Release PR for 3.0 #616

jfy133 · 2024-05-10T13:24:45Z

TODO:

Update versions
Update workflow diagram if necessary

PR checklist

Post-release version bump

Add test configs for krona and concoct

…nto single-end-config

Created single end test

Update gtdbtk classifywf so doesn't break when mashdb given

…Samplesheet/map function in utils_nfcore_mag_pipeline

Important! Template update for nf-core/tools v2.13.1

Important! Template update for nf-core/tools v2.14.1

Add new logo

github-actions · 2024-05-10T13:27:55Z

`nf-core lint` overall result: Passed ✅ ⚠️

Posted for pipeline commit fa8f6ef

+| ✅ 304 tests passed       |+
#| ❔   2 tests were ignored |#
!| ❗   6 tests had warnings |!

❗ Test warnings:

nextflow_config - Config manifest.version should end in dev: 3.0.0
pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!
pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline

❔ Tests ignored:

nextflow_config - Config default ignored: params.phix_reference
nextflow_config - Config default ignored: params.lambda_reference

✅ Tests passed:

files_exist - File found: .gitattributes
files_exist - File found: .gitignore
files_exist - File found: .nf-core.yml
files_exist - File found: .editorconfig
files_exist - File found: .prettierignore
files_exist - File found: .prettierrc.yml
files_exist - File found: CHANGELOG.md
files_exist - File found: CITATIONS.md
files_exist - File found: CODE_OF_CONDUCT.md
files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
files_exist - File found: nextflow_schema.json
files_exist - File found: nextflow.config
files_exist - File found: README.md
files_exist - File found: .github/.dockstore.yml
files_exist - File found: .github/CONTRIBUTING.md
files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
files_exist - File found: .github/workflows/branch.yml
files_exist - File found: .github/workflows/ci.yml
files_exist - File found: .github/workflows/linting_comment.yml
files_exist - File found: .github/workflows/linting.yml
files_exist - File found: assets/email_template.html
files_exist - File found: assets/email_template.txt
files_exist - File found: assets/sendmail_template.txt
files_exist - File found: assets/nf-core-mag_logo_light.png
files_exist - File found: conf/modules.config
files_exist - File found: conf/test.config
files_exist - File found: conf/test_full.config
files_exist - File found: docs/images/nf-core-mag_logo_light.png
files_exist - File found: docs/images/nf-core-mag_logo_dark.png
files_exist - File found: docs/output.md
files_exist - File found: docs/README.md
files_exist - File found: docs/README.md
files_exist - File found: docs/usage.md
files_exist - File found: main.nf
files_exist - File found: assets/multiqc_config.yml
files_exist - File found: conf/base.config
files_exist - File found: conf/igenomes.config
files_exist - File found: .github/workflows/awstest.yml
files_exist - File found: .github/workflows/awsfulltest.yml
files_exist - File found: modules.json
files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
files_exist - File not found check: .github/workflows/push_dockerhub.yml
files_exist - File not found check: .markdownlint.yml
files_exist - File not found check: .nf-core.yaml
files_exist - File not found check: .yamllint.yml
files_exist - File not found check: bin/markdown_to_html.r
files_exist - File not found check: conf/aws.config
files_exist - File not found check: docs/images/nf-core-mag_logo.png
files_exist - File not found check: lib/Checks.groovy
files_exist - File not found check: lib/Completion.groovy
files_exist - File not found check: lib/NfcoreTemplate.groovy
files_exist - File not found check: lib/Utils.groovy
files_exist - File not found check: lib/Workflow.groovy
files_exist - File not found check: lib/WorkflowMain.groovy
files_exist - File not found check: lib/WorkflowMag.groovy
files_exist - File not found check: parameters.settings.json
files_exist - File not found check: pipeline_template.yml
files_exist - File not found check: Singularity
files_exist - File not found check: lib/nfcore_external_java_deps.jar
files_exist - File not found check: .travis.yml
nextflow_config - Config variable found: manifest.name
nextflow_config - Config variable found: manifest.nextflowVersion
nextflow_config - Config variable found: manifest.description
nextflow_config - Config variable found: manifest.version
nextflow_config - Config variable found: manifest.homePage
nextflow_config - Config variable found: timeline.enabled
nextflow_config - Config variable found: trace.enabled
nextflow_config - Config variable found: report.enabled
nextflow_config - Config variable found: dag.enabled
nextflow_config - Config variable found: process.cpus
nextflow_config - Config variable found: process.memory
nextflow_config - Config variable found: process.time
nextflow_config - Config variable found: params.outdir
nextflow_config - Config variable found: params.input
nextflow_config - Config variable found: params.validationShowHiddenParams
nextflow_config - Config variable found: params.validationSchemaIgnoreParams
nextflow_config - Config variable found: manifest.mainScript
nextflow_config - Config variable found: timeline.file
nextflow_config - Config variable found: trace.file
nextflow_config - Config variable found: report.file
nextflow_config - Config variable found: dag.file
nextflow_config - Config variable (correctly) not found: params.nf_required_version
nextflow_config - Config variable (correctly) not found: params.container
nextflow_config - Config variable (correctly) not found: params.singleEnd
nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
nextflow_config - Config variable (correctly) not found: params.name
nextflow_config - Config variable (correctly) not found: params.enable_conda
nextflow_config - Config timeline.enabled had correct value: true
