Merging release 1.4

goksel · Apr 24, 2022 · 4ebd616 · 4ebd616
1 parent 7f5870b
commit 4ebd616
Show file tree

Hide file tree

Showing 225 changed files with 11,012 additions and 1,990 deletions.
diff --git a/libSBOLj3/output/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.ttl b/libSBOLj3/output/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.ttl
@@ -1,13 +1,13 @@
 @base          <https://synbiohub.org/public/igem/> .
 @prefix :      <https://synbiohub.org/public/igem/> .
-@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix CHEBI: <https://identifiers.org/CHEBI:> .
-@prefix GO:    <https://identifiers.org/GO:> .
-@prefix sbol:  <http://sbols.org/v3#> .
 @prefix EDAM:  <https://identifiers.org/edam:> .
+@prefix GO:    <https://identifiers.org/GO:> .
+@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix SO:    <https://identifiers.org/SO:> .
-@prefix prov:  <http://www.w3.org/ns/prov#> .
 @prefix om:    <http://www.ontology-of-units-of-measure.org/resource/om-2/> .
+@prefix prov:  <http://www.w3.org/ns/prov#> .
+@prefix sbol:  <http://sbols.org/v3#> .
 
 <BBa_F2620/SubComponent3/Range1>
         a                 sbol:Range ;

diff --git a/libSBOLj3/output/combine2020/combine2020.ttl b/libSBOLj3/output/combine2020/combine2020.ttl
@@ -1,13 +1,13 @@
 @base          <https://synbiohub.org/public/igem/> .
 @prefix :      <https://synbiohub.org/public/igem/> .
-@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix CHEBI: <https://identifiers.org/CHEBI:> .
-@prefix GO:    <https://identifiers.org/GO:> .
-@prefix sbol:  <http://sbols.org/v3#> .
 @prefix EDAM:  <https://identifiers.org/edam:> .
+@prefix GO:    <https://identifiers.org/GO:> .
+@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix SO:    <https://identifiers.org/SO:> .
-@prefix prov:  <http://www.w3.org/ns/prov#> .
 @prefix om:    <http://www.ontology-of-units-of-measure.org/resource/om-2/> .
+@prefix prov:  <http://www.w3.org/ns/prov#> .
+@prefix sbol:  <http://sbols.org/v3#> .
 
 <i13504_system/Interaction1>
         a                      sbol:Interaction ;

diff --git a/libSBOLj3/output/entity/annotation/annotation.ttl b/libSBOLj3/output/entity/annotation/annotation.ttl
@@ -1,14 +1,14 @@
 @base          <https://sbolstandard.org/examples/> .
 @prefix :      <https://sbolstandard.org/examples/> .
-@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix CHEBI: <https://identifiers.org/CHEBI:> .
-@prefix igem:  <http://parts.igem.org/> .
-@prefix GO:    <https://identifiers.org/GO:> .
-@prefix sbol:  <http://sbols.org/v3#> .
 @prefix EDAM:  <https://identifiers.org/edam:> .
+@prefix GO:    <https://identifiers.org/GO:> .
+@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix SO:    <https://identifiers.org/SO:> .
-@prefix prov:  <http://www.w3.org/ns/prov#> .
+@prefix igem:  <http://parts.igem.org/> .
 @prefix om:    <http://www.ontology-of-units-of-measure.org/resource/om-2/> .
+@prefix prov:  <http://www.w3.org/ns/prov#> .
+@prefix sbol:  <http://sbols.org/v3#> .
 
 <BBa_J23119/usage1>  a     sbol:Identified , igem:IGEMUsage ;
         igem:inStock       "true" ;

diff --git a/libSBOLj3/output/entity/attachment/attachment.jsonld b/libSBOLj3/output/entity/attachment/attachment.jsonld
@@ -27,12 +27,12 @@
     "hasNamespace" : "https://sbolstandard.org/examples"
   } ],
   "@context" : {
-    "hashAlgorithm" : {
-      "@id" : "http://sbols.org/v3#hashAlgorithm"
-    },
     "hash" : {
       "@id" : "http://sbols.org/v3#hash"
     },
+    "hashAlgorithm" : {
+      "@id" : "http://sbols.org/v3#hashAlgorithm"
+    },
     "size" : {
       "@id" : "http://sbols.org/v3#size"
     },

