accept auto-detect as parameter value to activate

adapter auto detection

CHANGELOG.md

@@ -9,6 +9,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0
 - [[#334]](https://github.com/nf-core/smrnaseq/pull/334) - Fix [input channel cardinality](https://github.com/nf-core/smrnaseq/issues/331) in `MIRDEEP2_RUN` module
 - [[#334]](https://github.com/nf-core/smrnaseq/pull/334) - Fix [bowtie conda version](https://github.com/nf-core/smrnaseq/issues/333) in `BOWTIE_MAP_SEQ` module
 - [[#335]](https://github.com/nf-core/smrnaseq/pull/335) - Final fix for [casting issue](https://github.com/nf-core/smrnaseq/issues/327) in mirtrace module
+- [[#337]](https://github.com/nf-core/smrnaseq/pull/337) - Fix [three_prime_adapter issue](https://github.com/nf-core/smrnaseq/issues/327), allow `auto-detect` as value
 
 ### Software dependencies
 

conf/modules.config

@@ -47,12 +47,12 @@ process {
     //
     withName: '.*:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP' {
         ext.args = [ "",
-            params.trim_fastq                  ? "" : "--disable_adapter_trimming",
-            params.clip_r1 > 0                 ? "--trim_front1 ${params.clip_r1}" : "", // Remove bp from the 5' end of read 1.
-            params.three_prime_clip_r1 > 0     ? "--trim_tail1 ${params.three_prime_clip_r1}" : "", // Remove bp from the 3' end of read 1 AFTER adapter/quality trimming has been performed.
-            params.fastp_min_length > 0        ? "-l ${params.fastp_min_length}" : "",
-            params.fastp_max_length > 0        ? "--max_len1 ${params.fastp_max_length}" : "",
-            params.three_prime_adapter == null ?  '' : "--adapter_sequence ${params.three_prime_adapter}"
+            params.trim_fastq                           ? "" : "--disable_adapter_trimming",
+            params.clip_r1 > 0                          ? "--trim_front1 ${params.clip_r1}" : "", // Remove bp from the 5' end of read 1.
+            params.three_prime_clip_r1 > 0              ? "--trim_tail1 ${params.three_prime_clip_r1}" : "", // Remove bp from the 3' end of read 1 AFTER adapter/quality trimming has been performed.
+            params.fastp_min_length > 0                 ? "-l ${params.fastp_min_length}" : "",
+            params.fastp_max_length > 0                 ? "--max_len1 ${params.fastp_max_length}" : "",
+            params.three_prime_adapter == "auto-detect" ?  "" : "--adapter_sequence ${params.three_prime_adapter}"
         ].join(" ").trim()
         publishDir = [
             [

docs/usage.md

@@ -18,7 +18,7 @@ This option indicates the experimental protocol used for the sample preparation.
 
 The parameter `--three_prime_adapter` is set to the Illumina TruSeq single index adapter sequence `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`. This is also to ensure, that the auto-detect functionality of `FASTP` is disabled. Please make sure to adapt this adapter sequence accordingly for your run.
 
-:warning: At least the `custom` protocol has to be specified, otherwise the pipeline won't run. In case you specify the `custom` protocol, ensure that the parameters above are set accordingly or the defaults will be applied. If you want to auto-detect the adapters using `fastp`, please set `--three_prime_adapter` to `""`.
+:warning: At least the `custom` protocol has to be specified, otherwise the pipeline won't run. In case you specify the `custom` protocol, ensure that the parameters above are set accordingly or the defaults will be applied. If you want to auto-detect the adapters using `fastp`, please set `--three_prime_adapter` to `auto-detect`.
 
 ### `mirtrace_species` or `mirgenedb_species`