nextflow_config - Config report.enabled had correct value: true
nextflow_config - Config trace.enabled had correct value: true
nextflow_config - Config dag.enabled had correct value: true
nextflow_config - Config manifest.name began with nf-core/
nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
nextflow_config - Config dag.file ended with .html
nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
nextflow_config - Config params.custom_config_version is set to master
nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Lines for loading custom profiles found
nextflow_config - nextflow.config contains configuration profile test
nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
nextflow_config - Config default value correct: params.custom_config_version= master
nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Config default value correct: params.max_cpus= 16
nextflow_config - Config default value correct: params.max_memory= 128.GB
nextflow_config - Config default value correct: params.max_time= 240.h
nextflow_config - Config default value correct: params.publish_dir_mode= copy
nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
nextflow_config - Config default value correct: params.validate_params= true
nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
nextflow_config - Config default value correct: params.spades_fix_cpus= -1
nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
nextflow_config - Config default value correct: params.metabat_rng_seed= 1
nextflow_config - Config default value correct: params.clip_tool= fastp
nextflow_config - Config default value correct: params.reads_minlength= 15
nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
nextflow_config - Config default value correct: params.bbnorm_target= 100
nextflow_config - Config default value correct: params.bbnorm_min= 5
nextflow_config - Config default value correct: params.longreads_min_length= 1000
nextflow_config - Config default value correct: params.longreads_keep_percent= 90
nextflow_config - Config default value correct: params.longreads_length_weight= 10
nextflow_config - Config default value correct: params.gtdb_db= https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/auxillary_files/gtdbtk_r214_data.tar.gz
nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1.0
nextflow_config - Config default value correct: params.gtdbtk_pplacer_scratch= true
nextflow_config - Config default value correct: params.genomad_min_score= 0.7
nextflow_config - Config default value correct: params.genomad_splits= 1
nextflow_config - Config default value correct: params.binning_map_mode= group
nextflow_config - Config default value correct: params.min_contig_size= 1500
nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
nextflow_config - Config default value correct: params.tiara_min_length= 3000
nextflow_config - Config default value correct: params.binqc_tool= busco
nextflow_config - Config default value correct: params.checkm_download_url= https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz
nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
nextflow_config - Config default value correct: params.gunc_database_type= progenomes
nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
nextflow_config - Config default value correct: params.freebayes_ploidy= 1
nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
files_unchanged - .gitattributes matches the template
files_unchanged - .prettierrc.yml matches the template
files_unchanged - CODE_OF_CONDUCT.md matches the template
files_unchanged - LICENSE matches the template
files_unchanged - .github/.dockstore.yml matches the template
files_unchanged - .github/CONTRIBUTING.md matches the template
files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
files_unchanged - .github/PULL_REQUEST_TEMPLATE.md matches the template
files_unchanged - .github/workflows/branch.yml matches the template
files_unchanged - .github/workflows/linting_comment.yml matches the template
files_unchanged - .github/workflows/linting.yml matches the template
files_unchanged - assets/email_template.html matches the template
files_unchanged - assets/email_template.txt matches the template
files_unchanged - assets/sendmail_template.txt matches the template
files_unchanged - assets/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
files_unchanged - docs/README.md matches the template
files_unchanged - .gitignore matches the template
files_unchanged - .prettierignore matches the template
actions_ci - '.github/workflows/ci.yml' is triggered on expected events
actions_ci - '.github/workflows/ci.yml' checks minimum NF version
actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
readme - README Nextflow minimum version badge matched config. Badge: 23.04.0, Config: 23.04.0
readme - README Zenodo placeholder was replaced with DOI.
pipeline_name_conventions - Name adheres to nf-core convention
template_strings - Did not find any Jinja template strings (265 files)
schema_lint - Schema lint passed
schema_lint - Schema title + description lint passed
schema_lint - Input mimetype lint passed: 'text/csv'
schema_params - Schema matched params returned from nextflow config
system_exit - No System.exit calls found
actions_schema_validation - Workflow validation passed: awstest.yml
actions_schema_validation - Workflow validation passed: branch.yml
actions_schema_validation - Workflow validation passed: ci.yml
actions_schema_validation - Workflow validation passed: clean-up.yml
actions_schema_validation - Workflow validation passed: fix-linting.yml
actions_schema_validation - Workflow validation passed: release-announcements.yml
actions_schema_validation - Workflow validation passed: linting.yml
actions_schema_validation - Workflow validation passed: awsfulltest.yml
actions_schema_validation - Workflow validation passed: linting_comment.yml