diff --git a/libSBOLj3/output/entity/attachment/attachment.jsonld_expanded b/libSBOLj3/output/entity/attachment/attachment.jsonld_expanded
@@ -21,12 +21,12 @@
   "@type" : [ "http://sbols.org/v3#Component" ]
 }, {
   "@id" : "https://sbolstandard.org/examples/attachment1",
-  "http://sbols.org/v3#hashAlgorithm" : [ {
-    "@value" : "Alg1"
-  } ],
   "http://sbols.org/v3#hash" : [ {
     "@value" : "aaa"
   } ],
+  "http://sbols.org/v3#hashAlgorithm" : [ {
+    "@value" : "Alg1"
+  } ],
   "http://sbols.org/v3#size" : [ {
     "@value" : "1000"
   } ],

diff --git a/libSBOLj3/output/entity/attachment/attachment.nt b/libSBOLj3/output/entity/attachment/attachment.nt
@@ -1,5 +1,5 @@
-<https://sbolstandard.org/examples/attachment1> <http://sbols.org/v3#hashAlgorithm> "Alg1" .
 <https://sbolstandard.org/examples/attachment1> <http://sbols.org/v3#hash> "aaa" .
+<https://sbolstandard.org/examples/attachment1> <http://sbols.org/v3#hashAlgorithm> "Alg1" .
 <https://sbolstandard.org/examples/attachment1> <http://sbols.org/v3#size> "1000" .
 <https://sbolstandard.org/examples/attachment1> <http://sbols.org/v3#format> <https://identifiers.org/edam:format_2585> .
 <https://sbolstandard.org/examples/attachment1> <http://sbols.org/v3#source> <https://sbolstandard.org/attachment1> .

diff --git a/libSBOLj3/output/entity/attachment/attachment.rdf b/libSBOLj3/output/entity/attachment/attachment.rdf
@@ -29,8 +29,8 @@
       <sbol:displayId>TetR_protein</sbol:displayId>
    </sbol:Component>
    <sbol:Attachment rdf:about="attachment1">
-      <sbol:hashAlgorithm>Alg1</sbol:hashAlgorithm>
       <sbol:hash>aaa</sbol:hash>
+      <sbol:hashAlgorithm>Alg1</sbol:hashAlgorithm>
       <sbol:size>1000</sbol:size>
       <sbol:format rdf:resource="https://identifiers.org/edam:format_2585"/>
       <sbol:source rdf:resource="/attachment1"/>

diff --git a/libSBOLj3/output/entity/attachment/attachment.ttl b/libSBOLj3/output/entity/attachment/attachment.ttl
@@ -1,13 +1,13 @@
 @base          <https://sbolstandard.org/examples/> .
 @prefix :      <https://sbolstandard.org/examples/> .
-@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix CHEBI: <https://identifiers.org/CHEBI:> .
-@prefix GO:    <https://identifiers.org/GO:> .
-@prefix sbol:  <http://sbols.org/v3#> .
 @prefix EDAM:  <https://identifiers.org/edam:> .
+@prefix GO:    <https://identifiers.org/GO:> .
+@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix SO:    <https://identifiers.org/SO:> .
-@prefix prov:  <http://www.w3.org/ns/prov#> .
 @prefix om:    <http://www.ontology-of-units-of-measure.org/resource/om-2/> .
+@prefix prov:  <http://www.w3.org/ns/prov#> .
+@prefix sbol:  <http://sbols.org/v3#> .
 
 :attachment1  a             sbol:Attachment ;
         sbol:displayId      "attachment1" ;

diff --git a/libSBOLj3/output/entity/collection/collection.ttl b/libSBOLj3/output/entity/collection/collection.ttl
@@ -1,13 +1,13 @@
 @base          <https://sbolstandard.org/examples/> .
 @prefix :      <https://sbolstandard.org/examples/> .
-@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix CHEBI: <https://identifiers.org/CHEBI:> .
-@prefix GO:    <https://identifiers.org/GO:> .
-@prefix sbol:  <http://sbols.org/v3#> .
 @prefix EDAM:  <https://identifiers.org/edam:> .
+@prefix GO:    <https://identifiers.org/GO:> .
+@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix SO:    <https://identifiers.org/SO:> .
-@prefix prov:  <http://www.w3.org/ns/prov#> .
 @prefix om:    <http://www.ontology-of-units-of-measure.org/resource/om-2/> .
+@prefix prov:  <http://www.w3.org/ns/prov#> .
+@prefix sbol:  <http://sbols.org/v3#> .
 
