-
Notifications
You must be signed in to change notification settings - Fork 127
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
change default parameter values of FASTP max
length and three prime adapter sequence, set adapter fasta based on with_umi parameter, change included adapter fasta
- Loading branch information
1 parent
8c1143d
commit f83f0a5
Showing
4 changed files
with
16 additions
and
10 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +1,6 @@ | ||
> Illumina Sequencing Adapter | ||
> QIAseq miRNA adapter | ||
AACTGTAGGCACCATCAAT | ||
> Illumina miRNA adapter | ||
TGGAATTCTCGGGTGCCAAGG | ||
> Nextflex miRNA adapter | ||
TGGAATTCTCGGGTGCCAAGG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters