Merge pull request #311 from nf-core/fix-stack-size

Fix the stacksize and pretty much everything else
nf-core · Feb 5, 2024 · 3ef02e7 · 3ef02e7
2 parents cebd369 + 59eea65
commit 3ef02e7
Show file tree

Hide file tree

Showing 11 changed files with 189 additions and 56 deletions.
diff --git a/conf/modules.config b/conf/modules.config
@@ -45,28 +45,28 @@ process {
     //
     // FASTQ_FASTQC_UMITOOLS_FASTP
     //
-    withName: '.*:FASTQC_UMITOOLS_FASTP:FASTP' {
+    withName: '.*:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP' {
         ext.args = [ "",
-            params.trim_fastq              ? "" : "--disable_adapter_trimming",
-            params.clip_r1 > 0             ? "--trim_front1 ${params.clip_r1}" : "", // Remove bp from the 5' end of read 1.
-            params.three_prime_clip_r1 > 0 ? "--trim_tail1 ${params.three_prime_clip_r1}" : "", // Remove bp from the 3' end of read 1 AFTER adapter/quality trimming has been performed.
-            params.fastp_min_length > 0    ? "-l ${params.fastp_min_length}" : "",
-            params.fastp_max_length > 0    ? "--max_len1 ${params.fastp_max_length}" : "",
+            params.trim_fastq                  ? "" : "--disable_adapter_trimming",
+            params.clip_r1 > 0                 ? "--trim_front1 ${params.clip_r1}" : "", // Remove bp from the 5' end of read 1.
+            params.three_prime_clip_r1 > 0     ? "--trim_tail1 ${params.three_prime_clip_r1}" : "", // Remove bp from the 3' end of read 1 AFTER adapter/quality trimming has been performed.
+            params.fastp_min_length > 0        ? "-l ${params.fastp_min_length}" : "",
+            params.fastp_max_length > 0        ? "--max_len1 ${params.fastp_max_length}" : "",
             params.three_prime_adapter == null ?  '' : "--adapter_sequence ${params.three_prime_adapter}"
         ].join(" ").trim()
         publishDir = [
             [
-                path: { "${params.outdir}/fastp" },
+                path: { "${params.outdir}/fastp/on_raw" },
                 mode: params.publish_dir_mode,
                 pattern: "*.{json,html}"
             ],
             [
-                path: { "${params.outdir}/fastp/log" },
+                path: { "${params.outdir}/fastp/on_raw/log" },
                 mode: params.publish_dir_mode,
                 pattern: "*.log"
             ],
             [
-                path: { "${params.outdir}/fastp" },
+                path: { "${params.outdir}/fastp/on_raw" },
                 mode: params.publish_dir_mode,
                 pattern: "*.fail.fastq.gz",
                 enabled: params.save_trimmed_fail
@@ -92,22 +92,34 @@ process {
             saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
         ]
     }
-    withName: '.*:FASTQ_FASTQC_UMITOOLS_FASTP:UMITOOLS_EXTRACT' {
-        ext.args  = [
-            params.umitools_extract_method ? "--extract-method=${params.umitools_extract_method}" : '',
-            params.umitools_bc_pattern     ? "--bc-pattern='${params.umitools_bc_pattern}'" : '',
-        ].join(' ').trim()
+
+    //
+    // FASTP LENGTH FILTER
+    //
+    withName: 'FASTP_LENGTH_FILTER' {
+        ext.args = [ "",
+            "--disable_adapter_trimming",
+            "--disable_quality_filtering",
+            params.clip_r1 > 0             ? "--trim_front1 ${params.clip_r1}" : "", // Remove bp from the 5' end of read 1.
+            params.three_prime_clip_r1 > 0 ? "--trim_tail1 ${params.three_prime_clip_r1}" : "", // Remove bp from the 3' end of read 1 AFTER adapter/quality trimming has been performed.
+            params.fastp_min_length > 0    ? "-l ${params.fastp_min_length}" : ""
+        ].join(" ").trim()
         publishDir = [
             [
-                path: { "${params.outdir}/umi_dedup/fastq_extracted_umi" },
+                path: { "${params.outdir}/fastp/on_umi_extracted" },
+                mode: params.publish_dir_mode,
+                pattern: "*.{json,html}"
+            ],
+            [
+                path: { "${params.outdir}/fastp/on_umi_extracted/log" },
                 mode: params.publish_dir_mode,
                 pattern: "*.log"
             ],
             [
-                path: { "${params.outdir}/umi_dedup/fastq_extracted_umi" },
+                path: { "${params.outdir}/fastp/on_umi_extracted" },
                 mode: params.publish_dir_mode,
-                pattern: "*.fastq.gz",
-                enabled: params.save_umi_intermeds
+                pattern: "*.fail.fastq.gz",
+                enabled: params.save_trimmed_fail
             ]
         ]
     }
@@ -140,6 +152,26 @@ process {
         ]
     }
 
