Releases: atlasbioinfo/CRISPR-CBEI
autocbei v1.8
Resolved issues such as package adaptation and inability to generate pie charts
autocbei 1.6.5
autocbei
We provided command-line versions that can be used to design the cytosine base editor mediated gene inactivation for large amounts of CDS.
We developed the 'autocbei' to automate the calculation of potential CBEI loci of the target CDSs and to perform statistics and calculations.
1. Install
"autocbei" relies on python3 and requires 'biopython' and 'matplotlib' packages. The current version (1.6.3) supports ‘conda’ and ‘pip’ installations.
1.1 Install by conda (Recommended)
Conda (including Anaconda and Miniconda) is a popular way to manage software. It can create and configure a virtual environment without affecting global settings.
First install the corresponding platform of Anaconda or Miniconda. We recommend installing python3 version.
Then execute the following command:
# Creating a virtual environment of python3.7.
1. conda create -n runCBEI python=3.7 -y
# Activate the environment
2. conda activate runCBEI
# Install autocbei
3. conda install -c atlasbioinfo autocbei -y1.2 Install by pip
If Python3 (Python >= 3.6.0) is already included in your operating system, autocbei can be automatically installed via pip.
pip install autocbeiUse the following command to determine which version of Python you have installed:
python -V
If you haven't installed python3 yet, it's recommended to use the 'method 1.1' above.
1.3 Install the pre-release version (recommend experienced users)
If you want to try out the latest but unreleased version (possibly unstable) of autocbei, please follow these commands:
# Download CRISPR-CBEI from Github
1. git clone https://github.com/atlasbioinfo/CRISPR-CBEI.git
# Install biopython and matplotlib
2. conda install -y biopython matplotlib
# Run autocbei and show help info
3. python run_autocbei.py -h2 Usage
2.1 Demo CDS file
If the installation of "autocbei" has been successful, the sample file is located at [PYTHON_HOME]/site-packages/autocbei/Bacillus_subtilis.part500.cds.all.fa
If installed with Conda, it should be located at:
~/anaconda3/envs/autocbei/lib/python3.7/site-packages/autocbei/Bacillus_subtilis.part500.cds.all.fa
Or, it can be downloaded via "https://github.com/atlasbioinfo/CRISPR-CBEI/blob/master/autocbei/Bacillus_subtilis.part500.cds.all.fa".
2.2 Run
The -h parameter shows help information.
autocbei -h
usage: autocbei [-h] [-ns] [-o OUTPREFIX] CDS.fasta
Enter fasta file of CDSs, output base editor's potential editing site and
statistics information. The demo CDS Fasta file: "[PATHON_HOME]/site-
packages/autocbei/Bacillus_subtilis.part500.cds.all.fa".
positional arguments:
CDS.fasta CDSs in fasta format.
optional arguments:
-h, --help show this help message and exit
-ns, --nostat Only run CBEI design without statistics and plot.
-o OUTPREFIX, --outprefix OUTPREFIX
Directory prefixes can be customized. Default: "CBEI"
(CBEIRaw, CBEIPlot, CBEIRes).
Calculate the potential CRISPR base editing site information of CDSs
autocbei Bacillus_subtilis.part500.cds.all.fa
Calculation only without statistics and ploting:
autocbei -ns Bacillus_subtilis.part500.cds.all.fa -o Bac
3. Base editors
The autoCBEI contains 13 commonly used base editors.
#Set the Base editor parameter
# [PAM, spacer length, edit beg, edit end, direction]
# Direction refers to spacer at the 5' or 3' end of PAM sequence (5 or 3, respectively).
beinfos = {
"BE":["NGG",20,4,8,5],
"YE1-BE3":["NGG",20,5,7,5],
"EE-BE3":["NGG",20,5,6,5],
"YEE-BE3":["NGG",20,6,6,5],
"VQR-BE3":["NGAN",20,4,11,5],
"VRER-BE3":["NGCG",20,3,10,5],
"SaBE":["NNGRRT",21,3,12,5],
"Sa(KKH)-BE3":["NNNRRT",21,3,12,5],
"Cas12a–BE":["TTTV",20,10,12,3],
"Target-AID":["NGG",20,2,4,5],
"Target-AID-NG":["NG",20,2,4,5],
"xBE3":["NG",20,4,8,5],
"BE-PLUS":["NGG",20,4,14,5]
# Or, add your own Base editors
# "BE name" :[PAM, SpLength, EditBeg, EditEnd, Direction]
}
PAM: PAM sequence.
SpLength: Spacer length.
EditBeg: Edit windows begin.
