From 20a4f3c10e409f91f18f627f1d7e5311ceaacc7f Mon Sep 17 00:00:00 2001
From: Chang Ye <yech1990@gmail.com>
Date: Thu, 7 Nov 2024 22:12:31 -0600
Subject: [PATCH] quick update

---
 cutseq/run.py  | 2 ++
 pyproject.toml | 2 +-
 2 files changed, 3 insertions(+), 1 deletion(-)

diff --git a/cutseq/run.py b/cutseq/run.py
index 722f34a..ba5a6c7 100644
--- a/cutseq/run.py
+++ b/cutseq/run.py
@@ -243,6 +243,8 @@ def __init__(self):
     "ECLIP6": "ACACGACGCTCTTCCGATCTXX<XNNNNNNAGATCGGAAGAGCACACGTC",
     # eCLIP, SAC-seq, cDNA ligation method, with 10 nt UMI
     "ECLIP10": "ACACGACGCTCTTCCGATCTXX<XNNNNNNNNNNAGATCGGAAGAGCACACGTC",
+    # cDNA88, cDNA ligation method, with 8 nt UMI (left) and 8 nt UMI (right)
+    "SACSEQV3": "AGTTCTACAGTCCGACGATCTNNNNNNNNX>XXNNNNNNNNAGATCGGAAGAGCACACGTC",
     # p5 - [might be 6bp of polyC] - reverse insert (cDNA) - adaptase tail (CCCCCC) - p7
     # 6nt of polyG in 5' of R1 might from random RT primer
     # adaptase tail can be as long as 15bp at the 5' of R2 of polyG)
diff --git a/pyproject.toml b/pyproject.toml
index 1b61824..eaed68b 100644
--- a/pyproject.toml
+++ b/pyproject.toml
@@ -1,6 +1,6 @@
 [tool.poetry]
 name = "cutseq"
-version = "0.0.54"
+version = "0.0.55"
 description = "Automatically cut adapter / barcode / UMI from NGS data"
 authors = ["Ye Chang <yech1990@gmail.com>"]
 license = "MIT"