Small fix to how leading insertions are handled during subsetting of …

…alignments.
fulcrumgenomics · Oct 5, 2017 · 0739241 · 0739241
1 parent faa16a8
commit 0739241
Show file tree

Hide file tree

Showing 2 changed files with 12 additions and 2 deletions.
diff --git a/src/main/scala/com/fulcrumgenomics/alignment/Alignment.scala b/src/main/scala/com/fulcrumgenomics/alignment/Alignment.scala
@@ -333,7 +333,7 @@ case class Alignment(query: Array[Byte],
       // If the current element consumes the chosen sequence, calculate the end, else set to the same as start
 
       val elementConsumes = consumes(elem)
-      val currEnd = if (elementConsumes) currStart + elem.length - 1 else currStart
+      val currEnd = if (elementConsumes) currStart + elem.length - 1 else currStart-1
 
       if (currEnd < start) {
         // Element before the desired window, need to bump start positions

diff --git a/src/test/scala/com/fulcrumgenomics/alignment/AlignmentTest.scala b/src/test/scala/com/fulcrumgenomics/alignment/AlignmentTest.scala
@@ -212,7 +212,7 @@ class AlignmentTest extends UnitSpec {
   it should "drop insertions and deletions that are adjacent to the desired region" in {
     val sub = Alignment("AACCAAAAAAAA", "AAAAAAAATTAA", 1, 1, Cigar("2=2I6=2D2="), 10).subByTarget(3, 8)
     sub.targetStart shouldBe 3
-    sub.queryStart  shouldBe 3
+    sub.queryStart  shouldBe 5
     sub.cigar.toString() shouldBe "6="
   }
 
@@ -221,6 +221,16 @@ class AlignmentTest extends UnitSpec {
     an[Exception] shouldBe thrownBy { Alignment("AAAAA", "TAAAT", 2, 2, Cigar("3="), 0).subByTarget(2, 5) }
   }
 
+  it should "handle a real world test case" in {
+    val query  = "GGCCAGAGTCCACAGATTAACCAGGGGATATGCTAGAAA"
+    val target =    "CAGAGGCCACAGATTAACCAGGGGATATGCTAGAAA"
+    val ali = Alignment(query, target, 1, 1, Cigar("3I5=1X30="), 0)
+    val sub = ali.subByTarget(1, 20)
+    sub.queryStart shouldBe 4
+    sub.targetStart shouldBe 1
+    sub.cigar.toString shouldBe "5=1X14="
+  }
+
   "Alignment.subByQuery" should "yield appropriate sub-alignment when all bases are aligned" in {
     val sub = Alignment("AAAAAAAAAA", "AAAAAAAAAA", 1, 1, Cigar("10M"), 10).subByQuery(5, 6)
     sub.targetStart shouldBe 5