actions_schema_validation - Workflow validation passed: download_pipeline.yml
merge_markers - No merge markers found in pipeline files
modules_json - Only installed modules found in modules.json
multiqc_config - assets/multiqc_config.yml found and not ignored.
multiqc_config - assets/multiqc_config.yml contains report_section_order
multiqc_config - assets/multiqc_config.yml contains export_plots
multiqc_config - assets/multiqc_config.yml contains report_comment
multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
base_config - conf/base.config found and not ignored.
base_config - CUSTOM_DUMPSOFTWAREVERSIONS found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_HOST_REMOVAL_BUILD found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - PORECHOP found in conf/base.config and Nextflow scripts.
base_config - NANOLYSE found in conf/base.config and Nextflow scripts.
base_config - FILTLONG found in conf/base.config and Nextflow scripts.
base_config - CENTRIFUGE found in conf/base.config and Nextflow scripts.
base_config - KRAKEN2 found in conf/base.config and Nextflow scripts.
base_config - KRONA found in conf/base.config and Nextflow scripts.
base_config - CAT_DB_GENERATE found in conf/base.config and Nextflow scripts.
base_config - CAT found in conf/base.config and Nextflow scripts.
base_config - GTDBTK_CLASSIFYWF found in conf/base.config and Nextflow scripts.
base_config - MEGAHIT found in conf/base.config and Nextflow scripts.
base_config - SPADES found in conf/base.config and Nextflow scripts.
base_config - SPADESHYBRID found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/base.config and Nextflow scripts.
base_config - METABAT2_METABAT2 found in conf/base.config and Nextflow scripts.
base_config - MAG_DEPTHS found in conf/base.config and Nextflow scripts.
base_config - BUSCO found in conf/base.config and Nextflow scripts.
base_config - MAXBIN2 found in conf/base.config and Nextflow scripts.
base_config - DASTOOL_DASTOOL found in conf/base.config and Nextflow scripts.
modules_config - conf/modules.config found and not ignored.
modules_config - FASTQC_RAW found in conf/modules.config and Nextflow scripts.
modules_config - FASTP found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_PE found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_SE found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - FASTQC_TRIMMED found in conf/modules.config and Nextflow scripts.
modules_config - BBMAP_BBNORM found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP found in conf/modules.config and Nextflow scripts.
modules_config - FILTLONG found in conf/modules.config and Nextflow scripts.
modules_config - NANOLYSE found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_RAW found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_FILTERED found in conf/modules.config and Nextflow scripts.
modules_config - CENTRIFUGE found in conf/modules.config and Nextflow scripts.
modules_config - KRAKEN2 found in conf/modules.config and Nextflow scripts.
modules_config - KRONA found in conf/modules.config and Nextflow scripts.
modules_config - MEGAHIT found in conf/modules.config and Nextflow scripts.
modules_config - SPADES found in conf/modules.config and Nextflow scripts.
modules_config - SPADESHYBRID found in conf/modules.config and Nextflow scripts.
modules_config - QUAST found in conf/modules.config and Nextflow scripts.
modules_config - GENOMAD_ENDTOEND found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - MAG_DEPTHS_PLOT found in conf/modules.config and Nextflow scripts.
modules_config - BIN_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_DB_PREPARATION found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_SAVE_DOWNLOAD found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - ARIA2_UNTAR found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_LINEAGEWF found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_QA found in conf/modules.config and Nextflow scripts.
modules_config - COMBINE_CHECKM_TSV found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_DOWNLOADDB found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_RUN found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_MERGECHECKM found in conf/modules.config and Nextflow scripts.
modules_config - CAT_DB_GENERATE found in conf/modules.config and Nextflow scripts.
modules_config - CAT found in conf/modules.config and Nextflow scripts.
modules_config - CAT_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_CLASSIFYWF found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - PROKKA found in conf/modules.config and Nextflow scripts.
modules_config - PRODIGAL found in conf/modules.config and Nextflow scripts.
modules_config - FREEBAYES found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_VIEW found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_CONSENSUS found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_ANALYZE found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_FILTER found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_FAIDX found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - ADJUST_MAXBIN2_EXT found in conf/modules.config and Nextflow scripts.
modules_config - CONCOCT_ found in conf/modules.config and Nextflow scripts.
modules_config - SPLIT_FASTA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_CONCOCT found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_DASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - RENAME_POSTDASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_CLASSIFY found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - MMSEQS_DATABASES found in conf/modules.config and Nextflow scripts.
modules_config - METAEUK_EASYPREDICT found in conf/modules.config and Nextflow scripts.
modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 2.14.1

