From aed3cf29d22db4b800caaf6cde558dfccb6184b8 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Tue, 8 Oct 2024 06:15:44 +0000 Subject: [PATCH 01/27] Couple of minor issues resolved from reviews --- README.md | 4 ++-- conf/test_contamination_tech_reps.config | 8 ++++---- conf/test_nextflex.config | 4 ++-- 3 files changed, 8 insertions(+), 8 deletions(-) diff --git a/README.md b/README.md index d5257485..ad321d9d 100644 --- a/README.md +++ b/README.md @@ -51,7 +51,7 @@ You can find numerous talks on the nf-core events page from various topics inclu 4. ncRNA filtration 5. piRNA filtration 6. Others filtration -5. UMI barcode deduplication ([`UMI-tools`](https://github.com/CGATOxford/UMI-tools)) +5. UMI barcode deduplication ([`UMI-tools`](https://github.com/CGATOxford/UMI-tools)) 6. miRNA quantification - EdgeR 1. Reads alignment against miRBase mature miRNA ([`Bowtie1`](http://bowtie-bio.sourceforge.net/index.shtml)) @@ -82,7 +82,7 @@ You can test the pipeline as follows: ```bash nextflow run nf-core/smrnaseq \ - -profile test \ + -profile test,docker \ --outdir ``` diff --git a/conf/test_contamination_tech_reps.config b/conf/test_contamination_tech_reps.config index f164bde4..18a16c45 100644 --- a/conf/test_contamination_tech_reps.config +++ b/conf/test_contamination_tech_reps.config @@ -30,10 +30,10 @@ params { skip_mirdeep = true skip_fastqc = true - filter_contamination = true - cdna = "https://huggingface.co/datasets/nf-core/smrnaseq/resolve/main/GRCh37/Homo_sapiens.GRCh37.cdna.all.fa" - ncrna = "https://huggingface.co/datasets/nf-core/smrnaseq/resolve/main/GRCh37/Homo_sapiens.GRCh37.ncrna.fa" - trna = "https://huggingface.co/datasets/nf-core/smrnaseq/resolve/main/GRCh37/hg19-tRNAs.fa" + filter_contamination = true + cdna = "https://huggingface.co/datasets/nf-core/smrnaseq/resolve/main/GRCh37/Homo_sapiens.GRCh37.cdna.all.fa" + ncrna = "https://huggingface.co/datasets/nf-core/smrnaseq/resolve/main/GRCh37/Homo_sapiens.GRCh37.ncrna.fa" + trna = "https://huggingface.co/datasets/nf-core/smrnaseq/resolve/main/GRCh37/hg19-tRNAs.fa" } // Include illumina config to run test without additional profiles diff --git a/conf/test_nextflex.config b/conf/test_nextflex.config index 17f1b721..cc4c31eb 100644 --- a/conf/test_nextflex.config +++ b/conf/test_nextflex.config @@ -27,8 +27,8 @@ params { mirna_gtf = 'https://github.com/nf-core/test-datasets/raw/smrnaseq/reference/hsa.gff3' mirtrace_species = 'hsa' - skip_mirdeep = true - save_intermediates = true + skip_mirdeep = true + save_intermediates = true //skip_fastp // this profile should not be used with skip_fastq to allow for testing paired end sample handling } From df3899625a4f719fd4dbf88f26f23ecead558b56 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Tue, 8 Oct 2024 06:22:23 +0000 Subject: [PATCH 02/27] Add hint to license --- bin/collapse_mirtop.r | 2 +- bin/edgeR_miRBase.r | 2 +- 2 files changed, 2 insertions(+), 2 deletions(-) diff --git a/bin/collapse_mirtop.r b/bin/collapse_mirtop.r index ed885f63..58cad692 100755 --- a/bin/collapse_mirtop.r +++ b/bin/collapse_mirtop.r @@ -1,6 +1,6 @@ #!/usr/bin/env Rscript -# Written by Lorena Pantano and released under the MIT license. +# Written by Lorena Pantano and released under the MIT license. See LICENSE for details. library(data.table) # Command line arguments diff --git a/bin/edgeR_miRBase.r b/bin/edgeR_miRBase.r index c904b894..847612c1 100755 --- a/bin/edgeR_miRBase.r +++ b/bin/edgeR_miRBase.r @@ -1,7 +1,7 @@ #!/usr/bin/env Rscript # Originally written by Phil Ewels and Chuan Wang and released under the MIT license. -# Contributions by Alexander Peltzer, Anabella Trigila, James Fellows Yates, Sarah Djebali, Kevin Menden, Konrad Stawinski and Lorena Pantano also released under the MIT license. +# Contributions by Alexander Peltzer, Anabella Trigila, James Fellows Yates, Sarah Djebali, Kevin Menden, Konrad Stawinski and Lorena Pantano also released under the MIT license. See LICENSE for details. # Command line arguments args = commandArgs(trailingOnly=TRUE) From 351b8a8867356a8881b0c33021bfa11e2ea1fce8 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Tue, 8 Oct 2024 06:23:29 +0000 Subject: [PATCH 03/27] Put in links --- bin/collapse_mirtop.r | 2 +- bin/edgeR_miRBase.r | 2 +- 2 files changed, 2 insertions(+), 2 deletions(-) diff --git a/bin/collapse_mirtop.r b/bin/collapse_mirtop.r index 58cad692..49c95832 100755 --- a/bin/collapse_mirtop.r +++ b/bin/collapse_mirtop.r @@ -1,6 +1,6 @@ #!/usr/bin/env Rscript -# Written by Lorena Pantano and released under the MIT license. See LICENSE for details. +# Written by Lorena Pantano and released under the MIT license. See LICENSE https://github.com/nf-core/smrnaseq/blob/master/LICENSE for details. library(data.table) # Command line arguments diff --git a/bin/edgeR_miRBase.r b/bin/edgeR_miRBase.r index 847612c1..5c561437 100755 --- a/bin/edgeR_miRBase.r +++ b/bin/edgeR_miRBase.r @@ -1,7 +1,7 @@ #!/usr/bin/env Rscript # Originally written by Phil Ewels and Chuan Wang and released under the MIT license. -# Contributions by Alexander Peltzer, Anabella Trigila, James Fellows Yates, Sarah Djebali, Kevin Menden, Konrad Stawinski and Lorena Pantano also released under the MIT license. See LICENSE for details. +# Contributions by Alexander Peltzer, Anabella Trigila, James Fellows Yates, Sarah Djebali, Kevin Menden, Konrad Stawinski and Lorena Pantano also released under the MIT license. See LICENSE https://github.com/nf-core/smrnaseq/blob/master/LICENSE for details. # Command line arguments args = commandArgs(trailingOnly=TRUE) From a1b8dc4023cb0961897c73e191e974c9c12dde34 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Tue, 8 Oct 2024 06:32:33 +0000 Subject: [PATCH 04/27] Bump release date --- CHANGELOG.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index fac0ca93..8a498c39 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,7 +3,7 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). -## v2.4.0 - 2024-10-07 - Navy Iron Boxer +## v2.4.0 - 2024-10-08 - Navy Iron Boxer - [[#349]](https://github.com/nf-core/smrnaseq/pull/349) - Fix [MIRTOP_QUANT conda issue](https://github.com/nf-core/smrnaseq/issues/347) - change conda-base to conda-forge channel. - [[#350]](https://github.com/nf-core/smrnaseq/pull/350) - Fix [MIRTOP_QUANT conda issue](https://github.com/nf-core/smrnaseq/issues/347) - set python version to 3.7 to fix pysam issue. From 015471f7b4f7775b5196fc851f5579e434676f19 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Tue, 8 Oct 2024 10:08:27 +0000 Subject: [PATCH 05/27] Fix tests --- .github/PULL_REQUEST_TEMPLATE.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md index 7360667a..3cdbf2b7 100644 --- a/.github/PULL_REQUEST_TEMPLATE.md +++ b/.github/PULL_REQUEST_TEMPLATE.md @@ -18,7 +18,7 @@ Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/smrn - [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/smrnaseq/tree/master/.github/CONTRIBUTING.md) - [ ] If necessary, also make a PR on the nf-core/smrnaseq _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. - [ ] Make sure your code lints (`nf-core lint`). -- [ ] Ensure the test suite passes (`nf-test test --tag pipeline --profile +docker`). +- [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir `). - [ ] Check for unexpected warnings in debug mode (`nextflow run . -profile debug,test,docker --outdir `). - [ ] Usage Documentation in `docs/usage.md` is updated. - [ ] Output Documentation in `docs/output.md` is updated. From b54f4b06d3deab6acfdf8bca8b380eeac40cf667 Mon Sep 17 00:00:00 2001 From: atrigila <18577080+atrigila@users.noreply.github.com> Date: Tue, 8 Oct 2024 11:05:34 +0000 Subject: [PATCH 06/27] address Change to `=` assignment, see above #470 --- subworkflows/local/contaminant_filter/main.nf | 10 +++++----- 1 file changed, 5 insertions(+), 5 deletions(-) diff --git a/subworkflows/local/contaminant_filter/main.nf b/subworkflows/local/contaminant_filter/main.nf index 456ffc20..f0df6a75 100644 --- a/subworkflows/local/contaminant_filter/main.nf +++ b/subworkflows/local/contaminant_filter/main.nf @@ -88,7 +88,7 @@ workflow CONTAMINANT_FILTER { rrna_reads = BOWTIE2_ALIGN_RRNA.out.fastq } - rrna_reads.set { trna_reads } + trna_reads = rrna_reads if (params.trna) { // Index DB and filter $rrna_reads emit: $trna_reads @@ -118,7 +118,7 @@ workflow CONTAMINANT_FILTER { trna_reads = BOWTIE2_ALIGN_TRNA.out.fastq } - trna_reads.set { cdna_reads } + cdna_reads = trna_reads // Define how to filter significant BLAT hits ch_program = Channel.value('BEGIN{FS="\t"}{if(\$11 < 1e-5) print \$2;}').collectFile(name:"program.txt") @@ -168,7 +168,7 @@ workflow CONTAMINANT_FILTER { cdna_reads = BOWTIE2_ALIGN_CDNA.out.fastq } - cdna_reads.set { ncrna_reads } + ncrna_reads = cdna_reads if (params.ncrna) { // Search which hairpin miRNAs are present in the ncRNA data @@ -215,7 +215,7 @@ workflow CONTAMINANT_FILTER { ncrna_reads = BOWTIE2_ALIGN_NCRNA.out.fastq } - ncrna_reads.set { pirna_reads } + pirna_reads = ncrna_reads if (params.pirna) { // Search which hairpin miRNAs are present in the piRNA data @@ -262,7 +262,7 @@ workflow CONTAMINANT_FILTER { pirna_reads = BOWTIE2_ALIGN_PIRNA.out.fastq } - pirna_reads.set { other_cont_reads } + other_cont_reads = pirna_reads if (params.other_contamination) { // Search which hairpin miRNAs are present in the other data From 60dd0f95e33186647c272c989951fd625c110093 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Tue, 8 Oct 2024 11:15:05 +0000 Subject: [PATCH 07/27] Fix tests for release PR --- tests/test_contamination_tech_reps.nf.test.snap | 4 ++-- tests/test_mirgenedb.nf.test.snap | 4 ++-- tests/test_nextflex.nf.test.snap | 4 ++-- tests/test_skipfastp.nf.test.snap | 4 ++-- tests/test_umi.nf.test.snap | 4 ++-- 5 files changed, 10 insertions(+), 10 deletions(-) diff --git a/tests/test_contamination_tech_reps.nf.test.snap b/tests/test_contamination_tech_reps.nf.test.snap index 9441f4c5..6f08ae53 100644 --- a/tests/test_contamination_tech_reps.nf.test.snap +++ b/tests/test_contamination_tech_reps.nf.test.snap @@ -34,7 +34,7 @@ }, "software_versions": { "content": [ - "{BLAT_CDNA={blat=36}, BLAT_NCRNA={blat=36}, BOWTIE2_ALIGN_CDNA={bowtie2=2.5.2, samtools=1.18, pigz=2.6}, BOWTIE2_ALIGN_NCRNA={bowtie2=2.5.2, samtools=1.18, pigz=2.6}, BOWTIE2_ALIGN_TRNA={bowtie2=2.5.2, samtools=1.18, pigz=2.6}, BOWTIE_MAP_HAIRPIN={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_MATURE={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_SEQCLUSTER={bowtie=1.3.0, samtools=1.16.1}, CAT_FASTQ={cat=8.3}, CSVTK_JOIN={csvtk=0.30.0}, DATATABLE_MERGE={r-base=3.6.2}, FASTP={fastp=0.23.4}, FILTER_STATS={BusyBox=1.32.1}, FORMAT_HAIRPIN={fastx_toolkit=0.0.14}, FORMAT_MATURE={fastx_toolkit=0.0.14}, GAWK_CDNA={gawk=5.3.0}, GAWK_NCRNA={gawk=5.3.0}, INDEX_CDNA={bowtie2=2.5.2}, INDEX_HAIRPIN={bowtie=1.3.0}, INDEX_MATURE={bowtie=1.3.0}, INDEX_NCRNA={bowtie2=2.5.2}, INDEX_TRNA={bowtie2=2.5.2}, MIRTOP_COUNTS={mirtop=0.4.28}, MIRTOP_EXPORT={mirtop=0.4.28}, MIRTOP_GFF={mirtop=0.4.28}, MIRTOP_STATS={mirtop=0.4.28}, MIRTRACE_QC={mirtrace=1.0.1}, PARSE_HAIRPIN={seqkit=2.6.1}, PARSE_MATURE={seqkit=2.6.1}, SAMTOOLS_FLAGSTAT={samtools=1.21}, SAMTOOLS_IDXSTATS={samtools=1.21}, SAMTOOLS_INDEX={samtools=1.21}, SAMTOOLS_SORT={samtools=1.21}, SAMTOOLS_STATS={samtools=1.21}, SEQCLUSTER_COLLAPSE={seqcluster=1.2.9}, SEQKIT_GREP_CDNA={seqkit=2.8.0}, SEQKIT_GREP_NCRNA={seqkit=2.8.0}, STATS_GAWK_CDNA={gawk=5.3.0}, STATS_GAWK_NCRNA={gawk=5.3.0}, STATS_GAWK_TRNA={gawk=5.3.0}, Workflow={nf-core/smrnaseq=v2.3.2dev}}" + "{BLAT_CDNA={blat=36}, BLAT_NCRNA={blat=36}, BOWTIE2_ALIGN_CDNA={bowtie2=2.5.2, samtools=1.18, pigz=2.6}, BOWTIE2_ALIGN_NCRNA={bowtie2=2.5.2, samtools=1.18, pigz=2.6}, BOWTIE2_ALIGN_TRNA={bowtie2=2.5.2, samtools=1.18, pigz=2.6}, BOWTIE_MAP_HAIRPIN={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_MATURE={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_SEQCLUSTER={bowtie=1.3.0, samtools=1.16.1}, CAT_FASTQ={cat=8.3}, CSVTK_JOIN={csvtk=0.30.0}, DATATABLE_MERGE={r-base=3.6.2}, FASTP={fastp=0.23.4}, FILTER_STATS={BusyBox=1.32.1}, FORMAT_HAIRPIN={fastx_toolkit=0.0.14}, FORMAT_MATURE={fastx_toolkit=0.0.14}, GAWK_CDNA={gawk=5.3.0}, GAWK_NCRNA={gawk=5.3.0}, INDEX_CDNA={bowtie2=2.5.2}, INDEX_HAIRPIN={bowtie=1.3.0}, INDEX_MATURE={bowtie=1.3.0}, INDEX_NCRNA={bowtie2=2.5.2}, INDEX_TRNA={bowtie2=2.5.2}, MIRTOP_COUNTS={mirtop=0.4.28}, MIRTOP_EXPORT={mirtop=0.4.28}, MIRTOP_GFF={mirtop=0.4.28}, MIRTOP_STATS={mirtop=0.4.28}, MIRTRACE_QC={mirtrace=1.0.1}, PARSE_HAIRPIN={seqkit=2.6.1}, PARSE_MATURE={seqkit=2.6.1}, SAMTOOLS_FLAGSTAT={samtools=1.21}, SAMTOOLS_IDXSTATS={samtools=1.21}, SAMTOOLS_INDEX={samtools=1.21}, SAMTOOLS_SORT={samtools=1.21}, SAMTOOLS_STATS={samtools=1.21}, SEQCLUSTER_COLLAPSE={seqcluster=1.2.9}, SEQKIT_GREP_CDNA={seqkit=2.8.0}, SEQKIT_GREP_NCRNA={seqkit=2.8.0}, STATS_GAWK_CDNA={gawk=5.3.0}, STATS_GAWK_NCRNA={gawk=5.3.0}, STATS_GAWK_TRNA={gawk=5.3.0}, Workflow={nf-core/smrnaseq=v2.4.0}}" ], "meta": { "nf-test": "0.9.0", @@ -117,4 +117,4 @@ }, "timestamp": "2024-10-01T20:06:05.070939602" } -} \ No newline at end of file +} diff --git a/tests/test_mirgenedb.nf.test.snap b/tests/test_mirgenedb.nf.test.snap index db381a2e..f8770295 100644 --- a/tests/test_mirgenedb.nf.test.snap +++ b/tests/test_mirgenedb.nf.test.snap @@ -19,7 +19,7 @@ }, "software_versions": { "content": [ - "{BOWTIE_MAP_GENOME={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_HAIRPIN={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_MATURE={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_SEQCLUSTER={bowtie=1.3.0, samtools=1.16.1}, FASTP={fastp=0.23.4}, FASTQC_RAW={fastqc=0.12.1}, FASTQC_TRIM={fastqc=0.12.1}, FORMAT_HAIRPIN={fastx_toolkit=0.0.14}, FORMAT_MATURE={fastx_toolkit=0.0.14}, INDEX_HAIRPIN={bowtie=1.3.0}, INDEX_MATURE={bowtie=1.3.0}, MIRDEEP2_MAPPER={mirdeep2=2.0.1}, MIRDEEP2_MIRDEEP2={mirdeep2=2.0.1}, PARSE_HAIRPIN={seqkit=2.6.1}, PARSE_MATURE={seqkit=2.6.1}, SAMTOOLS_FLAGSTAT={samtools=1.21}, SAMTOOLS_IDXSTATS={samtools=1.21}, SAMTOOLS_INDEX={samtools=1.21}, SAMTOOLS_SORT={samtools=1.21}, SAMTOOLS_STATS={samtools=1.21}, SEQCLUSTER_COLLAPSE={seqcluster=1.2.9}, SEQKIT_FQ2FA={seqkit=2.8.0}, SEQKIT_REPLACE={seqkit=2.8.0}, Workflow={nf-core/smrnaseq=v2.3.2dev}}" + "{BOWTIE_MAP_GENOME={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_HAIRPIN={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_MATURE={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_SEQCLUSTER={bowtie=1.3.0, samtools=1.16.1}, FASTP={fastp=0.23.4}, FASTQC_RAW={fastqc=0.12.1}, FASTQC_TRIM={fastqc=0.12.1}, FORMAT_HAIRPIN={fastx_toolkit=0.0.14}, FORMAT_MATURE={fastx_toolkit=0.0.14}, INDEX_HAIRPIN={bowtie=1.3.0}, INDEX_MATURE={bowtie=1.3.0}, MIRDEEP2_MAPPER={mirdeep2=2.0.1}, MIRDEEP2_MIRDEEP2={mirdeep2=2.0.1}, PARSE_HAIRPIN={seqkit=2.6.1}, PARSE_MATURE={seqkit=2.6.1}, SAMTOOLS_FLAGSTAT={samtools=1.21}, SAMTOOLS_IDXSTATS={samtools=1.21}, SAMTOOLS_INDEX={samtools=1.21}, SAMTOOLS_SORT={samtools=1.21}, SAMTOOLS_STATS={samtools=1.21}, SEQCLUSTER_COLLAPSE={seqcluster=1.2.9}, SEQKIT_FQ2FA={seqkit=2.8.0}, SEQKIT_REPLACE={seqkit=2.8.0}, Workflow={nf-core/smrnaseq=v2.4.0}}" ], "meta": { "nf-test": "0.9.0", @@ -148,4 +148,4 @@ }, "timestamp": "2024-08-30T20:30:51.144222162" } -} \ No newline at end of file +} diff --git a/tests/test_nextflex.nf.test.snap b/tests/test_nextflex.nf.test.snap index 6cbb32d8..647a0ff7 100644 --- a/tests/test_nextflex.nf.test.snap +++ b/tests/test_nextflex.nf.test.snap @@ -34,7 +34,7 @@ }, "software_versions": { "content": [ - "{BOWTIE_MAP_HAIRPIN={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_MATURE={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_SEQCLUSTER={bowtie=1.3.0, samtools=1.16.1}, CSVTK_JOIN={csvtk=0.30.0}, DATATABLE_MERGE={r-base=3.6.2}, FASTP={fastp=0.23.4}, FASTQC_RAW={fastqc=0.12.1}, FASTQC_TRIM={fastqc=0.12.1}, FORMAT_HAIRPIN={fastx_toolkit=0.0.14}, FORMAT_MATURE={fastx_toolkit=0.0.14}, INDEX_HAIRPIN={bowtie=1.3.0}, INDEX_MATURE={bowtie=1.3.0}, MIRTOP_COUNTS={mirtop=0.4.28}, MIRTOP_EXPORT={mirtop=0.4.28}, MIRTOP_GFF={mirtop=0.4.28}, MIRTOP_STATS={mirtop=0.4.28}, MIRTRACE_QC={mirtrace=1.0.1}, PARSE_HAIRPIN={seqkit=2.6.1}, PARSE_MATURE={seqkit=2.6.1}, SAMTOOLS_FLAGSTAT={samtools=1.21}, SAMTOOLS_IDXSTATS={samtools=1.21}, SAMTOOLS_INDEX={samtools=1.21}, SAMTOOLS_SORT={samtools=1.21}, SAMTOOLS_STATS={samtools=1.21}, SEQCLUSTER_COLLAPSE={seqcluster=1.2.9}, Workflow={nf-core/smrnaseq=v2.3.2dev}}" + "{BOWTIE_MAP_HAIRPIN={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_MATURE={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_SEQCLUSTER={bowtie=1.3.0, samtools=1.16.1}, CSVTK_JOIN={csvtk=0.30.0}, DATATABLE_MERGE={r-base=3.6.2}, FASTP={fastp=0.23.4}, FASTQC_RAW={fastqc=0.12.1}, FASTQC_TRIM={fastqc=0.12.1}, FORMAT_HAIRPIN={fastx_toolkit=0.0.14}, FORMAT_MATURE={fastx_toolkit=0.0.14}, INDEX_HAIRPIN={bowtie=1.3.0}, INDEX_MATURE={bowtie=1.3.0}, MIRTOP_COUNTS={mirtop=0.4.28}, MIRTOP_EXPORT={mirtop=0.4.28}, MIRTOP_GFF={mirtop=0.4.28}, MIRTOP_STATS={mirtop=0.4.28}, MIRTRACE_QC={mirtrace=1.0.1}, PARSE_HAIRPIN={seqkit=2.6.1}, PARSE_MATURE={seqkit=2.6.1}, SAMTOOLS_FLAGSTAT={samtools=1.21}, SAMTOOLS_IDXSTATS={samtools=1.21}, SAMTOOLS_INDEX={samtools=1.21}, SAMTOOLS_SORT={samtools=1.21}, SAMTOOLS_STATS={samtools=1.21}, SEQCLUSTER_COLLAPSE={seqcluster=1.2.9}, Workflow={nf-core/smrnaseq=v2.4.0}}" ], "meta": { "nf-test": "0.9.0", @@ -142,4 +142,4 @@ }, "timestamp": "2024-09-20T17:11:24.369706104" } -} \ No newline at end of file +} diff --git a/tests/test_skipfastp.nf.test.snap b/tests/test_skipfastp.nf.test.snap index ce2fdbd9..274ffa9e 100644 --- a/tests/test_skipfastp.nf.test.snap +++ b/tests/test_skipfastp.nf.test.snap @@ -41,7 +41,7 @@ }, "software_versions": { "content": [ - "{BOWTIE_MAP_GENOME={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_HAIRPIN={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_MATURE={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_SEQCLUSTER={bowtie=1.3.0, samtools=1.16.1}, CSVTK_JOIN={csvtk=0.30.0}, DATATABLE_MERGE={r-base=3.6.2}, FASTQC_RAW={fastqc=0.12.1}, FORMAT_HAIRPIN={fastx_toolkit=0.0.14}, FORMAT_MATURE={fastx_toolkit=0.0.14}, INDEX_HAIRPIN={bowtie=1.3.0}, INDEX_MATURE={bowtie=1.3.0}, MIRTOP_COUNTS={mirtop=0.4.28}, MIRTOP_EXPORT={mirtop=0.4.28}, MIRTOP_GFF={mirtop=0.4.28}, MIRTOP_STATS={mirtop=0.4.28}, MIRTRACE_QC={mirtrace=1.0.1}, PARSE_HAIRPIN={seqkit=2.6.1}, PARSE_MATURE={seqkit=2.6.1}, SAMTOOLS_FLAGSTAT={samtools=1.21}, SAMTOOLS_IDXSTATS={samtools=1.21}, SAMTOOLS_INDEX={samtools=1.21}, SAMTOOLS_SORT={samtools=1.21}, SAMTOOLS_STATS={samtools=1.21}, SEQCLUSTER_COLLAPSE={seqcluster=1.2.9}, Workflow={nf-core/smrnaseq=v2.3.2dev}}" + "{BOWTIE_MAP_GENOME={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_HAIRPIN={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_MATURE={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_SEQCLUSTER={bowtie=1.3.0, samtools=1.16.1}, CSVTK_JOIN={csvtk=0.30.0}, DATATABLE_MERGE={r-base=3.6.2}, FASTQC_RAW={fastqc=0.12.1}, FORMAT_HAIRPIN={fastx_toolkit=0.0.14}, FORMAT_MATURE={fastx_toolkit=0.0.14}, INDEX_HAIRPIN={bowtie=1.3.0}, INDEX_MATURE={bowtie=1.3.0}, MIRTOP_COUNTS={mirtop=0.4.28}, MIRTOP_EXPORT={mirtop=0.4.28}, MIRTOP_GFF={mirtop=0.4.28}, MIRTOP_STATS={mirtop=0.4.28}, MIRTRACE_QC={mirtrace=1.0.1}, PARSE_HAIRPIN={seqkit=2.6.1}, PARSE_MATURE={seqkit=2.6.1}, SAMTOOLS_FLAGSTAT={samtools=1.21}, SAMTOOLS_IDXSTATS={samtools=1.21}, SAMTOOLS_INDEX={samtools=1.21}, SAMTOOLS_SORT={samtools=1.21}, SAMTOOLS_STATS={samtools=1.21}, SEQCLUSTER_COLLAPSE={seqcluster=1.2.9}, Workflow={nf-core/smrnaseq=v2.4.0}}" ], "meta": { "nf-test": "0.9.0", @@ -142,4 +142,4 @@ }, "timestamp": "2024-10-01T20:19:25.557700049" } -} \ No newline at end of file +} diff --git a/tests/test_umi.nf.test.snap b/tests/test_umi.nf.test.snap index f56e3ff3..3805ed81 100644 --- a/tests/test_umi.nf.test.snap +++ b/tests/test_umi.nf.test.snap @@ -41,7 +41,7 @@ }, "software_versions": { "content": [ - "{BOWTIE_MAP_GENOME={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_HAIRPIN={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_MATURE={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_SEQCLUSTER={bowtie=1.3.0, samtools=1.16.1}, CSVTK_JOIN={csvtk=0.30.0}, DATATABLE_MERGE={r-base=3.6.2}, FASTP={fastp=0.23.4}, FASTP_LENGTH_FILTER={fastp=0.23.4}, FASTQC_RAW={fastqc=0.12.1}, FASTQC_TRIM={fastqc=0.12.1}, FORMAT_HAIRPIN={fastx_toolkit=0.0.14}, FORMAT_MATURE={fastx_toolkit=0.0.14}, INDEX_HAIRPIN={bowtie=1.3.0}, INDEX_MATURE={bowtie=1.3.0}, MIRTOP_COUNTS={mirtop=0.4.28}, MIRTOP_EXPORT={mirtop=0.4.28}, MIRTOP_GFF={mirtop=0.4.28}, MIRTOP_STATS={mirtop=0.4.28}, MIRTRACE_QC={mirtrace=1.0.1}, PARSE_HAIRPIN={seqkit=2.6.1}, PARSE_MATURE={seqkit=2.6.1}, SAMTOOLS_FLAGSTAT={samtools=1.21}, SAMTOOLS_IDXSTATS={samtools=1.21}, SAMTOOLS_INDEX={samtools=1.21}, SAMTOOLS_SORT={samtools=1.21}, SAMTOOLS_STATS={samtools=1.21}, SEQCLUSTER_COLLAPSE={seqcluster=1.2.9}, UMICOLLAPSE_FASTQ={umicollapse=1.0.0-1}, Workflow={nf-core/smrnaseq=v2.3.2dev}}" + "{BOWTIE_MAP_GENOME={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_HAIRPIN={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_MATURE={bowtie=1.3.0, samtools=1.16.1}, BOWTIE_MAP_SEQCLUSTER={bowtie=1.3.0, samtools=1.16.1}, CSVTK_JOIN={csvtk=0.30.0}, DATATABLE_MERGE={r-base=3.6.2}, FASTP={fastp=0.23.4}, FASTP_LENGTH_FILTER={fastp=0.23.4}, FASTQC_RAW={fastqc=0.12.1}, FASTQC_TRIM={fastqc=0.12.1}, FORMAT_HAIRPIN={fastx_toolkit=0.0.14}, FORMAT_MATURE={fastx_toolkit=0.0.14}, INDEX_HAIRPIN={bowtie=1.3.0}, INDEX_MATURE={bowtie=1.3.0}, MIRTOP_COUNTS={mirtop=0.4.28}, MIRTOP_EXPORT={mirtop=0.4.28}, MIRTOP_GFF={mirtop=0.4.28}, MIRTOP_STATS={mirtop=0.4.28}, MIRTRACE_QC={mirtrace=1.0.1}, PARSE_HAIRPIN={seqkit=2.6.1}, PARSE_MATURE={seqkit=2.6.1}, SAMTOOLS_FLAGSTAT={samtools=1.21}, SAMTOOLS_IDXSTATS={samtools=1.21}, SAMTOOLS_INDEX={samtools=1.21}, SAMTOOLS_SORT={samtools=1.21}, SAMTOOLS_STATS={samtools=1.21}, SEQCLUSTER_COLLAPSE={seqcluster=1.2.9}, UMICOLLAPSE_FASTQ={umicollapse=1.0.0-1}, Workflow={nf-core/smrnaseq=v2.4.0}}" ], "meta": { "nf-test": "0.9.0", @@ -160,4 +160,4 @@ }, "timestamp": "2024-09-20T19:12:28.290360163" } -} \ No newline at end of file +} From 48337c8f0c7c94c473fe190230d5d3d75df42b4d Mon Sep 17 00:00:00 2001 From: atrigila <18577080+atrigila@users.noreply.github.com> Date: Tue, 8 Oct 2024 11:31:41 +0000 Subject: [PATCH 08/27] Address Make citation tools dependent on whether tool was executed #468 --- .../local/utils_nfcore_smrnaseq_pipeline/main.nf | 15 +++++++-------- 1 file changed, 7 insertions(+), 8 deletions(-) diff --git a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf index e7f656d0..81d9b80a 100644 --- a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf @@ -220,23 +220,22 @@ def toolCitationText() { // Uncomment function in methodsDescriptionText to render in MultiQC report def citation_text = [ "Tools used in the workflow included:", - "FastQC (Andrews 2010),", - "MultiQC (Ewels et al. 2016),", + !params.skip_fastqc ? "FastQC (Andrews 2010)," : "", + !params.skip_multiqc ? "MultiQC (Ewels et al. 2016)," : "", + !params.skip_fastp ? "fastp (Chen et al. 2018)," : "", + !params.skip_mirdeep ? "MiRDeep2 (Friedländer et al. 2012)," : "", + params.filter_contamination ? "Contamination filtering tools: BLAT (Kent 2002), Bowtie2 (Langmead and Salzberg 2012)," : "", + params.mirtrace_species ? "miRTrace (Kang et al. 2018)," : "", "UMI-tools (Smith et al. 2017),", - "fastp (Chen et al. 2018),", - "miRTrace (Kang et al. 2018),", "Bowtie (Langmead et al. 2009),", - "Bowtie2 (Langmead and Salzberg 2012),", "SAMtools (Li et al. 2009),", "EdgeR (Robinson et al. 2010),", "Mirtop (Desvignes et al. 2019),", - "MiRDeep2 (Friedländer et al. 2012),", "SeqKit (Shen et al. 2016),", "UMICollapse (Liu 2020),", - "BLAT (Kent 2002)", "Seqcluster (Pantano et al. 2011)", "." - ].join(' ').trim() + ].join(' ').trim() return citation_text } From 8c22e20b9e98b315dbdbc1f2904955b97ee21285 Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Tue, 8 Oct 2024 12:32:16 +0000 Subject: [PATCH 09/27] Template update for nf-core/tools version 3.0.0 --- .editorconfig | 4 + .github/CONTRIBUTING.md | 10 +- .github/PULL_REQUEST_TEMPLATE.md | 2 +- .github/workflows/awsfulltest.yml | 23 +- .github/workflows/ci.yml | 17 +- .github/workflows/download_pipeline.yml | 53 ++- .github/workflows/linting.yml | 23 +- .github/workflows/linting_comment.yml | 2 +- .github/workflows/release-announcements.yml | 2 +- .../workflows/template_version_comment.yml | 43 ++ .gitpod.yml | 7 +- .nf-core.yml | 19 +- .pre-commit-config.yaml | 2 +- .prettierignore | 1 + CHANGELOG.md | 2 +- CITATIONS.md | 4 +- README.md | 5 +- assets/multiqc_config.yml | 4 +- assets/schema_input.json | 2 +- conf/base.config | 34 +- conf/igenomes_ignored.config | 9 + conf/modules.config | 1 - conf/test.config | 13 +- docs/images/mqc_fastqc_adapter.png | Bin 23458 -> 0 bytes docs/images/mqc_fastqc_counts.png | Bin 33918 -> 0 bytes docs/images/mqc_fastqc_quality.png | Bin 55769 -> 0 bytes docs/output.md | 11 +- docs/usage.md | 12 +- main.nf | 10 +- modules.json | 12 +- modules/nf-core/fastqc/environment.yml | 2 - modules/nf-core/fastqc/main.nf | 5 +- modules/nf-core/fastqc/meta.yml | 57 +-- modules/nf-core/fastqc/tests/main.nf.test | 225 ++++++++--- .../nf-core/fastqc/tests/main.nf.test.snap | 370 ++++++++++++++++-- modules/nf-core/multiqc/environment.yml | 4 +- modules/nf-core/multiqc/main.nf | 14 +- modules/nf-core/multiqc/meta.yml | 78 ++-- modules/nf-core/multiqc/tests/main.nf.test | 8 + .../nf-core/multiqc/tests/main.nf.test.snap | 20 +- modules/nf-core/multiqc/tests/nextflow.config | 5 + nextflow.config | 148 ++++--- nextflow_schema.json | 85 +--- .../utils_nfcore_smrnaseq_pipeline/main.nf | 56 +-- .../nf-core/utils_nextflow_pipeline/main.nf | 24 +- .../tests/nextflow.config | 2 +- .../nf-core/utils_nfcore_pipeline/main.nf | 45 ++- .../nf-core/utils_nfschema_plugin/main.nf | 46 +++ .../nf-core/utils_nfschema_plugin/meta.yml | 35 ++ .../utils_nfschema_plugin/tests/main.nf.test | 117 ++++++ .../tests/nextflow.config | 8 + .../tests/nextflow_schema.json | 8 +- .../nf-core/utils_nfvalidation_plugin/main.nf | 62 --- .../utils_nfvalidation_plugin/meta.yml | 44 --- .../tests/main.nf.test | 200 ---------- .../utils_nfvalidation_plugin/tests/tags.yml | 2 - workflows/smrnaseq.nf | 23 +- 57 files changed, 1210 insertions(+), 810 deletions(-) create mode 100644 .github/workflows/template_version_comment.yml create mode 100644 conf/igenomes_ignored.config delete mode 100755 docs/images/mqc_fastqc_adapter.png delete mode 100755 docs/images/mqc_fastqc_counts.png delete mode 100755 docs/images/mqc_fastqc_quality.png create mode 100644 modules/nf-core/multiqc/tests/nextflow.config create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/main.nf create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/meta.yml create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config rename subworkflows/nf-core/{utils_nfvalidation_plugin => utils_nfschema_plugin}/tests/nextflow_schema.json (95%) delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/main.nf delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml diff --git a/.editorconfig b/.editorconfig index 72dda289..e1058815 100644 --- a/.editorconfig +++ b/.editorconfig @@ -11,6 +11,7 @@ indent_style = space [*.{md,yml,yaml,html,css,scss,js}] indent_size = 2 + # These files are edited and tested upstream in nf-core/modules [/modules/nf-core/**] charset = unset @@ -25,9 +26,12 @@ insert_final_newline = unset trim_trailing_whitespace = unset indent_style = unset + + [/assets/email*] indent_size = unset + # ignore python and markdown [*.{py,md}] indent_style = unset diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index 0779fb9b..2e48f9a3 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -19,7 +19,7 @@ If you'd like to write some code for nf-core/smrnaseq, the standard workflow is 1. Check that there isn't already an issue about your idea in the [nf-core/smrnaseq issues](https://github.com/nf-core/smrnaseq/issues) to avoid duplicating work. If there isn't one already, please create one so that others know you're working on this 2. [Fork](https://help.github.com/en/github/getting-started-with-github/fork-a-repo) the [nf-core/smrnaseq repository](https://github.com/nf-core/smrnaseq) to your GitHub account 3. Make the necessary changes / additions within your forked repository following [Pipeline conventions](#pipeline-contribution-conventions) -4. Use `nf-core schema build` and add any new parameters to the pipeline JSON schema (requires [nf-core tools](https://github.com/nf-core/tools) >= 1.10). +4. Use `nf-core pipelines schema build` and add any new parameters to the pipeline JSON schema (requires [nf-core tools](https://github.com/nf-core/tools) >= 1.10). 5. Submit a Pull Request against the `dev` branch and wait for the code to be reviewed and merged If you're not used to this workflow with git, you can start with some [docs from GitHub](https://help.github.com/en/github/collaborating-with-issues-and-pull-requests) or even their [excellent `git` resources](https://try.github.io/). @@ -40,7 +40,7 @@ There are typically two types of tests that run: ### Lint tests `nf-core` has a [set of guidelines](https://nf-co.re/developers/guidelines) which all pipelines must adhere to. -To enforce these and ensure that all pipelines stay in sync, we have developed a helper tool which runs checks on the pipeline code. This is in the [nf-core/tools repository](https://github.com/nf-core/tools) and once installed can be run locally with the `nf-core lint ` command. +To enforce these and ensure that all pipelines stay in sync, we have developed a helper tool which runs checks on the pipeline code. This is in the [nf-core/tools repository](https://github.com/nf-core/tools) and once installed can be run locally with the `nf-core pipelines lint ` command. If any failures or warnings are encountered, please follow the listed URL for more documentation. @@ -75,7 +75,7 @@ If you wish to contribute a new step, please use the following coding standards: 2. Write the process block (see below). 3. Define the output channel if needed (see below). 4. Add any new parameters to `nextflow.config` with a default (see below). -5. Add any new parameters to `nextflow_schema.json` with help text (via the `nf-core schema build` tool). +5. Add any new parameters to `nextflow_schema.json` with help text (via the `nf-core pipelines schema build` tool). 6. Add sanity checks and validation for all relevant parameters. 7. Perform local tests to validate that the new code works as expected. 8. If applicable, add a new test command in `.github/workflow/ci.yml`. @@ -86,7 +86,7 @@ If you wish to contribute a new step, please use the following coding standards: Parameters should be initialised / defined with default values in `nextflow.config` under the `params` scope. -Once there, use `nf-core schema build` to add to `nextflow_schema.json`. +Once there, use `nf-core pipelines schema build` to add to `nextflow_schema.json`. ### Default processes resource requirements @@ -103,7 +103,7 @@ Please use the following naming schemes, to make it easy to understand what is g ### Nextflow version bumping -If you are using a new feature from core Nextflow, you may bump the minimum required version of nextflow in the pipeline with: `nf-core bump-version --nextflow . [min-nf-version]` +If you are using a new feature from core Nextflow, you may bump the minimum required version of nextflow in the pipeline with: `nf-core pipelines bump-version --nextflow . [min-nf-version]` ### Images and figures diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md index 3cdbf2b7..2544ad43 100644 --- a/.github/PULL_REQUEST_TEMPLATE.md +++ b/.github/PULL_REQUEST_TEMPLATE.md @@ -17,7 +17,7 @@ Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/smrn - [ ] If you've fixed a bug or added code that should be tested, add tests! - [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/smrnaseq/tree/master/.github/CONTRIBUTING.md) - [ ] If necessary, also make a PR on the nf-core/smrnaseq _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. -- [ ] Make sure your code lints (`nf-core lint`). +- [ ] Make sure your code lints (`nf-core pipelines lint`). - [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir `). - [ ] Check for unexpected warnings in debug mode (`nextflow run . -profile debug,test,docker --outdir `). - [ ] Usage Documentation in `docs/usage.md` is updated. diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index b1e23db7..a269d0e7 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -1,18 +1,33 @@ name: nf-core AWS full size tests -# This workflow is triggered on published releases. +# This workflow is triggered on PRs opened against the master branch. # It can be additionally triggered manually with GitHub actions workflow dispatch button. # It runs the -profile 'test_full' on AWS batch on: - release: - types: [published] + pull_request: + branches: + - master workflow_dispatch: + pull_request_review: + types: [submitted] + jobs: run-platform: name: Run AWS full tests - if: github.repository == 'nf-core/smrnaseq' + if: github.repository == 'nf-core/smrnaseq' && github.event.review.state == 'approved' runs-on: ubuntu-latest steps: + - uses: octokit/request-action@v2.x + id: check_approvals + with: + route: GET /repos/${{ github.repository }}/pulls/${{ github.event.review.number }}/reviews + env: + GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} + - id: test_variables + run: | + JSON_RESPONSE='${{ steps.check_approvals.outputs.data }}' + CURRENT_APPROVALS_COUNT=$(echo $JSON_RESPONSE | jq -c '[.[] | select(.state | contains("APPROVED")) ] | length') + test $CURRENT_APPROVALS_COUNT -ge 2 || exit 1 # At least 2 approvals are required - name: Launch workflow via Seqera Platform uses: seqeralabs/action-tower-launch@v2 # TODO nf-core: You can customise AWS full pipeline tests as required diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index a2472105..33d2ae00 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -7,6 +7,7 @@ on: pull_request: release: types: [published] + workflow_dispatch: env: NXF_ANSI_LOG: false @@ -24,7 +25,7 @@ jobs: strategy: matrix: NXF_VER: - - "23.04.0" + - "24.04.2" - "latest-everything" steps: - name: Check out pipeline code @@ -38,9 +39,21 @@ jobs: - name: Disk space cleanup uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 - - name: Run pipeline with test data + - name: Run pipeline with test data (docker) # TODO nf-core: You can customise CI pipeline run tests as required # For example: adding multiple test runs with different parameters # Remember that you can parallelise this by using strategy.matrix run: | nextflow run ${GITHUB_WORKSPACE} -profile test,docker --outdir ./results + + - name: Run pipeline with test data (singularity) + # TODO nf-core: You can customise CI pipeline run tests as required + run: | + nextflow run ${GITHUB_WORKSPACE} -profile test,singularity --outdir ./results + if: "${{ github.base_ref == 'master' }}" + + - name: Run pipeline with test data (conda) + # TODO nf-core: You can customise CI pipeline run tests as required + run: | + nextflow run ${GITHUB_WORKSPACE} -profile test,conda --outdir ./results + if: "${{ github.base_ref == 'master' }}" diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml index 2d20d644..713dc3e7 100644 --- a/.github/workflows/download_pipeline.yml +++ b/.github/workflows/download_pipeline.yml @@ -1,4 +1,4 @@ -name: Test successful pipeline download with 'nf-core download' +name: Test successful pipeline download with 'nf-core pipelines download' # Run the workflow when: # - dispatched manually @@ -8,7 +8,7 @@ on: workflow_dispatch: inputs: testbranch: - description: "The specific branch you wish to utilize for the test execution of nf-core download." + description: "The specific branch you wish to utilize for the test execution of nf-core pipelines download." required: true default: "dev" pull_request: @@ -39,9 +39,11 @@ jobs: with: python-version: "3.12" architecture: "x64" - - uses: eWaterCycle/setup-singularity@931d4e31109e875b13309ae1d07c70ca8fbc8537 # v7 + + - name: Setup Apptainer + uses: eWaterCycle/setup-apptainer@4bb22c52d4f63406c49e94c804632975787312b3 # v2.0.0 with: - singularity-version: 3.8.3 + apptainer-version: 1.3.4 - name: Install dependencies run: | @@ -54,33 +56,64 @@ jobs: echo "REPOTITLE_LOWERCASE=$(basename ${GITHUB_REPOSITORY,,})" >> ${GITHUB_ENV} echo "REPO_BRANCH=${{ github.event.inputs.testbranch || 'dev' }}" >> ${GITHUB_ENV} + - name: Make a cache directory for the container images + run: | + mkdir -p ./singularity_container_images + - name: Download the pipeline env: - NXF_SINGULARITY_CACHEDIR: ./ + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images run: | - nf-core download ${{ env.REPO_LOWERCASE }} \ + nf-core pipelines download ${{ env.REPO_LOWERCASE }} \ --revision ${{ env.REPO_BRANCH }} \ --outdir ./${{ env.REPOTITLE_LOWERCASE }} \ --compress "none" \ --container-system 'singularity' \ - --container-library "quay.io" -l "docker.io" -l "ghcr.io" \ + --container-library "quay.io" -l "docker.io" -l "community.wave.seqera.io" \ --container-cache-utilisation 'amend' \ - --download-configuration + --download-configuration 'yes' - name: Inspect download run: tree ./${{ env.REPOTITLE_LOWERCASE }} + - name: Count the downloaded number of container images + id: count_initial + run: | + image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) + echo "Initial container image count: $image_count" + echo "IMAGE_COUNT_INITIAL=$image_count" >> ${GITHUB_ENV} + - name: Run the downloaded pipeline (stub) id: stub_run_pipeline continue-on-error: true env: - NXF_SINGULARITY_CACHEDIR: ./ + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images NXF_SINGULARITY_HOME_MOUNT: true run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -stub -profile test,singularity --outdir ./results - name: Run the downloaded pipeline (stub run not supported) id: run_pipeline if: ${{ job.steps.stub_run_pipeline.status == failure() }} env: - NXF_SINGULARITY_CACHEDIR: ./ + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images NXF_SINGULARITY_HOME_MOUNT: true run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -profile test,singularity --outdir ./results + + - name: Count the downloaded number of container images + id: count_afterwards + run: | + image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) + echo "Post-pipeline run container image count: $image_count" + echo "IMAGE_COUNT_AFTER=$image_count" >> ${GITHUB_ENV} + + - name: Compare container image counts + run: | + if [ "${{ env.IMAGE_COUNT_INITIAL }}" -ne "${{ env.IMAGE_COUNT_AFTER }}" ]; then + initial_count=${{ env.IMAGE_COUNT_INITIAL }} + final_count=${{ env.IMAGE_COUNT_AFTER }} + difference=$((final_count - initial_count)) + echo "$difference additional container images were \n downloaded at runtime . The pipeline has no support for offline runs!" + tree ./singularity_container_images + exit 1 + else + echo "The pipeline can be downloaded successfully!" + fi diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index 1fcafe88..b882838a 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -1,6 +1,6 @@ name: nf-core linting # This workflow is triggered on pushes and PRs to the repository. -# It runs the `nf-core lint` and markdown lint tests to ensure +# It runs the `nf-core pipelines lint` and markdown lint tests to ensure # that the code meets the nf-core guidelines. on: push: @@ -41,17 +41,32 @@ jobs: python-version: "3.12" architecture: "x64" + - name: read .nf-core.yml + uses: pietrobolcato/action-read-yaml@1.0.0 + id: read_yml + with: + config: ${{ github.workspace }}/.nf-core.yaml + - name: Install dependencies run: | python -m pip install --upgrade pip - pip install nf-core + pip install nf-core==${{ steps.read_yml.outputs['nf_core_version'] }} + + - name: Run nf-core pipelines lint + if: ${{ github.base_ref != 'master' }} + env: + GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }} + GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} + GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }} + run: nf-core -l lint_log.txt pipelines lint --dir ${GITHUB_WORKSPACE} --markdown lint_results.md - - name: Run nf-core lint + - name: Run nf-core pipelines lint --release + if: ${{ github.base_ref == 'master' }} env: GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }} GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }} - run: nf-core -l lint_log.txt lint --dir ${GITHUB_WORKSPACE} --markdown lint_results.md + run: nf-core -l lint_log.txt pipelines lint --release --dir ${GITHUB_WORKSPACE} --markdown lint_results.md - name: Save PR number if: ${{ always() }} diff --git a/.github/workflows/linting_comment.yml b/.github/workflows/linting_comment.yml index 40acc23f..42e519bf 100644 --- a/.github/workflows/linting_comment.yml +++ b/.github/workflows/linting_comment.yml @@ -11,7 +11,7 @@ jobs: runs-on: ubuntu-latest steps: - name: Download lint results - uses: dawidd6/action-download-artifact@09f2f74827fd3a8607589e5ad7f9398816f540fe # v3 + uses: dawidd6/action-download-artifact@bf251b5aa9c2f7eeb574a96ee720e24f801b7c11 # v6 with: workflow: linting.yml workflow_conclusion: completed diff --git a/.github/workflows/release-announcements.yml b/.github/workflows/release-announcements.yml index 03ecfcf7..c6ba35df 100644 --- a/.github/workflows/release-announcements.yml +++ b/.github/workflows/release-announcements.yml @@ -12,7 +12,7 @@ jobs: - name: get topics and convert to hashtags id: get_topics run: | - echo "topics=$(curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.full_name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ')" >> $GITHUB_OUTPUT + echo "topics=$(curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.full_name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ')" | sed 's/-//g' >> $GITHUB_OUTPUT - uses: rzr/fediverse-action@master with: diff --git a/.github/workflows/template_version_comment.yml b/.github/workflows/template_version_comment.yml new file mode 100644 index 00000000..9dea41f0 --- /dev/null +++ b/.github/workflows/template_version_comment.yml @@ -0,0 +1,43 @@ +name: nf-core template version comment +# This workflow is triggered on PRs to check if the pipeline template version matches the latest nf-core version. +# It posts a comment to the PR, even if it comes from a fork. + +on: pull_request_target + +jobs: + template_version: + runs-on: ubuntu-latest + steps: + - name: Check out pipeline code + uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + + - name: Read template version from .nf-core.yml + uses: pietrobolcato/action-read-yaml@1.0.0 + id: read_yml + with: + config: ${{ github.workspace }}/.nf-core.yml + + - name: Install nf-core + run: | + python -m pip install --upgrade pip + pip install nf-core==${{ steps.read_yml.outputs['nf_core_version'] }} + + - name: Check nf-core outdated + id: nf_core_outdated + run: pip list --outdated | grep nf-core + + - name: Post nf-core template version comment + uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 + if: | + ${{ steps.nf_core_outdated.outputs.stdout }} =~ 'nf-core' + with: + repo-token: ${{ secrets.NF_CORE_BOT_AUTH_TOKEN }} + allow-repeats: false + message: | + ## :warning: Newer version of the nf-core template is available. + + Your pipeline is using an old version of the nf-core template: ${{ steps.read_yml.outputs['nf_core_version'] }}. + Please update your pipeline to the latest version. + + For more documentation on how to update your pipeline, please see the [nf-core documentation](https://github.com/nf-core/tools?tab=readme-ov-file#sync-a-pipeline-with-the-template) and [Synchronisation documentation](https://nf-co.re/docs/contributing/sync). + # diff --git a/.gitpod.yml b/.gitpod.yml index 105a1821..46118637 100644 --- a/.gitpod.yml +++ b/.gitpod.yml @@ -4,17 +4,14 @@ tasks: command: | pre-commit install --install-hooks nextflow self-update - - name: unset JAVA_TOOL_OPTIONS - command: | - unset JAVA_TOOL_OPTIONS vscode: extensions: # based on nf-core.nf-core-extensionpack - - esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code + #- esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code - EditorConfig.EditorConfig # override user/workspace settings with settings found in .editorconfig files - Gruntfuggly.todo-tree # Display TODO and FIXME in a tree view in the activity bar - mechatroner.rainbow-csv # Highlight columns in csv files in different colors - # - nextflow.nextflow # Nextflow syntax highlighting + - nextflow.nextflow # Nextflow syntax highlighting - oderwat.indent-rainbow # Highlight indentation level - streetsidesoftware.code-spell-checker # Spelling checker for source code - charliermarsh.ruff # Code linter Ruff diff --git a/.nf-core.yml b/.nf-core.yml index e0b85a77..1d204498 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -1,2 +1,19 @@ +bump_version: null +lint: + nextflow_config: + - config_defaults: + - params.fastp_known_mirna_adapters +nf_core_version: 3.0.0 +org_path: null repository_type: pipeline -nf_core_version: "2.14.1" +template: + author: "P. Ewels, C. Wang, R. Hammar\xE9n, L. Pantano, A. Peltzer" + description: Small RNA-Seq Best Practice Analysis Pipeline. + force: false + is_nfcore: true + name: smrnaseq + org: nf-core + outdir: . + skip_features: null + version: 2.4.0 +update: null diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml index 4dc0f1dc..9e9f0e1c 100644 --- a/.pre-commit-config.yaml +++ b/.pre-commit-config.yaml @@ -7,7 +7,7 @@ repos: - prettier@3.2.5 - repo: https://github.com/editorconfig-checker/editorconfig-checker.python - rev: "2.7.3" + rev: "3.0.3" hooks: - id: editorconfig-checker alias: ec diff --git a/.prettierignore b/.prettierignore index 437d763d..610e5069 100644 --- a/.prettierignore +++ b/.prettierignore @@ -1,3 +1,4 @@ + email_template.html adaptivecard.json slackreport.json diff --git a/CHANGELOG.md b/CHANGELOG.md index d3c09380..d1294fe9 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,7 +3,7 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). -## v2.3.2dev - [date] +## v2.4.0 - [date] Initial release of nf-core/smrnaseq, created with the [nf-core](https://nf-co.re/) template. diff --git a/CITATIONS.md b/CITATIONS.md index c33b0d8a..13a7efbf 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -12,11 +12,11 @@ - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) - > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. +> Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. - [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) - > Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. +> Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. ## Software packaging/containerisation tools diff --git a/README.md b/README.md index f30c6ac3..7ca76fa5 100644 --- a/README.md +++ b/README.md @@ -9,7 +9,7 @@ [![GitHub Actions Linting Status](https://github.com/nf-core/smrnaseq/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/smrnaseq/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/smrnaseq/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX) [![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com) -[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/) +[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A524.04.2-23aa62.svg)](https://www.nextflow.io/) [![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/) [![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/) [![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/) @@ -67,8 +67,7 @@ nextflow run nf-core/smrnaseq \ ``` > [!WARNING] -> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; -> see [docs](https://nf-co.re/usage/configuration#custom-configuration-files). +> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files). For more details and further functionality, please refer to the [usage documentation](https://nf-co.re/smrnaseq/usage) and the [parameter documentation](https://nf-co.re/smrnaseq/parameters). diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index bd6b5ac7..a946e6dd 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -1,7 +1,7 @@ report_comment: > - This report has been generated by the nf-core/smrnaseq + This report has been generated by the nf-core/smrnaseq analysis pipeline. For information about how to interpret these results, please see the - documentation. + documentation. report_section_order: "nf-core-smrnaseq-methods-description": order: -1000 diff --git a/assets/schema_input.json b/assets/schema_input.json index 892b1996..b5face8a 100644 --- a/assets/schema_input.json +++ b/assets/schema_input.json @@ -1,5 +1,5 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/nf-core/smrnaseq/master/assets/schema_input.json", "title": "nf-core/smrnaseq pipeline - params.input schema", "description": "Schema for the file provided with params.input", diff --git a/conf/base.config b/conf/base.config index b6e0183f..1e6a7432 100644 --- a/conf/base.config +++ b/conf/base.config @@ -11,9 +11,9 @@ process { // TODO nf-core: Check the defaults for all processes - cpus = { check_max( 1 * task.attempt, 'cpus' ) } - memory = { check_max( 6.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 1 * task.attempt } + memory = { 6.GB * task.attempt } + time = { 4.h * task.attempt } errorStrategy = { task.exitStatus in ((130..145) + 104) ? 'retry' : 'finish' } maxRetries = 1 @@ -27,30 +27,30 @@ process { // TODO nf-core: Customise requirements for specific processes. // See https://www.nextflow.io/docs/latest/config.html#config-process-selectors withLabel:process_single { - cpus = { check_max( 1 , 'cpus' ) } - memory = { check_max( 6.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 1 } + memory = { 6.GB * task.attempt } + time = { 4.h * task.attempt } } withLabel:process_low { - cpus = { check_max( 2 * task.attempt, 'cpus' ) } - memory = { check_max( 12.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 2 * task.attempt } + memory = { 12.GB * task.attempt } + time = { 4.h * task.attempt } } withLabel:process_medium { - cpus = { check_max( 6 * task.attempt, 'cpus' ) } - memory = { check_max( 36.GB * task.attempt, 'memory' ) } - time = { check_max( 8.h * task.attempt, 'time' ) } + cpus = { 6 * task.attempt } + memory = { 36.GB * task.attempt } + time = { 8.h * task.attempt } } withLabel:process_high { - cpus = { check_max( 12 * task.attempt, 'cpus' ) } - memory = { check_max( 72.GB * task.attempt, 'memory' ) } - time = { check_max( 16.h * task.attempt, 'time' ) } + cpus = { 12 * task.attempt } + memory = { 72.GB * task.attempt } + time = { 16.h * task.attempt } } withLabel:process_long { - time = { check_max( 20.h * task.attempt, 'time' ) } + time = { 20.h * task.attempt } } withLabel:process_high_memory { - memory = { check_max( 200.GB * task.attempt, 'memory' ) } + memory = { 200.GB * task.attempt } } withLabel:error_ignore { errorStrategy = 'ignore' diff --git a/conf/igenomes_ignored.config b/conf/igenomes_ignored.config new file mode 100644 index 00000000..b4034d82 --- /dev/null +++ b/conf/igenomes_ignored.config @@ -0,0 +1,9 @@ +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Nextflow config file for iGenomes paths +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Empty genomes dictionary to use when igenomes is ignored. +---------------------------------------------------------------------------------------- +*/ + +params.genomes = [:] diff --git a/conf/modules.config b/conf/modules.config index d203d2b6..d266a387 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -21,7 +21,6 @@ process { withName: FASTQC { ext.args = '--quiet' } - withName: 'MULTIQC' { ext.args = { params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' } publishDir = [ diff --git a/conf/test.config b/conf/test.config index 23f96a5c..ae7c5942 100644 --- a/conf/test.config +++ b/conf/test.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} + params { config_profile_name = 'Test profile' config_profile_description = 'Minimal test dataset to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data // TODO nf-core: Specify the paths to your test data on nf-core/test-datasets // TODO nf-core: Give any required params for the test so that command line flags are not needed diff --git a/docs/images/mqc_fastqc_adapter.png b/docs/images/mqc_fastqc_adapter.png deleted file mode 100755 index 361d0e47acfb424dea1f326590d1eb2f6dfa26b5..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 23458 zcmeFZ2UJtryD!S#x<#o93es(Ww4k)maRbte0-+a?-g^xY-3myTE`8G_KvA54)F1tn})nJ5u%TA4Y;^!^{48eL_}p#q-Umo0M|F1 z74+PQh^X8N|9_jcWbq~ zzn+tZC9B75nKdz=gQ8wo9GJ$P{D~3knlI_`-PRhCw34f1oYDLr^;oEbgxa#A^J%*2 z>FfDE*(~JzKFs$t_oeLz))qDU?s}%Q?7b~3Y;lUi^Oy-2@3g?joA4Wkgb6-2=ih*jub)~7yZ`T=L=Z`B`{1jhkB-iSjea94&Eo9A zxN59pv1p_}RO1>EC^q}Z2)ZI;b7JV_x4lMr=Bker2+EK;8~!;JO7re*@ZkDmoV878S*N^yX(F@U1yqt?Is3nnV>7}#(5pk`V3C) zWhB8;CwWIwsVIjH+`<9=YA(j&3DgQdFOOGU~*`36wNC&QDv8> zr?h2PQgnHkp&t^S)q^K!68h~`$PjZW&-Wns;Zlw$M2sc z1xR!u{m|Kih*|Hht#M@eOMM#8O*={^6b9k5B5^eBsrnhVHD7XZ5BWO&F?q(>Y=QFl z`f>yQ9NCoxZCH-1F{#mz_j{QeyY~4h*VeyYZ#S@Z(Pnb7G=ud!RW)5svqM*&GI_za zzn;8LkOTT?``1Ygt6w!2;5arK*o5k15cdIJnMg)IQhF_zVK%!ma$z&jL zZt>Q{!PqKl^`Qw?nJUOEm@@qX(y(TwSJ~dqW&M@7-N4Wk_wC4izx(xJMrmNjsl$XR zCyK&INt}7@FzNAbbg-nW)sJ>3->I1+2~YdlPsaS}^X-H0GR_CEsw`PGjpq`uX}8VP zJ)HC34>D(z{KR9;E&z=@?@q_|I{NPOj~g>w!$gR?Tlu~F+L$Mk%}xQEm+{&T(5zkH zacVy0k3w!T9r*p2sgX@V;^+PfUYUrEde07XSV=KSDbkIZU!j!Rk3MQV=h-!y@kWVB zdYkmu^fiU~pp#ixe4hBEMx7^LdHa z_L*14aVIHtrsR)SO?=&kQS&JR#^AVvln=P=bUXEIy$QB&!s34znCV@y(C%j9V=}SU zoYLHn+-Lalm0$-=QQ}a(+2dR*{DPF+)J4y!ukiA_T%dF zVKEk;c?LWheG#A5{A20}CKjMw5G%2}cT5@Oce=wqdobHC70=kY7}dxt3diH9(Zcwr zCabx8yObHQ@#e_wjl%wp8s_!Wvxe5f-Duin@obgt>qOcqN$$@{X^C_rEDh3fmM;|X z$zu4;D`{YRbaJ?o!KkazII&|th9v5MG2Mao$ytOHtW+wo;XJJdtLuGjg;d020qT++ zpD}e&o?SeKSqR`}4`OdkWNC7K)Wltn zbwBrWGM;bBGm8uP_RiqfwvDD1f+uRX>b=nTH9Y%vpg{ka0e*E>%<+3!G3#s*-1D>q zHg~1@BT52a*L>mVcP>6y*0iX8@!3tDFJLE+sRlnU(cl``hF`0Q>e4i6P8|wKmqIqI zoY+a0V*Bib0`F9nG#sR(8$^!IWLR)cE8@7XZTN%L-ucJ{9yijy)w5Pom%XG7V<^PX z$Z$U82w0qgcGmld-O6*e)?pm$g@!6`Pps5SPKccjDf(|vX9zcLs7t!7cyyckZI#R* z#lj(HqfVeqyZ+Va{)>65sAb3IQ%a{9W^_F!5!;w=XD}ZUHFH$8=Xjw+VE)s$q(nt> zE2^aDYki5`e73RQ=DxaBNZ6CK?XKCv@V}=y(g?YHnFaHfXnl}Lo;36@?471W;&#Se z>pE*@M{Y?CevLG8il9#HXG#W3>;o$1``EYBY5i<;JlBqj2M8Y2!+6bPj1(S_bOksY z<34UQE;=Z>KiL``pYd}5fpOOT)GJQnXfNiAc5wgJ>F|$Eqw&D*Vmz+#mM0oFD^`-^ zB~SXe{T+5hd$gnKd7Afo9cy&Lii@syPDFDK)^V{iWEAEO@?xzx1bd`ta z;$(vG+=i3~9|D=GX%f~<>eOVjy~-yRAhLf2dR8V<@M_`C^ev(yOTg{uf=L3uyDb-w z&)l7KXS_HTo87BxI}fXF{ge&5p&IHk9M1}eNAwqw)`eZSOPFhqjS70{hyE@C{oSN$ zam*`-UH3RF-RWEP`^Su1q#n_J{AncekkV4m7YITf%QHBo60h@pk4N4O}hhf%rxuIZGiQpprVMal%h7?8+cY#L>pYnx6v!EnuIgInW` z)w!NuTp;fz9md^}*x@K9+`^2LO*bZp1^?BG#iS@(4i%AB6YP023T8Eb?M5K7ElSpe z9-wA22Mm}VwDkmECLd*}a=7bCf(}@SHs6UBe)Xvk(+hQ^^unj5JBeo$=><{4PBI%P z4_9XQ=XnE``;1Daa6f`~rGwNj9{YXY)eIw3G90Ip+QEWg0%?g=i$UHuQ?Qc0OR0!w zv?BvlQa!QMyI*IP!0>goBt$xo2^hlD&wRp?$=}}#?q~Yw z{**_|5&yL*Epz|4V#SJjg-lNaIx_{sCL3R=_VH&_;oOn5J2P=h!0enu-i%FAZ- zw`Hm*u6N*}&A7pAqr>-?%0(lveb{r8>hpDmex?Yo*8!-%1?YV0R~VEPBFp>)ba=mv+2(#>WEy0yxHZX=Cr2 zKmew%=^>HsD3BtRR*#H!@!TTGcI&fHrVh)P&|X;>)OHML+uWDn(dlsDjXa;5uBM$r zdt!r~ig?5iGbx!GpH+kdG8k0%;~)Q#0L6wFROJ}^Z%DvO3x#yNk13^&ccd&l)BP9h zD5cU-qZg-rV3Sg&?)`x}cI3`zw#zq{-eN4pNf(+?QuOG4oZ7zMGSVqOUe>`u=GfKM z{xPCciJFw9%Pk+uDSoormR&c=fS#hGOk=RGUtizBOoY^8P(>!Si|I9i=1ZCQbcc)5 zgE6UED;+b$4u&#dhZjdXwO3tpG0QaQwXrLOx5YP#TOaS@FP!h|G!z!Pbv?hTp0eQL zoUsiv4d@*Ck#ID9-ua|zPbQepcC4a>>9-bJApd()Wg%}hj#%A4pO-q{jIJ$f-SL7- zo&=keG_jhq$Ty4e|J^l6j6TQ=W)|~&Ei6gRn<{*^cFG*tS19#kHpMD7Y;wb~!3_%X zS_-3NQoGiWCX!M-Id;Nsg7oSi4VJ=Hi{bYNfjnmTq?IyK@@&_uacfb&8h@DIe70-Q zZ^KaT(4UX*vf7@A7CY;P!IVGIuXPRIe^&71Z1EyHO5&^=jUUKHF+h&m!4!dOA+!Ed zfA#uQ&p6vD7|O8(?5`bf8^gK)6p`>+$c*yG?Sw29;OD+tp}kDD9augDAEXWbSVoie zpHF1Wj8lWfIZ}mx%(2XREqF9!{fNd&iurAaoQDMCSNo!vRHE8wH%QLLZf9u;ADqnxOaAD#VE%Yg z?Gb?EmGbY}a0|vSZPlF3z6;Kf669Bf%h zlSGiY-}E4LFurm_CJN)(*l?=uX);o&R&qLuzENz?9I%S&YQ2>rVhx#c!hbvWLL!CI zA8mXM$zjnnJ#Me@-99}hjxCE!w8|9w{SBlj%Miq#dvS5GHP!DxO$sDx^4PF^#`;A! zb=bZ1pyj{R#9h$r7svB$QlJqeF1cp*ubT12UZ!deKFG%1N<@S2x&2UtqsVz zn=gF&$D4i3x7&vdoa#^cS?bQuP69OpspVPxm*%@DSWf!NG`o`y^R~o1Hvta;#!r%i zvEB~Jsi~sJ7Y35P!bf?OQin->fAk+TpU$Ow1st|l9|i2rrOneBP3&aDyoUj3K{a7! zOYpnJyYD#nr4GNJ;@$ce2dSN=eS7f-VptzM(|Ek^ze)mPVrpAEgrFs3mL>f(ZwriH zCZ65HdO0|W@2<+v9t?J=-4U9>bvM@@Ew4uVZy@c^Ovw9`k|$!+CTAn(u#4kC7TVTB zXuy#d+GC@RIMaPyp|Y2jS%RJkktCracCaLqfs^i^XFqK#3z+d}n02*VDF&My)vp)lNzWx<< zGB7hEAH?7_joYR?>+&+JIas*%Oiux%kr*X*B=8N8Ulowx0MkRK?pR)K1F_m8>dSe54 z)48k>#|F!OV#yOs7xQNQ@1iun5pl;py{tx+o044?r{W2O{f}3r{#QS#4bf(|f9R3y#6*0YY) z5Ey{M`dj)yHl)B{sdmvti^b0IE5xFx%jJM&5w69;`PGy0vGk2ztSW|5H3~zhXO?mn z+4mo>;Y7=4&gC}HifyMO`#70u3H6;0|| z!l=0lP|zVF`bfxm{%i98943^7y4Iz};Z9F$oY3iUI*FIsYa=o=nS^d`;3?*wDxi&| z=?oqs6uDcd1e_e5z7M5q(+I^PilSRE(T6%z<=U8%sq63V!wELY9Rj%#Y@2Y+TEJ8(f_Kh0ih?l6E6~wDl3~?-5%7>d{ zKs0XHUeORoi5+U#M{kE!Ae%|)^dabh1DsJI9N~LVXp*8$XlOfc6J+Cc?}SM zsc3N~L7hzcpXn2>b(_YN=J*C0N}$f_NINTiV!~L}nA{wn^XfBogd5hu!G?*THg^mF zFJm@9m{X~X3t5{7 z#lWIO++R8;BTByGl7U;fz|JBB^*4R|bLvm18x;DF*U`=kyxbH2nD*RIH5AWfJ4^5o z&Nr;*|NreNKo$fUI5}~n#Xcbjr0T-7MV;wZXA(QPt^`x;=ZK)5^`AFgQM?7ry_(Tm z0|EhWs&cYJW?|uvc3af(tfuyDf$28~R=HOa#}3Edru##Wwm0a$Vnk=_8+eQ; zfyq+GVt0Twr^QS*HtI+&&>_<%-Gq-!{iQr-3LYn-6bqW0VW)>%iat!2IP)Jd+LgnS zgI+jJ-I9HMJ8Z*$2FjwK1T0RpF%U`&x)S{3HqRJ z5^;r?VoA(k7*aP@tzB`O5Y26jv#x54xNH;E`KzzLxC)FEnQ<}IR#w*>9sq|zFzZq< zdM1%ynXvcLfZ{Xm=l(Op?=XGV8`BwRiQ%@@A-GnjD+y3K zN2Pm011b!s`3368%P&MapW-PDulXKfpeyRXNjN`lKKgC%CplwE#GrRw#0FE#Q4>R+ z23B4CmO%uy8Y@;F$hCHU6+oJ}_cKgm|4Amr{$`38ue-?+GX1T!hd$w@x=z{w30Z*W za@$MLl^=f#*oR+8(&a&`E@Bj{{1O;DPjj$g9U7~{m*?^Tj}Rrc^wc=(SycXVT?bW{ zUus*6{74fo{nOh@zQyv0g{)t}Qekl*>KXQYCI9m2jqge|&Ntj{V?gLs*_GkeODYhf zW39Q1L1~vk+#E^S!nCyO&z9Wh}2=K}`9#{=`j&)^}8=U|lz}DqgAteVsos){s zDhK`>&pK%cVuhO7tPu7@Y4|yXAdHs!(uKDuLL@i$Okc6Gs;2456Br??ZNZiONAe!~ zvY5w1(C)E9fRmpWgWU2Su0u6~9{@wIm<-lha;uuEN>&C^FJ#^|oopkg``l#i0&{OX z%rI6Q>l^9J++K19D;HrFU#V9o0M`MBTT#-(q&A{|n-`T~CgAFET=$E_&pIQTPE;J#&nrwf2N^I*d zH)ev~7d=Sy8<@syK<`PFvNtyfa#8^JceG^ua^o%!fl6R&j--jGkz8wS`EgfEZouOD zr97H059Dj(#$*$-!UQLvb92wS40!wJc!4K~lq-K2h2rXunCs?SjQERnvv9Fs?tF;y zWUTcQ&PtDMbsUY6_&np`UGMS0ZZIhnDh~p{`Bryj7XS~*R}%z6 zUO^hJn$_-CW(;$)hHu0ej1BNqv^o%*D2gR6zUvCZyw)ddNB6JE$;okhf7PEEz|dRN z$sP&o`MU(L_I8mDW33;)3!U*;HRm$zVV%%zaDn^*Qj~RdWdFNb;^fRhnF&{oeY-tv zq$p~pZw)Ls$EWKsEZubtx_9bpdCfsjdy*<8_Io8VtCIC+8kk@Qxdti>xnu}nRYJ-y zp8$3YP7u;u+YlPQ2`o_>S?mpXvd0-x!Z3=}>ceWDg*e)+#wQLE)Uwhneo z;*y`VfoY<#lwT^k4BP(ytfI;M`FoYsedi}L{1V|Ho}ciBs=`@vtgnieHdpWz%Vyy$ zlnn?k0KJWOnlJD9>6y64*X=G{lyl&%pV8Uo&>tXw%1za!6*YYVB$jR$Y0XhB#1mVx zvjd8N4X~{Dd&28RVEkCw9TLN9*Ng!?9F88l2Bl)w%7!97mtx5(Qx%1u6h+$OGa4#qGGGI{Pj4d)5yg8F4O2sfu61u0uM}?$_nH8=0St?`ogZ@1LAr@*uC4Z9(|dIQ z?OH<_%?PD56K*Kty@PQT;W#)tazY~|I7-aq)tQ($$#Q?{gEbJwJK3mnk)|l>XgmJQ z_POHzee+4NEWu0i0zUFmLTF(zvD3B%sp1_F7 z<|O7{-oZ2>t9k~zX0MDQ(4&(YZ#~baV{$ah?o_K1p$Ad`PAvgtuhW(xO{@bMjNb>Y z-k>lsDx?xX;x5*9RSpJe~BwLtb79%{p~+JTs5HZ&#({u>j3kAOLx*Y zW{7^+`OD%vhcxVW39F$jZ;I@H`3X?>Wwt@269f1o{V4-t-|dX4x7L3j zUHltoa@jqToWvn&=0CF%6%D0h50m^)qaXkRMC&Owv8iG~$}1PBgld3nBE#Rg(5)8n zga7!2@yjoBBoF_e3M$ongy7N1L_hT@!LUaCXX6QLZFKcq1r;;Z$sca}zfwaCji7PcbfW7H9p`7Eh$-j*7-=%{5f&}TidFWiMr=NYvc}Q@gh_z)<;^d&F zd@za3ugvK(BbprUX|)`Rk0&+6)#sm5S8a7;dzrqn*f)iXpvW$BVu6u)bR+ywtGne@B61Om=Q)yvb`45S}|LKt&5@)wSOfk;LhZ^UofjlQz0h zm)>a9f&40n$;-ndr=xntY3nOFGmA5POfiIsfgTzT*Cl zU{P;It;qo}n}IeEA1&?GRONCJp3=_!ce2$kKRZonNV+tS_uFPWzeS zhqSPws(Jp?TsgNT7yGtphSz=h2-}y#HTWNE#@LHFs^pseT#RfN*P8yLUm`jG1N5s* zfU25qv2akmjD=Q`s4SJxi@i`xIOCdT5B%W6wj1Fz8)Kuv*iB`}b^(em~z zz4~VcUB9M5@W}s3-SOWXu+*?)Al7p)Bw?jh8_#s)>lYp{{b%_vCY00=iC@I3$FcpY zYuOjg948l-C~}cDxL!%j&X1(H6ZC7U5?oVLQ<)zh*qg)k6HdNPB;PQcbVRXucl7>@ zE`Ga=^8RPrIRE!3E#e-v8MTy%%a1yk_k{s|V-=5ML7(Mg#S@LA3;rEyjF&X1w*^R&VJ>2%B@{=W9BD)oa@0!_Gl{G8Oe+Vki1QQWd~<<~Et zEV_YlJ=t8VXv>#L|FKXIJ)GZ1(d6xUoSPZVFOzMhM$6tgyhWq=@}=HzWm&b4o8R}L zQd7<0PV(LqaHYNNcXtTN4rc2ov$)VeRm&}XS-vamGB^G4tspa#HrPa5#22^pb?s&W zS%!p!fba6R+WLMjkeUo!qpKob}#cMpU4(`C+U6R8i>qlJ&Hbh52enW<`FmyjlhwlfIlxyu$Pg z3uS-Qau7K~%A$hBFocIe2<$LBIbEI!uddh9(JX=++R9aM|DO2#5*qKh#Zq^~O40f6 z0#s@~v{DPy=4^A}ieKe(Idu22Ex4~>p=#u?w_Lx>bHE@Z4Dh%iKrDJj2IJ+qNDIxj&WPRXRSaNz$JyFkpFK#gLAB6G;4KKql{+5w z{2yWKln-fjDCc()q_W&mmIx?JvpXPb{)hR&ok40*!M7lC!&?b|=efwVb@r0;FeD2( z*x!h~5OA8DEVr>6PS6o_oYt+7HY+d${lh@ruB?hP=`vq;@uLNGIb%@~*X54+`NY0- z35nZLFQArwtL~;t?sb(T6k;wi@v0FFLV}%b1@;p|R%u%8ROV= zRWO3*fG33>>}We#nQ5Vk3gY2ODY5fL+-E@ zvWG%=(;1n3UEEjqSDn9V_C*FMSXjR{uYKa`>$>D#@FacqRX4qmy{)y4&Gf)@V_BVr zvNEa@r<%e5HW?jhEb!SY6v|~N%22Y0992I>~ud8In`Lf`QStH3E)x@G=`2&AraN&V){PF%a=v)Pu{I zuQ7a;TZAlAgDiVUO+`B+z-8%M0kCiylcazP7I(w|^h*D4Sn6R#-jd7ZMN@iJo=6v2GyL zo;~Df{e7CCta*U4B1pD0lfi=EwI3CTf2}#(`mwSD-u-%XLU(&V?BTG?P-Fx}R5*E5 zcvSdpxqh`s3e`yRJ6%Efp|NYd2}SjJ)h@$9391YRLSU!qq4E=W9yx#}_KqRcG)(~r z!+&i&OckDJQ2El}fI8mdeCHPcJ2=byp-dT&ZFDzLuqc{lvh)^vKB2 zL}g}~j~QUN0Fo{!0BTTKwrDjx#j6KVb>MsCz=!G& z0?uz!q)+3>Q|KAM0zy>+^zjMt4}XE)t2HIfc*Tmi?$;KdI7B#Aw9_O-Zg>98L}4}% zna0Es9syWr5+f5RGVqawtNUt}*r|Zy#6ay+mEGaSGMmMOW%88u6mXzDD_wlGT6!zy zpLOrO442P{0J&IYJjqwrVrEF87ZDTT<9iz5xv)C#pUTTj+d73+z7GI`Ehx*q&zxS(F>^b?4*udLeSbU~XBKKi_PI+| z`R!s3tpv7gX^R3~Cce0vX(P9@UCS)XwG6mNX_eM`6X(`UW>OMp*nTlrcUU?`gCzDr zKR0P?yj9z#ME0=e!>GupM|%&t{Qcx)sN)wVzW*5E>yxt5g6NEc!GR+F(!Nysd6n&^ zN?K|Q@t>y$%H^ z1}}eMB%-GY`CK5%Pj}AkUNRem1zBUE6y}0KA;6;dZu&VyB`KCwPfdQ5Xri>Osl*$@qxi zNUlL!r3OOxC4C`xXPqL4Ec)b`ajpfaw12E4xMZ6=Yyb-WN0LL2RUzLj zAKS$6X%>ekm|3yQ$#-`3N8ah|B+0f4bxDc4nfJcHZ{dlBeXYRL5bY2afSAF|vcc%G!HPxGS8==1)_U|T zNvWWGt}f~OGmCtqW8>q3f@5Go0Rce)p>g@dgop$3UUF3))$Wn6gRX7M3GQ}?tC)i6 z5#2fg?U#)GsvTF-;w zY-Nw9hPGMC9F9(W5F-PUEmiuS(F06nlcE{I)}b=%A7_~A6cEH$BClS~DB|X6Z*IT2 zIpOX|#S?qiLR2Osk#^=DtNG&ym+&FR*Kv8P<@ep!ZLZtJSjcEO2t@V!3dE-*!yhNO z<`xWq;JT2z{)iLD9MQ;&^p<*B%Gv z9;zH_>TGtlGO@9MT_xDkFS4=QaZA)){{?|_B)8Hw-q)H3IPzKPiHM2|2?0GNX^+EI zRf5>q`4yE?GgaPuK8|(quyuVfv-aF(wlXs_w}4}Na=7tnIA2P*pcwxEhcBp%Q-6rI3Rc0j@jnbz>h=|(@M6C7U>fx%lJG+#q2Q4af?@H7>c`6Fw&JpwfW1WFvJ!J#H z%4DH$Nww@r6h6K-1K$M;1QOi8g)GMGRywKGssy2=E7s%k;ESt|W)#O-pRtb)vf8-D zxR2gI3De!E>)xMZTl>m(C!Tx|_c}u7mC!FmY~hT4&*t)mO76L0VQ$Zm)=+l7>+9FH zfQZjFC%h{enbPhuNz~lx(beZsjm#JG@8B$iw_cTSX-?0fRc}lkFJafCcF=wqJsUd8 zMn~$&N!wK2xp3mXuom2=TlzBdg~W^u`*x0IxUuITUpwpCCpIqO47DsRfB}i?8mn+k zO?VOK*oa)bFN6F7oN04eyGiZR6q#;01`nk`g-ro<5USFo8#dEMz{N z)FLtwpl>inBl;{0syyqD<@D`l$#Jfl)EJHXIv_2TJFdCbB1tJq2^~2}iq9XvxA^o{ zn0YLREmF;vJ(gM2^u>gGlpZOM>hd=@e@%v3L4CC$gdajz11>;t>9B37u4gN+c2EaN z7N{PzCO`Ov_B8QVS#5&Tgk_TYRF@xdXvUjab#=&lP?prpL~g4|3*W;OC@JF8+0RZoP6YS5=9t%X5j<@=9s zJZx5j1kEdx-027b#7vEm4TRT9soiaOv=y$Y#MT=^nhP%|fDdU^7Ez#Ft2I{)2fQ7` zW7SkW?%wkBWnL)w_~|{}hkUWMk@uEt@uS1%?(3-dK@CnX)?b$25^pIgnsh^HS!eiB z?gK|C)llrf;ga;b^r9EOF`p3yYRe*y*MIBz1Bd-qR8TlBdJn2ur@`?phF`DfaY8;D zCwmvCvRQoWVlI$tetKk}o?MNTX9H3!Y@C`PXWV>S%$VZ{%|p4jHr#UH_Ryyow;{{;KtygLxrG7(#ca)wTYK z-Y0sN6h;=V$f!GPone8y(zPnL+1N>PyLSs(y=`1y*FQ1lR8e`3s=cW#m$+c=3)Tb3 zN7!8_R~a%Ek8tTvTN6~|O}BoxmiKrt8Mkh0)vSD{hV=%yVvnL*%!|m2!23pSnTfsT zwQ-^GnI8{pLlWXKtGU!5h-Pk2LFIGB{oj=);~!Nlji{=PmP~Mqtb8I%bKzXfV~y`v zhZpp~H7qb%5D%?Sa5$&Vmvl)54qk6v;W{B~UlL4_ z81zf;L5bb3SJPuc^~%Ua_>tB)$VLK>FZvy&b%*eB+g)qdbU(k_R*eJS(gX< zJxL0apH$ji6sKDr)n`3{aNlN^Qwkhtd8DRdnV96&?L&8b5Co{7; zvmmb;3CdwVs8W1GMY~|zn1^&RO1t0hBt(ULtGJTf^IAMxRpD7HU;6{ij?XXdjHv`a zw9!c(a5cYpR_vk~eKYL+k6gM+5023LHvMEY_p}y=4k&Q!!C<*zC^2Ia3C3Ji zL1sbM+*p_j602gKXP|mF$s?~%_vnUv zj52~Vd_MWnLq+!(*+*-Lw~%K)_w>^_onjFhcBsl-1z4eAVzf$ZoD9yB+;Sysedi;%NXg8B1{e-#F_eG|zvUc4YC2OlIpARjmdsP@u05 zr*U3jsq00uHQh{r5KWSeeT?KjD!)FjzCJInzFM??L^jL9NcW`?Lr-^4X;Bzlu&Q?y z02M)ULBT=3$s#1Y9wAzg8-+0n||g$cI`eH$?LAzF9rpS6h3c^3UB*o~o`&^2bx~YDhrzULrno%G+^r zq3*RFmK+#R^m@8?svWLq){v0z;Az zxet5`c$dkiO>9f|6fbU>MAIx-Kjc(r4SckyK$1&9Ug3)mVCA8Y1>GV0bcjayWKU?1 z;d6`Ui1G&YLMmdtb&4SB(ffffFqD_1Okq%F3-y=7Xr$+V_G^RS{QgC zXKOBBq9L5K2Qnz3y##l~^f-q^dVo0JTO6ysmtjFF?tQ4=Mh9FhB)1vUcK2(Quo8ja4+LSJ)Y<8ba zuA}O{%Nltg%FD9=r+$Zri;I)XEgq8j;?A9Ap0;b5j5DIM+@eRt2of>UaXBan>ZY7* zVXIJgT25e+vU`n3vm9;wD-XX>S5Izts;k7?q0ifUbXFZ ztu890yFSO?daUUr!gp4FD4cm`X`a_ImZ)oY+O^`2sgS=Z-sfHvxbI807yFk_pf??D z)@elHpxFmUW>0G7ey-bx)DpdGO}*NS(z-#}PYqNxLg1@YN}fvhUtBLqKc+GUT;OW% zO_B<`R#rcqET`udx*1pLFro0I)_p#G&G^C(J)_;ph87-;WP@^*-yrWnJiD`bUJP4q znYR1%sd_A6GDQ|qpc%2A)KEGs;Y;857S{2jmRaCehP?GUgH%@%HTz-B?uYLBrVgP} zH@h;%V${F6+&AJkBG1T_xqmSr-oU0c++uF-EFD zir8XIv!Ke#t=O)W|8PyRa?ZUc=)2$4uI5;dauysN?Iuy7nk&-rwtj_ zbqWwtQli>QcMkpbLD<<#ef^2AtKAu7XV^+t%ng>C+4%Wb9$F58#E^h`#n9f!Ps zj#E`k*Ev&FK`3R|?l*-YBQmL)w`1e~thLbiWK69X#vg3g_b_#aGcF(hyvqEk72SD; zu~^e}9oE2m94b1C2NhicobMMlg}U1!FA|mJle8de9Xe&=-H(MvA(68kA0+z|@_;-# z&(b*W+h^U$FizY_L_j1L?db`Rywq|kJ8nKA;QjfTaq4P?Nw-t8PTt*s02E}f>sbOX zogFNsq@})oI`S|>iHp=g?5*Ri>{ zfB@dk5v}dqihux<=+%{)tOw&-*p;K#;k0?3?5LDv#-^~Bshk-i29xz)oSMVH0{UfE_@k=$Td6mLADmA5HCS>H;8Elg7$zuRGQ_PzI@ zO7f{m&I)ngat~(Q!A^05yQ_P6@m+rB1*YFo4Y=~o+^59v4+%;&=jKhGbUydp4sH`1 zy;I`gK$wj(W`yp3Yj2)F9^2eqVW8uZJUv^BWHR7|G0X^Vuta6p*nh6WK_UPW?g|4H zCB73}#_XrDiYLG?L;{a;A`xflU$&e61X|e>FFS;FXT~~Nej^;8D;T+(JOGZ)-YCl! zDic2c`~DhIAgQ(OXEkNRICxKJ<<&$(86$}P>l1x?yCEt=imFk`Pe$TW&4$L37fnx4(%*=smL>0uH114m_}1+sdfuU!A0Zqzr@~p)h_Rae)3fnObHlP6C?me#TrO zCzi%;E6iC);zLiV*o22GEXIF{NL2tM-wS{K&aCtKGNF+iOQ+JaXYw|H4%FRB?7R&T z1KbAY2p!11zb8icU0Q6TPkZCL#ztpG;uZYw`xg!FyJfa%ZgI;OhQyI`fsLCle_S+t z4uqjjj%#Gy0#Ipt92R{W{euP*jXIOxh~qaUFM9L1FgE=XM~3_=Bba|6C*-;_c4HdFiehcxh0 z3i5W02=DV{(OsRR{NTp{O}%1D0O?=QOrHWG;?)^(Uyagt?*2oVuw0Pnoh8{=0EzL^H|PjFP(dF&|L7WETT0GcVgY_ zx1oq}^k1#{aimB=*)HzvnsDIHm*|-4-oMfmwO_ThrZR-9o)Q(i2K8OOn)fj<5|I>i zrMN-NYx$b70)BeTtJLb1l@(5>DzdL{44E$Db`c|6v{j8rk`njaT(d`!Q+zvdV+~uc zwOi(`abOznKOr4><!y3?&Pn`#_&3l#Gef?)=p3_f^Ui;vfzaAOR#H0C- zC_m1^677NRcZrEQlhb%^AG}2eIicl$V9+BoV;Y&B{w1=n5~3`>l3tCJ_iei91O5sJ zlfRNrKdWsWxAWWhrxQmbuci*ftO7n7Oc}WO%lj>uVaUiDKPF^(#js~|dl-WEB(b%;R&%wBZo4s*Feg>11~T!zk!KqRO#H>GQupBCvQnt=r+5tC~|_jcwZextGmQ=bxnE*pJAI!;`6FR9y=}o5@Ho683hnm=2#mq1!K9 z;~t#M?%xqQa&ju$A*O`A5Y;)3bM=^-yRtSfb`+m*&?NHD1^&k_^1V`zUUp zBQjO}+aSl}wx4UqTg2FEd)wQlHv^*CRVd!3FhGRo(ku4))jpO12ugP&rZjKiwWfRW zYw>!=HK|cBWxk2w*r^o8&xo`u5~q#7C$1%JvzI7GnjkBxN}y~)MsK5FzthqT)I+i9 zLQUJe#tLyOp$}IIr$A@HkBqga9H3%Ak12)kQ{#!2%+*+9#70XhbyV%2UkvY~D0|mM zOicCza3cpNf8-DDqMQ{MkW2mhk21pBOx#yO@k>+nz1ZeIc+LzQXaBES&Mc^@EREx+ zqiBmVE)B9tyJ8C(1%!qWVxu&JY>L`J5QAF>)IcL^2uZMMRMdci4TdEsixgYJCJ-=e z(Lp2&ix5o$VGm(RSON)Tn;Yzh>4%xBd6>6bx9&ano^!tXf8ROv|DAg`e-7-iRZ8cm z=ml-2W49d)ss}v#)i{V&<{UK+J~DWlkr^ixT(|EP4_lGEv+7l6mX7 z`rnoA>yKLGlLdp#ymRS3uTeX~bc`pDe>eR8u{uRKGM^xch?2hX5Bxxz6(kXw^chB# z#7h9KbJ}H`x6PI{mOk`b>sfNpaaH^>y|DfmqK}?)K;U6OD{UDN0WtzaUnVZ#(spqZ zVUr8UHtKKJjt*vN1d8xgpq!jad2C3(uDSb@6AQqAzw;SdN2f_9m=Y%6(PT^t2e zg=!ibR|V#v11NDo)>*m?5o>hTQnM~G5obZpgu!tGj(YQzF70x0uAV}pwc8nXX9bNO zbd)kXD!8@U4%A|o<87&s*`|`dnky@hr;;ZAo2~Bu2g7qn%3zfDbCVL7wu5 zo6Tn~<`BAK((ct9AG1D;F6BcA^^r>vEU%LrOxsOA%-~5M z#X&|sFPm7+R$g01eYw6pxAtP}a&bw{TPi%16;?Qf0?g2_F$#<3}XnXEmOcm0X z!{Mfdfq*I2fU-a1TZs929@5Rg{4M{z@?9Cko|M^ReIRLnw|jnGRaL}G1ibFOa|A7s z+co|6Dsuoxs)B@lW!!Fy@jnb5RF(!^gPXPin?1IG|04fYi3yRqp(DWls)4f1ZERc>4-}4==@QsXQg#VCX`Pjnxeb({{Mj4zJ&j-1gzqTJ&ZexJiN=qXShYkaMiouM$* zihdgSA>BBh>UG8sz{fP)%#B>6)ZZ=Zve3ylD#}%J_s_FUjp|p?zS5nme$D^s9D%?1 zd2a%1f&hF>jr5)w_Qg&=>>L|+n_ZGJ{}HuB-aWy6I|{a6W`Hnb;cfm6{HJ~AA5ZV+ zO^P4X_D8eT5KMzCi0L0n3XE^`Xqp2~J~>=whP^9u!!3KaNy^5JOLz)Qwu7R8tf2ks zjisRN+T82EvVNsTX1X}xJ+r&E1Ana8Qpn2QD&fVB#c4QXwtxn8H8-fA^k_PfU1K3X z>IqazcZf<=_}R)j8P@aQ7;I*x%o;+#m133p4|1XdRsx)DWgq8qRCq~o16CxrvV~U` z$2#Ub_snsmq87&UH8fBu1S$k8W-@S#nO1mvLoQ#oa#qzo1j5WsbiT7n#x9E6xctup zJJ%*Op$=MhR$JZqbv_dwGf|=jmqw4H=Qe2mw@dI%LXLx+E_G`7=_yvYv(qNF3xrZR3f^9WzweTrZ7WqEQ>&+*-xiy?FBw3-ZWJN4Th}bQmbtp<+ZqlYjQPJ zzNJfa4MuhJC8X&CS?MdFHTA9?=isQw$nkr*(2+Po!G*E?U$K}~)F4_CUzSe8@O3kZ^Er5IyP;Rw( z35J!UL`-m9!A;qPy7nr*dZ@-uSCrN8P)B_V9{n(?zi#F`+gKxs#*j zIH*Icy{ipTSyFy2@?sB~?5qc-cE2IAHt=n!gOV&jwpC}hxH_Kx% ztE2W0xmBmGr@cJg0cyO-?r1X(kr9xzu3+5V>1YzBtuK6Ra+RToix@7>2?<#qlBORE zbPI%~d_ybB0wTJa@)1vVt^ENOxF^N8TUJ5l82Ua|j9w5GM!ns$6;8y2MsryfV`-qN zEznw|%v2>{C)I{qY-dkz`?