EditEnd: Edit windows end.
Direction: 5 or 3. Spacer is at the 5 'end or 3' end of the PAM sequence. The example in the figure is the 5.
4 Output
4.1 Output message
The output message of simply run
autocbei Bacillus_subtilis.part500.cds.all.fashould be:
Input file: Bacillus_subtilis.part500.cds.all.fa
Output directory: CBEIRaw
Base editors:
BE PAM Spacer EditBegin EditEnd Direction
BE NGG 20 4 8 5
YE1-BE3 NGG 20 5 7 5
EE-BE3 NGG 20 5 6 5
YEE-BE3 NGG 20 6 6 5
VQR-BE3 NGAN 20 4 11 5
VRER-BE3 NGCG 20 3 10 5
SaBE NNGRRT 21 3 12 5
Sa(KKH)-BE3 NNNRRT 21 3 12 5
Cas12a–BE TTTV 20 10 12 3
Target-AID NGG 20 2 4 5
Target-AID-NG NG 20 2 4 5
xBE3 NG 20 4 8 5
BE-PLUS NGG 20 4 14 5
Start calculating: BE
CBEI calculation of base editor "BE" , done!
Start calculating: YE1-BE3
CBEI calculation of base editor "YE1-BE3" , done!
Start calculating: EE-BE3
CBEI calculation of base editor "EE-BE3" , done!
Start calculating: YEE-BE3
CBEI calculation of base editor "YEE-BE3" , done!
Start calculating: VQR-BE3
CBEI calculation of base editor "VQR-BE3" , done!
Start calculating: VRER-BE3
CBEI calculation of base editor "VRER-BE3" , done!
Start calculating: SaBE
CBEI calculation of base editor "SaBE" , done!
Start calculating: Sa(KKH)-BE3
CBEI calculation of base editor "Sa(KKH)-BE3" , done!
Start calculating: Cas12a–BE
CBEI calculation of base editor "Cas12a–BE" , done!
Start calculating: Target-AID
CBEI calculation of base editor "Target-AID" , done!
Start calculating: Target-AID-NG
CBEI calculation of base editor "Target-AID-NG" , done!
Start calculating: xBE3
CBEI calculation of base editor "xBE3" , done!
Start calculating: BE-PLUS
CBEI calculation of base editor "BE-PLUS" , done!
Calculate complete!
Begin statistics...
The statistics directory: CBEIStat
The plot directory: CBEIPlot
####################
Pie charts for different BEs have been generated.
Path:
CBEIPlot/[BE names]_Bacillus_subtilis.statPie.png
Transcript statistics and mapping completed.
Path:
CBEIPlot/Bacillus_subtilis_CDSlength.png
CBEIPlot/Bacillus_subtilis_GCstats.png
CBEIPlot/Bacillus_subtilis_CodonUsage.png
CBEIPlot/Bacillus_subtilis_CDSlength.png
The comparison of CBEI ratio of different BE has been completed.
Path:
CBEIPlot/Bacillus_subtilis.statBar.png
CBEIPlot/Bacillus_subtilis.statROC.png
CBEI statistics complete
4.2 Output files
The output directory or files shold be:
├── CBEIPlot
│ ├── BE-PLUS_Bacillus_subtilis.statPie.png
│ ├── BE_Bacillus_subtilis.statPie.png
│ ├── Bacillus_subtilis.statBar.png
│ ├── Bacillus_subtilis.statROC.png
│ ├── Bacillus_subtilis_CDSlength.png
│ ├── Bacillus_subtilis_CodonUsage.png
│ ├── Bacillus_subtilis_GCstats.png
│ ├── ...
├── CBEIRaw
│ ├── BE-PLUS_Bacillus_subtilis.part500.cds.all.fa.cbei
│ ├── BE_Bacillus_subtilis.part500.cds.all.fa.cbei
│ ├── ...
├── CBEIStat
│ ├── BE-PLUS_Bacillus_subtilis.Thre025.tsv
│ ├── BE-PLUS_Bacillus_subtilis.Thre05.tsv
│ ├── BE-PLUS_Bacillus_subtilis.Thre075.tsv
│ ├── ...
4.2.1 .cbei files format
KDE22635 Minus 0.8674698795180723 {TGC,[TTT,C(C->T)]A,TAA,GAT,TAA,AA}|T,G TGCTTTCCATAAGATTAAAA 222-203 216,215 219-215 TG 201-202 TC,CC
- Fasta title: E.g., lacZ
- Strand: E.g., Plus
- Relative position: Edit position/Gene length. E.g., 0.012032520325203253
- Rich info: E.g., GT{C,GT[T,TTA,(C->T)]AA,CGT,CGT,GAC,T}|GG,G
- Spacer: E.g., CGTTTTACAACGTCGTGACT
- Spacer position: E.g., 30-49
- Edit position: E.g., 37
- Edit windows: E.g., 33-37
- PAM:E.g., GGG
- PAM position: E.g., 50-52
- Edit pattern: The edit pattern indicated the adjacent nucleotide at 5’ of the editable cytosine. Typically, the in vitro activity of the base editors follows TC ≥ CC ≥ AC > GC. E.g., AC
4.2.2 .tsv files with threshold
Filter according to different thresholds.
- Thre25: CBEI sites at the upsteam 25% of the CDS.
- Thre50: CBEI sites at the upsteam 50% of the CDS.
- Thre75: CBEI sites at the upsteam 75% of the CDS.
#Editable sites in the first 50% of the transcript
#Transcript Strand Position CBEIdetail Spacer SpacerRegion EditPosition EditWindowsRegion PAM PAMregion Pattern
KDE22636 Plus 0.3686274509803922 GG{A,TT[T,CTT,(C->T)]AA,CAA,ACA,GTA,C}|TG,G ATTTCTTCAACAAACAGTAC 87-106 94 90-94 TGG 107-109 TC
4.3 Figures
Pie charts for different BEs have been generated.
Path:
./CBEIPlot/[BE names]_Bacillus_subtilis.statPie.tiff
Transcript statistics and mapping completed.
Path:
./CBEIPlot/Bacillus_subtilis_CDSlength.tiff
./CBEIPlot/Bacillus_subtilis_GCstats.tiff
./CBEIPlot/Bacillus_subtilis_Codon...
autoCBEI V1.6.3
Both pypi and conda installations are supported in this release.
1. Install
"autocbei" relies on python3 and requires 'biopython' and 'matplotlib' packages. The current version (1.6.3) supports ‘conda’ and ‘pip’ installations.
1.1 Install by conda (Recommended)
Conda (including Anaconda and Miniconda) is a popular way to manage software. It can create and configure a virtual environment without affecting global settings.
First install the corresponding platform of Anaconda or Miniconda. We recommend installing python3 version.
Then execute the following command:
# Creating a virtual environment of python3.7.
1. conda create -n runCBEI python=3.7 -y
# Activate the environment
2. conda activate runCBEI
# Install autocbei
3. conda install -c atlasbioinfo autocbei -y1.2 Install by pip
If Python3 (Python >= 3.6.0) is already included in your operating system, autocbei can be automatically installed via pip.
pip install autocbeiUse the following command to determine which version of Python you have installed:
python -V
If you haven't installed python3 yet, it's recommended to use the 'method 1.1' above.
1.3 Install the pre-release version (recommend experienced users)
If you want to try out the latest but unreleased version (possibly unstable) of autocbei, please follow these commands:
# Download CRISPR-CBEI from Github
1. git clone https://github.com/atlasbioinfo/CRISPR-CBEI.git
# Install biopython and matplotlib
2. conda install -y biopython matplotlib
# Run autocbei and show help info
3. python run_autocbei.py -hCrisprCBEI version V1.2
In this release, we added support for conda and added unittest to test the stability of the software.
CRISPR-CBEIV1.1
The version has been trimmed to keep the HTML version and the command line version.
Among them, the online version released github.io, which is currently accessible through two domains:
The command line version, named autoCBEI.
CrisprCBEI HTML version V1.0
This version allows the user to access the full capabilities of the CrisprCBEI with a simple HTML while offline.
It should be said that although we present the offline version, but we still recommend the most simple way, which directly use the online version (" https://taolab.nwsuaf.edu.cn/CrisprCBEI/ ").
Please attention!
In the off-target prediction part, we adopt the HTML5 WebWorker method.
However, the current security settings of Chrome, Safari, Firefox and Opera do not allow files to run locally (i.e., does not support WebWorker run locally). Microsoft Edge can be used without security settings, which means it can run directly (IE 11 excepted). Firefox could run by changing security settings (more details below), but Chrome, Safari and Opera may not.
Of course, if all you need is CBEI predictions without off-target prediction, any HTML5 enabled browser could work.
It is worth noting that for Firefox user, changing the permission to run local files may pose a security risk while users browse other web pages, so be careful!!!
Therefore, I recommend using the local server version for its safety and support all HTML5 enabled browser.
Of course, if you use the online version ("https://taolab.nwsuaf.edu.cn/CrisprCBEI/"), all HTML5 enabled browser support it.