 :col1   a                  sbol:Collection ;
         sbol:displayId     "col1" ;

diff --git a/libSBOLj3/output/entity/component_urn_uri/component_urn_uri.jsonld b/libSBOLj3/output/entity/component_urn_uri/component_urn_uri.jsonld
@@ -1,7 +1,7 @@
 {
-  "@id" : "urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96",
+  "@id" : "urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58",
   "@type" : "sbol:Component",
-  "hasNamespace" : "urn:uuid:50c93ae6-96d7-4145-9673-c3acd68182a9",
+  "hasNamespace" : "urn:uuid:6752ab9a-9626-464c-aec5-52bf4a89a5fb",
   "name" : "TetR",
   "type" : "SBO:0000252",
   "@context" : {

diff --git a/libSBOLj3/output/entity/component_urn_uri/component_urn_uri.jsonld_expanded b/libSBOLj3/output/entity/component_urn_uri/component_urn_uri.jsonld_expanded
@@ -1,10 +1,10 @@
 [ {
-  "@id" : "urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96",
+  "@id" : "urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58",
   "http://sbols.org/v3#name" : [ {
     "@value" : "TetR"
   } ],
   "http://sbols.org/v3#hasNamespace" : [ {
-    "@id" : "urn:uuid:50c93ae6-96d7-4145-9673-c3acd68182a9"
+    "@id" : "urn:uuid:6752ab9a-9626-464c-aec5-52bf4a89a5fb"
   } ],
   "http://sbols.org/v3#type" : [ {
     "@id" : "https://identifiers.org/SBO:0000252"

diff --git a/libSBOLj3/output/entity/component_urn_uri/component_urn_uri.nt b/libSBOLj3/output/entity/component_urn_uri/component_urn_uri.nt
@@ -1,4 +1,4 @@
-<urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96> <http://sbols.org/v3#name> "TetR" .
-<urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96> <http://sbols.org/v3#hasNamespace> <urn:uuid:50c93ae6-96d7-4145-9673-c3acd68182a9> .
-<urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000252> .
-<urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
+<urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58> <http://sbols.org/v3#name> "TetR" .
+<urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58> <http://sbols.org/v3#hasNamespace> <urn:uuid:6752ab9a-9626-464c-aec5-52bf4a89a5fb> .
+<urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000252> .
+<urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
diff --git a/libSBOLj3/output/entity/component_urn_uri/component_urn_uri.rdf b/libSBOLj3/output/entity/component_urn_uri/component_urn_uri.rdf
@@ -10,9 +10,9 @@
     xmlns="https://sbolstandard.org/examples/"
     xmlns:om="http://www.ontology-of-units-of-measure.org/resource/om-2/"
    xml:base="https://sbolstandard.org/examples/">
-   <sbol:Component rdf:about="urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96">
+   <sbol:Component rdf:about="urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58">
       <sbol:name>TetR</sbol:name>
-      <sbol:hasNamespace rdf:resource="urn:uuid:50c93ae6-96d7-4145-9673-c3acd68182a9"/>
+      <sbol:hasNamespace rdf:resource="urn:uuid:6752ab9a-9626-464c-aec5-52bf4a89a5fb"/>
       <sbol:type rdf:resource="https://identifiers.org/SBO:0000252"/>
    </sbol:Component>
 </rdf:RDF>
diff --git a/libSBOLj3/output/entity/component_urn_uri/component_urn_uri.rj b/libSBOLj3/output/entity/component_urn_uri/component_urn_uri.rj
@@ -1,13 +1,13 @@
 { 
-  "urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96" : { 
+  "urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58" : { 
     "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { 
       "type" : "uri" ,
       "value" : "http://sbols.org/v3#Component"
     }
      ] ,
     "http://sbols.org/v3#hasNamespace" : [ { 
       "type" : "uri" ,
-      "value" : "urn:uuid:50c93ae6-96d7-4145-9673-c3acd68182a9"
+      "value" : "urn:uuid:6752ab9a-9626-464c-aec5-52bf4a89a5fb"
     }
      ] ,
     "http://sbols.org/v3#name" : [ { 