}Fkw&fQ zBN#PretyOeaJs1{;WawCpt=$SI;XBPp7InnGa1cDG>a+B>Gj%*6DIE9rWl)H8{q`X zVd*sdD=SM1z|Vy6zDVL-OqDUa_)7$Y%8SwTNc$fK$`(EpOnd?|qD%^KF$$pzZLs>; zv5g|58uwUn(Y{xXl&jn#G4$KyOX%KD$tr1&*MWVUnx;mKg3#9O_l|8-Q|n3o{>>eu z!`5^oYumbF>)9rC1!*L0!jnc)RWy#I)ou2c_^7-jK29i+|GW6{gJ3&?o*?PGQU4@` z$7-B=gU6FGBh1l6I?5Y{G*rvYh!1zuM?w70^DH5@`^PXicUM2_WGwV*Cy$rqr&KUs z;}joZDc2XLy+|3^isfRqI4kTS5mliCSf3Z_X+6tS(ggtRztKx~?*aru3zmUEkLmby!sE-ZloZO_Y`t>6Y$Ly1P@lk?ycSK)R&6OFD*7$sq=57)m6D?#^$`jN9!w z$Ftw}yzlq@^{wmjQf8PnYd!0E?%(f@$3O)+@w>P1Z=s-|+?A9NQ9?mM?L$Gi>i)-7 z;FZH#{oBA_R~(hZpP`gM2$z8$uA4oTeTsro7IypWIV$k;%@-1yjwmP?PVhfhrcFuQ zP*C1rN{T#HanoBrM|UIK_dfItqc6S?i^K#wb=ab?`wf!gEn-xkev5WY+aryTcai40c^)|>K>E+ec<8oTH!6Jvz?Pot=)BPAz*Z5>N7QUnkVti;^*btsSu9JUB@m~FS*n@cgXc6=9G3|4JYC@2aKBbRSEYonlO za7Xp=p9IuQxwVwM&PZnCJ#%x~OjH`hZAy4prD3VfDMm6~t%mQtl1`0vY z*HSSM%jBKyrWm|{+j6?LEI}Y3GvqKEDtH)kdJrmQRpWguolR0j=(SSeI_c4Jel05F zE(*$y81yR2r!Hccg3dmurS^Q(HErm&J9Lcb19agHm=hjsYU3Xc8JP81a5~KKILPL7JFyC z^*y&LQk#x%OoY^&&%X9NV8Xxp!e{Yo1&Fv(yp%lKzl_l9%%8x6n5Y`}aGHU!@%d=C z%jwtMQ?X)wPTTQXsI6($fxrBiWKUnp@$!V6r|EpIV72dz`))g5bBFxBNjs7q0h_?| z+eB8$4^{il7xeGQr?`&Hv+-V>O$Tf^Z*KOwdfAV%mO|c1H&BWl2sj+taB>rPpM2Ks zBTjfYnw03!%t6XgR&N&9DCQ*5^#-(%(Jz$S5s>P!v_TB(teM{aHrGek#kJFI=zD-| zcF#h8!oH(eZMS`5FU^Vlw!V6P zQzEMlGS7gS9xjcGDfav+vr-4~BAJaDGUC(`T{j2v{X^#xw?pNF?_27&6{QB-d@81T z-jvQ!gz*74P}1rns(}HmjXUJydQr5B-n6IgyBo%&<#RShWtQss{dV*2*RaN!muBb} zZBwb|QQl@PVS=EU>8^+Z)QZ_ATzx_hx8TNFo3PrwHnftOgs4nG#~VdD!^6)nyJlbO z60GZ^q1Vss__}XBJROZK>0Z}AUiyRIlw@c7XzjF`2{syyG6|e@>Q88&&ncr@ zyL*nFhnc(7S6a{Y@q4H*1@~P-uU$@Y??fFAT^^bIgMnpt^lYt6P)Fa+jKb4p zZ?a(y9I-9h^0XbT>Ehd`CI8bVkHh_97f{nGrvBL(!@$zC_yMt0=!XydN3CR@_mZc# zzSR&{_SqO)=z+GUr^3#2Z|8}7`RJTNUqcfKh?g2YU$bK6U3AHNE#Iz@u-ounY9?{0 z-hv)})tBIH+I?|E1_`mA!fP^WBqy3Y4a;XR(;wR(FXiVP^nw}5Q*d-Ej6L8FeIGK` z%;B=&-IU%>;#5Q2qwWxVl-YB)%VX;np!}q(Hrr5%~#e840K*K^J zXcHTx3)+WF6rWzaCOLOne!#;jc)rSiKz3TfJ8HH{jDli7`g34i??`x8>?ZHGakeMr ztT#S{d9E&*&kEl+Jr9sDc9uJ{rKTST%iDCs3SLZK9zkHq@v^LBWkl&IM4ozkJwiOb zFJ@BFr3c!#LQ)h73OTLoo<_E(o`IQKgW`QBL8B`n1TD=mdM|4BpF!RqRe0{f z!}sj9;oIzeC<8$;nc#j@&rR`xcC?El2&4SX+3Fm*)tPOw4vf0Cqe0)YKCS5&Gt~@r zw0Ch`M8b9}Ac`y5Jh^pQ;}Om0p;gUQhyK-E=%sI<`?H{G4fJCE8Bg0~Yw`eyyzlZ$ z0{*b26E)cV%nm-^VM5cm%T8daTZY4zIv?Z-=4^S0c1e}bT|tl0Q2xF!2)*JqxoqPu zzwg1BW^PPsEACOnTf)3YM2VZz=W7+7O@!6*ZcbkFflHf{n<}Jb=R0k%wKvp8K{95! z$pt;c_|DCr`-q29D}0Jo1$0`sIRo}!YjT$oixKNbi+kz)J?`?l;~g>YNifUW=0DG- zYBrDfcnL$m0;t6Onbp&hY^G8DV;IwC;Q3l8RRB%qZ4@Cjcp0VdUOW2yl8X4`m3NTNM5AZhNpzK~ z&uW>?=+MOHR+1U}-QJq1&EjV(W>ck82ABBmrymA;NF&-Rd0H%aM(Q(##X91M6JK1h zncX~}GIHf%?%Gl(hQdac_|HqCK*lo7_1hODTyeKpJCZ``dDdph+Zf*EjY@iNgKfUEl!h{(dmX0U zNbz!;kR{sBr3x_OwFRwzHcMjq+Qd^|;_NSb_QkcJeIirtLHIsFi9?W?mw5}-ntn@w zp8ke;z?rkP`_|2xrp?dKrxG{l6MPoj=vB_NSmHOjeCA(FV=LXNeov;i7%CAVc28G9 z@mmb6hyFD8B|rL1Rd%Mk%g!+s02W^9s-9O+^623Mj%Ds*tiBicI(O9ew4&MLXpmsU z^r71~MeXK;ldWsM2Wu6V=byFJqzATP#3zt}Dvptv`red+?eANkC&_Tz^}X6lIz4QT z=4|gqkA#pk4_}<`Z8htj)rv+ko*pr928n7rCSsBi*6(HW;cM+m29P2} z!v`B^9BA)Z01N_^hi#`)S9UH|+jgs0bD&Dk5vERZb3*!ZH>T|x0ZVYP*VcijfX(_@ zUGo`;5LO${U%N>I@>!{7n%wXrt*M;e83%!iq%TYl2Q6T%O|_HmG6MnCTs1}_o}a12 zmX_+frrnPAIVWAZxGn5czTuRDpLn{lWgd>$xrCl&94NcW4WeSC4<8m=z>K0w~a56+P1wDksK7nRmdn4Ee zq=bJC5eDh$Rl;@wG!s7z9W8A>EKEHl7uX-2KHbtCX+rmz6ZCCyq+AJ}JL=rJ9XaG> zc0_4LFR^}Nqu(@GPlJ{U<%~RiBSj!!U+O(`X~9)oy?SiFzO8#ni7%Pq)>~AwwRPmE ze_7!j-)1dPzAo*;;{0NBCUkzAQ$uN$Dg)j2qs!sZXqAq8_glj4a-dQO+U3WY9(o@K zpZe4dRjqQ`o(k4zxSoPv&Q{9ykqo5Z$7Yp)1U;p{WA(VZs*`H@nl$cjcABq(>)V z4s?5N_!w`pHsiSp$B%E%>iSm8TTbt6;YQAcua^$WT|6m2^lZuSvvmlU-t|Yju5Ca5Cb>mVJixq34`PMiwUGtt}AZ4}nLGr6Kod{&6Y zL23K+JOusXTZFb&$KkZ^W+s%0(kz*mg_oJfTo7q5DSX1X@*xE5(7!Q*j*vk2PPuCYwgK zvyhqQUV+>`k?(d+J}#z)d*3Qfo3=a9DO}4r_BxH4XV_0)Gl?0IWpq%Yub)OOVcJzs z@5FQn_}c7jruw>Kr>!mumWzMqYjm9{gbh+4*yAQFA z`s72sHv3!!_uuPgnCw$EZFA~3wt-&mR~@(I9$pBYf-i)lQkcnfn=dui!fKp`f=qMf zGFt>Mv~3KG=W#P_DMC)VM_j%4>g6vMd$p@|Mu$n8G62@#JE88MO+eyvu>Dd0q4p}r z*_wDCKkHd0uK2x1i}li`xrDIGkxl>2S{v!n?{=e@WS*C+Df7D1Zgah99)mCAHRME+#PX!(3lN1tyq=wT z4A#BN&r~(!hl?8D-(8q?pbPBoHJJs7`@|k~muzS?`<%BY3SNMFYl-# zSpNE*;$dCwjgys>^i6)kf_KLvz&kOo>VZ$g4^g2h;ERF7FZdOpHo%Xx4-x>mh95zJ z|G&Qk*S3oEGcz-Fb#*srb?`S+5oBUZl{ ztFc@4{$KCIbmON+V<1@XIkP&EV_d%Z0;RhHk5Kd@szVHg4sn+t6ke?YtZ=e*eNt@7uFX{LH`VP z^yuQ?DeNfC5hYr{6eFhO_!#y4>pYskSNdV*DC%HvK6rS&(8|h66ttI=%Cy&vI|72Om90UCr7>1mT5s8(#7L*CZeotBrN>eyyZ1y+y3kbcz4m? z-vfEW9v<~|b#Ecyu9c+N*w~Yk;0f+g-I}NLF)?J~p&BI4_yh!^1j|KeVf%`?#l^Cf zv(LTd?p?oHTwI)S7k&r8o%W^hPxSYbLb=HYu?J!Y7IGNu8gRMHF{b0PPqda(o9krR zfCnMf6Qi!TJs-u~PfeG_a3P`Xb)Ooz&ok_V>L=2FGr426Yed6D4eK>rI!RThXoL4Z zf2^+%$BEOJta5P6g<@7tw5Ju^!y9>3s}{sORA`w4DiS%(2m&pAJtZrv1$}_V7~jip zOlV{Z8)9#aa}htS_B@PZG!k5PB|W?gp&jRqcTImZWJBXR1eZCp-`6w51l2PLP|JP? zM$46ErF!W+LZau+=Gv}Q_oJR`^%63KCl{3lVv+O3mipCrU+{*qhztYzH!4Ls@KlV9 zp08Tsu#;Of1_r<4-;nw|U0ANUrWLkt`PuyYD>oUUo_8iJG~f_f*>(A;6&+44G*3=T zbFcz(rmCcU8N}ho36_>(W3DtVOQVP$Bs#|Z* zzeLHps63DlHS0g@i0LH|%|vN`Za4Nohl=1@0dJZp$=57}*hGUn2NtW5n!(AZ*Vktm zgb#drNEu4r#HCy(|6t@_DQD^g*UbT-8!9iDXT%o1zFtNZxGX%fxzTzQd37vPC2Qk_ zLtZd{996+m**lZV_Ps!9M#nrmp<4kB0ZJL(mKp;pt304=i3{bIYumgICnbo}q3k%= zLnN_OI8Z6hEj$$h`9sW&(#zf|)4A$uDQX)jgtU_L@|SfKiabuqpk*}sBu(z^6IGS& zVGu<$C;=?*AyPZ`c)55`TYzyxjnXG3D*#(2~YjfQBB=%Uc-N3od4ttKbpexVfi(dnjDP% zP)qx|aoO*D;_YcU(mOdDB9Dz$&}67?NX@m<*)uSEN{rrkFB&Lw@4G-`4dPsWuNcfI zBg&^zY{;aN#>#Us4ou&w3Nr6q^XFxvA=R`H4b%#FA1tlnsitVzCpKBH6?-hTqo#US zQmfRH!n0Ebx<;b*87&`E?4wSGru(E;y7_a1h~btRvq^RYgfcZD<`*=R~q$@dq?Wh%Bt%nbs1AI*a|w7 zm4RUOm;mts1-ZOP?fOaDIt19VbY`!y%b%Z7U9MYY0PibYEos;ZqDp-qD5jY%RU%k0 zf0A~;2pBOERR`qNsA0f|6F7vJ;leEZz{33b5<`tt32|_%Q`uU$a6!E)&g$#u&Sqis zjAgY}3tMtkROU4yPgRMY6rtJ|V;SYC56ie}1|EoFyY{CaiW}OyGFQ=o36(tAJ@tw6 ztvs04Ll0~YH<)zWeFiq4Z4e~I?>kj@U+>ZbVPZ^wLel_o!6A8pQE#O`*m*xGm2yt|-dK zogz9zqRwH56>=3Xpz*o*i)8CNc^iH>-a=8&G;LookL4Cin=-g;U{(gya0yHQBN*#V z-+9Djl$3?2p?)jnMYMI&ZTFvgu1Ol6gztlRnVYgu4ydv7d6NiN4Eq)WX+7u-$D5hG zzejcxt`LNOA>B-m&f|^isE63nL>{UhSZ^hY8QNd z%9wY=@rL0}Gm4O^7DVQ;35b6}ESjs#M4n=;_g0~g;S$;%PlI=3#T5TN(1vIx?RG|& ze?9D=$d!>9Kz$#HT;vNmrq7>$K4ItKfesHZloYtZd!?*Cneqz4G95ori}yN13AMYs zw@=c+oYS`n+4=%iskM8R1uwzArwQi34YnZPTKkws->Nji~nkb z-JKxW#*N=)Wo1kCrt}!YlB73}wlQU8L+;+ai|AZCw&yw$6A}pUS40VjfesufM~jO% zJXCarj#^q;E2~VlFdf&a8)YhLd6BDOKe4HUJCHUYvD(XAw|k|Uvh3E)k+~7JUI;{P zbwQ};*;OQkIPt1B?M0N7QYl{P~Z32{(ltt)fva$`&O@I;js25et z^u|d}?fNZ&B|_gU27y1YynqVGMFqIb!0}1ymy(7o9!I`}yT|?LvRaAB@yV_=Xo%l4 zc?lGXp&^M;o&Jqo$9=ST3k1{%9j8m#E;|&?kFc>5r;=f58-FfQ9GaYLD5&n?feBtL zqZQx9J?999Xtt42MeV`4%QxS zvSxn6oF~cKdM|UzA~2LWuf6@t$S}R7#DE7TE~@8b%&SIqlZvq_;??0-{jI3mA9y}I z=r&f0BuGqvrgGJCXGuOdyt*1G`gG9nz;-B{QxrMhhcmV+MZ?;@M`Fm{VbG+f?v6~q zn|1Z3w}^WEF8(a3T?nOX;hQhz#`u9l?S!oJvOxp}ol}Vpn3zN12FD^2R@LN#~aAA#Z%DCzEEK4h?B5E47AWNEtgHd_*&qz=gnKjQADb(QFEGm z=k_MMV*S*9_G1JV*GIwaek=EA`_b5Fq8BLfUVB69jYkY&0#7~Ny2Beu93_J3W-B$N zeR`OMwW!P{pnPjYKU$V>TTNAmijMm<|E2)R3pki=YaH0gq}I-}1f1N+deP}gO##jI zr;x2Gsn8DMs(8O+7&a3z=t_b2I)M>89E!MRKTF4dtw7I%e^Y_L8MHScesK~fXOvdL z`=2Ozb0TD9L-K^B?@HSb5*`W#=Sp!`IlRVIIznnIDh(#t4B%IkuaXtBaMNNuZPnMb z>gxG@b3a8e0FAuo#Ut0rE=Zo?x_hqjEly%-I#sJMF)*P+#$m_aMjrpI_IxdZd-zaW zGc`q9xfmU*O%H4Pguzr9TjZp60LB_Y5@O>;=?#C+5|j%@{;B>rwE^`fWpT_*B#5rR za!?D|4jL=|Re#)ZjA4XA0c+?@7 zrL9%1YoxjaPml%ZLv8RuCq9{T0U2^&Cu3QoB*ty~svl6uS&zTQ^{lWSmUmzUI0I`G zH4RXH$_lev+b9b73#qHj$ZT~Py1gje3k&?oi$@zH`Hd-UTq2oFK&+{qbykpzK|3{Q zB@Ob#(f>ppxZ7+8%_td4ch)l=2>hNm9J8jV&3Mf@_XB6hV@W+xIl8U?E~wpsh}$8n zv9YnNOtCV;7EmmztE&-O1T#B3_8-@^w6zfs-W)|GpTh51otY_I=_rvyH~gVG`u0F< z5TcwEJhbSh5Q2VxE%X^!-=$wG7rrN50kSc`k*4*V2KYBG*~?`NETlx4Ygux6eYqg` zZ1q&@Lt=9A?dxj8(VB*NzL$mj&g>cX{XG!KjjJyc5`ulwSSp|J@`?jgA~CVBShvbj zwHQeqI61YowaxZJ5kEa|d_Fwf&pobc2|I(9Is;!59O8&^{H>A~UK5h8)H~E#bO(%7 z71>&06own{+sY2Et*uq+-D{;K2P(=U3|8D{W;Ie&CeR$DD&e}f)DI{*i;Jd6fydDB z%gKw8zgWun$ukL#+w$k;=Hx&pCRSJS z7UIDkZ9wVOYpidSA>oeuv^__akbqBsk1v9##B&{Cob2qJY(v2ud_Vyj931TJWdLfV z8mzLia%fcD09lwTb%t!V#iwvcqA9n5(vvA=yYON#_RlsZ534sy@DzM`j+{*Rz-0R1 zh@or!v&7~_A{)eyk$}!zc1e*j9Dh(HxYmnS2 zQ?TOqoZ+2SHlA=}foXlWR3%eEZScKDL5yHfaK5hOVmP#L{B%b`chJ+qwbBmc>buNx z5aoj#$vGD3UQxcaCugdTD8y0-6G)(9oV+V>Vq(T`rTEv1l(+=1Nbhl&{ZmF_ z%pZ4@l_tyRMfXl^JQIk1AraetCnEB?X9k#F@@By6NbZfeRO*SSr;(G6pvUn6js2L2 z^_XXkn#*wVj$e^_4L8NQJTu76fiJj8u*7?Eza&)LEAw_IN0vR2%Af*hI`-BQ|-sIu32GbNaWR!8W# z(^e18lCO$alRw7TJbpcCPsf`XR0T_xqnUK0FIFk$$ER@Y44ftz1ZBF6J;!ZUZFwp@ z(J1m+D_5$d%9X#Gt9MzRlGFW3fC!h!5R#C@(EP6}mRH|`b?R-&TlvSRtcdGQ%fJ$- z77Y{wt#4CZm_4n=d~o`o6fe-5t_%@MG$sGvHWgjoZV{Y1uvitC!9`TPX-tCpIJbYN{& zxKz6lvqs8lQ4!_EZDx-XA6ap^ml(rgL;Jc(kdfQOFf#U54)Wom=4)zbeDnzk4RvvL zt}CQXQC{QlHdUIAu^XhvpC!YsqTDz;d*x%k6LNSJt=G{In^tspzRzdJ*H;%VP!+W2 z3SeJ+!Oh4h(-99Pw6L?Yv$n>v$x2K~DJd?tv9iLnag&jiMZNlRWJC>t-JA2^D6_tl z^`)iz>x7ZZQtUYl3$H4(U%_jW---y-;b!>%f=Yd@j~%v=HN?g!>L|8INKQ_EDfE-U zTy#c|0Tm^`un@B_d}FCUlYxPux3?EboLXB&00%-D(@sMZC_hD`^MHm2@FpZ)DN>B0 zy*2O#ILvPW)}*Z`DP{MP+uZ{KUF%tE0P!Qnmil%U1D)yfryl#om;!>Ojprp}Sco^G z(E-hDa0FxNVqY$m#H3NzJGU&Q8A*;7-Z)~!Fdim}3@WwEVjj%=p?7=W%jBB1?xT+d z{%o|EfKjuaB;@TKqC%!dI<+=wU2O8B{yuk>OCIKQlH)+QFad+y&V_2*wkfE|b9Nh( zIsi!=7R}H_Z5O+^I7$Sv22GIho?vb+DH zJP6)BFnqZ)?mN;%hrh7QnpziCncZrC1I~ef=N9u9yERF!25LrxL^Gonyj(03v50h! zf6BQRZ>TD_7`|e=Dz)BfdMD`i@YBr|oxKkrXYyE=ImB6nu=Cc+7##W_O-*@^wcHgl zyh8zrqkyU-qNd>OTIX~KexxXJWvF19VwhyV5iVyloo5Y2`YfM!Xti09UN5ic1$l+Z3$%;>iTx!rb0 zULiG>g|rJ?byj@y33+{3zf&#nGG-MrT*_i!F-RHBhZoo~KrJ$1Fx)-ir~nwgo`;!Q z5#l#@-E`3!h0yS9#HP$_e=X8n7AOD zg^kMw-{3pMo77am+Wy6SH4i&4Ec+>N*E3`X)7JSQh2N(!li3Q8L7+hgnp615{MiP1 zHL#zx)Qz*UvlrqQ^*o>>=-xLOOMNQW@6ri!2U(>p{lEdJYE2fz89qVi=EyTW+zU zR>$w{Baxi7K>9eBVOu2xOPZchP5(Y%8FtSqTu}~p_zH-&_uevjA=h7;PW12BY}Z1$ z3l1wF?C*aG=tNwKU-@U53^uu#$-KwQWqZm**gXO*5mDp!s}S!hm`G^jC}${&26Y&A z_W>GtDdpRtXAuAEh<9nPTS#+Au|aKc?KJhK;k?*@>r38`E5!g7H=s_gf1!Je#&~j3 zOCF!FqT*+-^NAWr$pMFg?LXM~1wm%;ewq~j9)%^Y70p-%n;4^|>?G0#pRMzcn~ujW zgn#Z)O`Pjx?%}kjJez`mz-~P6W*y8iqwE>rd|!PjWMx%oPB!(A-t-S85)L|kufnUN zX#lTU-5mP2`&=??rI#I6tCMcAHTtXptNIP9#dBMiYR3B-s=|gJ0wLS8E^=v2O=1NP z3d3z(Y^z7g3)Cv%Yvm(PE@Xv(hl&6h7+6lKS1oko?0W^--mdWW6H)WHtH zqena(0y+4QqT_Fuhe=z5r={)Lm_;gy(N1O6c-`*q#sT~Rprp}TXfE>^1em^ z@ZuQlS6JF)dAM=;7+>@Ycc9k`C=mi=fXog2_$^WE;;~`&_aKY#(XAu|Xwm?$@w?cH zm$F1GZ3Rg^q{CAqG0?zXJQ-a)X?EYk{`1B2-dbgwZ|ro1btIzv72A5W9xd!w8ZM zfhDYjv{3U57gDQR|Ea2K<~(``s9Q9%^9nyc?F9UmQ?L?UiFu7iBVR^?jZDx%KL67) z7BHU5@JoZrG$|wlNb7nMMg2>m#c34GARf!YKrU1i{VaxHn*O}UZAR0W=nr38(wB(1 z9z1#d2jUWs$ZWu3@Fx5_!(%&UKzzGH^&0WmP&BUoS%X{e>AXL>LZ&&;mVVFSN6!+j z+xz9qt9>gcr^>>@Ze7*wB*PjD`@r&suA0Xok`clMS`CBPy?sne0hH){>kQiOs&4f*+X>FIii<^3Tg z#n#p~9Z?~(v$LC0AmEHIJh1vzj(6FQXOlz(xYptM9uhOZlAr6?`IlCEr28dcIP-LL zoSmITkcp2JX)3FC4AO#tvaFS=pO~14^dtfUZ?3jzDl13*(1|Fu_5WB-Dk_5fNgm*C z`OhSc{f(t^W=9XmC2W3~+p1!B*M$&itpNT@caWw=xSsdwo4!6PyXIAEczzW)gt$p< zG?{G}UT)}b?j0+ROprydSpH=&Pbk$-)-&W@l`SRVWl~f9h%f1Ywq1+;vUp+sl}Ug3 zer@=L6*88L-G$C)SZ5PNA?(>uDW4Sy55SRPauXINCgw z3`mG1^w{^1$_CZqYQ!y-QC!7s^u07KtHO_Ei$S)$ewJTkGKzjtNVH8{`|HW!_|kkP zGM;kBZ61iOfcYBcKOr?s1!ka+X6?9Rk(~5Sqv2M!+~4;Gu{09!42cvM_mIiWdJcom z^cPng;}I7u6i;_qnXMhIWiJY9TUmIpU}L0IDZhR*C`J-)7GBRhR(n-;yWs<=YA9eS6R?za z39lg~N7|b|+lL44!Q4Zf23!wi^!6@35dUJ5KDGfvxPvQn-9+Qa$$UOZ#5&pMy%sR@ z8vz_o@Q_MbaT~7`ag78RA%Z6-KI*9J zdk=3+U5c^=8UKe`GftW@f}3YNvZ-rD7S&s_+VIdQ{P@+*{Efr;^Q9kE($d;@CPI1F z5IYiQE$A!2z6&iS@8G68detTm4m4N}qdG%oYo_(s1s>zaEd2276sQm@1fUc3>FG@+ zp%5_8aoDd6<@@{J04O?7hxl7(h_0&*ru08l*k70f*yrzxrEusY4Frs56ICC;4QHC^LBg3uSO9cY?v)Fk{Rve4!L zIh|cfrhD932NcF)3`VmyM#wcjS$_T%A)Qm*fi4piK zNG%{dRY^vB&qq}ox7X-PXfGaT_BTq3h=O@zLPlyHW;iPKEFtw9g}ec2Z85`x%CuH% zAf+M{GB!YYy{_!t_@<6wH;-;7o`+UkeG539QTjzk_nVy*Zsbx4S8xD?=TQpfRe~PE zzzl0wx`MrYQdS(rfCk4`-^4gk1*g47muU8QIs zbl)W83cI?bw!0NMAzS5@zP71;k+-;YFc(o4^rd`yu`to0Yl%Z%892f4{75|UZgeM- z5q9d+jMxBjilqc(mGD_)mbHpQTt!vk`pVRCte>R9+7=~oH*5(x10G5-+mv-`51ZFy zbqtu@sdJKLO%89%wpLSO4I5ag0Q}R0e34y(;YhJS9&su=B#NQ}&R$!FwfZ`c7~J>+ z*C=l^KhH35S!yU{J<6cwRfbaDeegE1vQB(?TXq_e%VT&k5}EpsyeT}Odqv(#e}WNSLsXX|#4qM^5(OCX zv0;GRx4ym}5)zUT;sp3DRaI3sHZ~b|!+=b)(4((VC@maT&XW1uch<%$h=_r=(pqJ+(64TIjLi_UZ7fNiR_W; z>c*i^oPpsDQ99}sQO8zVF_p3r;=PjUJVH&c3 ztXlM}{=d>lkVy9ckz)RtX2_IcL_DD1Bsczw{lOr8pb13v^D7sEmPg8^B zu+-4tv2m-LI*y{CzP@3S%2lo5;T=xI+Dl7%fwUo){=}==4{E7Lha~3I@Lc`PV7F6lk0Dch*+& zLTjd`-XfCK71T6fA~P5v@ zwe}q)3=_{C|8D*ox=44fnHIz_`t7I(Sp-j)TCQfe%Z!yhoXf$Q%pzBcNqXOcDoVBZ zfwVX(j`Lb)cauBf8`Bb^^`I;m6}hMsrq|pbUbAeC-^kXGO!RcfD>FW6O^Vr6Pt_TL8bS*QSUbok1spKPn97(M zu`f@B3AS`5iDa>)>{qi0zbb3KCl1a-u z`W2{TSOklXmq1zlJ*FNo0<}+Bu?=G|CXauD>a#7X=oMW%Zydm|;bIMpEH~lg<}$N~ zIJ(K+@b=Y-l<94J8hRU#0@*Nj$^H`^eGf!YB@#WOiD%|*6!CvCV*YN4{NI2+9Ygpk zN;3?vR$(2$Awhbdm7+>PzrT=s?3)zTiIzJB*IeiB ze1%82N*XPlz0-g!_pAL{cG-%Gia`(VpRwo~fz)EnikyxsA zfiE#JTHH&z>;n%vj+nw=>s)sb6B8cTz^?fCsPSavW@_r_w9n}Hd*nVRKZj>XX=$o? zdU-dqs79Rn7f@8F$#$x9)|Nv}&=YjgE21}yIuB(p{Exzf_k;k z@|I*~`Sei{ovr|#!+zqSYAj%HWj*tCCQW4eSsW5ep2sepN89 zc8}AB`%lfQ>t%j^X0sQ<67;*}&_UEJ4pquW@K$8wp&|Jbn*XwjvQ=u@fIxMX0T3=Q zwgAG>8k3rv$Y^%RdudRn_r#PgB7eXW92q%j?*f^<(;uE?pfNQb#plPIS8(n7muwf~ zendM75555+qcUQ{i%>S8aiV5Ao~g=A;qWiY>Jd6ftV?&k*J}Tg-z_rq7?7zdg^Pk+ zs4(vfN~u_vXv};##Y{{TPQbEf`p5`25(ffo3M)7n1#I31$r=c3RmmQZ(SDyk{o$d~ zE zP~2h+p&5sT(E2>ry&!a>$>>*!(IN$rQTDZIeyxP8SZysRVW(Iab} zWu98km0)kVV2Txmyb1|rpl!vdTJ6TaW?3RtxicccWo~{gB^Z<$cqWVpfnW2W4emEW z(B;&;w(r1>5|^BgND2qcJs(%`AK?5+{+~Nfr3Gu&@nM(!4KL|W@AScWH;PI)@5WK1#JpZVwXm|XGO!w}s#Fnb+wUDa8fC;f$y3QckY`UL7=2`i?%yvE*DGCSWCqz=|Hr_5R5yxxG)E9x0Ig zF$Bn#KVz|_g@8-;r+=3Y_;*1F--_39QAW0x7J&!rC7|lSY!(qx4WyW@^3$aId#e3^ z&!qdEevXj!H->BEj?Nkm4nP0|LzI8P*~sZpjIC3PoD$^vSO}o4%kD0Y1i9Eu#5=MZ zV)IevQmWUK0=Wh3^;4=N?9$uGQ8B~ZK-ge^-$@SGRnr_FA5~RV$f&1zxLPvtD7Nc9 zGF!k!r3epuwK(2oYGkETOXtzS;mY>re+*v>Lg3oD(3xN)1S9AOkl99p%J25PDANqv zF#oTZdhLsRBF$gh-vS)?|A2*}kdQZ_^cg^QY-L~zqk9xC5FtCoV9AUvd$GdupbAjr zDA(_=W=sLQ>Nx)->DIRQER58zWRQLa2o(rW9rPj>`f%3& z3~7zmB?z9(D{!SU^B^8Z8cVbeG^4{AJalq{RXl@w0yA6T83JsCqqnmQBdBeUAaoCUQCy4(yz%qwVj~CIj|`+;wBz z2&LRXuaWDz!XMKH>_r6j3MR-88QK@jYw->mfidcCdNhMF&oXcvC7f9aGJcqrGXH%5 z?mg6j9Ndh_;wwBu5{oV+fLMr57l?r<_+tf(I>rt0i2KQtV!wU+_DE@ee}72{qw8=Ge2VrekHh((m8dC;yac0QM;ZTR;%GrGWi}$&nE;n6Zho9I#i~$S4!x zsvvi=Sn<~Z0>Xd2Veda>?q*see=&DJx`Wr9pB@=X?VIVdRi=k?Mu;tYlmaLHVSEQ; zHKJs8$XykPsqkCU{!3@5NTCkjDuIOvrj~VmFNta49ZpFDwd1X*vJdLUDorE`Tb7#E z(h)gGsMd7BMSVAQ?Pzm-l?UC+EH05gMv)+g!?lv0-o}O4$$;)_zz#tJ6NJneO;#|k zcV|I|Vw5k9DheyOY33$9Mh_`_20)v=C3&+19$1cH^-^67btEHpCk9sJ-lXw_$W%O3XhRC$M_ZTzqZTW1rMQrh;#tCrYJsL`$&n$ zV4xJnZ7Q*9ES8HLx@R$8Wikv7DY?15J5Q3iSH+tqInTZtJxF(@Hj)Vf_SH$wzPQkY zM_dg*Fh*Yy2&9J(r@+O%%eHY z{fdsKWLh=Vfau|*|J=&_@HZh0A!rggMZJi1)D#fHxR<{&l99~e@sAxG$|s7wMSWi| z9tkE~EN9v75A&HX>u6%YcL(y_KQ@JhI03PIKF~5#=u9;Mdjb&2 zi+Mx%rZ4$^ZUMO@uKuwxgo8W0o;-TlSj@aXgMlE)8II+=K4)&q%8tUqjR+KA=I5W9 zoP34=2Vjq{H-B;zJPl~NXbfnLh%9|aPtW^(?vMCCT;2vigC~KJ7yJ+G-D9s~ zHhJvs>WP?|3OInj0&IYB>cw6c5LEa5nqr}8Wb>!asOlgcr%h2)cJ3`M$J}5NfeJ!4 z!v7|;#uMad=D5uRtAbso<_Ni)t^R&<7%=$2rJF&L^7A#@#+%ALHXB)iF0SDJly{zC zO{H7kcg9g%ac%cTYalgN&8m;+>7;sRAQzKcsL! z9pdSp-)^vD46y^}ZSo8jw7~|G+H&sxaLztL2KDbbZ0?mi)ClgWC9UwIH- z17CgkS`JW8#g)EVwxU^5+l4f*{DI-wYZ4s7KrOL2cH>;^Xnc(=#Kr}~2eBT{{rL|d z+T{I0lC7_u7L1*@nrq^;#*J{QMywSe;GdeohQ!z2&9Usb4zV2je%+=8FuN-Wo4osyaw zOG%I|3KuP~O(nBoAZKvJ6A99jOgB+t0cj4+Lo|*^>p>a>K0)hdeQ;2Wa;}St#?YC# zjqH^IvcbLR39D`;M=8&11eM|>vtMMy>F8U)yuzWf&YxuZ`#?v2-hm>X!;}?Q@tB8` z!fOmsT#}Re+TGXCMhEnH$C*(=;_j?TzK#I@Ha!F&iI-)cfvO?E8!?-H!PX~Qs5H>v`6bfxFdo14N~kp_>vNA47z9PSn7%X5y^mcq};(@5$Yu`t-EWoV}Nke?`&98vC<*d=66R>Ot`8# z&|CP-8zazRrzcgs{y+q9pK1zgX=wp%_ij|<3-f&wm;7*oWDp6(W09gQ^?%W3)zQ`@ zzb#zM(6}c2hLvGwM~6Y$Vc`5p7&xHw=!*Y~s(2_abuNrPxCD|&3ZLl?0n1h_W93W6 zFEtnb*4Fnm5r3wf;R3RsCNFa5`GaNrx3MNj=_*sq%2s7biEbNm29*0`N+J z?>wQ`W|IhmA&~T7V>k%FP@5# zIm6X<<~=8J)gLm7G<$|s_klLm>pVM&mt!%X>V{ z8OkVf2)fqC1ux?`7>>0(P8yDl9eONSW-J802x>U_D7SKUVN8OdWk4J=8-pFp!QLzd zQ%7n6R@!8d(e^m}AW)q8#|XNO65@Hx-2Y3)5!FR3g(cfI~Sf_55# z2s+Q)#^7fO;5k~N$-(_(>659=$+0#FiLsZUhdqwx`I<~ zHJ^Q!4_~#&g-4JXVg8$PBEVpu$lIAT^{I`@OmXtS5TUWE%kBwo!4fhe^S4{{(awhkNpg=`Jfxt7In5W3@)d7Pu!C9DL?p53ulWm`KA<$hwy zq|f8_?1?44Zy54Vm(HE2uSTB_I+peknNFArf~kp+JZ9*00w|{PTT3>oo<;tUdKP;E zy3bp;%Lhlg%MoWZ%*s8ohb!q*bw_O%fZ<+mo_x_QS2Ig97-(r{b~x1dX;w(Ahb3P@ zhB;Alm@+MXF1aLp@Qm?jd?)fPdg$v)W)C_WnY`pBO^y}|gCZsZQvLGB&i0}7jVtQ4 zJF#^&B;?E?-DxY9y?KP`1a+kHKbQ(h?p5%cI-ETT&0w^qwUaaj4qjZ2f1|$t&3}D0 z=~Qp!^=;k*bN=5r0H|vh{?%{)sc*Hc?H`6{zFYe$%gej})i-mCY?U-p=O-g_;x;c1 z`5Tfk0{;XE5c;eAZ%apj{E;*OJV&qN{r!zUqns`1R*`?yMtRU__9FUccfm@=5%t>o z?GxnE^u3F+rkLTd{Cg(8CbL<;l{g`}i)|vBn-57K zgG0xIe}6tAb`OVR+#5H$A-{lbmRKc1&N^fc4GkH!=M5*buiqLGE^I;Tj{?kcbTdyxjot~Y4)i{T@hjy<+1ZtZ6PrYMk#S__K>z!*sk7$GKuvkx z?Djz=T;wW-XPZA})EM)jR{O|pP}9628^AQ~KT|3*P(rZ--w8P$(%*a3&ZNbbSHVA= zSSGuu62hoS|SV#5o~d8Ie%3Kn`pAEv$wGmycK$6 ze2tBqH2Gep-~V1)3x<$uYp13^YwHA1TXQJD*?-6^4+O%+rmG?xOed7*-k1l0A%y=; zo+&mm`J)$+vXlK+AJ>@J-q3;xcxli~dtfOboSmlY92GpecZHh?CF9sl(lAfhRNWWM zS%{$~_s|hk3?4am*~o(9T@QU=P`KarDm_!i*_LDL%FD<{HfKPzgzMUSJ74=1`@zxV z$zvx=tug__=U0JRc+R9+5pkQ|S1`rD&hp@UF6ZZePd%IOY?4w>Go}>l*@NnwtOf?l zNfmKVC=2@BGUqJ4=s;c|>1}a3!>md^EtYnIogbdvoH@It#ZV)P(E0qw*=GJP)G$AF zNo#UDhNK1p>`?3tho8JH$#>;i7FThZyp{;Wn8=TSgW-^4?RQ#+;u0n4ORbwuGN?V& zW*`w|wo(VHzF8mtAtkMN&W-w^n(tU5k-g#!ov#Xj2@Cn>({ds{Y)Z@PWUO1W*0RWrMHS< znBh&n?wo%r=RcECC0y5m1D&HcJ|^j#>#_g;G++H4`2p&|1&=PJPlJSdw(L1z3E~^1 zeF2=%`h77B`~ZyTCXt=x*T*ByS<{=XHUM5n7UgQL)Z)5`>Yjm-b_L13+3FNOZ{DL` zN~Q*m$Ayp(+}AlOWUh8LBO~K{aslYufSv+iH+}-SC^;|1)(1xG0n+WW|Ji(Gz9$%e zKS#nT0^CdknSN%p)XG8T=afjZ8w<3PWlG=~KQOWyC_OpwKK>PIY5DNrYbq-WF88}D z=%5>{>1wlm&Gt2LAjGU0B^}<~|2DW|_Mct+|NU>}{s0=fkxOzeVt898QykPk8WzyC zN)(a`?^2$3WL45|84$tLP3Fx&)eG4o=bgqD%<~KP!{u4iFP#)~J`LgE7=y)&f*=9#d);a7Q8)-D$BoJ^VS zw)A8ajO299nwOo#LNTv>@nxfy+|-&&Y|Juq+c=H=RaWNdxL^ExT-==3J-$u%NR<0|q1J2|-=;+~ zZvV89e1rUh!wxsG3>03jkj!n}M;a9p+h!V#*OkUI-{2e1C3qKF))`H`pwXSmRZI8m zN!63M$~>)KK?NJ27VWY*W zQ)DezvXGXox+lf_XG3Y=;j-Q;AX9Fpc3lBjt^GyOe9CK!=1*F6+I%S)mnNLzBgdiW z5wRFv3J(0jCurDdnG4<#Se5veK#DPYDG#lEbGMmv-sbX81BaIQ6tv<-UF~T@P{n4x zdqIkQA zOodNJUK(13$SPhA9L3h7bd3rL{ z1}>QfUr6?f$HV>3vIIu>u_zfUYk3sixQ{=dyjyP)*-<>Rl-WpN;Dk@-#=pbd%1u;3 zI}77;buE^c4VC9g#%G%EG`Ky6xkT|SFxAOSJyz1}vVNK+j@;#k@1UGcsw;Np7(&b#e*M}=eAT-#<-voHLR(k94qFB!M`88NHLy&+9NzwOjvB}Dc^j3w*(SZ! z$>r%KIZ-I3PZ}Bm!Q#}d$##p4_|J~8xGT$(l(aiTeGJQ`=l@vfn_jb#F&cHx#281d zTV%aw&vzZvj?=#Pz9;X6=dy%dptg@S3bVx_!D5ioU43vZt5prXDPW-JTi^nY1 zduhn)cB})E7hrmc9eMY`%JodPjoov$CC*+P+7*}y&>@`DE7s{&`FQyYe25|qj*sh9 z`FJE?gKs#H-I-fS?fs&SLeXwLh5ls;$cD%L*3U**Whf>~YD1+`W=9V*;xM(IzwO*e z5MUNS69f8NQ{#1e#Q3Xh6%5qWu9#MPj#Ad)f=maFvUlyYhEMJz?Iq`e5U>r05PT={ zY;$ziZ&6YieT26!PTJ8DTg}E9DJf`ZDi)aZ|ImzJ-&8H8OCe&{N{F(&_|`l68AV9K z`~xF-A~F}$=&>=4Ma;DphRLhaC{9z&_a8s{jIhivFePR;dFWJ_8IM9Zz|%DwRQ82> zCe+sOMnYGIms+(lz9Zl|Sa;r}br;K=ZJ0JD-|iR3+2yX$xlGI`GTSN8mrKM~RL|3X zG_wFXTFzjlE>t6VXMfQK`6U;3x__y~qE~{gTXQ!hR#rM?njmwN_Z2jIP4C2BjheDf zalH&D&klP1KAXgJF~~+CJg&m&o}=_;*qPijdrEQ7hcGCywgBAV$TK6Sw>h7P=gNk% z#D$2sT8pYK`jcq*lw`tuvb?1HFJMKX*X<@bK2UUBR@ee3AC=bTM_FA2tCz0^D~h8n zsy7B*rI`Q5Y|MjxWxFU%rvEqlmp#5&#T3nOLuCGlU_i;MYLE!O`|@%;cLx>55t=*F z+@g(5+4YKAzx8%8V?-)@s_?{a?dL(3TLtE+C1+^cG50=E0P$`2?F%HXIh1-29v^_q zj9;xJ(r~x;A_M8}__gSs*rOSlQn#wL2)l6EuZJJqaCQs}m^$LnQyPn6@6YLprz!j< za9!FrVMslV2|VmfHJ*7mA}bAvQj!Ffw$~> z+aXTVb@q9_-aO<6ux|$DeWb~l;!U;xqWp%Qmg{M48sE^Bb!>@J1j0( znVzA#l=qu0x16mf!IOJL2%$BYL0u9h^BQ-RcTXNbY{Pokw}^jmrd{%i+D;ioXf6as zeF*`8h>S;x7i0qNZ0&Y*sA!Z2-$70HnrdRKelU?9)CqTQaP-o)kaPj?`n$1??|{_* zOkn+g^jmK&{duW1DX6-u<$$m5@lp(vzdVKw=p6S*o}D;aAgjr-;;Zedm*W?oavRyS zkxd4}w%V0#mO$C&k|hZk>BpO`iZ^Preg+8VGqsXjpc#<!dv!hWLF=PxZdsvP zxxdjp(oJ3Btv>~>HJNW8_X1;AW_8enh_2;GL)Qg_}dl$aoik?y6oCZzkgwBS*tGN zWq+e*&En@~`5T(W>VhE4hw~R=61r!`UueU#prxGCMG;es6dM89yOkjb&yJZH7VozX zVLHwAe~4XeGZPTi^}Wh17IOhOGCjMjKw)u&4C%B{QR?7qyNcjq6a!|;a;*%xrrnoE z1R+Y;N?E#XR^d2E!kOh_OiW#%WJ2jY=zV-3Pk?Y)SxRfFw#Qd8OgD#7X&simU$O}k ztavikwkFOkJb}D(UL+LR{l9Tfa<9Xskn%CEpK<|yb z%cMqs@~)iOIKvItCbOF!ze=7RLYtlAbcCqF6C_>QTRWvKC+4o)xaId{{bn_ZG!=^P zQXiZ4>vslir3*HSg}h)<98;`<#-iudnoVrEV}&l}KBd$H)By4W%;gCtY2xILTO{(G z9V!@4%}`SUgPL-~&e%&+$%f&=yG0(qIrl{3NbXKur)g?Kp-3=zf>Z9a=H_d(DS zW{09il11yfqvVbxD5jM)p55zRGO=cs@-E$WRZAkyq?Qj)jt)IJ23P}UGJhzH4yw0n zFTkb~RtJjie>}l_V9)#iXa|Ts%no$j^;Rcysx-s_n7VHaF)|0PPY_l2Cx4I&vp#G{p!F-iaeM|p}i^0f+VJ;eAR^MA{7~hUf+n)w> zh%sR>=|pTNdh`MV6sAw#d=>!&pErXCTY{uBricm=D+SU5939lkdQBS;liLVrnqB$~ zzKbZf-|0#iTIkJ|ml#9Ku;9lgs3Jh!{H34?MzMCMmKb@AaslO7un~1lx=N72_QfSF-e(t>6VS4+W?n1q(M(FE1yW)@S&9g@Z(#V-pv60ZT`MAxOH1}X9w(ma~ltK zkz#Rj)1Mh_edt51gJ#ui4Qe}LO7xfO^nbb8e|5bktt7}8veHbS7PmFrPDwMYzg#oD z{Lwx7k}B9bM2~mY!bil`bjC!SAJR1_Dk+ZHH)|V*jx}sXbcqXgjzbeuA6Y9<>z#z+ z7MqccdbWm3uQA?w{w!jxr?2)TC@k+@Q$y0t3O?O=FdV#OyJ8_AAnBj9XV8gf_yQd@ z%R_=3DvPA=X_y+F`_&ig=$vy}g}w=g!@oUhZ<;9NF6$rY)g8RbvX5A=)2Uuc{bJ)| z3R4)pNbC2EX-CC2v$4V$QHj`DHBOdY4wP0&XB&K^m@Lrevl@k5ZUhYnzRMnI_(uU_ z@tD_)%qc|;D#R?BLMOi&*m64}_$~f?P?)!mPk2_=r-6aW%F3{tgnpmdy~IoCj9N^lB3VLA*FFw0(l*lnVV+3&PuyJ2b3Y6J5D3U-^fXYjp#seSEaJ3C4sJw-vVrNw4Te&sQ3yZO^Uu;)9 zAkoki_0WebPq)Mm zw+dv!g$ix$!6Ns)bY*BcT7ZM_{lF+b{i`78Eb8@*2I$7x&9J_L``(FQCsZ~pt=&-8 zG3lSxqc|&->?wL5IhbRcDU0iflJtJaQj!lH%($2=@U{waSqxXb4(*mqoC)0Kv$IT_ zH42b{pfk^m2oIPrpCCrr%~aU;QZ;NEUyZo=Q;d*}OY7w|xnBguX2i_6SF^j4cVcUC zv0Jt5!Qceh(W-p@r{;o=&uqS_n}>nW4lJtR_ALgm8xVgJ41(Ks+NeR zFZ%UML6MR>1F+!~eh~zeOWoDxRGOcFEhzbap?;!mA_I)N(-f*5Wa#spDGU z3Fh>CdOyuNEHay*mGr@ibE_<_HH|RnnIE%xeQVGbp`_E%d85PA&_le>1J6Q4qFrlO z!Jy`liFaRU{Z2CxW_RXVTxvObOq4^VXYFw!B#RgsBjQ~TIFn&jR?QX;zqz@Wl1F1YlWBeEWsWBJj=nNkCOvK(k4cYPWYD_ot+aYV;7X+7 zI7P6x_gGy+_g3`nI=j7Lw=`%1U8VKSmuoph_9!QjQ8bFKc-wOX<~lSTM5Q+9W4wZ7mwpdC{~$5n#h%3)AK*U6)o} zdv&9DlP<~!DQE7Cq`u!{4>sRzV+;O50eO70dc@yf?>A4@&M&v|J)0Wz{s=8dMZ5Sli6wZCTqbg1 z?BgTW7>b_5IMlM(w#gCOTmjKko*bhE9Ko4htrr(dK@$AH!&{6=he+0th5;bg-KOZ98*t1i7d(5%nP=ag3FOAMZl+T8U$4nc->{a?L;C>flNRi zplitg`cJtJq_-!%{+56LU%uB5P9$3L+j40a9^aH9M%4`By43^kv@=3>r~GEIdz;(n zz;r8t0AeUIenpCf&ek_ zno^0AIi3)fg&{*e~y@EJqFwi!ipU__DEJ#qQ-16{S z|DA|a*G?q5O0iV7i(~(D6kl4E{cEYy_BBE@==cV8lj#gjFUXbf@>n=b zEJMbnZqy}v!6f+6%(8<2Y$UwDAFi~=Q&>wt8FfXri$1iOoABPdws zqp4Fuq@c@$;J8b5){re~y#^Ji-qxefjCD`a#-j2dMgkCus)7Z(^5Cq6TAati zYguGLr0DXY_ihR{LPF?m(?y&>3v5>+k&z4QeFnt0fC_ghUBafT%Md?QuNKo zai}G~GY-WHamRcpCBiEB4Trm4q!Nr~*^ zn{_>80{RM3`+JWeo5c%fb2krHP5;I@y)#h8>^)rSvV5H%^C7XhAmhoBj5M!dO?hl$ zBhL6Wfz5breR5*QV5vhDWmnw!$bGnYcIl3ZV_e{T-vLP3{=%$yj=& z!hNZ)8~fzwbtamRjIC`6b?s-EeiS)RguQhYmDf~jz_070-W;*v0~f)4uGx0kp^UC( zaV1p7ZL9Avn-3J>yfU*yk<412vaUdwZ9eQmInrKOwXeEw=uU<1nQMO#CX6;7sFxUt z)8iQE_Z#0y9AJzaDR?kku5*h$-zv*Ogs2TwOZ{9C6Ukjz7SmxEw^}zuoBQPlZl9PuT?ut@#>I4jtKjOCkMqHdziOPd>sSE(3jidh}P9 z&>ODr9aGYG!0lOlqs;yTgX-HLYii(20Dr>&;*%fYezh diff --git a/docs/images/mqc_fastqc_quality.png b/docs/images/mqc_fastqc_quality.png deleted file mode 100755 index a4b89bf56ab2ba88cab87841916eb680a816deae..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 55769 zcmeFZRal$t)-Fn+z*nS{Vx>rm6qiDAOL2F1cMtAuDNvx0;#Q!zyE_zjcbDMqmSlzR zn{)pEI@tSUUwdu2)&Y>bJb7fuJ?=5a1EER^lGqq;F_4guu%)HMRFIHRN0E?_z5hZ+ zJaJ}X&O!Wm=At4gf>b&}x`%l4+)`Lx7zwEYjQMDcig^FRNlM!V3F)=#)7P^V3xFpQ z(!7JTn6R3s!6EcTteK|QPPjx@DDOv5T2*CXB}Z%z@|SP-DsObzPh`FaVcdV&m0)j; zcZ>LN@}*RhsyUw6to^1IV&KrBgSL*D84<+V=b92tLUGmkCzrla{Dr!*h^X~IGAQjM zyD9lfz=>mTe@ql{QdCq_QdAt=(BA&2YBUsY=dfzD{{p(Xxaz)h;YCF8?Ul%1e}5}@ zO@0yZuh)nND%kn8|Na%lH#NLM=KqYOnC|MbCw}whr}=*yP7H-Y`-r9qwQ2rq9Dz|0 zBdN65Kl4A$DgS>m=QkV7|7=EzGh^Yu&HaDh$NCi3wnS$c$@$FVUp#HFss7?l0LJ~{ z!`SL7tNPPP=8^Kq8)3(i@(qbit!IaRj$Duu3h(VXaI4Sdu3~_@H&ak|A1shtFJP;$ z&Ff|ziaT$FS{aiU@Te#m;Cp!