+    withName: 'UMITOOLS_EXTRACT' {
+        ext.args  = [
+            params.umitools_extract_method ? "--extract-method=${params.umitools_extract_method}" : '',
+            params.umitools_bc_pattern     ? "--bc-pattern='${params.umitools_bc_pattern}'" : '',
+        ].join(' ').trim()
+        publishDir = [
+            [
+                path: { "${params.outdir}/umi_dedup/fastq_extracted_umi" },
+                mode: params.publish_dir_mode,
+                pattern: "*.log"
+            ],
+            [
+                path: { "${params.outdir}/umi_dedup/fastq_extracted_umi" },
+                mode: params.publish_dir_mode,
+                pattern: "*.fastq.gz",
+                enabled: params.save_umi_intermeds
+            ]
+        ]
+    }
+
     //
     // MIRTRACE QC
     //

diff --git a/conf/test_umi.config b/conf/test_umi.config
@@ -31,6 +31,6 @@ params {
     //UMI Specific testcase
     with_umi = true
     umitools_extract_method = 'regex'
-    umitools_bc_pattern = '.+AACTGTAGGCACCATCAAT{s<=2}(?P<umi_1>.{12})(?P<discard_2>.*)'
+    umitools_bc_pattern = '.+(?P<discard_1>AACTGTAGGCACCATCAAT){s<=2}(?P<umi_1>.{12})(?P<discard_2>.*)'
     save_umi_intermeds = true
 }
diff --git a/modules.json b/modules.json
@@ -27,7 +27,7 @@
                     },
                     "fastqc": {
                         "branch": "master",
-                        "git_sha": "c9488585ce7bd35ccd2a30faa2371454c8112fb9",
+                        "git_sha": "f4ae1d942bd50c5c0b9bd2de1393ce38315ba57c",
                         "installed_by": ["fastq_fastqc_umitools_fastp"]
                     },
                     "multiqc": {
@@ -62,7 +62,7 @@
                     },
                     "umicollapse": {
                         "branch": "master",
-                        "git_sha": "6971511e34fb6563a48f1bf583238a7c49654910",
+                        "git_sha": "2e561f4551ce3df2bc60016f7ea359f2ed4bce49",
                         "installed_by": ["modules"]
                     },
                     "umitools/extract": {

diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test
diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap
diff --git a/modules/nf-core/umicollapse/main.nf b/modules/nf-core/umicollapse/main.nf
diff --git a/nextflow.config b/nextflow.config
@@ -31,7 +31,7 @@ params {
 
     // UMI handling
     with_umi                   = false
-    skip_umi_extract           = false
+    skip_umi_extract           = true //Needs to be true for fastq mode in collapsing reads
     umitools_extract_method    = 'string'
     umitools_bc_pattern        = null
     umi_discard_read           = null
@@ -41,7 +41,7 @@ params {
     // Trimming options
     clip_r1                     = null
     three_prime_clip_r1         = null
-    three_prime_adapter         = null
+    three_prime_adapter         = 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCA'
     trim_fastq                  = true
     fastp_min_length            = 17
     fastp_known_mirna_adapters  = "$projectDir/assets/known_adapters.fa"
@@ -52,7 +52,7 @@ params {
     skip_mirdeep                = false
     skip_fastp                  = false
     save_reference              = false
-    fastp_max_length            = 40
+    fastp_max_length            = 100
     min_trimmed_reads           = 10
 
     // Contamination filtering

diff --git a/nextflow_schema.json b/nextflow_schema.json
@@ -228,7 +228,7 @@
                 },
                 "fastp_max_length": {
                     "type": "integer",
-                    "default": 40,
+                    "default": 100,
                     "description": "Maximum filter length for raw reads.",
                     "fa_icon": "fas fa-ruler-horizontal"
                 },

diff --git a/subworkflows/local/mirna_quant.nf b/subworkflows/local/mirna_quant.nf
@@ -58,8 +58,6 @@ workflow MIRNA_QUANT {
     BAM_STATS_MATURE ( BOWTIE_MAP_MATURE.out.bam, FORMAT_MATURE.out.formatted_fasta )
     ch_versions = ch_versions.mix(BAM_STATS_MATURE.out.versions)
 
-
-
     PARSE_HAIRPIN ( hairpin ).parsed_fasta.set { hairpin_parsed }
     ch_versions = ch_versions.mix(PARSE_HAIRPIN.out.versions)
 
@@ -75,15 +73,14 @@ workflow MIRNA_QUANT {
     BAM_STATS_HAIRPIN ( BOWTIE_MAP_HAIRPIN.out.bam, FORMAT_HAIRPIN.out.formatted_fasta )
     ch_versions = ch_versions.mix(BAM_STATS_HAIRPIN.out.versions)
 
-
     BAM_STATS_MATURE.out.idxstats.collect{it[1]}
         .mix(BAM_STATS_HAIRPIN.out.idxstats.collect{it[1]})
         .dump(tag:'edger')
         .flatten()
         .collect()
         .set { edger_input }
-    EDGER_QC ( edger_input )
 
+    EDGER_QC ( edger_input )
     ch_versions.mix(EDGER_QC.out.versions)
 
     reads

diff --git a/subworkflows/local/mirtrace.nf b/subworkflows/local/mirtrace.nf
@@ -0,0 +1,17 @@
+//
+// Quantify mirna with bowtie and mirtop
+//
+
+include { MIRTRACE_RUN } from '../../modules/local/mirtrace'
+
+workflow MIRTRACE {
+    take:
+    reads      // channel: [ val(adapterseq), [ val(ids) ], [ path(reads) ] ]
+
+    main:
+    reads | MIRTRACE_RUN
+
+    emit:
+    results    = MIRTRACE_RUN.out.mirtrace
+    versions   = MIRTRACE_RUN.out.versions
+}