diff --git a/cutseq/run.py b/cutseq/run.py
index e3f1560..8c70d74 100644
--- a/cutseq/run.py
+++ b/cutseq/run.py
@@ -254,7 +254,8 @@ def __init__(self):
     # https://www.idtdna.com/pages/products/next-generation-sequencing/workflow/xgen-ngs-library-preparation/methyl-seq-dna-library-kit#product-details
     # https://sfvideo.blob.core.windows.net/sitefinity/docs/default-source/technical-report/tail-trimming-for-better-data-technical-note.pdf?sfvrsn=135efe07_4
     # 10 bases from END of R1 10 bases from START of R2
-    "XGENMETHY": "ACACGACGCTCTTCCGATCTXXXXXX>XXXXXXXXXXAGATCGGAAGAGCACACGTC",
+    # remove 2 letter from the begin of R1, which might be random primer
+    "XGENMETHY": "ACACGACGCTCTTCCGATCTXX>XXXXXXXXXXAGATCGGAAGAGCACACGTC",
     # for snmC-seq, trim 15 bases
     "XGENSNMC": "ACACGACGCTCTTCCGATCTXXXXXX>XXXXXXXXXXXXXXXAGATCGGAAGAGCACACGTC",
     # The general method for xGen / Swift kit, might be better than hard clip, TODO
diff --git a/pyproject.toml b/pyproject.toml
index 0907372..75119da 100644
--- a/pyproject.toml
+++ b/pyproject.toml
@@ -1,6 +1,6 @@
 [tool.poetry]
 name = "cutseq"
-version = "0.0.56"
+version = "0.0.57"
 description = "Automatically cut adapter / barcode / UMI from NGS data"
 authors = ["Ye Chang <yech1990@gmail.com>"]
 license = "MIT"