b/tests/test_server.py
@@ -1,6 +1,7 @@
 import time
 
 import pytest
+from kent.src.hg.utils.otto.sarscov2phylo.bioSampleJsonToTab import epiIdFromRecordAttrs
 from pxblat import Client
 from pxblat import ClientOption
 from pxblat import UsageStats