The API add Unexpected "S" in sequence

[Masterchiefm]

Hello, I'm using the local API to optimize protein sequence.

While I was optimizing seqence "RSVGSVY", the output is "CGCTCCGTCGGCTCCAGCGTCTACTGA", which amino acid is "RSVGSSVY*". It seems the local server change the "GSV" to "GSSV".

Can you fix it?

The code I use:

import optipyzer
api = optipyzer.API(local=1)
dna = api.optimize(
        seq = 'RSVGSVY',
        seq_type='protein',
        weights={"human": 2, "mouse": 1})
seq = dna['optimized_sd']
print(f"{seq},len={len(seq)}")

[nleroy917]

Hello! This might be a similar issue to #57 I'll need to look into this for a sec...