Update README.md

bcbio · Jan 31, 2022 · 36f74be · 36f74be
1 parent f330680
commit 36f74be
Showing 1 changed file with 2 additions and 1 deletion.
diff --git a/README.md b/README.md
@@ -37,4 +37,5 @@ CGCCTGAATCCATATAACACTCCAATATTTGCCATAAAAAAGAAGGACAGTACTAAGTGGAGAAAATTAGTAGATTTCAG
 ## Output
 
 - DRM.xlsx - 1st sheet - DRM stats, then one sheet per sample
-- freq.xlsx - individual and top allele frequencies
+- freq.xlsx - barcode stats, per sample all and top allele frequencies
+- `_hivdrm_tmp` - intermediate files from all the steps