Skip to content

Latest commit

 

History

History
79 lines (76 loc) · 4.25 KB

README.md

File metadata and controls

79 lines (76 loc) · 4.25 KB

Secondary Structure Identification in RNA Sequences

About The Project

Dr. Kirt Onthank, an Associate Professor of Biology at WWU, studies ocean acidification and its effects on the physiology of marine invertebrates, especially cephalopods. The goal of this project is to create a script using Python that, provided files containing potential edit sites and corresponding RNA sequences, will locate secondary structures at the site of each edit. This will facilitate Dr. Onthank’s ability to identify actual RNA edits, which will in turn aid his research on the effects of ocean acidification on RNA editing in octopuses.

Getting Started

Prerequisites

Clone Repository

Utilizing either SSH or HTTPS, clone the repository.

SSH

git clone [email protected]:wwu-cs/Octopus-RNA-Analysis.git

HTTPS

git clone https://github.com/wwu-cs/Octopus-RNA-Analysis.git

Install Dependencies

pip install -r dependencies.txt

Input

FASTA

Each item in the FASTA file contains a sequence id followed by the sequence.

>lcl|TRINITY_DN119711_c0_g1_i1:220-300
ATGTCAAGCGACATCCCACGAGAATCTATGCCAGTGCTATATAGGATGGTGTCCATTCTGGTAGTGATTCATGGTGCTTAA

CSV

Each item in the CSV file must contain (at least) a sequence id (orf) and edit site (pos).

orf pos
lcl|TRINITY_DN119711_c0_g1_i1:220-300 32

Usage

Parameters

Use the command below to view required arguments and additional flags.

python src/main/main.py -h 
usage: main.py [-h] -f  -c  -of  -st  [-ml] [-ll] [-nl] [-bl] [-nb]

Identify secondary structures in genetic sequence

required arguments:
  -f , --fasta          fasta file containing genetic sequences
  -c , --csv            csv file containing edit positions
  -of , --outputFile    name of output csv file
  -st , --structType    type of structure ('hairpin'|'int_loop'|'bulge')

optional arguments:
  -h, --help            show this help message and exit
  -ml , --minLength     minimum length of reverse complement (Default:5)
  -ll , --loopLength    max num of mismatches in loop (Default:1)
  -nl , --numLoops      max number of loops allowed in loop structure (Default:1)
  -bl , --bulgeLength   max num of mismatches in loop (Default:1)
  -nb , --numBulges     max number of loops allowed in loop structure (Default:1)

Examples

A couple of examples utilizing the sample files in the data folder.

python src/main/main.py -f data/swissprotORF.fasta -c data/aes_profile.csv -of sample.csv -st 'hairpin' -ml 12
id position length base_string base_string_loc rev_comp rev_comp_loc
lcl|TRINITY_DN149051_c0_g1_i1:7-1731 718 14 GAATACACATTACT [707, 720] AGTAATGTGTATTC [356, 369]
lcl|TRINITY_DN139047_c0_g1_i1:115-2832 2457 12 CATCAGCAGCAG [2452, 2463] CTGCTGCTGATG [316, 327]
lcl|TRINITY_DN141652_c0_g1_i1:981-1274 230 14 AAAAAGAAAAAAAA [225, 238] TTTTTTTTCTTTTT [277, 290]
lcl|TRINITY_DN102602_c0_g1_i1:128-3073 2835 12 TCTCCAAGAGCG [2832, 2843] CGCTCTTGGAGA [1381, 1392]
python src/main/main.py -f data/swissprotORF.fasta -c data/aes_profile.csv -of sample.csv -st 'int_loop' -ml 8 -ll 2 -nl 1
id position length base_string base_string_loc rev_comp rev_comp_loc
lcl|TRINITY_DN115027_c0_g1_i1:269-580 119 8 AATT..TT [118, 125] AA..AATT [59, 66]
lcl|TRINITY_DN131245_c0_g1_i1:16-339 224 8 TAAA.AGA [224, 231] TCT.TTTA [265, 272]
lcl|TRINITY_DN131271_c0_g1_i1:11-253 195 11 TGCACA.CAGG [185, 195] CCTG.TGTGCA [142, 152]
lcl|TRINITY_DN141161_c0_g1_i1:70-897 212 8 CACTTC.T [209, 216] A.GAAGTG [6, 13]