Run details

nf-core/tools version 2.14.1
Run at 2024-05-10 14:17:47

main.nf

modules.json

maxulysse

Minor comments

maxulysse

<3

CarsonJM

A monumental effort by @jfy133!!!

erikrikarddaniel

Looks good with a couple of questions:

Is it the new behaviour of --input that merits the 2.5.4 -> 3.0?
I saw a number of closed issues yesterday in emails, e.g. CheckM2 and dRep, but I don't see these changes included here.
Fonts in the svg files appear different

jfy133 · 2024-05-13T06:28:28Z

Looks good with a couple of questions:

Is it the new behaviour of --input that merits the 2.5.4 -> 3.0?

I saw a number of closed issues yesterday in emails, e.g. CheckM2 and dRep, but I don't see these changes included here.

Fonts in the svg files appear different

Thanks @erikrikarddaniel !

To answer your questions:

Yes exactly :) Because we drop support for direct fastq input --input '*{R1,R2}.fasta.gz , I consider this a backwards incompatible change, so following semvar this would equate to an API breaking change
They've not been added to the pipeline, I just did some issue cleanup as I saw a bunch of duplicates, so just consolidating the issues
That's an system rendering issue thing on SVGs. I didn't convert text to paths, so if you don't have the font on your system it'll fallback to something else. As we normally only use PNGs for actual display, I leave the SVGs raw so the text remains editable:)

I hope that answers your questions!

erikrikarddaniel · 2024-05-13T06:32:18Z

Regarding no 2: Since I just started a run and saw the closed issues, I had some hopes of finding those features in 3.0, giving me extra motivation to look at the PR 😉.

jfy133 · 2024-05-13T06:39:14Z

Regarding no 2: Since I just started a run and saw the closed issues, I had some hopes of finding those features in 3.0, giving me extra motivation to look at the PR 😉.

Aha, well one of them already has a module (checkm2 I think), so I promise to prioritise this for your review.😬

But highest priority now is adding nf-test so we can be sure we stop breaking things 😅

workflows/mag.nf

prototaxites

One minor comment!

workflows/mag.nf

jfy133 and others added 30 commits February 12, 2024 20:24

Fix rendering of markdown badges

67106f0

Post-release version bump

5359282

Merge pull request #586 from nf-core/post-release-version-bump

dce6da6

Post-release version bump

Turn on Krona in base test

c6b8546

Add CONCOCT test profile and tweak test_nothing metadata

4d0247b

Add CONCOCT test profile

495c719

Merge pull request #591 from nf-core/new-configs

30bde89

Add test configs for krona and concoct

Merge branch 'nf-core:master' into single-end-config

921ebbe

Added single_end test

69b9218

Merge branch 'single-end-config' of https://github.com/CarsonJM/mag i…

a9fee4d

…nto single-end-config

Merge branch 'dev' into single-end-config

67694c9

[automated] Fix code linting

f39874c

Merge pull request #593 from CarsonJM/single-end-config

9898052

Created single end test

Template update for nf-core/tools version 2.13

ebd96a7

Template update for nf-core/tools version 2.13.1

21e24b2

feat: allow adna co-binning

4a6d9e3

chore: update changelog

8344d18

Fix gtdbtk classifywf crash when mashdb given

7a9508b

improve changelgo

6f870d9

Merge branch 'dev' into nf-core-template-merge-2.13.1 [EXPECT TO FAIL]