diff --git a/libSBOLj3/output/entity/component_urn_uri/component_urn_uri.ttl b/libSBOLj3/output/entity/component_urn_uri/component_urn_uri.ttl
@@ -1,16 +1,16 @@
 @base          <https://sbolstandard.org/examples/> .
 @prefix :      <https://sbolstandard.org/examples/> .
-@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix CHEBI: <https://identifiers.org/CHEBI:> .
-@prefix GO:    <https://identifiers.org/GO:> .
-@prefix sbol:  <http://sbols.org/v3#> .
 @prefix EDAM:  <https://identifiers.org/edam:> .
+@prefix GO:    <https://identifiers.org/GO:> .
+@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix SO:    <https://identifiers.org/SO:> .
-@prefix prov:  <http://www.w3.org/ns/prov#> .
 @prefix om:    <http://www.ontology-of-units-of-measure.org/resource/om-2/> .
+@prefix prov:  <http://www.w3.org/ns/prov#> .
+@prefix sbol:  <http://sbols.org/v3#> .
 
-<urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96>
+<urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58>
         a                  sbol:Component ;
-        sbol:hasNamespace  <urn:uuid:50c93ae6-96d7-4145-9673-c3acd68182a9> ;
+        sbol:hasNamespace  <urn:uuid:6752ab9a-9626-464c-aec5-52bf4a89a5fb> ;
         sbol:name          "TetR" ;
         sbol:type          SBO:0000252 .
diff --git a/libSBOLj3/output/entity/component_urn_uri/component_urn_uri_ordered.nt b/libSBOLj3/output/entity/component_urn_uri/component_urn_uri_ordered.nt
@@ -1,4 +1,4 @@
-<urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96> <http://sbols.org/v3#hasNamespace> <urn:uuid:50c93ae6-96d7-4145-9673-c3acd68182a9> .
-<urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96> <http://sbols.org/v3#name> "TetR" .
-<urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000252> .
-<urn:uuid:d713be1d-3c4c-48b6-a0a3-669f13ee2d96> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
+<urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58> <http://sbols.org/v3#hasNamespace> <urn:uuid:6752ab9a-9626-464c-aec5-52bf4a89a5fb> .
+<urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58> <http://sbols.org/v3#name> "TetR" .
+<urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000252> .
+<urn:uuid:5a9913bd-8b15-492c-a5d5-707cbc3c7c58> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
diff --git a/libSBOLj3/output/entity/implementation/implementation.ttl b/libSBOLj3/output/entity/implementation/implementation.ttl
@@ -1,13 +1,13 @@
 @base          <https://sbolstandard.org/examples/> .
 @prefix :      <https://sbolstandard.org/examples/> .
-@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix CHEBI: <https://identifiers.org/CHEBI:> .
-@prefix GO:    <https://identifiers.org/GO:> .
-@prefix sbol:  <http://sbols.org/v3#> .
 @prefix EDAM:  <https://identifiers.org/edam:> .
+@prefix GO:    <https://identifiers.org/GO:> .
+@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix SO:    <https://identifiers.org/SO:> .
-@prefix prov:  <http://www.w3.org/ns/prov#> .
 @prefix om:    <http://www.ontology-of-units-of-measure.org/resource/om-2/> .
+@prefix prov:  <http://www.w3.org/ns/prov#> .
+@prefix sbol:  <http://sbols.org/v3#> .
 
 :impl1  a                  sbol:Implementation ;
         sbol:built         :TetR_protein ;

diff --git a/libSBOLj3/output/entity/interface/interface.ttl b/libSBOLj3/output/entity/interface/interface.ttl
@@ -1,13 +1,13 @@
 @base          <https://sbolstandard.org/examples/> .
 @prefix :      <https://sbolstandard.org/examples/> .
-@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix CHEBI: <https://identifiers.org/CHEBI:> .
-@prefix GO:    <https://identifiers.org/GO:> .
-@prefix sbol:  <http://sbols.org/v3#> .
 @prefix EDAM:  <https://identifiers.org/edam:> .
+@prefix GO:    <https://identifiers.org/GO:> .
+@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix SO:    <https://identifiers.org/SO:> .
-@prefix prov:  <http://www.w3.org/ns/prov#> .
 @prefix om:    <http://www.ontology-of-units-of-measure.org/resource/om-2/> .
+@prefix prov:  <http://www.w3.org/ns/prov#> .
+@prefix sbol:  <http://sbols.org/v3#> .
 
