forked from bokulich-lab/RESCRIPt
-
Notifications
You must be signed in to change notification settings - Fork 0
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
FIX: update
get-ncbi-genomes
to use genome accession IDs as taxonom…
…y IDs (bokulich-lab#193) * FIX: use NCBI accession numbers to represent fetched chromosomes * More updates and fixes * Update the tests + small other updates * Lint * Add missing test files * Review requests
- Loading branch information
Showing
11 changed files
with
38,638 additions
and
56 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Binary file not shown.
11 changes: 11 additions & 0 deletions
11
.../data/ncbi-dataset/ncbi_dataset/data/GCA_000008865.2/GCA_000008865.2_ASM886v2_genomic.fna
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,11 @@ | ||
>BA000007.3 Escherichia coli O157:H7 str. Sakai DNA, complete genome | ||
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTCTCTGACAGCAGCTTCTGAACTG | ||
AAGAAAGCTTCGTAGAAGCT | ||
-- | ||
>AB011548.2 Escherichia coli O157:H7 str. Sakai plasmid pOSAK1 DNA, complete sequence | ||
TTCTTCTGCGAGTTCGTGCAGCTTCTCACACATGGTGGCCTGCTCGTCAGCATCGAGTGCGTCCAGTTTTTCGAGCAGCG | ||
TCAGGCTCTGGCTTTTTATGAATCCCGCCATGTTGAGTGCAGTTTGCTGCTGCTTGTTCATCTTTCTGTTTTCTCCGTTC | ||
-- | ||
>AB011549.2 Escherichia coli O157:H7 str. Sakai plasmid pO157 DNA, complete sequence | ||
AGCCAGATTTTACCCGCCCATCCTAAAGAAGGGGATAGTCAACCACATCTGACCAGCCTGCGGAAAAGTCTGCTGCTTGT | ||
CCGTCCGGTGAAAGCTGATGATAAAACACCTGTTCAGGTGGAAGCCCGCGATGATAATAATAAAATTCTCGGTACGTTAA |
Oops, something went wrong.