Update isoseq version 4.1.0 (#54)

* Update isoseq version 4.1.0 * Fix formatting --------- Co-authored-by: Jessica Mattick <[email protected]>
PacificBiosciences · Nov 7, 2023 · 9c74517 · 9c74517
1 parent 90890b1
commit 9c74517
Show file tree

Hide file tree

Showing 3 changed files with 11 additions and 2 deletions.
diff --git a/docs/changelog.md b/docs/changelog.md
@@ -5,7 +5,11 @@ nav_order: 99
 ---
 
 # Version changelog
- * **4.0.0**
+ * **4.1.0**
+   * Update minimap2 to version 2.26
+   * SMRT Link v13.0 release
+
+ * 4.0.0
    * Rename `isoseq3` to `isoseq`
    * Add new tool `isoseq cluster2`
    * Update `--max-5p-diff` default value for `isoseq collapse`

diff --git a/docs/classification/pigeon-input.md b/docs/classification/pigeon-input.md
@@ -8,6 +8,7 @@ nav_order: 4
 ## Pigeon Tools Input
 
 **prepare**
+
 | File | Description |
 | ----------- | ---- |
 | Transcript GFF | Collapsed transcript GFF from _isoseq collapse_ |
@@ -16,6 +17,7 @@ nav_order: 4
 | Intropolis data (Optional) | Intropolis data in custom format |
 
 **classify**
+
 | File | Description |
 | ----------- | ---- |
 | Reference Genome | Reference genome in FASTA format |
@@ -27,6 +29,7 @@ nav_order: 4
 | FL Counts (Optional) | Bulk IsoSeq FL count info from _isoseq collapse_ (`*.flnc_counts.txt`) |
 
 **make-seurat**
+
 | File | Description |
 | ----------- | ---- |
 | Molecules FASTA | Molecules FASTA file from _isoseq dedup_ |
@@ -35,4 +38,4 @@ nav_order: 4
 ### Examples
 Sorted and indexed references for human and mouse can be found [here](https://downloads.pacbcloud.com/public/dataset/MAS-Seq/REF-pigeon_ref_sets/).
 
-Guidance about custom references can be found [here] (/classification/pigeon-annotation).
+Guidance about custom references can be found [here](/classification/pigeon-annotation).
diff --git a/docs/clustering/cli-workflow.md b/docs/clustering/cli-workflow.md
@@ -36,10 +36,12 @@ sequences in this [lima Iso-Seq FAQ](https://lima.how/faq/isoseq).
     $ lima movieX.hifi_reads.bam barcoded_primers.fasta movieX.fl.bam --isoseq --peek-guess
 
 If your sample is barcoded at the cDNA level, use `--overwrite-biosample-names` to update the sample names.
+
     $ lima movieX.hifi_reads.bam barcoded_primers.fasta movieX.fl.bam --isoseq --peek-guess --overwrite-biosample-names
 
 **Example 1:**
 Following is the IsoSeq_v2_primers_12.fasta for the MAS-Seq bulk Iso-Seq primers that supports 12-plex barcoding at the cDNA level:
+
     >IsoSeqX_bc01_5p
     CTACACGACGCTCTTCCGATCTACTACACGCAATGAAGTCGCAGGGTTGGG
     >IsoSeqX_bc02_5p