 <LacI_producer/SubComponent1>
         a                sbol:SubComponent ;

diff --git a/libSBOLj3/output/entity/model/model.ttl b/libSBOLj3/output/entity/model/model.ttl
@@ -1,13 +1,13 @@
 @base          <https://sbolstandard.org/examples/> .
 @prefix :      <https://sbolstandard.org/examples/> .
-@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix CHEBI: <https://identifiers.org/CHEBI:> .
-@prefix GO:    <https://identifiers.org/GO:> .
-@prefix sbol:  <http://sbols.org/v3#> .
 @prefix EDAM:  <https://identifiers.org/edam:> .
+@prefix GO:    <https://identifiers.org/GO:> .
+@prefix SBO:   <https://identifiers.org/SBO:> .
 @prefix SO:    <https://identifiers.org/SO:> .
-@prefix prov:  <http://www.w3.org/ns/prov#> .
 @prefix om:    <http://www.ontology-of-units-of-measure.org/resource/om-2/> .
+@prefix prov:  <http://www.w3.org/ns/prov#> .
+@prefix sbol:  <http://sbols.org/v3#> .
 
 :toggle_switch  a          sbol:Component ;
         sbol:description   "Toggle Switch genetic circuit" ;

diff --git a/libSBOLj3/output/entity_addiitonal/component/component.jsonld b/libSBOLj3/output/entity_addiitonal/component/component.jsonld
@@ -0,0 +1,82 @@
+{
+  "@graph" : [ {
+    "@id" : "https://synbiohub.org/public/igem/BBa_F2620",
+    "@type" : "sbol:Component",
+    "description" : "PoPS Receiver",
+    "displayId" : "BBa_F2620",
+    "hasNamespace" : "https://synbiohub.org/public/igem",
+    "name" : "BBa_F2620",
+    "role" : "SO:0000704",
+    "type" : "SBO:0000251"
+  }, {
+    "@id" : "https://synbiohub.org/public/igem/BBa_R0040",
+    "@type" : "sbol:Component",
+    "description" : "TetR repressible promoter",
+    "displayId" : "BBa_R0040",
+    "hasNamespace" : "https://synbiohub.org/public/igem",
+    "hasSequence" : "https://synbiohub.org/public/igem/BBa_R0040_Sequence1",
+    "name" : "pTetR",
+    "role" : "SO:0000167",
+    "type" : "SBO:0000251"
+  }, {
+    "@id" : "https://synbiohub.org/public/igem/BBa_R0040_Sequence1",
+    "@type" : "sbol:Sequence",
+    "description" : "pTetR sequence",
+    "displayId" : "BBa_R0040_Sequence1",
+    "elements" : "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac",
+    "encoding" : "EDAM:format_1207",
+    "hasNamespace" : "https://synbiohub.org/public/igem",
+    "name" : "Sequence1"
+  }, {
+    "@id" : "https://synbiohub.org/public/igem/BBa_R0040_Sequence2",
+    "@type" : "sbol:Sequence",
+    "description" : "pTetR sequence",
+    "displayId" : "BBa_R0040_Sequence2",
+    "elements" : "aaaa",
+    "encoding" : "EDAM:format_1207",
+    "hasNamespace" : "https://synbiohub.org/public/igem",
+    "name" : "Sequence2"
+  } ],
+  "@context" : {
+    "role" : {
+      "@id" : "http://sbols.org/v3#role",
+      "@type" : "@id"
+    },
+    "description" : {
+      "@id" : "http://sbols.org/v3#description"
+    },
+    "name" : {
+      "@id" : "http://sbols.org/v3#name"
+    },
+    "hasNamespace" : {
+      "@id" : "http://sbols.org/v3#hasNamespace",
+      "@type" : "@id"
+    },
+    "type" : {
+      "@id" : "http://sbols.org/v3#type",
+      "@type" : "@id"
+    },
+    "displayId" : {
+      "@id" : "http://sbols.org/v3#displayId"
+    },
+    "hasSequence" : {
+      "@id" : "http://sbols.org/v3#hasSequence",
+      "@type" : "@id"
+    },
+    "encoding" : {
+      "@id" : "http://sbols.org/v3#encoding",
+      "@type" : "@id"
+    },
+    "elements" : {
+      "@id" : "http://sbols.org/v3#elements"
+    },
+    "SBO" : "https://identifiers.org/SBO:",
+    "CHEBI" : "https://identifiers.org/CHEBI:",
+    "GO" : "https://identifiers.org/GO:",
+    "sbol" : "http://sbols.org/v3#",
+    "EDAM" : "https://identifiers.org/edam:",
+    "SO" : "https://identifiers.org/SO:",
+    "prov" : "http://www.w3.org/ns/prov#",
+    "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/"
+  }
+}