Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Fix auto-detection of adapter with fastp #337

Merged
merged 2 commits into from
Apr 5, 2024
Merged

Fix auto-detection of adapter with fastp #337

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
2 commits
Select commit Hold shift + click to select a range
3824d68
accept auto-detect as parameter value to activate
christopher-mohr Apr 4, 2024
2bfbbd5
reference correct issue in CHANGELOG
christopher-mohr Apr 4, 2024
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
1 change: 1 addition & 0 deletions CHANGELOG.md
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -9,6 +9,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0
- [[#334]](https://github.com/nf-core/smrnaseq/pull/334) - Fix [input channel cardinality](https://github.com/nf-core/smrnaseq/issues/331) in `MIRDEEP2_RUN` module
- [[#334]](https://github.com/nf-core/smrnaseq/pull/334) - Fix [bowtie conda version](https://github.com/nf-core/smrnaseq/issues/333) in `BOWTIE_MAP_SEQ` module
- [[#335]](https://github.com/nf-core/smrnaseq/pull/335) - Final fix for [casting issue](https://github.com/nf-core/smrnaseq/issues/327) in mirtrace module
- [[#337]](https://github.com/nf-core/smrnaseq/pull/337) - Fix [three_prime_adapter issue](https://github.com/nf-core/smrnaseq/issues/326), allow `auto-detect` as value

### Software dependencies

Expand Down
12 changes: 6 additions & 6 deletions conf/modules.config
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -47,12 +47,12 @@ process {
//
withName: '.*:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP' {
ext.args = [ "",
params.trim_fastq ? "" : "--disable_adapter_trimming",
params.clip_r1 > 0 ? "--trim_front1 ${params.clip_r1}" : "", // Remove bp from the 5' end of read 1.
params.three_prime_clip_r1 > 0 ? "--trim_tail1 ${params.three_prime_clip_r1}" : "", // Remove bp from the 3' end of read 1 AFTER adapter/quality trimming has been performed.
params.fastp_min_length > 0 ? "-l ${params.fastp_min_length}" : "",
params.fastp_max_length > 0 ? "--max_len1 ${params.fastp_max_length}" : "",
params.three_prime_adapter == null ? '' : "--adapter_sequence ${params.three_prime_adapter}"
params.trim_fastq ? "" : "--disable_adapter_trimming",
params.clip_r1 > 0 ? "--trim_front1 ${params.clip_r1}" : "", // Remove bp from the 5' end of read 1.
params.three_prime_clip_r1 > 0 ? "--trim_tail1 ${params.three_prime_clip_r1}" : "", // Remove bp from the 3' end of read 1 AFTER adapter/quality trimming has been performed.
params.fastp_min_length > 0 ? "-l ${params.fastp_min_length}" : "",
params.fastp_max_length > 0 ? "--max_len1 ${params.fastp_max_length}" : "",
params.three_prime_adapter == "auto-detect" ? "" : "--adapter_sequence ${params.three_prime_adapter}"
christopher-mohr marked this conversation as resolved.
Show resolved Hide resolved
].join(" ").trim()
publishDir = [
[
Expand Down
2 changes: 1 addition & 1 deletion docs/usage.md
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -18,7 +18,7 @@ This option indicates the experimental protocol used for the sample preparation.

The parameter `--three_prime_adapter` is set to the Illumina TruSeq single index adapter sequence `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`. This is also to ensure, that the auto-detect functionality of `FASTP` is disabled. Please make sure to adapt this adapter sequence accordingly for your run.

:warning: At least the `custom` protocol has to be specified, otherwise the pipeline won't run. In case you specify the `custom` protocol, ensure that the parameters above are set accordingly or the defaults will be applied. If you want to auto-detect the adapters using `fastp`, please set `--three_prime_adapter` to `""`.
:warning: At least the `custom` protocol has to be specified, otherwise the pipeline won't run. In case you specify the `custom` protocol, ensure that the parameters above are set accordingly or the defaults will be applied. If you want to auto-detect the adapters using `fastp`, please set `--three_prime_adapter` to `auto-detect`.

### `mirtrace_species` or `mirgenedb_species`

Expand Down
Loading