+I*IbJ@XxAqIeeeH<$>FQ&-YdyTH@a_&X?%>7*prF zp2!e%;=M(CLssc(k6U1h(+Z6N7fk4b1$pU zx+k}@k}uu*?&UWT+g}Y#gV?3_XQkIe!hs%Suq9Q))|Tlh`Wr-J#)v6)bNt9IQZ-?zd%Hw*=ZrCzD^f-D3r^0KBi$+ip$`A6Mk<3rtrZFNxAf zKk90T99Gb#t7ndaGJ(*jcpaOR-2zFV|0MH`0H4>cX|8kH-A>yB@PzO5QPgAAeG<9~ z(7IdVikhJ^RFhx&6*~Cd*30U>;FKs>ES%nYuI$%8RM=1({ChUX}X7!Wu zAA=&In$O5ezi+pM8LtJ8`oW`oa28+E!&*f>9{W97;k4XXkIS^H4+UAGvZx7D{UOIK zH$}ZEkpj2NC%)GxA>My-R{)`xdTyO1fcg{J)!T^@lJhkw=vrQzj&$^Qa(I7Cu2xl- zg5af(2k=sEQGeBmBNF1c9B_MFCIG7eR|`T^)>Jws({-d$>S9rNoIs$o1qKW1U(s7gPai5(qrX(&Um zwy;AI@AZ}{%d9#&PBP>zwc8=%jgWWGH2jQp`DWYPw4k^T`^Nvelzg_m4tOygvshAx zSic)*_56B2$iwR{sdtKA-$NW8Cffewvz4#abf1JwCg*y2X*Lu~6edkmydt&um&!Yh;0Fgz!I z8S zXW#cIlDgIR7Kgd*mV>IL1+VdR*KujmVe6Bnrwi2`nyj5h(N`umHB#h26X zt}BBFa)TAfq5C^R?mPC5nk4!GljuO$+PG#|*B4a_2>^!?m-qb{I`I10^!40&Ah?Xo z5pt;rAZdrM_}>Q86li@(J8)D#f?(9Br`@U}FA1>Jx%%}~}bmH|q8K|Y!jaNAu?dYM~6 zRZJc^eBV;Y!Mnx?kn&2<<#2q|Pp)+P>ZBPmqA2KkX?Et2s&9LqBzZimIWVsmGYatA zRXt~RY=fjB;A5x~rSrZ2e#S!_7>vCGqC{9lj*|V8LTb}g!H@mpp{+Rn_v>x&(6H+J z7}nKf@B4Ld%Z-a7|M0=og<;D>XSx@Y&lV$4Ekin}o2SXK^<>^M{r+%K-I&?XE$nJSn(xJK4qrH|bnqfPU>4jm=e=x!oc#?Jke&g(g- zUucQtw<$SVY?d~P}!t-c2Lo8mx6d`@70 zvP5TBSUX%%C7-WOwciMN4WbKqP5B%ow3f{Z-jx6kgNKYV|^tpbL^<*qZ-A^30n?FBY*Hn_q~jp%0Mg-<>UCF!!;rL{!Y{b z*3Cv>f1?;licgf`G`bG-zLl-3R|wc#Q538g0z$S#C86oCbHSjNy?ANChiOIVH2rMI zG5nGlT3Axtm$CYA3AoOV^jpuMy|ROZ?T(T^1UI_*!$t2I@DM>^@!2%tQ*2Px;zGGh z02fo5-BK-N3cz|cST76mXYkO_egPK}#MwY7cUixalk{5k7n=LGIBj3hTJKhyeXzl~ zGo3fkBcT7$3Q6oSx65M@pbZ+YC;(b=HY>1%!!mZp6Fqznq0rpI#0pXZU|dVnIlk9-%u>~`h}VhYjz zmPod{6t5ndj-zKD=!WOo(!>9dq!*2ld8_8dca!LG1x9m|yPCUXkoxbbV)V`B^QlP* z2QLUMxOI2m3%(x6c>7K);Oa-%C(!K#N~N9Ef%3qRq9J)~x4KpV>itdW?%7A43LDIa z8X^^jrZk!ojDyDSMXww70zLApJntoe%=xcBD#D>RDy64nfaU_M6Z)d7V4v3O7+UfM zI23&xL2-PqOi$oj<6nQBorePGYWBHH+x}3PF;m>1({p~`Te}(*tYP8JcKw|ZaIa3W z5|KeaW+a1}*~V9jOh9(L$~YKYYcNd}*`l$FOU6yA(HR-(cSZ&9*~&v1R}oErionDF zkmE|SIb~(H=VJ$DZ4b&-CQ)fO@a_a4)*zSnmv493+6k&S(%z0p_QJ>psX^O_V9lhrb>BAr9 z#!w93wGILaXkvaRP39@H;n)|GB8ih{1e-l>kB{FBn1qGHL%+#NzbvY3$Xf&5Ir5z2 zPG9!I*3-qPiSN%$8O#PHBV)1VD}P1)O~7Dhj2?72@pBcduzphsN8H)`k=p3Wh%;_$ zOeXLMp7o@Qaw@rwstN}`?{)X08s5C`DQlRw*eDrX7{@P}7d8#NUz6uvKJSkcQF?Ne z6pViyWiT|=e=Doa?LjcWpUG)555Bnx)chgcgWJ97&2EQZf!xal z)p2nI02nbGF^RF>u>$hlk&33=WQ-^JoI>Si0u8 zV07Zbz#>r^qAXD{lBu!00RKml^p=Cv64=~UMF`M+kogAK za9tvbFb_5Czmu~*!Wcf7X4}nlOhFn>z@2UYs5e8zXiDYQ=Ox))S3>&zy2o(u2h5!JvYvSsLq$lAJ%%c;J%Lb@e5mEkCW z?eZ|Dux0i&Si?wGLD+e^#G`KKbCx{u6gsr?6jUM?pE*3wAGiPuHc1MIvY4|WVosn|)%172v_ zuJ9qyLTdW=-$|n#8!G@V$$7Z3oifYzxs!m`vv;S}RV*&e|L#YrvkJalcR(jP&|ivp zdX?VXKmoSP&tSH<4&P*Xc=vJz77}8-1B8!d0cW#BxWLd8o=iJfUfU`0+(QVsx$4{8 zM%dD+!cq1`U^-K(q~!|)T~eLAZia5FB+I+)`mCM=ATeKEa>FyeeU0P0N(2$?H5_a% z1c?1K;t}s!d86fx%Dsml&FIN>)%>u!tJSay-_BD*KV3b8rOY0MRDF}8&W3rMO8Cvd zq4No{`UQOiAyeW&=;8TZg&{D6<%2^Z z!|qE6iY8+BPguq9y#O>n~H+h-giBAsF%%~f&;2z zHSJ9+elB|j$&@GebI=dtreMMQ&ghri{%!G?7SS%=%2G0KqHH#RkD(za3ny=Hi$(=p zLGvS3B|d!WGOoC}J8#If=~Y0uQMxBB0Dao47Ri8W79ysyRyY66Fcmx+Tm-DB zhy25cx=95+#qc?ToUlOnSSf2{HM2o=*VzYQSjU+-RrVoQq-g{FF4Zg zE~D2d*8doXY~?Q)$%+d%R^R5T*Ja|j(efj$qMbfNU$|`D4f(?#^kdi{t)k*vJRUdL zlxcwb4m#}66CTp`2n9CPSQhv#x;!Mn5l~6yO6GGaT9+UCvj-#Cg^PfUgy(9?6bFXL zpNb`ZMW&HB#=RloUUl{4T*WAYN0#{>9S=giO>#Fy+5dV^K*r~FnE~_`y9;cG`R|Z< zoOm=C`0i!|j9q)!?A~%82Uz7BM!4{L-9s2&lDz;lp6G%f*Hh2|EjuF*ZTdWkb~fij z6_P^E5528|&KH1y9o-vpP$5xCn_I}+iK{MC;6&BY+8Fs=m!-n;b%SD?b{UHjMD=vl z=|HehRp36=l!l{Nb=j)%E)c-p>$yu+7f<0NCv?~F0Cqtaf)`7bVV&u>BhZse9N&i(A3$x{)K4e9C)`q;|M{`52%Ol-Fg#F@RhIVC{{nI!7gqddBASWD!btp-(BBw zy3b`l5s_nR2<)6q^Y+vd*eWbZ{zSIO{;S}l*pU8|lJn$|PvBuKUqx7+=-R09e`&ej zfx{|HP3Z%AGj5jsR!`dCO19@yQ~>yvW;*!(X7#4zWHpB}1(BEfJf?t!{10!5-z-JJ zQX-eGqE>l9_7%!}cZXT{YORv&H@6?!P^VBI%uu6V6=U2bfK z-nUhXzIRgAtSRD^1sRqBr@J>`*yP8cp7G0o-9a4q`1%ZFqkHR25(W(nc!>F8Rev?+ z2p#E#0X>$-*t{U__3WWm|LRC(^ku5R)_I#q+`)twhDXu$zH2tK)}SV;F#zE0@2 zg?0JR?v@D90Hrb{11&%10Dztc$r&o2>~^QX>Hg!vk;( z#!o$oW+d2aJ3E!HTRLmi#ku04&fiTkl>~TQ=DSMO6nU&V@0^f&T|`G#xX*^A`Jd~q zJ}%Ne)$q(Ccl0IwAN0|Wt_{zb<)PfG{R#-xbxpIXTB^TSg|zin6u zSh5q{v1O+fzBxjo@#?QW1SARF$04v2_)CFv*=aWK_yOuc#x(QJ=Ett;&FUqs;sfxq zCIB|&O^N=5HrZJJV02Sr(xjsQLk19jeTIiI@V|PQ~{$B-zwT*x3pGviT$60%8 zCF!>divF-$D){m87X$&aRcy6G_WdbycC+L(o9?%>1B5-W24q|AHU&J)RiTV0+o^D# zT@WW6EHpXfOd)pp&5q{s?`;3C`S)0Y*FJT?+vbC9;6s04-B?QK(}F_(bAgv9`a9z3 z6M28iWc~@r|2+7AU-9?vZT>GSHUD2*%^6Xwe{?i5`rX!MSZEWDhZAtQj+cwo7%6a? zSLc=zv`#AoZy(3i_dRGaga;nDKI!IPS|BN(j!XSr`)E`qYOKB0Wf*X2oba7V#{I5) zk=%1laIo%)G5j-l9>dPfyf>2it=GmbYZG{h1;(^o*K*Rh-V5gQHTu_th|#qnsfD#z z@N=S0eaEKKL8ivW8}}v!0nvu1qUJx#E)FXw=}JTjohk=?^dIb7E2n>IU)7z^yXKN5>F_agCUG}=!;#J&CZeBX*c`T6-#zh=YC zndemokzv74zo3(!G~OKC6xP?%!8h!~ZNg_vh8nM8JRn4`F)hCQXDep(R~_D}48xI{ zy4B6+;dRhGlsf5MLde2Kp_-kt&0xj4>3R zhquhEz2pj?@1^q#2>W9fj)Lo|e>Qu;f1NoyY^u>Q{MwRUOwH>_4=8z=h;cgr9=^=* z?xGoVzo&BQKig6XySlGE%#IRELH|3M`R8%$1||7_>z7ob{BH;Pi(>l!kOxD5aw~vz80WD^z{{}CSKKBaMsdz*X zg6)>mlPEl1p-B3iKpQu{PzB-uPdhWO{u5Cs7TY70bf2c^q^bito#+l%nrww;wH*q9 z9^AY$9%^s&xgT$p@9X{}TC>IZXEuYUIBot@Zd+L=dt8Ib>xM9s`UCq}w*sdfH-c>$0J>4`lZ*J!KJWf!Y{KJ18 zO*eu+eRMMb1qB7s`&Lme!UCS%p^vnj9Q2HvZ-t@@!T%j}87W(a>}+UdXigJcB$4Fw!o$e+tk>*3^i~SJOF4C(3^hQo`+k zUHc7b-*l>D~O}$@DWtwNsB+WB=I-1wY3B z)aL(26^f6bcMLQ!gU#$v8OoT`dO;}%ZkQ@+oL)F*{Gtk~zA0_h*@O(Wo!zyFkK)04I`B2uMsXC_I zU!z7c!RhYhJk8D~`gE!0=iP>pQ1&?a zB!)_?vR+2ekCH#{3X(;%F)T=$KuNw;e-z^P__rCKy7~zHo4Nd6PA>hsiCK;Rkg$~!x* z1oZ}mhF_&o*#{n_Gl6O4`E5MaZ`8*?L(y-2KH65;x&P}1M}c~Nt(r)Z&EUbuGWgb` zq7h*-WJ2sQ%Gao%mg#yU&%gCFZGLyHw3wSiqxS1=ra7 zhfVM<(E_q=xL(ERoMH|F6v6KtK8Lk~#`=qi2h8)gZN zpyUxJ+PA&F!GFW~&t>#~6y)_7(HpW8GA#0Jj)JnO8cp|o$d$>=w7`eLBf~3W4w@?I z3W{(h>8dd`6ru&FGa6{(H&J8WF#<6i9@Pa!~XE?j?N_|er(s~ zoQnPL+2qvYPfp!VWX_=|XJ`LT_K`)B)Hpg6`5Jj1h*XuWGaakV^^5GAL8 z1<+W`_)7+Y9;rgWz7UMAb3^H0$qF~P}9YX$|(l68N)eOTs+-Qe#c_pox#H>9Hd=PVCb?037 zc_zYv+uwJQsXssy&e|r6osX(3gtZO%F+;}1ED_{DN(OKVGEW(OEgOHy`z;Y7edqUg zys_WA|GWh3p==edvj;U(>@0s)K za$RXeodzH`gT9(d)4eY`^}kKtGx+twpn!(!VK&>E+`yXpuh(v|Wpi(xTH=d7h;v5M zR!OVLI0!YPL@|EdV)~92GWb13R$pt`GEOT?Qb3x8FL#*Qs?^3PjDp30bwiH;|K&TnmI{XS_VTuIA^Xnk) zsnw>~BEwGBj$xwjGp_8r=GxpTbLY>4v$JC!E~~?Hz8N?^Ndu^6cq%-o7f>+JKkXTPIu#nTp1%Bf8oJEn+~#k zN$lGfo=h(}gTm<=NmRx#HWubhurWa9!z_j0mirhQKozcX)o-MCKS+U+)JmbYr=O&@ zqxm_+j`#c2m5$2FzBZCB1j*|si#Xvy3^!Fg04#vUxMh?he_JB87X1Pu^@Js}Al%lvRC}tTS?07wM`*eC|2fyacbu0nu1^PZ>k4AuS6p2pa8h}3!lXb z7r_gjW1#8@siJi4P7|_X)OLVfrXKQ1D=O4MjItz#=B=8o?40SD-1vq-P6EOgSr>U~Z9S?C>u(HvJCbLw4qC ztop8mY8GXcZ~_~n((s%NJy11JVUEbad`sQH;>i#eZ%GutbswFi`1%Pt)KH$zcr%DNDbV>DfG#DbOi8HOuFJpN&gT2;Iw>eOv}O#o z4R?4w{O&%K5Vb8@eB}{yeS>?T6RABQWkJM`{;QZIfGnGhyGq@IV*-6knvpw|-p9>L z8_Al3s`00QS`2aOB3S!KJ6PoClJHk*^e<9Ad|2h$i@?&-W7MU;?%kal^yz-r<+G^1 z3ePEaFu4kt4B8S>_b4Tog*3~bz8YIp2aKD9eM`&~kMoKBWiRy9>3*ex{3JikcJ}Fb z%F|>X-1Il#2ykyN?PknmKS5VQ>R)oG6|@i!HKt@e_*{`e6InENts%!y^}F{k;`8W< zOrqN3znhy>Y9D=`Y^b~%VAL%YTfa)04G_FL@T75=u?EDHHkKYcahGyN8oqe$#fkN- zL8ZX;gEHG~1>0NUj1-Y$rY3Fo=O%*5W=W@_?&iwRXu`HWXo{>Xyp@Hhxe!iZ?z&aD z4#nffwZ_Qzzrns#X;7I)Zjo{zoMhLa+xqy$Lg_DE<4d}V4`)a2&!Cd8UrIb`$7hQ~ z=rk3pL_>uShe-#nDQLLow4nimpL(^LXX95){J{Vs+#}lAx7hhMZKMAmM z@F@}Uj3|<`r$;{V-DHE@vA-qpGrh)EZ5nLHWL(KsXXqLi6M2tSeldQ*-*^A#+2(TN zh$e0D&p8p<0o2}CZ?Hhg*9_EEM8poNPOG1Aa2MN4ah2O+F;TTtw>uGr!H)Gh>J2rH zXFLlZh85r9yE4=+UxGnHePi3;6^A7(&UUa7E_@yVU?4Y_-Fl<@d%Quv-C`T%DQ|3``&(L^MPUn-q&sCZ zIsW1CvgOQcUB>3?@6N76^$4n~f@AH|@$r9Ikk}0E6n$%+>4bIhw}NC?o0k^zHGQCq zxp%a2gBW2V&eD+hK-KcNgv_rD{9j9$3M3nTudV&qOyVhqdTQ*bNTlgAZR#YREPi=I zfkqQU1+uZ!r~ zapTZw$fVK7r9vJg-B@Ml62+w5DO-4xdbOHw%~CT+&0R2hKK6+*aN;}#xCcXC8`-rj z#;6lm-Bt>#;*zI)V_WakvCNkFRBe|M;i6nIt8_Sqf)GD$y4Ebet;_EQ-h36+-}Hwi z*G}Fgdp~G<3==(#xp-|EIBy&Mupf-xtXVY1eM0f9a^eqffibJ*| zFeh(6S1byR5ldEw}h82UX3!s5W0g3eUd%q+f2x+?Q9?AJ$OF(NzRM^O0ul)+F&srRw4rpP9NNM zC+6g5Exi}AgJU;t`_6WH(mrCoZ3b*c%ri})d9Ihd2^NoS7gwNk za5jd{cQ*6X&O$wBl|Mpu%G zfG|V3AiCEMp;(0hIdu;xI$DRF-Q+5CzoEklgGPL8%wa`qXo-C(ae{e2;oprIn(;Y@Rg$=FML#BVB8#k+Rsl+tItuyeq~L*%@f2v&d2@{8TD zM4U=vKs?;y0D1T4AlMAjt@pZ4y~b5b@2%c%N=e{S-}#nshr*)&pdIT`hWpYx&!zQe zjQd!}?*!y1TmKrsOhSFkV0&vQpSUeJ3^??Yn_vhJE!C@OqdrT8p(8U?oK zh4%j8J@{vmM&n5g*a{t_Z9=H#&%@^O?8k?dY_{BgDp+AGs7eel>=}gdqYj%0RVi$( zsT+LAc6Q%axVf$PzQhzC+57B3hfK@;tUU~41cfVo{!Kj}NUffe)J3ZeQ!*z(w z>Yf&dPaI1$fq6}(4-q#NuR(Tjuk+8QT?>!Z%}?WO-j#B?w@`gzPQ`$y$X_?XzFGTR zq4hP-)!S%(Z9A9kK-iSIk7=8q-+i=TuFWi-ym*_>eUoPt=U@$W&Du0xolIbxFcuds z4|Sb9PnETL$71WkID^fx}bZ->Qs>AzZ!# z)c%0bGRnt2(({R^w`7S zQ7`JPVihS~JElzLcg&Jdd}{iZFO;O*+4PfZg117qLHd0iCL@#g)Gf`g%DXKUr@=Yy zaQwqceMb;fi5;K|T|B z`ANT$P7xM#`E`EtzTje-z>i*~rOcq&w0y=+5+UNB=7_ZR+xavh$!gMiy9+D2V)I5) zXmTO4S339dDqho((|)vpY7L~`^o1fNL?K(C>SAW7+0tP}5O6WnD~RdrArPuwYBrFn z0t9YDTYbmUanM0m#&K`|H1tT-76<{b^1V|*ZWLDqsJ;U0k+kIi?txp3rqAApczcKB zo-dSweIHV#%4W#2=aTn${B1Sv+UK<<0kN}qKR$ZB4bCuBx0k6_9x~vVoKV+ z&(}WQ=Jfd5nXXxN3SCvQlpXd}JoI-|b2eC!WgJd}PGeu$0!A_7d^#zIInYxi2_?*Ae@&^G z$PDnH`PPs*7BM*M79tWQTA8;<+CjnjahNS z)TAw}dr@;mwFV9luiSC7%1XKG3xtoE5sB2~ygqfPHmK?D`3S&-UbuAZDCpu%&f(5$ zZ=tm6>C+h!4NRlD7~_9!xK|Rw7kh7$EdN8&O|Q*;*ZCaD z4jJd=S~Xv{DiBm!zi9n!b0}i$`%OoeZgb9z_M07f<{%w$=I`(F7_&6GM`$zITB8MB8N6Ln8`vU|&v^H% zzlI7CK3Iehb#r8caRv?DU*F)1A3F@2*T^{A{zQd`>S=|uUQsZ&KA$%6(}JuU$Osz{88r^rp+Wi2e{`0T9QV1?p4 za~L#5T~1-Vhe|5^Tiu~ICc2J`73V*Tefm#B~4=bveHUwyMjMBL|;cX%8)=8 zoFo#i&)!T+)w-21=sR3;km9s1*flcnP%RDC*F=Tm+O94aEg_pD%leF8vta2*Az+P5 zADCIRacf?WQ5yN&B7R1q%5=w5DPM1NI*8FkNSjOkOD-biO1n=>Yb5tgEnr6RP3U8p z5Y3K}dS=;@c)-P$KCeSaK>{xIyvtA`@hFg}FUHmS*FTS48)2aw_y`Ge$ znPdOp^4YsOOpB;eHiXpO*`L}sIyT{J3b~>{{`Hm*>q&-6fwqLN*}Hm*SJZr0npYDr z?=PMOu;BO2GP-?w@jR;0&XjsqFWugHNL(Ya_7gUH7>j4_c5%P9E#H1=OZjV-#{l0u_)~I>-0fUVyiYkdf9XWUa zM1Xd3e6i;hJ1jx+30m4J7u2Est`0T%J8*(f$K%%KjgCZsHvMO3bvqCnPh3H|?xQma z4rSbdWu=z(`9a-Vy*y?Xf&ekh=h1@{dte9L4d-_~uQ60YMb*`Oc8Afv+%Yp?VF6=U zBVxaZSM8}7nHB{T5Ec5;B(df4+%q?_-G3OE5S=3EkUl8VV4L_ckv;LF(c9jrKJ0u# zcUAY~BU|YBk+VVlfiscRFj_~_Mj8R6yWmfL^BTYEytrmUr|}&luY{yq2gBhj`^c5Z z^S(cSkrU0?2?&(}>)0c{^rSVWrQMSY%$yc?UR!hrcSNmq+0&B!svJ0?5C~GA8}c>6 zj3N{*t4OCfKpu_^evK+tV7fprL3p;sL9(|iBI7Pia)v6MwpCc}&x=Mz?g403Xl<e;viOll%5G z0F13z2bFa2Hzg%Djq*8s(f={4DAR z_VYbC*mT3k8^YwXI%jshm2GBx>{5ieUdx1_gq9OvdT$5b@dmgLq=((RU{ZK6<-f+T zm}DK>i(S6*_7hf2xOTX|1-7HO4%Lop@E&^79{! z@9zg?%&B$Nbb{u$4&`iUl7ECne{W^Zt*<`qAxIkdiPu5@9OKNSobC�)v~C(0C)c zgd3@mu<_@wnt>uVJydQ~oz|jKOy0;^`Z?+o2D0^+hp!@j_=nH5zG^AYBuV|wimv<8 zJ-BGiO^XI}T+0%OK+mPa+&L+!)PYa5H}wL${$XzJBCc;XV=Co{g^!)F^tz?jpNo4b zH_VuCMYaCaZVyd48bC?#x#Q0K4CK%<=X&Zv)V@IQ!g5ZVK?zTp+C(vj*rq zre0*ZTR%sn9`4BUqa`iQwuwP$!iTu9y z*^Aa8nvPt{NV`}cy5l$vTGknczicBgdPa#+$B~_lxB0^l39bW-wL`u?WXo>LbCrxs zHO}TPn@o1wSYvVPGZi62B3}9ADk9<9rEQFD-?ViCJHyk~ulRlQ*z07+ zmqT0+dAd*&o$#ah@3U!@BqPvJ}Ns=MjBuIqf9PCEedGznEA@4tG^@#xdHP z5}hhW*p9vTm8p^F2zoA2iJy%YoUT99TiNM^!6xPDkXY%@^R6F7n4GGx+4V!RemOu` z=Bso5M|O}5LA6BSOdLB#UmR7s1}UL!yoSsl_4aP{66T2X(LM*|9)bk2fjUQG@;XV5 za7g2iD)Klhxr?NUp}g%l7S(du@pSRzjsod24a*3J?<_x#8}8QdV|kf7grum zMHRS^M;MRa{Q64RKHpz0W`#~YUyQ#oG(l?D10Z|E)=~C)c9e1bRQzl_KE8L*d#S4H zGq*7)2eRPeh6YhjH3bvBj1tQl|SyY`C6lvas01T(9PNZJK6 zP3wxPDqmT-KbA4>ntJkBD=r{uh>P2dKe_5iem*i@&Qi7(JIJESfjBKGU&VlMgWXOZ z+grrgAg-ko&vt-qp3qk_{Jyj{S5C8tp_aWI-lcFeqdCorB>t+{;r}X*a{YZ_D7jsx@3ZLF5~Y0 zEmA^FHl-=O@oYTk=b{3)f#6wrVMR^aAFkWt`K!X;*hkOEJ}h?qih1@jUzl5Auc6L~ zxmKdYX`}A(wIiw@Nvhre3EN-J<9T?KI85Pa#lXhN0pxf~!g)YyRJC$%aOPVO z1|N}Vm(EBijEx+5zwlamO7S~iGl_`D(3_AYNv=Tp-B zLfLb!LWW&-P|dCrm$Sp?uU4-Z9Z(L)Y`Z^8vKv;BwSQutkP{9P7Ks==4@J%CYWj*9 zM}5&B_xX$_jmo8fH#TZaygRjP#vD;JIFLu_3CL=zp!gk|koyVmeEXBMat*taN>zb& zg&Kq-YKy~J*#7QCz^h^O!Y`}mn!;bvx)sw2>M`%V$C^-PmWPOs%LdR>R9a zjk<;fPnjUHaeQF}hq2MN56#UAxS3c@3Q9#gOvfR69IJ)f)#IIsnP!H1MzFJ+M~v3H zm2atRwZuz(u=p#QW$W$iOXDKnfSyYt`5~>Wm|Mz|({I|E$#NdL=fer>#3u1y5dSj4 zhbTlcNm<$ZXDm5+&{w;^Vnmq)aShdk!HJ)q1*3!J?c7eue z4Ayl-cd=DH3Kr87G6hlUw+4yt%YStriba0x#%6h8yWB{-wpg`bEXk>vAuT`8CMCZ= z-ET)=GS~U_weHAuj!N8$QxriRCC_$2*OZ)z1s7+y0Y=tKL9QtIwdQO;E))*V`;X)q z!yVh(pIlUb7qE?K#Tiudee6%#>#9!n7viM7$pyuCMEsl%le^k_Q@40@a~s%d)S`(E zEoa4Rt!`>1A*l{oFdqaZ%8$Gp!HH!0fyIoqj-0fBJZJCd=cuTUbI%~>YWI-?Xf_iU z;p(r4yd|!ntJP(HtQYRCvJmF3CM-fcN?4UOu~xNlO#K4l9UutOL;i*TcD40HZNfNZ z48=KpV`9#O&p~l1lqXnxeu_{R(_Fy18x?Do2vyIpfsMNi==h3*DeaW9KFeGKVIEUk zFA=1Sbsa>aOw&?cN(-LAsQGLQI*QKv_J(QxZW9@`w79A$t3iTm_8RU}= zPk1~jn1_ubHVP*Y=ty%DSKZCk_LL+S4BZt3ps?hcWV7U@v&+g|tce!uuT zoaf$auXWTi2^OKA6T^5VDK+&=LRZ zh}nwN4f|Wi2H;M29qxDsS1;ds?$L2%vs&=*`}(}x?fu@t5*h?7mkz7o7{o ziz|$({9mgQP|Q^QNr%LsNmqXDY%h(Z4D5=5G#s8mXc;bGXjqNhviHGjue>Uo%4SRF z*bqwj7Nod}m)P&L4UmIEG5T06`^F6ydHyGsz7w|bSdf}FmmV{OAIoAn zvSLZ+%SiQOM*3+%Bp+W1Lg$l}=r{Uk#**4isDECH=%jX5K&c!$Byp5BG?w8J;=YkIeXoqkj znKUFjOl-m^nECRn!;La!Lg$gJIgh_m;Fm}zxFr*;hzA!C9k~v(P>w8rpF(hXh1ovr zzA%Rm`6u4?vDUSNLT~;c9KJVF;WP;$)M+Y!vNGWDe8gda@!UuX;bF}B<-Nf*2T4sj z3>#r!`)cWpK08bL@-hHE@LQROyQGIdK{mv!k;3mAV~Y*& zSx9%5c6=H`R2c<5TZom~S)T3I8*R!KE9Z zGy!Hum?_Ifj#-ah^FhR$lt)QpLd z4Z=r(dZzP@l^;2su|VZMmnmOEH~2N&6&pO_5y1FY{2%~AEy}vnB0qX?;I+BeKcB&f z|5-n=5l=bT!BIq+;RyxX6beD)7x>UAtobc61SA?P_ozwGiB-Aj_c@!Lx0)r0&$Q*; z7-Q3p>Q8fJ@t8ETi=ab%YjAt}qA~>G@Vs;N-`I%rADs}msjm0>eWY*01Gn@It7Gr) zvfk|JHY~V9eI(H5^?}anqY4?%?)Xku8F<& z>_)a|3WD-J7>6{IyHJ7Ny`sr%kPEeFA5=8sz8I;*LW|uf$ijVCB$3K8y`x{FJORg-`CT zC}*oRScJZ^5!az4e_~k*L8Kie5o|%0U=n+}6MSoXJV^q{avZhx_N7Rh6~0qzf$Y&r zdu6)*)REIY#^T(0%7wuvlqQEMvE;#rG+58^o-`ukh`jLP##HQy1~6-E4c@rB3Pqh8 zDUnBX7mjDFaBO-{#bn&eWY$}&K#}-hW>rwhHS7<%)64c=7yoZj1-pKq1+iGlPBJuV zKWWI?fcdcbKl5WJrm2fffh~(~uvkVjp*vVr(~|$L=|8=URvWRpUf6Lsh5vzbQvm?> zx`zl(i*xr!4lxhdG3~Y`Q1gGiOqdro9<4s_DQ8>s)cb318F(RE9jSx=U_oa)!&<@6 zW>xI-V$Y4~$-l&cpIC)?eD<+JdcA$LeW$*9XCE(FnjzJSg_7=*jN^W1@WeUBcjDH4 zDPL7o!srDPfz9aXRG;qPXHjo@CM^=WfXt`E4qzoma*pJ40+uSL4biBj23qPqe)@#A-O+O882J9sS zx^ICqC-ENXg873a)hiL?Yz@}dc-2eO3P(wUqi2Mlig-`}Xn^2<>c-!c)nYA2ANpSM zuX$`hTok?gLtX^Ds38~f)saMV)hGjY49J#-6JXcd)fmPuT>MU&!;gXb^H(>&Zpei{ zD6$?;nhRf>Cl)J|l?%H+@7`H_THjT#q2NZFv}4$jI?{y^AFw)t(<3NOQOC{@uK$`a zoPZm>!1K=HBz(h-CC8)qCeFF)q=Y?4W0+Y>aYM_;Ck3GXj6bx#QiT@aGiN1BTVkl{ z$_soMv^o*z|IS*ibD=5ke1x4mH+90p^=6jL+vCqdmy>bpw>AThce8)=@3y`C^n)S` z2As*5mQq-ZofZMgl3aFv4EY~!kc=DVgPk4%_|XB9(t z&pkSvEgC-Fd2cJ<#I~D^+)wy<2|Dc}KteTsyumg~<4T`RTwO73uT1x6b7?Nz2m-zv zqyOe#?uynui^nat&s)saS#K051fD3HM8_dfRsv_4@!qD$rGwLBE5@Z2j9$ta(Iy%Q zyI?(ek&`*!o}zI)2_mMe+s^6{Ncvh8eAY-1@6{vYFcn>k8*Sfm zy$cr$g*55TbyE3$Y-}MsJmS0A>(>=$`3LA|Pq1!y36T*z%Y;3sBPxQ9<3LzLbMRC2 z^lI6cc)`I^f-xhbbhyc!6GZwVIRv`9)wSdf+(mLG-yGJyMG40l%UHu-3#%X;qlpQ4 zI#_zNF=lp0{;4(>6BbnpqPK82Py0fT!H1JSM(`6+d>88_BgyPd;`e|gGv!)&v8f|h zKFe}=GlJEsk%FxPR7!jXRBNR>!wcL`rav1Gca&M6@ZFqE% z`4Mh^%VfTB>88(OnS}XjA%!~1TgzdO3p7|7|926;mpc4??7wq26+B<|^nJ2fDzywu zFo?l1EdtXHOpk5ff@z1DS-<$rG(ZFiXuFs|}Y34Kpxiz9w9v)SYh`Qlsa!LK_OFPk$W_-wQcU; zqnMAG5Q$Prs$WQkS8`znPLX==kuQ7CiAW{Rl1k9zUL&)gL2Ky%RI6%ljx`3Lym78HOG_r#NWZ`h;UmT; z8Q;NB(OjT-ypxw`C{7rz=Ah6?Ilf*d)0!r@p+-^-rj8xi z_6SQ&${Rp@207;QK;#<376gviKcGm_O;|y6$pBqF&Tj(sX+L)PBhju%zN5&)Py{q84S1 z!u8GCK6^gp(|xu;h?PPKnUh7Lmhp+RzfjWm!UtOhw9(KveIW^uIn_ z_4XfElclN`*ZUd3r=6|g_*_mCYn{^noi)emliSaY^fz<49-|%;zdlvkVbJWlK+ewK zY*{HA(P$@!lXVkSTpg#-w&~WQVm=nA@QV~tjbwOd-7zb2C?(IOw{6?D(sBB$ncUFf zOE(5xIKJ9Pt&il#NG9BsH`1^QjnQt{9LJsje&!xuc&TL(@ zAuXdsJ#S?ulhXa4ohB~W21ju2HEmn9;Ale><}Dj~ZAt1pw2jd+HpPP}W)J-w1RDseHl7A;l`H-f zBR?QsBau>#e*U!E>9Dp@ArRa{F&#eiGa?C9X0D*u+HD^SnppyBly#h5H*jF%%7=!sw59c9vD zehhfcSO<-^K!2XtS}}-6ld)lbeq<@ttMA$#^BVn6O>T$3LxpcObE-NtEn)SH3DAgsjf%Hy@L@o z>)9|}Njhf6u=~m;LtCH0meC4`1j`X@*Usz5Oj(WAi)jVKP9?vMg6!#`W_aJeyzA9E z8Et=&jhAK;rplBlx~kENNni)V)@4o#6iK~r3DI>TTeDky--t|0k4HK@%pgO9xQ%UD zyh!gX7B7xtM3{)5K!6}U%CGpooZ#bwfJBA8TNJ|w2h=#+HMy)2qAkKu)x~cv^MTR5 zgRFZprT~ARVEa$0VJl_teYh6S_m})2e(B2S7D%gA2}!UY_BEL%&Tpl&tiC2nrB;xd z>BKo49MIQG#xbHH@XVM6HDxXHxI_x8HLWh^aO2<0Q|I4KOH9SCksvdzy{{R;Q_qkt zt6QqxbuiwIc%>4LsbH_z77CuZ(N3Eh{Hjl*tq**sjUxsbL00hB%O`K$_t@x|s{n4T zNd=a$$ae5z7;Rcbu!eQO`0qOBG$j8>tyuBKRunfzdwqI*M)DkXw4BTY9#k;h5lpSc zQ`n|Bngm4zP!!TzK$%?Z-G;AmCHO7HG zJ4a(MJnx8jrjb>P`5nQ+l}d5)GCk*Icu;gi*^oOINvafMb|ZIakvKmN9Bc9!zuX@| z8c!6fcJBtgI}cj%Z*hu}cIGcMT*eEDaRt3viG8Pz`YPlFCsx%E3 ze|0qp+oBM@_a-zIsY9^~(nq26QCP#uvzBLITT-Fz1pxTVGcnL9>X6Hfuvh0pCi`ERa%Md2+UxG~gfM-;9Wc)ekf>K{tXe9Mtf!(RFbeqz0o?=Tkh6Nvrj3gQ`mk*o^N zm!-*o=#C|``9cYa3e9*JN%R@qkelPrEPd#e)szjS?u45l-g~tSiv;RefFk~@$ll69Yelw0B?`5LzC;tmCJSyx_+HqT%Gc-2 zhqa7V;q8X$f6QtH%hylOT@X$Mzo#h71A{SUK$?cZ-d!_6boCTtWx6T|zRb+Ik5lZx zC5dG%G$-g=G*YM6F_`aAlH>GIDIqE;_y7oJh498JT}+&LXR4d;+c`H(r3h&!=?z9x z4Q9TKSxmY$n+qmpaZ(L5^RA7HmY@KNAqINP#5>dVozR%cDNn*ch4az#C??EvxggEz zsSOE4zWxw3&F#htFngbgdsT{RM~3V7uK!%; zSN!T%2CcRzG~5cBOfItKldRJy+p^9QA@i?}dZ znE+cDmfM=j?ciR(FH$XL?toJf-0P#?``x(7+V%+5_T&Q}4ryu>>On>|O2>w&hEpt* z5)Q%Yc&uncx(~56ht=CiOPu^_jEY%zk8Kpx8pu5Vbwy1^yuRo6Z{#hTke{V6p)&Tv=g`ZHv@IDp| z9-YRIOoK7?Vhu_H48|kcl8_9){<@Y7i_RF`qbV6-7s>n$_Pk7Q+O8Ny@3HclM47Ac z6zq|t>*>*jzQ1Q3l^j2@k0ZK+I`N0qp{^YV!oBYzZE5 zSvR>;F(^9oMiSA@_%a>wFdl#lN12STlFn`{Qmaf}rDn#9RS6j!Q3~}X zj=UMxLXAIWT*~kt-mDJCc)Cpz=ibFBQnyK#3pFG)Am4l|0PbQn#eT`Vij|AEU5G%h z$?8@IdZ=eNwR^{eh9<;Pjkqg_&CZ`Hvor z^fGvd$l6WXOdtBDp6J#m__((+#YK7r9MVZZf^jwc^VldYv>MnCwxEHmjCA-@!jTj?aPs5l^liizJ(^&FE1FpZ{Ym2#`r~ z3$WnCaEA?+aPxO%`B{1|`gSd*Ka{eb%NZ?ZKVE^@Xr40xBKY^cL=YK*9#^7FK>)h( zQSI76fgkV{B@bpHxC!faVCy9_0+fD8)Zyl>Oz5wZTeI&x21V>$btPM->8wm90k^yf zdoyGD<+a&Jz#pF3h!1alyPUX(tHDr~S87UyD+l>$24NU?oQO9D4|DnM<<{P-5v z0EfE~)@KAjemmaKTCM0`k3tG8krF!R2_~LbrBR2%teCVPh=veVmQB9mWCw` zRBgo9P5Zjdo9INN96~`85TLimeAWEwn27-7gW?#U5e%o(cE$*1-b}L?*H}@0i!8#D z>Uo|PP&r6F`v|C&?si$#j^150fj%x~5ONvfry{1>s%V^z?BIVI6%;awoqIAAE+1r% zr%okZN!tCI+p9joS~>M{6SzZ;3?!2Dhs9X!)6EG?W`;1=K2r-_=(Wi~M!Bb|OgmT_ z`2VC)SopD@PttM9_!%^JN0ir>nt%q^UFnwBe^6%XTT+3YDSb?Ycreb%B%%D&Nya3+ z2w8xJsD7FRj?pAvgW`tTb`Y4^yWJDg1&-?3wn>%6BsC2_CNkshL&e|3s0g6 zCp}stZhun&7%~}K)l7`s*HIU=ZT@Ig^~ciyxVAo{|#log(TGcqhFz2n>YD}PfA{!SqL*%27i3L zVt~5xwo(|dpyWNbTT%Xq90l-OjX0{cQ19gm4a+43;MeNTZ=^*pQErF466HVSl3n+B>}KhjI4M{vNuAyFoXS1WABDQ=ro#C9LHsinW@c$u zat7*s0VfDf|5M;;M0)rQl0tU8yk)AY$&F5i9w5cuIvS^~N4`8Er&8j=LloSD zIB@a!n7j^ZL*-A|ES~z_uESM3XAG>{e-s_b5@Y`0H<8?2V(vtNLcG>P#L70QDc=)3S59YTUZanCyxMgJ9IkJd@Js*GAR@QbFvEkyRt*ihX00jFbI`A{T@Hi7a>$ z9dv>9Zj5Nb)QrZRk2L02K06WlI?fU!y<7-R6wIRSDQm0??g)lKHj%zN!@_9%(a0V@-q0Y8JIgQw0k zW7KL3JY)7Dk5n5?r)jU5j0mN7vF}HdGu<)aLXMCHNd@t)OBd>dOcSQhVqu3=2eTsJ zgNs889adQocnYQEJQ%-no23VQ4pIz4bPKzPwc4-DLBR#uam?%N00hJ1njr|mOjTE{ zuR*ca{PW6n35vM9iK!*t8#DOOToBZaHj4?8k)~387a3NBLhj#R<;uK?z!bpJAS{wMPPYv6QFvJ; z1pm(5kCd0#WeWoFpwEhy?MR{TpwFJvXUtWgmeSGOP~>%i;$uC8L4s7CRaGSMz)fV7 zUH@X6>SJwD$y@wy2ft<@D9oe0{#fa=1O4+V;?Bu0XBj9@M&lTPmY1jKr%$u)t-%0H z3-xW%={G`|GW$M+@#1R2?cK`Es+e7a%3W&Y1={ajI{pp38a*BZf*cLMk@lcca%YXg zlb1((z53>tdl)5ewLO~{@W(aPGbV;*m_@yq z!qTY3JAN1dwSq6%J#P}Te0+5klVk5cW$!ppnl4pN5rBxnk}NjD;mr^O8WxI(tuyk`0_N-ZINriG=?|u0V*1~khV8VY1|dGfHsb!! z+(Ui-?Et=|dkl0Y1P6cph=LaS8TfA9T!yz?PpqW;y^36HLg)!o#r+qiEHMP~Vi977 z$7(}MP96Xy$AJ4j@)5S$ z2snd)MC1dM)y=FAI%aa~((I9!l;V~J2~%)Ps1pnWdtN_h)#4y1#Z|)Fy9R6MzFoTe zsG`5SF9Og>19#F$6A!2U5?$CmJUloKIWH2K!Pd!8Gl`-1B`tWbEj% zwiRkjD6ZDTM|sd?csJIOZSX&P3A_*kqq5%5i_x!yzuk!p2uJdXg!FMp@@_6aB7IoK zTfZ~n1_C0XsCgX-MJnqGCJnx&_GY%K+A@wwo}wu?zoJ5#%SCTshjddm*NlVOA60_o!t^8= zI0W__5IW`8Nk&UmI_i37>*#cFxlw+_lofMOq0LpPidbt%JRf+;51US0iZ2wkzhXBU z{sXo$ZRM!4y-fB)6GIa>mYK;(pHg%hKn`sr{vXS;Aw-_P)O1OwGV)Fmp4(3wz9Z;JL^LazLgBqs3c>31Ete zkvJ1G`mg2RFVoXBnbHFFXWG}DO5nA2ddz$^Q8rNcLw=sroH}ESu(vXg%7D4dr20c9 zVNbh2>kz^V5OkSK&mtMk#;7y~;;>bHPfBU~h1=K)Dez%9_oT_M9oq@hXPaCI-KAEa zu{h^qo^D~8_;yJU*(bQ2%Oy5pYPXS<8wW+^w*v_EnVFo=7Mxz0CO69%AvIkDua;ml zz0U!d&tone{&(zC2X!Ary4j(iv_c8}woL+hqX_34lAb%E5GR|RK3+PiU)tc&EO!lKt<)6Q?q{01?$TSpi z38`d+Wo9~JQFS7;L2m6=S4)!eGXEzn&)k-^*? zd1y`4oT}4%G%!z%}xCXHc>M$mhmTVAT336kckoBel%Bj z)&g8&jvAf@O!Xhv1y`%@vuHDzBU2eIKJHE-d^ihaG#+dinEZ??qTvKcSlIFl81&S% zoHEM=3Op{yn%GAlOe-^MQu7mA{UvC{^itXKzvVGn(In#i#7D#%-g`5-t%^txqr;ss zRa0U@3P+4G!CJk))@m4Yv!C;=t6-d2%gT=&k-LlU|HZLBjegiyu>*aHJ!<&T@twR$ z^k4HAr3$u8`D~&vUEwT~q%_-kU^k{QgYV^l6xU@aP~?)2R7Ni$;PRB>bq>wO4x z2Q47emNCk?Js?qGe-5jolGaEsMPNIPaN$dtXL$dp|N+K@#;;e$!}L;e9} z9|)HU8%z}N04-t!fy*cV-| z&}2yI^chFepYwSOh4h{7N6VIfD{fU8et0cv8q!pPWz}4dDhN9|6I4wEbU6S->l0aK z?`%!J%XqGI<%f9I^uH^v<41c29XWsR#SV7|oO?9xCy>;&NqxDJX*3)v0PF5mQe}Es z@{;McY=s=QsWN-j8l0i~VYxwu_RW_Ls(MO$M{F8D_^*6~WTdgNv!&mSpEEAgV7HKY zTz%Wg9D9(mFuZm&NL&x$k&5rqgW!Yx@a3u(zOIv;Ue;XgsP!R%QYvY);a(757zH9- zc4Ud;32BE97bj;-a`!?>KVi0llNL>XV{9ku{Qmt2^8w^JR*d2BdNFU}#jr1+?>tXidnE0BuK=S-> z=h>P=fbRnz5T;}T#2o|*n;igrz#sHq*Bq9%ys)H0F?pyPCv1_YM@pkxZGk0jT@WbQ z5KDokY=z2KTuDMU4aqZi^4=l86&mO^S~CWqFJ#i%2anIL^fydaUH znXJV@%IYSNofgsOQP}Cg&4d09K3VJd-5y#GZ}o0}XOvHnK&sdphlZ&~#{|6}+ePr)l?$_|NKwLRKN(BdZ3 zo#DJ@U=>sU752Y!1jPp&lbVL#t1ET51sA7t1e0$u;%X|Ct*=X&mew+NwOB)Prz=`#`&@WnIu3xwe)a~C4 zL3v7x3@n3V8V#$U@_G!`_`vmnCMluP{oO7rK%lLl3x8yU+u<%d=vI7RcD(rIYmub< zT~sKdn`Pe^#RKp{qrZlIH+Iz?rGH+&5V9Psbt{^s~I1Ml@4D2Us9a; zf4SJtwo@OBo~(qNojBF^%Gy!d?!UHHei#89mXzm%#QE2`WDj{{{~$+0LOqi*%6P%0 z%3*@i?u*OGyVk3B*A@ywsLuGBl2XYGDBy!kJtwQF*UaS`^K4pW=iof1FET}khs3Pk z`NJ&y!b>98;h~${_Too$)x{x$R6!8lWcpKg1iM0@TPL@5L~j{1C5nuVnU4R5xHDw3 zqy^a<2LKeQ&$;g-_YXS^u5A2l7-&=BGi7NvGn(RPbh&U4IM@v9x)hMm*~+kBFCBdP zu4W6LX$?j_MX-4Jo@9aOZxENUak7i;55J?NPMBy`KM7T5ki?o8-nY?+u$qaWER8=g zX0`0P5AGVR99*~Hw`{`*p!!-^knJK}Mz1=QZU%3}(R)yvgcrj?|fbhq#uk$67 zMp4}MhtDq#SrBar_6ynA{zL$l`8iMX#AmJRP2+R3}^5MRaqpmbj8GW4!Z$hLkza1`zr z@k1u&zx9zVlB`!`#B2Lg5tCAMDrTA+UfcW6Nk5kMr}E;uAB)ID3+Z}V$xKiXWLCGu zb&@@Pb=!WfDCLy2e{fUTg0SW%7c@zmHGmJkn5=1dILIl&6ZLKPV0MRz{m^T^tnU0UCMJ`aMmWMX6AQLqmL;?q?P zsbsx@f@LdX-&7D>Q*qjpw6tK(m1T$qYAVZXr#d;VCrG*3N1uYBJ$*>h8d-xGYpn=o zUXj?>QLCMN@Z(K7T^8!Pfq%bg=|gHJDV*VtQ|Rre}=?E(~;cSh>N0a!&!`UV$bA_ zrNERQ=kmQr#)YKfW1eZN?^ZaROvEf+Yg$8b;+I~$(Pc$u*9{X-G#3IEkEt*`$QSVIog6J# zA`y-Qp5M6VpbaKYFu}LMRK3jUvBOu0mF2z1`>m?1rp5!TB?KT<)b`${2^}{Z=Kap0 z{@V3UP2Cu&xngy8UO?MRAL3Ui;OO2=NV3gbgfYwkP86@NxCxSNd?D*Z;Zxl1p2TPq zrfV*YYx>zPG-*J6HTk{i<}%v5b&p^5)+`-ncA=7+ncNZE0?ZkE3V~-}!vX1E{LVMpgh3KmU##d}~-$~?0L z!|)PA9W6o#giPgsU|Bd3WY?@A&mz2kBdC8gH59E4D;y?C1g*@8X)44>)LvUB+KSRrZn=Pa@>glXfFN%iKv9F#NG)hABKjwmrQf`7$ zE^WH##}=w5_T5xu{lMbWSxb-&^K6pkh!Q&d0xdri^MFOgdH#*LE+|n)iWM|pweW{VTV9CFXr9w? zT@lQL5&`5YX#i=(c#8(v!80ed^u*m4}!_GKMeCmXy@wwvgds+K#6l{NU|Do5{(O1B!Z{bv(e>!|OAEauS zFeCzQ!T5<^)IA>Yesp68z2Lp{xE_t0@12s0l`&0uW2#aSd@}jt+iIPR$@|wAI{##s zO~&Eqz$0ku7AcgPbRy%=czUPh9_h?#Y7j1-_uwi+$vayFT~X+LPFx#MV3UgN7xq*W zdRE@0<>|@hX2qG>alJKa2Lf$fQ{-%T4DfS`J5Uf9P!LYt8I`KK-+Y^67+c?upqH?A zbu+jCX>IsTy&Mr$c#Z{Qw{IN)7_C$@ll$C^JjFaM4UaBV3d+sjB%0sMUs6dF*N}-xms`V{CaT%m*h#p@O z>BQbq6`f=qyyS0ry8-B=tf6jBpPis4XrLe+l{eb)ECZnKA49`I8v$CsCnT;z#CU*a z3rJ6pN9ZOU#7HD0wcJsit~-$nq-<+5xq1!z^C_`6szx(sQ!bfJfwoLDM^!hV!6YSJ z+0L#W|7eCMNd}#2)Rrn)R4P|t<_mHSDlSf8mDcyxcR%pilbomaJVaG_erwu*dH6n; zqfkc$7&t{y139)h%fUV|pyCnKR07)+)&mzNl~E!yFB_feQ(|~4lV8CVewB`IK~pJV z&M*5ev^{b(giYFsq`_n9ZtN>{C@9!j#P?p^RxU&>uHm3yb=kO%=F>&qmOf-m(WdU_ z|GyTDdlZ_dFE9Y<2rhwQ#LPA(L4NcFlH`}C(gvI9b*L6E0yhqi4ydqdDEI}QbYJ#w z6s3BOr4oJ1EEBU=s*~`r&>xDG?ao@fK z-5cUhSAgf=s%@m1wL)&1?g>1;v`GxC45skT;j)yN7-vDMotdI z3OSDKnsivlGMbhGKdZ2B)r5|NC4od58dXW%bW&>Fm^=Eey|!iZb?s;alW-ume{ME6 z^-@gBV6DY|joezuIF0uoWhvV7FGr*jd;7XXF#8r@)E{3E0EdqiKw}A+tfszOT1xAM zI@Yp=1WjEk8mu1Q_};EU1QG6i8p@7^)KpTH<|>_KzF@VKS?)}5?*^>Muh{Dbomv}C zZ)MM%Wl3xss_PQ69Hptk8=e64H@5$<)w6K{ka$v-q*jkReP%Hpze^vX@;;S^oiF#p zP^ZC<|BZbn$a_rk_ND!%!^nzsbP&HxMfr4&>`&zRfbmN4n7}mH0brX_P`(N#XNl#< zmlf3~Eab19m+!$p{M;v`C0hYbGa_hx+LXnSpxzr-XRM%bQN=*EL!