d2f1f38

Merge pull request #608 from nf-core/update-gtdbtk-classifwy

1ffa881

Update gtdbtk classifywf so doesn't break when mashdb given

Get basic input samplesheet validation in, however need to check from…

304ae69

…Samplesheet/map function in utils_nfcore_mag_pipeline

Get pipeline seemingly running again

c66ad23

Re-add single end as can't mix the two in one run

c48dbab

Get SR tests working, start adding assmebly

f522c76

Re-add missing single end test

7763ef0

Re-add single-end test config

09f45ad

Apply suggestions from code review

2f62ecd

All --input validation checks working

8a8ab91

Move all input parameter code to utils_nfcore_mag subworkflow

4d4ba13

jfy133 and others added 8 commits May 6, 2024 11:28

Merge pull request #599 from nf-core/nf-core-template-merge-2.13.1

8392af9

Important! Template update for nf-core/tools v2.13.1

Template update for nf-core/tools version 2.14.0

182b401

Template update for nf-core/tools version 2.14.1

055d02a

Merge branch 'dev' into nf-core-template-merge-2.14.1

1e85604

Update all test data to new system

13bcb40

Merge pull request #614 from nf-core/nf-core-template-merge-2.14.1

600e458

Important! Template update for nf-core/tools v2.14.1

Add new logo!

a4d9de2

Merge pull request #615 from nf-core/new-logo

9d6e7ef

Add new logo

jfy133 marked this pull request as draft May 10, 2024 13:24

Update versions

370e188

jfy133 marked this pull request as ready for review May 10, 2024 14:04

maxulysse reviewed May 10, 2024

View reviewed changes

main.nf Outdated Show resolved Hide resolved

maxulysse reviewed May 10, 2024

View reviewed changes

modules.json Outdated Show resolved Hide resolved

maxulysse approved these changes May 10, 2024

View reviewed changes

jfy133 added 2 commits May 10, 2024 16:14

Fix module JSON

e6f1282

Harshil alignment

fa8f6ef

maxulysse approved these changes May 10, 2024

View reviewed changes

CarsonJM approved these changes May 10, 2024

View reviewed changes

erikrikarddaniel approved these changes May 13, 2024

View reviewed changes

prototaxites reviewed May 13, 2024

View reviewed changes

workflows/mag.nf Outdated Show resolved Hide resolved

prototaxites approved these changes May 13, 2024

View reviewed changes

jfy133 commented May 13, 2024

View reviewed changes

workflows/mag.nf Outdated Show resolved Hide resolved

Update workflows/mag.nf

5cae716

jfy133 merged commit a50117e into master May 13, 2024
32 of 33 checks passed

harper357 linked an issue Nov 18, 2024 that may be closed by this pull request

Replace CheckM with CheckM2 #607

Open

harper357 removed a link to an issue Nov 18, 2024

Replace CheckM with CheckM2 #607

Open

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Release PR for 3.0 #616

Release PR for 3.0 #616

jfy133 commented May 10, 2024 •

edited

Loading

github-actions bot commented May 10, 2024 •

edited

Loading

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

maxulysse left a comment

maxulysse left a comment

CarsonJM left a comment

erikrikarddaniel left a comment

jfy133 commented May 13, 2024

erikrikarddaniel commented May 13, 2024

jfy133 commented May 13, 2024

prototaxites left a comment

Release PR for 3.0 #616

Release PR for 3.0 #616

Conversation

jfy133 commented May 10, 2024 • edited Loading

PR checklist

github-actions bot commented May 10, 2024 • edited Loading

nf-core lint overall result: Passed ✅ ⚠️

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

maxulysse left a comment

Choose a reason for hiding this comment

maxulysse left a comment

Choose a reason for hiding this comment

CarsonJM left a comment

Choose a reason for hiding this comment

erikrikarddaniel left a comment

Choose a reason for hiding this comment

jfy133 commented May 13, 2024

erikrikarddaniel commented May 13, 2024

jfy133 commented May 13, 2024

prototaxites left a comment

Choose a reason for hiding this comment

jfy133 commented May 10, 2024 •

edited

Loading

github-actions bot commented May 10, 2024 •

edited

Loading

`nf-core lint` overall result: Passed ✅ ⚠️