OPR is an open-source Python package designed to simplify and streamline primer design and analysis for biologists and bioinformaticians. OPR enables users to design, validate, and optimize primers with ease, catering to a wide range of applications such as PCR, qPCR, and sequencing. With a focus on user-friendliness and efficiency, OPR aims to bridge the gap between biological research and computational tools, making primer-related workflows faster and more reliable.
| PyPI Counter |
|
| Github Stars |
|
| Branch | main | dev |
| CI |
|
|
- Check Python Packaging User Guide
- Run
pip install opr==0.1
- Download Version 0.1 or Latest Source
- Run
pip install .
>>> from opr import Primer
>>> primer1 = Primer(sequence="CTGGAGGACGGAAGAGGAAGTAA")
>>> primer1.sequence
'CTGGAGGACGGAAGAGGAAGTAA'>>> primer1.molecular_weight
7235.79>>> primer1.gc_content
0.5217391304347826>>> primer1.melting_temperature()
57.056521739130446>>> primer1_reversed = primer1.reverse()
>>> primer1_reversed.sequence
'AATGAAGGAGAAGGCAGGAGGTC'>>> primer1_complemented = primer1.complement()
>>> primer1_complemented.sequence
'GACCTCCTGCCTTCTCCTTCATT'Just fill an issue and describe it. We'll check it ASAP! or send an email to [email protected].
- Please complete the issue template
You can also join our discord server
1- Oligo Calc: Oligonucleotide Properties Calculator
2- Marmur, Julius, and Paul Doty. "Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature." Journal of molecular biology 5.1 (1962): 109-118.
3- Wallace, R. Bruce, et al. "Hybridization of synthetic oligodeoxyribonucleotides to Φ X 174 DNA: the effect of single base pair mismatch." Nucleic acids research 6.11 (1979): 3543-3558.
4- Panjkovich, Alejandro, and Francisco Melo. "Comparison of different melting temperature calculation methods for short DNA sequences." Bioinformatics 21.6 (2005): 711-722.
Give a ⭐️ if this project helped you!
If you do like our project and we hope that you do, can you please support us? Our project is not and is never going to be working for profit. We need the money just so we can continue doing what we do ;-) .