~-s>=JoHgqoiD zmVUtXU2Q0#koE<;u(ea_d7+7=)KNo`nZe3H+js%Zapby%dzMdg8Q?dPc>0LC=XW%$ zA&94IY=F+HD-W#y=xdOp2alN6y9Fl0=p-sQ1-ZEslOzb)HC zFhk+y8%GUGuIY{$8=Ly=tk*N+t09D{jR&g)Q+MN9*#U%VFjBCoYKH{i_rn4lrfa>o z|Ip`>IH&N+O+v3&tywmNYXlqo#0uK=MYXTRWm&c7fih5AWF1K^{7`h}&tQ%WMSXlH zROqnOkl9@Ep_(hq0c+Lm%78cqD5!7Hhd0}Sm(MfNEQPfILeGVu3nP>A1{j(9C!*9% ze%Y-f92R*nz*5!ps^FtUL*f%R2QFQZ?qg>85EhKo2PkKZ?fG5MUQ(OS#3l1T7ru+F zj{*hHy1JjQSmy((?D|kgxB4pGy3VpoV$y(Rb%Ou@QQXk+LK+jk1>2b~=1%HZh4Dy`vziB=x^Yls~C#>020lv-;?LpQ~-2kH;EQQ~}+TdG)vi3@3};f$5i3CQ3^ zYuR*OoV=rykE7K;8F2*>kUmk|ppqG+Wg5r&D9;dTq!bzT=#>%e^-IZIqXezVLBrT& z@UWkNe@2~93z#=99oN6=eT_z!x91M{2FA`8&61U;EHu_+{`Z+zQ}A4Ix8FtM{{Ptf z%BU*4w@*+36#)eWk$R*XrKLqWr8}j&J5&UuyG!Xt>KwYeI}aeufkSuCMxXyXGi%M4 zS!>pOdOykWu6^(O>iAtNOJpgMtw<0u=ihwTrl^KTyoGbW!|`F5VD^;|{;*Ck`6BwK z;R!>C7GoQZuIm}L!o>aW6XTd5)NV}ssjS7%Bne6|c$O3=(!|DcO2obc5h<%vtQa7IKA^Y(eaz^nI_J}jXD6Qbc0+zw*m zGAIlpF_r2+duF^JU?lZXDB#CXv2-iSNV9zV=2n^iF}4MD^%w0|x+=}D5%*+(Z+p)n zGcHG)kIj}gk@-va5Iz_UmCi7B(sM-TG9gZ}QMBu+aG7*L>S^TK`ae}ldtf4`t3`*4 zS+Go=c!Y$kP>Ok=f!pk;I~OzWHnjn_M&IKy?9^)CuV?9YyHgdXu4(;7Bd5 zQBNYajdS@nDLd2>L`LZ_uqL%P^s?e#6x`!(UOu7E#8ZB2dT(B!9;#i)q>$wuuwA^h z1As!TH~iTQ%?dE+i+}q5Ts+rXiQ4Zbt;Os7rw1K@bJs%jRGxR}QP$xyB(hl|UGzI{ z_&}Bl{<|`5m=#psfJY=E?{IQ)LLo3%Td_LJuKal7>!>LA_aF(-0WAGk`b#2n8oQuR zBXSrK%_V)B-RXe|Lo6jl_-`$PR(VcOtlCKd8NuQV~m%VsU#5A;sxAif^%f2W!v zV6na%<#KXl>0(A?!t>d|Xs6GdrDS?=5%hQbgnWqO&}rE3oN3R2{281Vn#d2EoVz@B zFNsQTDcvkO^}5C)G@p3%M-UpQ=)qV!vgOej0_~u zxVm?()qPlQu+IR^jSYtx)EOOxcHyV4N>Mx8W1m86nCC2Aq}jL3u;Zzt0>tq%$*_Zg z&GV8S1T?JU?YpbxzgXO#7f|@|2zNjV06!N&KF*F8sq|(Fg7m&tlTDpz=v;hi6_F}?!{@{|?Ly{}xL_P%Q^5Mf!3Uv<6(a-(z0BoMwi+9SaqTkg#>?mqAtcx z7Vh2pH*2+T)_C~?zp_=^DTZ1|e#lm#W1_Vlgs`z7dTFc5)y!=)yBXI-q93sE$jN)W zci(K*?77VK`%s(xh#R+Q~3K z_SwGZ*lrDT=#Mw+#TV5Lh&{A|&l%X$hAv(%Jbc;)oh`WA`CHg`HO0zn^yJ?xXia%> zY$BfiLyFS#=9dCN5Pa)_=e%*kN9L;KaGTbp9fi%{(1NmOTlM$WOpd2na~su$2FzP8YrqpiD@lmitMf1)uah)UIlDowLgx;4CIVWA`=~L--eODx>>w0 zq42Eoza~BAJ$%bJ8Q@=ev~=X5hW6KsUuq+grCk-ylG{ChyStG|2W^?vp5IkS1!|R| zJSPJ+XDyG$!`L6Bm17Q=bH6bt)CN0vhdsU=$w}W%*ORs^itINANY8Cb2CVGrJspQ` zb)d7%O^4T_1pw(B^m`ENeE5N!-7XZc0m)L83yNq5Ii!L#^uAxITrXC#pbdEI`eu*v z#E0BJaTx@Uo~e9t8hIOS_`46)_Yv|b{mzas8ou{kUhRy)ro0!yLl7r4i6TRolRV}n zz-b$y`%$$Iokcs&O|=MfK(P&vM=x10xL%c2mnubaFlTN1%ctRr)FX*W-I!^U`wo+i zI-^egAkap=9LUdqa}}h(l>NB8Yf;Z7cl&ARwr@Ayo=ud*FQ^{V<~}t`@2c&7K7)kz zyBVdYim}v8y6~A}!9RB7>w@1h#(aCtmq=hdK;2j1FUGnr_YR@HWSDx=ZKq)<6Hr6Q_OlXKN8P8$@+TzJM)aIEAUWv3 zRqdt7&kapo0e$O~MVW5fCL9lD+K$`%mK__~j;r%g3SKioa1-)p~6CIl7WCx&<1X52k`&E#vUN_LjxZ=#tYs}e7C}f@Xbwd?wN6I)TQcH2O z@5phbWfo`MPTKAqrfOkfq9=v|)5=zU=+cfCgud1f%5fmbfuHk`W((P-W)v1iwI)-# zTTw^evY{)a)4mqLo2YoA7YM3Gxm#068=i-tQ=<$RvO;o68E$ctQBJ1Sa@yiRVIdk} zL=b9xV0Un+?$XP$2Q1o(0S4>|1Npxj?(l%Ge|wek#Dct)dyLE%#oYoGJE@PoZ|C<; z@)J&;GVmBE7WbN<@i=`{Eg{7Dbq{hzio)Y-6WX=!z)WCDZV)D?Ctnk;_MI}L>ZwtX zq3*g$rM9E=EZfxURP~agWyVx(C)$<#uvSu-H&`7L~=IWbY`erWU!GmxK~32z&7iUb+4*)M{62<(fbyUL}X z;gLm}Me|4C>eTss;;XQP>xoXUeV5lBizj>0%{g1R)I0IYWtBK63}X;0EhH7hLQ8V% z&Om<@Nl(RSGmZ4NM3d2HhT)ech{7#I(Uv79d#if5Ql5nb4U;ciMlm(CS+y)@o4N&_ z{#9|!`p$5O@O?)9JeGu3iqbtzYq7Wpi&>&;f(%-8*3}2kD_Px)daZ;a znk{{2M~%;IcIhlz@B$u?f|ir$Ee}Uwu6A6X!*;bG+>FQSp%Jg5dz~>OjdfER!Hgc2 zT^048Zs#3gx&VRG(F35LS%gfHvX}iqLC+*XDfZHS&(dK__!}bD{u5%5pkn z7n#LZcQwzs7b~;B)y6MFzNeECGlF>$ce|L_o+43@7eQsrt6(qxD|?McH8|!+ zi~&PUPFv{vaG(@l1+Ui{n-B=zCyWgUsRQv~->GuKGC1xZjYvO^bI=im)K{aT(C@qA z#}k2~RC=rwBn4zh)Cy?h$VQQ>9B05SnMGgDWEh*k-}&|hnc&GufLcy76!=D+pO()y zOV6e(>{dC4K*$4dzk9CM>Y`JxWx|WBFFz^D&<{W;$)#;>9HC)^Y0^bktoQ4W>w!j6(8#7d2(>HFoYbWxPa;=9VaWbohWgh0wIqJUyA;R;LdJ;Q%B>TbjyysI8lR36tBt z*F(=XO&(Q%$)4OFQXseJpCeeXN$>+qW61gL^>!B8eBL!fr#{c7gZUD!vgLgBYtI!S zXjja|Ll6cT2_qA}pijQTowea`BG`{%3k?X@5@b$NY`xD?3ST+0FjMxUZ$JJg8^G?S zw~Ia13HUvWu(o;x88d}GgT)xtGEhbJ3XN_Og2@`3`$~T3kNiRX{E+Q^ne~<{-`lqr z{HS=iS}K7}2@P4>3@Yq8rqv9HtLpvr)HJtwVkF;*rWtefVj9t?7M#iwaZ`?h@=sv4 zwfFU}Ei5Trm~;xVn}N$)fwy;pv`aaXfTUMiW{s*NVx5xmAPT3tJHUh9NSUd%+&HY# zxTMlL&3Kp3e3wt5wzgX|WBPF24sXDiDOohs$f4-v{q{2Yiuo^+g*TFgl8lZVV-vqJ z7Tfl^6QX?fo4Z#GSaGz9l`X#EdP{n1-QLt(U$$Iw`J@aC(U!xf4@(c%m)9e7zU!zC z4}7VdAlTeSKR)(VGCPJQzMyDAKe6#Rvp^scd|8b3jk6U-jeLDjbz0~5vRKWi&9lSw=8yHd5Ypk-r=N=*>&*L`*@5vnFxto1Bx7H98)pfdGR2n=eWjXGX?eq@pEG%q4pLag@G(l6N7amC4vea^al|i&J zo8DR}R@#f7i!z1mpj9l$6W7y3u_#7*Ctk;1O@MHwe38G#PD zXK4WD6J!+7$M8do`F=p4;H%MORtoN>AL4I6m)cIUrudR*Z*#v^Lk%)SC<6O8lf z=qF5psNO-g+DoF4qNl#1s1Lt+F2)K-O6F$0n}TiVFnd0FZQuw7DND&}`x&?2VW+be zzom_~X4GoV_&^Em=ntJ`SqcO3YRfQCKr@#(V3pLi*Rls#8-&yhpP@}JOnGZ{I=Vbv zd}nWmSOJEUkv$!{Z0u}J-TA?XZU4QlmL)iRbc%RTHQM_$e?g0-YfP9o(q!~+csQI$ zK)aoBALEJpAlRWN8Ja5%5zs;@9Z@%L=!8y9IRmRQ-hL{9+*0rKv)e7a!eJVPt$%h8 zvxlwXPV%n=toc+k6kgGB)4uzZ16)oi(Els1D|9?|dNg+I;Kvyr2u66}yDMNz{W9!-8T&0< z9`tLV5LKyQC`jb%NvOiU<7S9Zx%z-+2|nS_vTw@MU-zVdrvN5Yxqn*2m`yO0H5hc< zo?Mjk8+8TMg;C2?Dz5B1Aqd_vuUx41yZq#^ROedQSyiDr%6|oXUUOqQldf`eBe+=* z1TPO#@lWWV%VIh;asl>;g0>-AZY#M92GUD^P`#CM{+3l=v?B??h9y~ zMbgEK3L|ktg{6D<(H}cSKkutKzK<>;y{_P=omYFkncFbMmzW3essXsRB-@|bErFiYvPPVZ!)vc1PQ;Jo_0&@kl0D?z9*FXtQcPj ztMzyy*Xeb2Z>yFNa}rRlp@L4rW1|zNHFNrboj@s2ULkLv-tte{ciH$CTWz48mk9vt z>3;gh*>45~RB=G?or>l4@9C)bya_rZli4?X!4%^{8G0Xra}r?vb}LqHx4`-lEfi1u z*B0crsH33Mi*5^f(#Zkxv0M=zRWJ)NKuSM`p!~TuZ)JF-ZpEN_Mx$H@R^oUJwq&PF zXqpF@7wo>n&Vy0BRkahDEeT^h_1*B*3BF1nqd!9mt0btk=9%&sqL0g78^dK&I$Un0 z)}&%VO>sHP=(L831;_M%{%hVcQo`WDr-<*=OcL+ER{NuA&u}OEo}J0LFz=b4z>`&#jB*MLq2J&h!&9@o{VO zwYu({G*vbgPE=Qxu5zJ}!VmFiJOnOx$?15~i*MoiUoSoRKq;xb{iFVkFColaGzrqN z@>(D)dGes>A7c6{*LM4&*F#VDg(nJR*}x2?IR?4DvV@+1ON zfuGxXg4k8DO-p573F@$PwK^6%qc6$Ol*>RS%d^KeDH`{ncFrpoa#ww_LfVm-dbo)! zN}KX_*Qg-eJhvCZzLrP|Y|~@X&Xq*6>Jb)Mo#-kBQwo)OzFd&Ne^R?l_YJ8F!jZ!` z7u8U~7G8(S~@urM;F z7b4B;``hMIlP^ua4Uc16d>O9n8Jv5w0y1}`4c~8jHO&SJHBd24L8k6Hn4Rr{AV|=S3HYCloaak< z`wC}VdCjdWA7_6SXq0pqgE?Y@A$+F?N4>(LU#-ufDpwli9}@v=&6tBABSl$mx6eSm zYym_5K>|URD$7U9KPr9aJq8;WH-ac_UusZI!9EqfaS+c$7YR^V5$QyFWeg$jR{B*H z4a?hwrRGJqS|j>0NanjXQn4K*Pu6f{_|1i_xjrH?!!ws9Lj9w`_=A z@pXIADP9D)JMFL(*+HgIoweJ3Hw*{pgB4)VKkK zdwNC9X6lE|b^zGsSGab(>>#KT*`tn^kqRQ~OSE#1W7Bc^u#Qo{gLZI!WnNyALdg9t z=FQ>IVr*mnYCcH#iPx>m$foh}*%2;;9_(sg*SPIRPiq)yx{(?5Y%xorkii72G zv$3bKYY4;r{q~+Yw0drlXJiJaPo;(TrJ7Pe-(pJ?vLR0#;$v0IykGro{+7<-2}dv8m)YC4 zsesa{czQQjDu9Ldmh99J%9}1_5ulTe#mTnV;5*2{f=w9Wn*A+_xGPUfk`r4GB;`aEQkpd)ZSj8EYN`#wd6z05IlD;7Z|)jhM^WA ztus>Vv$o>r%7U#>)(htR(8rRRcRmV^{mk*()>Zd;3{J*--*OC~DdMH*YW91nUu$@P zY3I@%DnXG!TGKa7Q{{)wyDpS`Z@6vP-JITVZ3N>4f7*HIjIf4zi!W0YT*=5h%tP6G zevw9YYww^pMsHrTRb!24C}pXeA&L8W{u3Av1j!`P!q8dIANx%jT=QRzea8yLL-H7O zg)YnEQE+IX6Mv1Rr)9RV=|VQvMQ)BwUXCSh{`?g`#N!jE`E{jFp(jq8Z$-5dcG%X>nL1+YPd`8n>(p}-c@!<}9T(=L#1zT=fIv`13~G>80;F0BH6%20Ep=KO z0GZ3ZQBrTNe&fA}fKA)muLqLW{dQM!iR-v7NV5DEzKtTAdi(B*e^7KV$q>Wpkf7E| zb50UPwrE`>jhn@}gT7YNGlI_}pRK~_pY0h14X1m5V~>LQq1Za8oiPYIDa-f;sd#Y zcDUVzqhptwmjsumY>2I*T{fjxgzSjoa(m+-%2-VIR*7s=SYwXYpqp_z#WxF#s#Rd< zcmwlq{S(??Ak?uDAm$*K*I~PSOeW-Zb-SpbcjKMsE~&Ebf96|>O94G0T`GR?Co%9X zoT16tY0BM7k%kE`yzlA7YUZW8;uPL99k*HO?e?$6l$-oT9@^m_*(*^F_^g*M=v=>eI2o^n9%Pr5?lmlmp>E{s5Nj~x!};_dDqpH0koFDG0kXL zOWPnD#(!R|Bc>!zdfifZ0}bhnRv_su>9P?TJUn@xx&A&>MiT@u~uqLW{da5j3+G9YU>3JeCn1OS>p0UCopmL8 z3)Va5{Yq;o;M3uCTO0t}RY&%wMoh~Sh?-)n+8XMApiyATWal=`dP8w(gb=MsFVnoT zyPj>(f0(eoiiNac<1>?3RvTWUwe8gK{6LVn$3CVkXcye|KCU}O{9@BW9FhXOr@k92 z$DPX>kV3QT=cdV|v-k;`e6-VCJzeysOfh3f5$LtUOm+$KsZ4Lu_Fgr*(a(bkX&MW& z3X`J>3-`@I8^j(6nA*G)9+5S!viDxTQ!GibBAY}ZA^OYq_C2zqW>#B`MNA`9hJs>6 zU#L0`aR$>~az_kgNyiXVAFZ8m=*&88qt1<*S&_>P2MZ-82E|DJjZ|l5+vKpI>~DZ=Kxi@a-b-h5%ME5J4XTS`&6 zZoq&RFO}Z-dwWjt-9z>F7N3>6E$oEZazGU>9TTV+`7({1d45!fbtSnpsc-`1EC1JqGzR>|7byEk!PP2vt36DJ<{bj?GRJu-Ds4qfdx1-m^^NoE`-XN2CT6~CW{)68e>}wpg-DpXx=y;3)#Prr zT?F!FlC3wq&qTT@3`8Rb*LA=^E4-!hi~CT z-&zk1$K0(dGS9I03{T=eGr=1MEJS;SNgMh)qtDWPFfIo|U5w&fjHgyMTYI*0Nyn<)KQ&tm=LitCT53i%K7fgfu<3Wf@sP2)f1t* zMJYz^w2-9yd&E#<*)YPk4EL-j=I2 zp{YK3I)Bny-&{u7csL1VgBG)wR{T;j>y`KvU}i=5tm*Iwk>8Vs|k+7eXO0ndvY&uPPR?yvQV4#3s%v-inRcYoC_suE5G3pt*+;hn$H zUP&!JAzC@W8O-vFiXzLSiHW3@U7<~Gdgub%`9&4qzrIwxBv2PSJ4#?u0{uE{apj@^ zwyKYp7pg^U6s;-fMC;QXaLcvNuN{V!VA$VW)3C7H&`%$o-Qa4SnWgNZG4^B#^g0ut zjn39cPK=@ctIinZ5ArI+us~YqRc}Z!Az|An>^FQ%xd;7#SBo)ivT$l~WqmCManNy& zX!1q)K2z9gBHGiqbT7K^UU)55pY62%CMtnMS~}=~&pi<2&`+t-D*n-#X1^L0nkQw! zb=}{k;epXO=~*xa0J<2L;R#e!Vf_5JeritDJ6o3mvOmV@qkm+B$RL*Y(Z+oG&ktt0 z!_{P!Yjgjmtqh!X+v1vsVJO?@%x~+zt_O8)!%dXRBz58{{hr&O1_%#~T7aO2s(yX8a?l*)v6m#lqT zDX6HNHn|CZ(<7;KDvZ5H5jTh#YJi3sGuS)bd?jf66en(W8*X(PcwqNqP^(eFCnh*6 zTPHBZ-E|Qrpidq*m@tD~HB2F8`%H3BJbFCsI-{NhaRA*g6YSdgN)|x-^{*HH5P+?C zXp^t?t{mAd&k{X0TNMs_H#56kT>DZ#d#!^qWye=gyiIiR@haS)Jc=Ys#TFSR^5OQGeh)Gwp3p0MdYBY7OnJZB0jKGQeSC zNcN<0+8LknO^1iTe#OM*nFr4bb`@uxjKvZm|JCkK%VZ7$6i>!k;5rTAu5d?%tWw6g zt=b*h-Jd>Ijf09>^zqdp15Zd-73lirKx>XCbE{klcSS4ZxEBN8*+EP7Xz5`_o~eRT z)AET}A0FWCGV}k10K~FZJ_Q_g$1yj0=ygBu&-E{Ra{O+|K_d|j^yd7TjDFJYZ+ZGBG0$k9r!7sDI7{D8-G?mk-p+JcU(&G z!QapOtm(dwXu}N}8*Y{FzXUM-rn)=fsJwB2=TzUyXh3n%mz(fN+kMD+E(Qn=vw@_b zXUSDXb-Ch|af_yA;SXyiT;Uchm29$HX|4?HE?iDGljz24%o1`JV+~l9myD4}yx+nd z3^ zuvtE%$N_pOfkL z=U^?Ts`-NT6!z?2f>=qXit4W0OMHwt*u>A-_zk#3%QUpP9B zBT#hpp_x_2jrPJ%Ivy?Vj&@(IL-Bd{tf1qKqMf7lFrp{%Jwb`WtE+t|Ig?=_Ia$M_v!=(6YVI{W z?lmyvMz!}3U(ZU12zQTf2GZc!o@_f~#$m^Qs6{*?l}_b&u{r5$SpyXz%DuVOtz1u%iCx0XpHy*s>u=Yz`Y6ztlGP zP#8gf893Kf%1AwWn}P%>vHCu zf@Snh=Wv6Gv{AYLHTxA6XNW|G2x z!x&&kMEPoT@6`rN#ph?aBoag)jEutJ!t;w(!SOHfcwJSjB!YlIEXNbE`;bA0>S0?w zmkKe;k~(&RCoiGD&g>b>y(^pHzu03^`gwVRM(iSMDcq&>pS!aOSh?_U^TZM)bYX_9 z`gI(lzb)6N*|GVE!V2F$a&T6yCrUlRE!W2jPl_MF2r(QCGZ@6m2$wA;Z}@KiG||L5 z%-EXa@g2MvZ5HJiZdOs%&h-UJylPb|zsK({o#+u7W(qbx|D=>b9xu$p;Wal;s)DK1 zi;ir~>SVR`rtMQ8_t*}^^4_Er)l$#wv?)5-up0B+2|^fO+AEt1Xy?qV<@T1X=w{zz z!G|K`@y($20XwMgiMTG{06`lW;-NzRlTDCNpm0 zYznetu>CM{(X4iP63P%pvt??2qFrEsXCB6xzDvohwz_BMMV@mMw+LGa&U5})TF}quF=FDk_9~}1H!*++63B)oqR6uKBMi^jtx;&0q5a!%L z)9^DTb;1vsL&x<&$PVTpN%3d5SJEldB#gCP80E0I$Lq3$t1l%fxT~ZboJi5zGZUeG|2~}-vVCAX*hvN3qS~h zMehJS4r3iR-s>y6={U6H#IM{Nr`onn?#G4`FVHx@ib%H?`4M6CT8L&(tUjK*zC9s^ zwL9Uwu6>!$@Z$YnKjs^P`2g;4vWiSmTX*Efw`#Mx=T;xLd#G(+eVQ)`dwpR`U1scG zw(e)=^Qjr@s>FmuLGt0WG$?y~_#a_58QE>5?L~HYMVAn#ql2w9xm=2gi0BT6MQ|yI zgEfP3OaJw>a0~Xs9(?euGxeL>h57pS4#)LVWd6DhtC?7aX_j;;joJpwIz}gf5`+;> z#v?nL4Iu}1VYv+PFA(Z(l)#gp+mdqM$bJZa{2}YQfjOR&ju{}8v_6cVtk+#RUx zmRN|<8#@_jD9!>gkYu-1!;2iXH^TJ)AW=cFD%=0_=v)A4&~UBK=7x*KzTxWD`<96@ zli-t<++b7ad?)edwFZ{6HJd224P7Ke6VDVK38^B%b87=}>u!J2pT-!Vm7eR~$y?8V z_`9Z)I2dn48VUM2G>0K(#3V10vBUt*Bdqq1B{I_I-u_AB1y?5c_CW{t@nBqE1gzfD ze0LeE^VaQRSDFJER#(hs3AZY~kAy@&IX8Z}cb~xfP{r!fd1034;B=DrxTtuRo#V7G zjn95x7Axhl{`TbD`-%yV^44PK+RUCCsZ@zrT#+WE;bNsttbk0i&TFH)(9t3QK6?)d zNyT_)V}E)wO!J~!<5-qYl7r1*!PR|ccJ+n`PWd^hz4F8oPJJdnfu!98X-05cRc5OB&^lXja+EC#W7c^H>wi%$U2Lz zfGaZBsW6t2p|r&a2}u_N4sUdBExCckdLM^Duadl9F;zUS>PtI6TDm>oufDzF=f9jA z@xAtDc0O{6KFUF>@+~x*i6rP!>Rm{)AZS)g@z^hr*Z}WrE^!Je+VbAd>%U!sT3{Z%lE!-mbJ#Mc^u55O4I@4XN(QPDEuWK0M`aec5DA4mo z$*M35&fy{omtLyG4rY@Rd1iWTd^X4$DG^)I$k@xZ<;yjFBoCC78yy1+T7-n_86kmYk+H5-72Z}ir-B<=&(2iZeqiNL;rD)B-+blaxpsISMKVzDcrX(p0r{mq0s9yb;o}a5Mf_L1wG4rdzcyi#FUt{Vlsj=)l?Y4FH=DHDf zP;%Ryy+Eve8zg(|wY;U}3^|T$WaW0Qb28ne!t1%c)P$e%U#2WvUOAt7?(5wCZn?c^ zEVr&>xgDN9GD6~jZHAIx>~%KYQmv<+abt;!YI~hWiF#iL6n8IqyPcOe8{baru2Ftr zk9>%PRF-Gno4w<{v*T%_I|pqjy;)EDetXP!AmDskKL=fy7@yO+UGiY%U#K&@zVba+ zFkTBKPP^`Hjl*nkg8x23M4YbipHT-|ms@E~W{31AA!`;$g^-(tQm9YFQSjG6Iin?2 z%38!ok&sj~HjmF0NCs78+0aP(mG}$257cVR^NOVjYMtk2N7Jsh<`cFWwhEY%krK-| z?mJkPacaxZtujhUMZfz)LTco^nxWoroJr3)yz3w%;pxR8TeZ8rr-(iZHaB0UrnsK} z(D`plC4O()8zIZ$h(-^!voco&S#RvxOkN$xeCiHTm+H(&VidL3Amg3Xg}sX0TXnfR zlYFtaGcA)lR-z>?MH~_NjcK2M5gj(e90RG4y-K$Hvjz%^*3fxtUnY{iG_}_r(-o!b zUv5Gcu2+j^ttB~-p^?EMHJD*0AQAx&!@c%%qqMl{<;rs$aM?NQ-0&|r z^yG-|#-`>TOoEvs(quYV2xGbcO!o$ok1^^S(=JtMFYI!>*s-4A7L=b%9A{sC*66Ox zW|-@DL_$J}h0j!!o-U$I+_pp|-3*r#q+PPfq1(jt0Sp>z@JdL(?s)=kM?&I)qbhbY zsEo$oI^O;M%tof*sgWPG(8yy3o`h7DP;`+jB)4`^su^%c&`3>>na817dn>v%55O;* zAk{hAYTt;`T*c(VtOD>qNF4RQ$pRvWKg2k=Qsl1y34~D5uTSj#CsNe0LX)^6~hn zT=`cFp75@pEvn27)RKMTcgrvQhs+-PZZ)uUZe}|)=6`VEXYMy5$dAzdJCNd7sGqZC3$#y8`^$&>> zX274XAfxfY6wHQgOk7}rA^PRHOC4YzKlQ+8#C-z5)t@nYy<%Y5naWm{vZZHI>g3Qe z>k5bTdXt?40?j11`ipsUI5Rj;AW0fJXTJ`)9Epjk9Eqt6hm27MEw93+gbKb&7P|dV zO`fTbhiJmtCw09VE}GH)y=XpY9lCHkUfTUiLPL3@BC?H6q4pHlKQT)qQbTx>2tw|u zftiT>3Ou0d>ntkj1*%m({tw9**xttKvX9+|R-f^M8zU{)=1NeEviRM%`i$A*vJjiu z+cOg2_t=t1H9u;(-OfHWy}2|XqVfGy`d@BaI z{-KzM;&=KC>1kvI3i#(A@;_$@h~4oV(&z9yMnXb*E&hk71tTGMzrK>RQ)@v5_Dg`ufZviPSX%1&>B?v&`<+Pgu47RqDZjZR`I_<_;2tLBUS2mlH#ZK3hD8pBMcE7? zE{0~O^GhGg!Gvj6^}u3o3-OWINo~ovJ7G6tQL~=Py<5wqr8Yeys}YI+g8;c#tgeXb zUFwko4WGSlKzfNpy*97Qo4+@=pKTIYXcDL?D^sp1^Vtl{k`}7^?@>F3bN>xf-KNc6W!Fa|*OeI{8D1d27rki`TN*e*RIUS}^Wt z>*C43`W0|&crRQ2;N$}5fnJSZtY*Hmv*>YZ@rpOi^jnSH&?Ez`Nsk&Cqqc2qsEq7n z9W}3cU6SF1Ca)LM)`4HFv`n%^;A|FMpj!&tG!93%W<9r6V%3+f#Et-k-DAJlx8=uG z;>9QCP1%malZ{T+e>qcmG*+aJxzgR*Hdn1C3s^hClLQcP$w;BT}X=w$Mm+Z%xTLvOmRww&?h!p7Y38yLZ8p60diT$X}+62y(V7n-P9fWSb zuNGAtMPY1Y1hqh@?Y4Et4>rUHmAvAxK4SaF-e`R*&4b!1nD?5w#xnY)1J3l`h3sIPwc+dzEWS7j zpCpA>hxfXjg9Mfc7U}J{vYc{iRlRkB0q2_D+u4_$JU)TN%|?PV*9Qh0T#pb?;_6x| zxR(%w@ZAY~Erj>_l+(5>%k2Wzw;o5_a2x8t`|VE7WmL9^*`5iRvdYn)h6SkKkrTb@ zC{e<}2X`uYajZXf%>awV6L8@F&K42Oc64^kl584>&(<+&kxEXSUNrR=A8%F2h*)Ya zL@^?(bWS35g%-Qj6W?;W9c>hA)g~r^ryx}+7dZ&e2>K~vJrBAp*cbG=GyWQ?OYyo`5ss3_VGD*ZV_mbtXwQTA6Jy zd#YnjpXy=ivEqzLKi5xNKz!y^ARGx%H3^Q-h8J#r*$?pTP@Q1iFOJy1Ki*-d!D8z} zu`XPAJvPKjY+b+6y*{us z4ptt$GOq2iidT{HUNXtFdy@^SK&SQgV*;W;ra`rP7vG99sA=_2eL5c|o@(-t1)X9{%$!Bf5wnAB<&)?;)41Iew<|Ie(j}@j>7L}M2>34Yp7#VrO%BV9;4+se zC*-d>V?i1`S5fWcR+T1?QslWOHougZmSvWeD5_m)mJlXd-A=>|o{Em=1!5f%&^0(| z)={ecFlCkmi#Rr5=-FmuEfI(v0*~W;Be!E+Ut*dVDye-ak;j?f!D0SDZ;<^^LV8pW zNIV_Hl>lG9Qk2mMEB?sC_8C6sNTYm0GtC}y6;_`h@2RC4v)A(F4 zPW?Se;W38>;0=uSn}ZFL!x9Y#?Zd&wNyU#L1Qh%gP}dQu;N!TUB1yM0-5Q6D+5Qe1 z%yrtV6VBi#-%DO*@MgdtJ}mnQoGZ@C+ISC+g4j;cppHxfp$uJHNAFU6VvEU%g|G~`=rPM9as(*y&Vi++ENO&a$J#4ne8d41GsHj$DnvW2UN78N5gd-+ue zbL^3Y^v#JpEUIKDP3&eT-Ly=1aaXUjl&EtFRZJc1tN2K1u2#mnoRw%@>9Ag-)=0^! z+W~N>65{9(14=pB8giZ^)5VrmWE_IW0=A3Gbs^c^#Vt`j+iVVz|Ijzq+H9vi(@cX{ ztCpS}yyeiexEf={&oHFP*s$ULJ^k^Kl!tq)<`fd@4%-P50%>_(L#KNl-HA0 z+K)U(%AGBC1tD&nBE}b)okXFDO{ao;`FI4k%v$`*My6GlKFvp~?*_?E$7T9yZvnei zcFPwG+Q@TzzTKup;19^gjeZf9?8zV1OQhs}<(rEu>1m#b8PvGM82ipddp2j($s}<= za&t*%5sNl4yZqID&r&dZ$kIRPlY!uZM4V!V=RAOXBMDv+Yi_)pKZBX}SJpVxY z2tL|0A5|)uTqY3>Bc7`?SFy)&P|RXYjE>b*-u)r>HuHR;{w-!%X?srG^VwQI(?l6{kK>ZP3$Q+O^AzCBPCPjUZzLBo znE2u`)HHD*UmCZw7kyzQ*6Z02Ys%P(mD4$gf%NFJ?q2O$1WJiaC|+;>p852;j61iM zlkLT-Iy~^NZ~IxfM*pu*@c-Gp70?~OpVh5i_Hmkni;GXq(xT2RW~4!)<{?s{G;p;4 z(a1*&%#e&O=6BDP?&wtCztL$ptpP$Y?~5R#R;`oo;>|&B6AIGAoeLlS-nTR$yHrq- zM$7&*90iEg<);`iBO50B0<#gZ2#hRw+Ht=|j%Znx649H4#TEw|k0%e1VAOZd>3!Vl zejvB4`bl%()kofs#Vby?7+ermibluP_O1SSq|Y)@z{58e{e&3&N|C}p(@DbMq^m|q zr%1!*rF=@oA!+@~gIsRp-0*#=noE}H&nt;7RJvpCJmu{C^EuyDA`RTMlO;U@Sx&xz zB_9Y0YaN3V^==&$s(GSm0g;w_s6MDwlHhxk?rGzv~s}vT<7f6k#!$Pyr zN@9W*!bAxCi3kc~J7>dQ@tYjR?~|?3WkJ4E0WUGX)4>Y)bLE|{YM=t*$mzMfrltuFev!U8<`6GHijVw!)&De8So2^o7;`?4a>x1fhe|5@$d?j?;mO z+|(~{x8RSL$wDewZ$|2DD|z_bSftW43ntQgQ7Mp-%)bGeR>fi5vKWcaGcgsPA1L{*R_Z=pk5kU7ucPZ%>U!a{-r#U1D<447=)Na`FF~eFg%5S|*TatjGp@5B*BEU9R7%jwSX9z3V@IDVlbo(R76 zyC787atv<4HhaNH#YoC#_sodKJtXshyG4=NeQ2+5mHYH~UDdSa4Z9qn+1fMHggBux z&!4p0^5;KyG1kpj&u)SggqX~p7pBOBDZofDcI!9gq%0%HjHdhgeLiIj3mxXJnw08W zeb7V9`oF48Y?RqTrdz!pH?q`4(q-7ppWNCH%McCQnW-$OeuVUSO9kY~IDfG!Re#<5 zqMw1f_kuLVU@~AaAi^BW9qDtZSr**|AixJoFX?vpAervHm3h&^3`oB^?tJNcz5Fb( zn6@>Cn9<%fd{|L>w+|9iyYPe@eGpX#*UuC99Objq6NG-bPg zb=>|e%QL1(JTo?C4}-(3v|N*s*83bU`NuDj+Q%o^?< zncUo8ASQ_u0kymrgVYxoJ!9Xz6Bb^9t(SE8pJudq-Hr zd)39HpZH#qG+Nt}d7HqNeHeVO*svOZ!MDRQf`*9}zVD7tC4b-5 z_TrzMiiB-$uVoOX!cH@)n``I2ZW?b5=6-(|9`WZqJ#nxc%e9NBQvOavW;pF$ILz&U=hg#^G!(p`jrmEV7o+YyB(~ zLIp*<)@QL+jLhLYI0}u5p*yCiKFkxmIFcbL?0e#|y;&1%AxpAe8?sQp`nY6#PUF&O zpiPwjYNxy5l0+@>M3d!Dv=?^d^nBza8NQGGL5%1B*hcZV`7b0aukwwq0Er}f<#pt=s&-;&I!&RFpNhjn=13e}f^lf1lE%(44X zb1U%a%egOgr+NQsTe5Cd!kcfqC)X)0x9fUW|Ky_Er=lN^XUfL!o>g79(p~@AV&=?R~j!`T6hP`EI3K;1p0={86)cK~BzX=kN3X zf8?K(wPoXyS8o@W$5vFox|;I$(pzi0s`OQXOUiElVXy!Acx4*r?Z$TYbN>GWtNM@K zJIlPYRkyg-+HUWTOwXxzj%?fcDqiMhz>ljx949-=-i-Kh_1KBUKX&esw4a``^RJ>* zXwhtT%ei{n#FzEH|C;yZ>+$!u_x#*+`=L8{b9SH^9&27u3G_Gxqxe`L2UJtdxghk z&-wzDFvLvW{chK5u3{n6GSKKy!P&C6w^IFpbD0bcp^A{{2lcLh_DXj@ybtYvc^;(2 M)78&qol`;+0Fu7JivR!s diff --git a/docs/output.md b/docs/output.md index 98255f52..0026ca8d 100644 --- a/docs/output.md +++ b/docs/output.md @@ -14,6 +14,7 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d - [FastQC](#fastqc) - Raw read QC - [MultiQC](#multiqc) - Aggregate report describing results and QC from the whole pipeline + - [Pipeline information](#pipeline-information) - Report metrics generated during the workflow execution ### FastQC @@ -29,16 +30,6 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d [FastQC](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) gives general quality metrics about your sequenced reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. For further reading and documentation see the [FastQC help pages](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/). -![MultiQC - FastQC sequence counts plot](images/mqc_fastqc_counts.png) - -![MultiQC - FastQC mean quality scores plot](images/mqc_fastqc_quality.png) - -![MultiQC - FastQC adapter content plot](images/mqc_fastqc_adapter.png) - -:::note -The FastQC plots displayed in the MultiQC report shows _untrimmed_ reads. They may contain adapter sequence and potentially regions with low quality. -::: - ### MultiQC
diff --git a/docs/usage.md b/docs/usage.md index 6324ff88..3b9c2817 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -85,9 +85,9 @@ The above pipeline run specified with a params file in yaml format: nextflow run nf-core/smrnaseq -profile docker -params-file params.yaml ``` -with `params.yaml` containing: +with: -```yaml +```yaml title="params.yaml" input: './samplesheet.csv' outdir: './results/' genome: 'GRCh37' @@ -199,14 +199,6 @@ See the main [Nextflow documentation](https://www.nextflow.io/docs/latest/config If you have any questions or issues please send us a message on [Slack](https://nf-co.re/join/slack) on the [`#configs` channel](https://nfcore.slack.com/channels/configs). -## Azure Resource Requests - -To be used with the `azurebatch` profile by specifying the `-profile azurebatch`. -We recommend providing a compute `params.vm_type` of `Standard_D16_v3` VMs by default but these options can be changed if required. - -Note that the choice of VM size depends on your quota and the overall workload during the analysis. -For a thorough list, please refer the [Azure Sizes for virtual machines in Azure](https://docs.microsoft.com/en-us/azure/virtual-machines/sizes). - ## Running in the background Nextflow handles job submissions and supervises the running jobs. The Nextflow process must run until the pipeline is finished. diff --git a/main.nf b/main.nf index 784b2be3..006141b6 100644 --- a/main.nf +++ b/main.nf @@ -9,8 +9,6 @@ ---------------------------------------------------------------------------------------- */ -nextflow.enable.dsl = 2 - /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ IMPORT FUNCTIONS / MODULES / SUBWORKFLOWS / WORKFLOWS @@ -20,7 +18,6 @@ nextflow.enable.dsl = 2 include { SMRNASEQ } from './workflows/smrnaseq' include { PIPELINE_INITIALISATION } from './subworkflows/local/utils_nfcore_smrnaseq_pipeline' include { PIPELINE_COMPLETION } from './subworkflows/local/utils_nfcore_smrnaseq_pipeline' - include { getGenomeAttribute } from './subworkflows/local/utils_nfcore_smrnaseq_pipeline' /* @@ -56,10 +53,8 @@ workflow NFCORE_SMRNASEQ { SMRNASEQ ( samplesheet ) - emit: multiqc_report = SMRNASEQ.out.multiqc_report // channel: /path/to/multiqc_report.html - } /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -70,27 +65,24 @@ workflow NFCORE_SMRNASEQ { workflow { main: - // // SUBWORKFLOW: Run initialisation tasks // PIPELINE_INITIALISATION ( params.version, - params.help, params.validate_params, params.monochrome_logs, args, params.outdir, params.input ) - + // // WORKFLOW: Run main workflow // NFCORE_SMRNASEQ ( PIPELINE_INITIALISATION.out.samplesheet ) - // // SUBWORKFLOW: Run completion tasks // diff --git a/modules.json b/modules.json index 6f36a912..ae6989f1 100644 --- a/modules.json +++ b/modules.json @@ -7,12 +7,12 @@ "nf-core": { "fastqc": { "branch": "master", - "git_sha": "285a50500f9e02578d90b3ce6382ea3c30216acd", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "multiqc": { "branch": "master", - "git_sha": "b7ebe95761cd389603f9cc0e0dc384c0f663815a", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] } } @@ -21,17 +21,17 @@ "nf-core": { "utils_nextflow_pipeline": { "branch": "master", - "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "git_sha": "d20fb2a9cc3e2835e9d067d1046a63252eb17352", "installed_by": ["subworkflows"] }, "utils_nfcore_pipeline": { "branch": "master", - "git_sha": "92de218a329bfc9a9033116eb5f65fd270e72ba3", + "git_sha": "2fdce49d30c0254f76bc0f13c55c17455c1251ab", "installed_by": ["subworkflows"] }, - "utils_nfvalidation_plugin": { + "utils_nfschema_plugin": { "branch": "master", - "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "git_sha": "bbd5a41f4535a8defafe6080e00ea74c45f4f96c", "installed_by": ["subworkflows"] } } diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml index 1787b38a..691d4c76 100644 --- a/modules/nf-core/fastqc/environment.yml +++ b/modules/nf-core/fastqc/environment.yml @@ -1,7 +1,5 @@ -name: fastqc channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::fastqc=0.12.1 diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index d79f1c86..d8989f48 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -26,7 +26,10 @@ process FASTQC { def rename_to = old_new_pairs*.join(' ').join(' ') def renamed_files = old_new_pairs.collect{ old_name, new_name -> new_name }.join(' ') - def memory_in_mb = MemoryUnit.of("${task.memory}").toUnit('MB') + // The total amount of allocated RAM by FastQC is equal to the number of threads defined (--threads) time the amount of RAM defined (--memory) + // https://github.com/s-andrews/FastQC/blob/1faeea0412093224d7f6a07f777fad60a5650795/fastqc#L211-L222 + // Dividing the task.memory by task.cpu allows to stick to requested amount of RAM in the label + def memory_in_mb = MemoryUnit.of("${task.memory}").toUnit('MB') / task.cpus // FastQC memory value allowed range (100 - 10000) def fastqc_memory = memory_in_mb > 10000 ? 10000 : (memory_in_mb < 100 ? 100 : memory_in_mb) diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml index ee5507e0..4827da7a 100644 --- a/modules/nf-core/fastqc/meta.yml +++ b/modules/nf-core/fastqc/meta.yml @@ -16,35 +16,44 @@ tools: homepage: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ documentation: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/ licence: ["GPL-2.0-only"] + identifier: biotools:fastqc input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FastQ files of size 1 and 2 for single-end and paired-end data, - respectively. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - html: - type: file - description: FastQC report - pattern: "*_{fastqc.html}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.html": + type: file + description: FastQC report + pattern: "*_{fastqc.html}" - zip: - type: file - description: FastQC report archive - pattern: "*_{fastqc.zip}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.zip": + type: file + description: FastQC report archive + pattern: "*_{fastqc.zip}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@grst" diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test index 70edae4d..e9d79a07 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -23,17 +23,14 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. - // looks like this:
Mon 2 Oct 2023
test.gz
- // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_single") } + { assert process.success }, + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
Mon 2 Oct 2023
test.gz
+ // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -54,16 +51,14 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_paired") } + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -83,13 +78,11 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_interleaved") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -109,13 +102,11 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_bam") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -138,22 +129,20 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, - { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, - { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_multiple") } + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, + { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, + { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -173,21 +162,18 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_custom_prefix") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } test("sarscov2 single-end [fastq] - stub") { - options "-stub" - + options "-stub" when { process { """ @@ -201,12 +187,123 @@ nextflow_process { then { assertAll ( - { assert process.success }, - { assert snapshot(process.out.html.collect { file(it[1]).getName() } + - process.out.zip.collect { file(it[1]).getName() } + - process.out.versions ).match("fastqc_stub") } + { assert process.success }, + { assert snapshot(process.out).match() } ) } } + test("sarscov2 paired-end [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 interleaved [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 paired-end [bam] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 multiple [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 custom_prefix - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'mysample', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap index 86f7c311..d5db3092 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test.snap +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -1,88 +1,392 @@ { - "fastqc_versions_interleaved": { + "sarscov2 custom_prefix": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:07.293713" + "timestamp": "2024-07-22T11:02:16.374038" }, - "fastqc_stub": { + "sarscov2 single-end [fastq] - stub": { "content": [ - [ - "test.html", - "test.zip", - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:24.993809" + }, + "sarscov2 custom_prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:31:01.425198" + "timestamp": "2024-07-22T11:03:10.93942" }, - "fastqc_versions_multiple": { + "sarscov2 interleaved [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:55.797907" + "timestamp": "2024-07-22T11:01:42.355718" }, - "fastqc_versions_bam": { + "sarscov2 paired-end [bam]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:26.795862" + "timestamp": "2024-07-22T11:01:53.276274" }, - "fastqc_versions_single": { + "sarscov2 multiple [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:39:27.043675" + "timestamp": "2024-07-22T11:02:05.527626" }, - "fastqc_versions_paired": { + "sarscov2 paired-end [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:31.188871" + }, + "sarscov2 paired-end [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:34.273566" + }, + "sarscov2 multiple [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:39:47.584191" + "timestamp": "2024-07-22T11:03:02.304411" }, - "fastqc_versions_custom_prefix": { + "sarscov2 single-end [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:19.095607" + }, + "sarscov2 interleaved [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:44.640184" + }, + "sarscov2 paired-end [bam] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:41:14.576531" + "timestamp": "2024-07-22T11:02:53.550742" } } \ No newline at end of file diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml index ca39fb67..f1cd99b0 100644 --- a/modules/nf-core/multiqc/environment.yml +++ b/modules/nf-core/multiqc/environment.yml @@ -1,7 +1,5 @@ -name: multiqc channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::multiqc=1.21 + - bioconda::multiqc=1.24.1 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 47ac352f..b9ccebdb 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -3,14 +3,16 @@ process MULTIQC { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.21--pyhdfd78af_0' : - 'biocontainers/multiqc:1.21--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.25--pyhdfd78af_0' : + 'biocontainers/multiqc:1.25--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" path(multiqc_config) path(extra_multiqc_config) path(multiqc_logo) + path(replace_names) + path(sample_names) output: path "*multiqc_report.html", emit: report @@ -23,16 +25,22 @@ process MULTIQC { script: def args = task.ext.args ?: '' + def prefix = task.ext.prefix ? "--filename ${task.ext.prefix}.html" : '' def config = multiqc_config ? "--config $multiqc_config" : '' def extra_config = extra_multiqc_config ? "--config $extra_multiqc_config" : '' - def logo = multiqc_logo ? /--cl-config 'custom_logo: "${multiqc_logo}"'/ : '' + def logo = multiqc_logo ? "--cl-config 'custom_logo: \"${multiqc_logo}\"'" : '' + def replace = replace_names ? "--replace-names ${replace_names}" : '' + def samples = sample_names ? "--sample-names ${sample_names}" : '' """ multiqc \\ --force \\ $args \\ $config \\ + $prefix \\ $extra_config \\ $logo \\ + $replace \\ + $samples \\ . cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/multiqc/meta.yml b/modules/nf-core/multiqc/meta.yml index 45a9bc35..b16c1879 100644 --- a/modules/nf-core/multiqc/meta.yml +++ b/modules/nf-core/multiqc/meta.yml @@ -1,5 +1,6 @@ name: multiqc -description: Aggregate results from bioinformatics analyses across many samples into a single report +description: Aggregate results from bioinformatics analyses across many samples into + a single report keywords: - QC - bioinformatics tools @@ -12,40 +13,59 @@ tools: homepage: https://multiqc.info/ documentation: https://multiqc.info/docs/ licence: ["GPL-3.0-or-later"] + identifier: biotools:multiqc input: - - multiqc_files: - type: file - description: | - List of reports / files recognised by MultiQC, for example the html and zip output of FastQC - - multiqc_config: - type: file - description: Optional config yml for MultiQC - pattern: "*.{yml,yaml}" - - extra_multiqc_config: - type: file - description: Second optional config yml for MultiQC. Will override common sections in multiqc_config. - pattern: "*.{yml,yaml}" - - multiqc_logo: - type: file - description: Optional logo file for MultiQC - pattern: "*.{png}" + - - multiqc_files: + type: file + description: | + List of reports / files recognised by MultiQC, for example the html and zip output of FastQC + - - multiqc_config: + type: file + description: Optional config yml for MultiQC + pattern: "*.{yml,yaml}" + - - extra_multiqc_config: + type: file + description: Second optional config yml for MultiQC. Will override common sections + in multiqc_config. + pattern: "*.{yml,yaml}" + - - multiqc_logo: + type: file + description: Optional logo file for MultiQC + pattern: "*.{png}" + - - replace_names: + type: file + description: | + Optional two-column sample renaming file. First column a set of + patterns, second column a set of corresponding replacements. Passed via + MultiQC's `--replace-names` option. + pattern: "*.{tsv}" + - - sample_names: + type: file + description: | + Optional TSV file with headers, passed to the MultiQC --sample_names + argument. + pattern: "*.{tsv}" output: - report: - type: file - description: MultiQC report file - pattern: "multiqc_report.html" + - "*multiqc_report.html": + type: file + description: MultiQC report file + pattern: "multiqc_report.html" - data: - type: directory - description: MultiQC data dir - pattern: "multiqc_data" + - "*_data": + type: directory + description: MultiQC data dir + pattern: "multiqc_data" - plots: - type: file - description: Plots created by MultiQC - pattern: "*_data" + - "*_plots": + type: file + description: Plots created by MultiQC + pattern: "*_data" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@abhi18av" - "@bunop" diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test index f1c4242e..33316a7d 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test +++ b/modules/nf-core/multiqc/tests/main.nf.test @@ -8,6 +8,8 @@ nextflow_process { tag "modules_nfcore" tag "multiqc" + config "./nextflow.config" + test("sarscov2 single-end [fastqc]") { when { @@ -17,6 +19,8 @@ nextflow_process { input[1] = [] input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } @@ -41,6 +45,8 @@ nextflow_process { input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true)) input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } @@ -66,6 +72,8 @@ nextflow_process { input[1] = [] input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap index bfebd802..b779e469 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -2,14 +2,14 @@ "multiqc_versions_single": { "content": [ [ - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-29T08:48:55.657331" + "timestamp": "2024-07-10T12:41:34.562023" }, "multiqc_stub": { "content": [ @@ -17,25 +17,25 @@ "multiqc_report.html", "multiqc_data", "multiqc_plots", - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-29T08:49:49.071937" + "timestamp": "2024-07-10T11:27:11.933869532" }, "multiqc_versions_config": { "content": [ [ - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-29T08:49:25.457567" + "timestamp": "2024-07-10T11:26:56.709849369" } -} \ No newline at end of file +} diff --git a/modules/nf-core/multiqc/tests/nextflow.config b/modules/nf-core/multiqc/tests/nextflow.config new file mode 100644 index 00000000..c537a6a3 --- /dev/null +++ b/modules/nf-core/multiqc/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: 'MULTIQC' { + ext.prefix = null + } +} diff --git a/nextflow.config b/nextflow.config index eeec075b..02c653a0 100644 --- a/nextflow.config +++ b/nextflow.config @@ -16,7 +16,6 @@ params { genome = null igenomes_base = 's3://ngi-igenomes/igenomes/' igenomes_ignore = false - // MultiQC options multiqc_config = null multiqc_title = null @@ -33,48 +32,26 @@ params { monochrome_logs = false hook_url = null help = false + help_full = false + show_hidden = false version = false pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/' - // Config options config_profile_name = null config_profile_description = null + custom_config_version = 'master' custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" config_profile_contact = null config_profile_url = null - - // Max resource options - // Defaults only, expecting to be overwritten - max_memory = '128.GB' - max_cpus = 16 - max_time = '240.h' - // Schema validation default options - validationFailUnrecognisedParams = false - validationLenientMode = false - validationSchemaIgnoreParams = 'genomes,igenomes_base' - validationShowHiddenParams = false - validate_params = true - + validate_params = true + } // Load base.config by default for all pipelines includeConfig 'conf/base.config' -// Load nf-core custom profiles from different Institutions -try { - includeConfig "${params.custom_config_base}/nfcore_custom.config" -} catch (Exception e) { - System.err.println("WARNING: Could not load nf-core/config profiles: ${params.custom_config_base}/nfcore_custom.config") -} - -// Load nf-core/smrnaseq custom profiles from different institutions. -try { - includeConfig "${params.custom_config_base}/pipeline/smrnaseq.config" -} catch (Exception e) { - System.err.println("WARNING: Could not load nf-core/config/smrnaseq profiles: ${params.custom_config_base}/pipeline/smrnaseq.config") -} profiles { debug { dumpHashes = true @@ -89,7 +66,7 @@ profiles { podman.enabled = false shifter.enabled = false charliecloud.enabled = false - conda.channels = ['conda-forge', 'bioconda', 'defaults'] + conda.channels = ['conda-forge', 'bioconda'] apptainer.enabled = false } mamba { @@ -178,25 +155,23 @@ profiles { test_full { includeConfig 'conf/test_full.config' } } -// Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile -// Will not be used unless Apptainer / Docker / Podman / Singularity are enabled -// Set to your registry if you have a mirror of containers -apptainer.registry = 'quay.io' -docker.registry = 'quay.io' -podman.registry = 'quay.io' -singularity.registry = 'quay.io' +// Load nf-core custom profiles from different Institutions +includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/nfcore_custom.config" : "/dev/null" -// Nextflow plugins -plugins { - id 'nf-validation@1.1.3' // Validation of pipeline parameters and creation of an input channel from a sample sheet -} +// Load nf-core/smrnaseq custom profiles from different institutions. +// TODO nf-core: Optionally, you can add a pipeline-specific nf-core config at https://github.com/nf-core/configs +// includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/smrnaseq.config" : "/dev/null" +// Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile +// Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled +// Set to your registry if you have a mirror of containers +apptainer.registry = 'quay.io' +docker.registry = 'quay.io' +podman.registry = 'quay.io' +singularity.registry = 'quay.io' +charliecloud.registry = 'quay.io' // Load igenomes.config if required -if (!params.igenomes_ignore) { - includeConfig 'conf/igenomes.config' -} else { - params.genomes = [:] -} +includeConfig !params.igenomes_ignore ? 'conf/igenomes.config' : 'conf/igenomes_ignored.config' // Export these variables to prevent local Python/R libraries from conflicting with those in the container // The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container. // See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable. @@ -208,8 +183,15 @@ env { JULIA_DEPOT_PATH = "/usr/local/share/julia" } -// Capture exit codes from upstream processes when piping -process.shell = ['/bin/bash', '-euo', 'pipefail'] +// Set bash options +process.shell = """\ +bash + +set -e # Exit if a tool returns a non-zero status/exit code +set -u # Treat unset variables and parameters as an error +set -o pipefail # Returns the status of the last command to exit with a non-zero status or zero if all successfully execute +set -C # No clobber - prevent output redirection from overwriting files. +""" // Disable process selector warnings by default. Use debug profile to enable warnings. nextflow.enable.configProcessNamesValidation = false @@ -238,43 +220,47 @@ manifest { homePage = 'https://github.com/nf-core/smrnaseq' description = """Small RNA-Seq Best Practice Analysis Pipeline.""" mainScript = 'main.nf' - nextflowVersion = '!>=23.04.0' - version = '2.3.2dev' + nextflowVersion = '!>=24.04.2' + version = '2.4.0' doi = '' } -// Load modules.config for DSL2 module specific options -includeConfig 'conf/modules.config' +// Nextflow plugins +plugins { + id 'nf-schema@2.1.1' // Validation of pipeline parameters and creation of an input channel from a sample sheet +} + +validation { + defaultIgnoreParams = ["genomes"] + help { + enabled = true + command = "nextflow run $manifest.name -profile --input samplesheet.csv --outdir " + fullParameter = "help_full" + showHiddenParameter = "show_hidden" + beforeText = """ +-\033[2m----------------------------------------------------\033[0m- + \033[0;32m,--.\033[0;30m/\033[0;32m,-.\033[0m +\033[0;34m ___ __ __ __ ___ \033[0;32m/,-._.--~\'\033[0m +\033[0;34m |\\ | |__ __ / ` / \\ |__) |__ \033[0;33m} {\033[0m +\033[0;34m | \\| | \\__, \\__/ | \\ |___ \033[0;32m\\`-._,-`-,\033[0m + \033[0;32m`._,._,\'\033[0m +\033[0;35m ${manifest.name} ${manifest.version}\033[0m +-\033[2m----------------------------------------------------\033[0m- +""" + afterText = """${manifest.doi ? "* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} +* The nf-core framework + https://doi.org/10.1038/s41587-020-0439-x -// Function to ensure that resource requirements don't go beyond -// a maximum limit -def check_max(obj, type) { - if (type == 'memory') { - try { - if (obj.compareTo(params.max_memory as nextflow.util.MemoryUnit) == 1) - return params.max_memory as nextflow.util.MemoryUnit - else - return obj - } catch (all) { - println " ### ERROR ### Max memory '${params.max_memory}' is not valid! Using default value: $obj" - return obj - } - } else if (type == 'time') { - try { - if (obj.compareTo(params.max_time as nextflow.util.Duration) == 1) - return params.max_time as nextflow.util.Duration - else - return obj - } catch (all) { - println " ### ERROR ### Max time '${params.max_time}' is not valid! Using default value: $obj" - return obj - } - } else if (type == 'cpus') { - try { - return Math.min( obj, params.max_cpus as int ) - } catch (all) { - println " ### ERROR ### Max cpus '${params.max_cpus}' is not valid! Using default value: $obj" - return obj - } +* Software dependencies + https://github.com/${manifest.name}/blob/master/CITATIONS.md +""" + } + summary { + beforeText = validation.help.beforeText + afterText = validation.help.afterText } } + +// Load modules.config for DSL2 module specific options +includeConfig 'conf/modules.config' + diff --git a/nextflow_schema.json b/nextflow_schema.json index 34443b3e..f53cbc23 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -1,10 +1,10 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/nf-core/smrnaseq/master/nextflow_schema.json", "title": "nf-core/smrnaseq pipeline parameters", "description": "Small RNA-Seq Best Practice Analysis Pipeline.", "type": "object", - "definitions": { + "$defs": { "input_output_options": { "title": "Input/output options", "type": "object", @@ -71,6 +71,14 @@ "fa_icon": "fas fa-ban", "hidden": true, "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`." + }, + "igenomes_base": { + "type": "string", + "format": "directory-path", + "description": "The base path to the igenomes reference files", + "fa_icon": "fas fa-ban", + "hidden": true, + "default": "s3://ngi-igenomes/igenomes/" } } }, @@ -122,41 +130,6 @@ } } }, - "max_job_request_options": { - "title": "Max job request options", - "type": "object", - "fa_icon": "fab fa-acquisitions-incorporated", - "description": "Set the top limit for requested resources for any single job.", - "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.", - "properties": { - "max_cpus": { - "type": "integer", - "description": "Maximum number of CPUs that can be requested for any single job.", - "default": 16, - "fa_icon": "fas fa-microchip", - "hidden": true, - "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`" - }, - "max_memory": { - "type": "string", - "description": "Maximum amount of memory that can be requested for any single job.", - "default": "128.GB", - "fa_icon": "fas fa-memory", - "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$", - "hidden": true, - "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`" - }, - "max_time": { - "type": "string", - "description": "Maximum amount of time that can be requested for any single job.", - "default": "240.h", - "fa_icon": "far fa-clock", - "pattern": "^(\\d+\\.?\\s*(s|m|h|d|day)\\s*)+$", - "hidden": true, - "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`" - } - } - }, "generic_options": { "title": "Generic options", "type": "object", @@ -164,12 +137,6 @@ "description": "Less common options for the pipeline, typically set in a config file.", "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", "properties": { - "help": { - "type": "boolean", - "description": "Display help text.", - "fa_icon": "fas fa-question-circle", - "hidden": true - }, "version": { "type": "boolean", "description": "Display version and exit.", @@ -245,27 +212,6 @@ "fa_icon": "fas fa-check-square", "hidden": true }, - "validationShowHiddenParams": { - "type": "boolean", - "fa_icon": "far fa-eye-slash", - "description": "Show all params when using `--help`", - "hidden": true, - "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters." - }, - "validationFailUnrecognisedParams": { - "type": "boolean", - "fa_icon": "far fa-check-circle", - "description": "Validation of parameters fails when an unrecognised parameter is found.", - "hidden": true, - "help_text": "By default, when an unrecognised parameter is found, it returns a warinig." - }, - "validationLenientMode": { - "type": "boolean", - "fa_icon": "far fa-check-circle", - "description": "Validation of parameters in lenient more.", - "hidden": true, - "help_text": "Allows string values that are parseable as numbers or booleans. For further information see [JSONSchema docs](https://github.com/everit-org/json-schema#lenient-mode)." - }, "pipelines_testdata_base_path": { "type": "string", "fa_icon": "far fa-check-circle", @@ -278,19 +224,16 @@ }, "allOf": [ { - "$ref": "#/definitions/input_output_options" - }, - { - "$ref": "#/definitions/reference_genome_options" + "$ref": "#/$defs/input_output_options" }, { - "$ref": "#/definitions/institutional_config_options" + "$ref": "#/$defs/reference_genome_options" }, { - "$ref": "#/definitions/max_job_request_options" + "$ref": "#/$defs/institutional_config_options" }, { - "$ref": "#/definitions/generic_options" + "$ref": "#/$defs/generic_options" } ] } diff --git a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf index 67633add..8897e7d1 100644 --- a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf @@ -8,17 +8,14 @@ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -include { UTILS_NFVALIDATION_PLUGIN } from '../../nf-core/utils_nfvalidation_plugin' -include { paramsSummaryMap } from 'plugin/nf-validation' -include { fromSamplesheet } from 'plugin/nf-validation' -include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' +include { UTILS_NFSCHEMA_PLUGIN } from '../../nf-core/utils_nfschema_plugin' +include { paramsSummaryMap } from 'plugin/nf-schema' +include { samplesheetToList } from 'plugin/nf-schema' include { completionEmail } from '../../nf-core/utils_nfcore_pipeline' include { completionSummary } from '../../nf-core/utils_nfcore_pipeline' -include { dashedLine } from '../../nf-core/utils_nfcore_pipeline' -include { nfCoreLogo } from '../../nf-core/utils_nfcore_pipeline' include { imNotification } from '../../nf-core/utils_nfcore_pipeline' include { UTILS_NFCORE_PIPELINE } from '../../nf-core/utils_nfcore_pipeline' -include { workflowCitation } from '../../nf-core/utils_nfcore_pipeline' +include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' /* ======================================================================================== @@ -30,7 +27,6 @@ workflow PIPELINE_INITIALISATION { take: version // boolean: Display version and exit - help // boolean: Display help text validate_params // boolean: Boolean whether to validate parameters against the schema at runtime monochrome_logs // boolean: Do not use coloured log outputs nextflow_cli_args // array: List of positional nextflow CLI args @@ -51,20 +47,16 @@ workflow PIPELINE_INITIALISATION { workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1 ) + // // Validate parameters and generate parameter summary to stdout // - pre_help_text = nfCoreLogo(monochrome_logs) - post_help_text = '\n' + workflowCitation() + '\n' + dashedLine(monochrome_logs) - def String workflow_command = "nextflow run ${workflow.manifest.name} -profile --input samplesheet.csv --outdir " - UTILS_NFVALIDATION_PLUGIN ( - help, - workflow_command, - pre_help_text, - post_help_text, + UTILS_NFSCHEMA_PLUGIN ( + workflow, validate_params, - "nextflow_schema.json" + null ) + // // Check config provided to the pipeline @@ -80,8 +72,9 @@ workflow PIPELINE_INITIALISATION { // // Create channel from input file provided through params.input // + Channel - .fromSamplesheet("input") + .fromList(samplesheetToList(params.input, "${projectDir}/assets/schema_input.json")) .map { meta, fastq_1, fastq_2 -> if (!fastq_2) { @@ -91,8 +84,8 @@ workflow PIPELINE_INITIALISATION { } } .groupTuple() - .map { - validateInputSamplesheet(it) + .map { samplesheet -> + validateInputSamplesheet(samplesheet) } .map { meta, fastqs -> @@ -117,13 +110,13 @@ workflow PIPELINE_COMPLETION { email // string: email address email_on_fail // string: email address sent on pipeline failure plaintext_email // boolean: Send plain-text email instead of HTML + outdir // path: Path to output directory where results will be published monochrome_logs // boolean: Disable ANSI colour codes in log output hook_url // string: hook URL for notifications multiqc_report // string: Path to MultiQC report main: - summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") // @@ -131,11 +124,18 @@ workflow PIPELINE_COMPLETION { // workflow.onComplete { if (email || email_on_fail) { - completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs, multiqc_report.toList()) + completionEmail( + summary_params, + email, + email_on_fail, + plaintext_email, + outdir, + monochrome_logs, + multiqc_report.toList() + ) } completionSummary(monochrome_logs) - if (hook_url) { imNotification(summary_params, hook_url) } @@ -165,7 +165,7 @@ def validateInputSamplesheet(input) { def (metas, fastqs) = input[1..2] // Check that multiple runs of the same sample are of the same datatype i.e. single-end / paired-end - def endedness_ok = metas.collect{ it.single_end }.unique().size == 1 + def endedness_ok = metas.collect{ meta -> meta.single_end }.unique().size == 1 if (!endedness_ok) { error("Please check input samplesheet -> Multiple runs of a sample must be of the same datatype i.e. single-end or paired-end: ${metas[0].id}") } @@ -197,7 +197,6 @@ def genomeExistsError() { error(error_string) } } - // // Generate methods description for MultiQC // @@ -239,8 +238,10 @@ def methodsDescriptionText(mqc_methods_yaml) { // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers // Removing ` ` since the manifest.doi is a string and not a proper list def temp_doi_ref = "" - String[] manifest_doi = meta.manifest_map.doi.tokenize(",") - for (String doi_ref: manifest_doi) temp_doi_ref += "(doi: ${doi_ref.replace("https://doi.org/", "").replace(" ", "")}), " + def manifest_doi = meta.manifest_map.doi.tokenize(",") + manifest_doi.each { doi_ref -> + temp_doi_ref += "(doi: ${doi_ref.replace("https://doi.org/", "").replace(" ", "")}), " + } meta["doi_text"] = temp_doi_ref.substring(0, temp_doi_ref.length() - 2) } else meta["doi_text"] = "" meta["nodoi_text"] = meta.manifest_map.doi ? "" : "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
    • " @@ -261,3 +262,4 @@ def methodsDescriptionText(mqc_methods_yaml) { return description_html.toString() } + diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf index ac31f28f..28e32b20 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -2,10 +2,6 @@ // Subworkflow with functionality that may be useful for any Nextflow pipeline // -import org.yaml.snakeyaml.Yaml -import groovy.json.JsonOutput -import nextflow.extension.FilesEx - /* ======================================================================================== SUBWORKFLOW DEFINITION @@ -58,7 +54,7 @@ workflow UTILS_NEXTFLOW_PIPELINE { // Generate version string // def getWorkflowVersion() { - String version_string = "" + def version_string = "" as String if (workflow.manifest.version) { def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' version_string += "${prefix_v}${workflow.manifest.version}" @@ -79,10 +75,10 @@ def dumpParametersToJSON(outdir) { def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') def filename = "params_${timestamp}.json" def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") - def jsonStr = JsonOutput.toJson(params) - temp_pf.text = JsonOutput.prettyPrint(jsonStr) + def jsonStr = groovy.json.JsonOutput.toJson(params) + temp_pf.text = groovy.json.JsonOutput.prettyPrint(jsonStr) - FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") + nextflow.extension.FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") temp_pf.delete() } @@ -90,7 +86,7 @@ def dumpParametersToJSON(outdir) { // When running with -profile conda, warn if channels have not been set-up appropriately // def checkCondaChannels() { - Yaml parser = new Yaml() + def parser = new org.yaml.snakeyaml.Yaml() def channels = [] try { def config = parser.load("conda config --show channels".execute().text) @@ -102,14 +98,16 @@ def checkCondaChannels() { // Check that all channels are present // This channel list is ordered by required channel priority. - def required_channels_in_order = ['conda-forge', 'bioconda', 'defaults'] + def required_channels_in_order = ['conda-forge', 'bioconda'] def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean // Check that they are in the right order def channel_priority_violation = false - def n = required_channels_in_order.size() - for (int i = 0; i < n - 1; i++) { - channel_priority_violation |= !(channels.indexOf(required_channels_in_order[i]) < channels.indexOf(required_channels_in_order[i+1])) + + required_channels_in_order.eachWithIndex { channel, index -> + if (index < required_channels_in_order.size() - 1) { + channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index+1])) + } } if (channels_missing | channel_priority_violation) { diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config index d0a926bf..a09572e5 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config @@ -3,7 +3,7 @@ manifest { author = """nf-core""" homePage = 'https://127.0.0.1' description = """Dummy pipeline""" - nextflowVersion = '!>=23.04.0' + nextflowVersion = '!>=23.04.0' version = '9.9.9' doi = 'https://doi.org/10.5281/zenodo.5070524' } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf index 14558c39..cbd8495b 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -2,9 +2,6 @@ // Subworkflow with utility functions specific to the nf-core pipeline template // -import org.yaml.snakeyaml.Yaml -import nextflow.extension.FilesEx - /* ======================================================================================== SUBWORKFLOW DEFINITION @@ -34,7 +31,7 @@ workflow UTILS_NFCORE_PIPELINE { // Warn if a -profile or Nextflow config has not been provided to run the pipeline // def checkConfigProvided() { - valid_config = true + def valid_config = true as Boolean if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { log.warn "[$workflow.manifest.name] You are attempting to run the pipeline without any custom configuration!\n\n" + "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + @@ -66,11 +63,13 @@ def checkProfileProvided(nextflow_cli_args) { // def workflowCitation() { def temp_doi_ref = "" - String[] manifest_doi = workflow.manifest.doi.tokenize(",") + def manifest_doi = workflow.manifest.doi.tokenize(",") // Using a loop to handle multiple DOIs // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers // Removing ` ` since the manifest.doi is a string and not a proper list - for (String doi_ref: manifest_doi) temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" + manifest_doi.each { doi_ref -> + temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" + } return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + "* The pipeline\n" + temp_doi_ref + "\n" + @@ -84,7 +83,7 @@ def workflowCitation() { // Generate workflow version string // def getWorkflowVersion() { - String version_string = "" + def version_string = "" as String if (workflow.manifest.version) { def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' version_string += "${prefix_v}${workflow.manifest.version}" @@ -102,8 +101,8 @@ def getWorkflowVersion() { // Get software versions for pipeline // def processVersionsFromYAML(yaml_file) { - Yaml yaml = new Yaml() - versions = yaml.load(yaml_file).collectEntries { k, v -> [ k.tokenize(':')[-1], v ] } + def yaml = new org.yaml.snakeyaml.Yaml() + def versions = yaml.load(yaml_file).collectEntries { k, v -> [ k.tokenize(':')[-1], v ] } return yaml.dumpAsMap(versions).trim() } @@ -124,7 +123,7 @@ def workflowVersionToYAML() { def softwareVersionsToYAML(ch_versions) { return ch_versions .unique() - .map { processVersionsFromYAML(it) } + .map { version -> processVersionsFromYAML(version) } .unique() .mix(Channel.of(workflowVersionToYAML())) } @@ -134,19 +133,19 @@ def softwareVersionsToYAML(ch_versions) { // def paramsSummaryMultiqc(summary_params) { def summary_section = '' - for (group in summary_params.keySet()) { + summary_params.keySet().each { group -> def group_params = summary_params.get(group) // This gets the parameters of that particular group if (group_params) { summary_section += "

    $group

    \n" summary_section += "
    \n" - for (param in group_params.keySet()) { + group_params.keySet().sort().each { param -> summary_section += "
    $param
    ${group_params.get(param) ?: 'N/A'}
    \n" } summary_section += "
    \n" } } - String yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" + def yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" as String yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" @@ -161,7 +160,7 @@ def paramsSummaryMultiqc(summary_params) { // nf-core logo // def nfCoreLogo(monochrome_logs=true) { - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map String.format( """\n ${dashedLine(monochrome_logs)} @@ -180,7 +179,7 @@ def nfCoreLogo(monochrome_logs=true) { // Return dashed line // def dashedLine(monochrome_logs=true) { - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map return "-${colors.dim}----------------------------------------------------${colors.reset}-" } @@ -188,7 +187,7 @@ def dashedLine(monochrome_logs=true) { // ANSII colours used for terminal logging // def logColours(monochrome_logs=true) { - Map colorcodes = [:] + def colorcodes = [:] as Map // Reset / Meta colorcodes['reset'] = monochrome_logs ? '' : "\033[0m" @@ -287,7 +286,7 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi } def summary = [:] - for (group in summary_params.keySet()) { + summary_params.keySet().sort().each { group -> summary << summary_params[group] } @@ -344,10 +343,10 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi def sendmail_html = sendmail_template.toString() // Send the HTML e-mail - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map if (email_address) { try { - if (plaintext_email) { throw GroovyException('Send plaintext e-mail, not HTML') } + if (plaintext_email) { throw new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') } // Try to send HTML e-mail using sendmail def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") sendmail_tf.withWriter { w -> w << sendmail_html } @@ -364,13 +363,13 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi // Write summary e-mail HTML to a file def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") output_hf.withWriter { w -> w << email_html } - FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html"); + nextflow.extension.FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html"); output_hf.delete() // Write summary e-mail TXT to a file def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") output_tf.withWriter { w -> w << email_txt } - FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt"); + nextflow.extension.FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt"); output_tf.delete() } @@ -378,7 +377,7 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi // Print pipeline summary on completion // def completionSummary(monochrome_logs=true) { - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map if (workflow.success) { if (workflow.stats.ignoredCount == 0) { log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Pipeline completed successfully${colors.reset}-" @@ -395,7 +394,7 @@ def completionSummary(monochrome_logs=true) { // def imNotification(summary_params, hook_url) { def summary = [:] - for (group in summary_params.keySet()) { + summary_params.keySet().sort().each { group -> summary << summary_params[group] } diff --git a/subworkflows/nf-core/utils_nfschema_plugin/main.nf b/subworkflows/nf-core/utils_nfschema_plugin/main.nf new file mode 100644 index 00000000..4994303e --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/main.nf @@ -0,0 +1,46 @@ +// +// Subworkflow that uses the nf-schema plugin to validate parameters and render the parameter summary +// + +include { paramsSummaryLog } from 'plugin/nf-schema' +include { validateParameters } from 'plugin/nf-schema' + +workflow UTILS_NFSCHEMA_PLUGIN { + + take: + input_workflow // workflow: the workflow object used by nf-schema to get metadata from the workflow + validate_params // boolean: validate the parameters + parameters_schema // string: path to the parameters JSON schema. + // this has to be the same as the schema given to `validation.parametersSchema` + // when this input is empty it will automatically use the configured schema or + // "${projectDir}/nextflow_schema.json" as default. This input should not be empty + // for meta pipelines + + main: + + // + // Print parameter summary to stdout. This will display the parameters + // that differ from the default given in the JSON schema + // + if(parameters_schema) { + log.info paramsSummaryLog(input_workflow, parameters_schema:parameters_schema) + } else { + log.info paramsSummaryLog(input_workflow) + } + + // + // Validate the parameters using nextflow_schema.json or the schema + // given via the validation.parametersSchema configuration option + // + if(validate_params) { + if(parameters_schema) { + validateParameters(parameters_schema:parameters_schema) + } else { + validateParameters() + } + } + + emit: + dummy_emit = true +} + diff --git a/subworkflows/nf-core/utils_nfschema_plugin/meta.yml b/subworkflows/nf-core/utils_nfschema_plugin/meta.yml new file mode 100644 index 00000000..f7d9f028 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/meta.yml @@ -0,0 +1,35 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "utils_nfschema_plugin" +description: Run nf-schema to validate parameters and create a summary of changed parameters +keywords: + - validation + - JSON schema + - plugin + - parameters + - summary +components: [] +input: + - input_workflow: + type: object + description: | + The workflow object of the used pipeline. + This object contains meta data used to create the params summary log + - validate_params: + type: boolean + description: Validate the parameters and error if invalid. + - parameters_schema: + type: string + description: | + Path to the parameters JSON schema. + This has to be the same as the schema given to the `validation.parametersSchema` config + option. When this input is empty it will automatically use the configured schema or + "${projectDir}/nextflow_schema.json" as default. The schema should not be given in this way + for meta pipelines. +output: + - dummy_emit: + type: boolean + description: Dummy emit to make nf-core subworkflows lint happy +authors: + - "@nvnieuwk" +maintainers: + - "@nvnieuwk" diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test new file mode 100644 index 00000000..842dc432 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test @@ -0,0 +1,117 @@ +nextflow_workflow { + + name "Test Subworkflow UTILS_NFSCHEMA_PLUGIN" + script "../main.nf" + workflow "UTILS_NFSCHEMA_PLUGIN" + + tag "subworkflows" + tag "subworkflows_nfcore" + tag "subworkflows/utils_nfschema_plugin" + tag "plugin/nf-schema" + + config "./nextflow.config" + + test("Should run nothing") { + + when { + + params { + test_data = '' + } + + workflow { + """ + validate_params = false + input[0] = workflow + input[1] = validate_params + input[2] = "" + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should validate params") { + + when { + + params { + test_data = '' + outdir = 1 + } + + workflow { + """ + validate_params = true + input[0] = workflow + input[1] = validate_params + input[2] = "" + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } + ) + } + } + + test("Should run nothing - custom schema") { + + when { + + params { + test_data = '' + } + + workflow { + """ + validate_params = false + input[0] = workflow + input[1] = validate_params + input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should validate params - custom schema") { + + when { + + params { + test_data = '' + outdir = 1 + } + + workflow { + """ + validate_params = true + input[0] = workflow + input[1] = validate_params + input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config new file mode 100644 index 00000000..0907ac58 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config @@ -0,0 +1,8 @@ +plugins { + id "nf-schema@2.1.0" +} + +validation { + parametersSchema = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + monochromeLogs = true +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json similarity index 95% rename from subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json rename to subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json index 7626c1c9..331e0d2f 100644 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json @@ -1,10 +1,10 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/./master/nextflow_schema.json", "title": ". pipeline parameters", "description": "", "type": "object", - "definitions": { + "$defs": { "input_output_options": { "title": "Input/output options", "type": "object", @@ -87,10 +87,10 @@ }, "allOf": [ { - "$ref": "#/definitions/input_output_options" + "$ref": "#/$defs/input_output_options" }, { - "$ref": "#/definitions/generic_options" + "$ref": "#/$defs/generic_options" } ] } diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf b/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf deleted file mode 100644 index 2585b65d..00000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf +++ /dev/null @@ -1,62 +0,0 @@ -// -// Subworkflow that uses the nf-validation plugin to render help text and parameter summary -// - -/* -======================================================================================== - IMPORT NF-VALIDATION PLUGIN -======================================================================================== -*/ - -include { paramsHelp } from 'plugin/nf-validation' -include { paramsSummaryLog } from 'plugin/nf-validation' -include { validateParameters } from 'plugin/nf-validation' - -/* -======================================================================================== - SUBWORKFLOW DEFINITION -======================================================================================== -*/ - -workflow UTILS_NFVALIDATION_PLUGIN { - - take: - print_help // boolean: print help - workflow_command // string: default commmand used to run pipeline - pre_help_text // string: string to be printed before help text and summary log - post_help_text // string: string to be printed after help text and summary log - validate_params // boolean: validate parameters - schema_filename // path: JSON schema file, null to use default value - - main: - - log.debug "Using schema file: ${schema_filename}" - - // Default values for strings - pre_help_text = pre_help_text ?: '' - post_help_text = post_help_text ?: '' - workflow_command = workflow_command ?: '' - - // - // Print help message if needed - // - if (print_help) { - log.info pre_help_text + paramsHelp(workflow_command, parameters_schema: schema_filename) + post_help_text - System.exit(0) - } - - // - // Print parameter summary to stdout - // - log.info pre_help_text + paramsSummaryLog(workflow, parameters_schema: schema_filename) + post_help_text - - // - // Validate parameters relative to the parameter JSON schema - // - if (validate_params){ - validateParameters(parameters_schema: schema_filename) - } - - emit: - dummy_emit = true -} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml b/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml deleted file mode 100644 index 3d4a6b04..00000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml +++ /dev/null @@ -1,44 +0,0 @@ -# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json -name: "UTILS_NFVALIDATION_PLUGIN" -description: Use nf-validation to initiate and validate a pipeline -keywords: - - utility - - pipeline - - initialise - - validation -components: [] -input: - - print_help: - type: boolean - description: | - Print help message and exit - - workflow_command: - type: string - description: | - The command to run the workflow e.g. "nextflow run main.nf" - - pre_help_text: - type: string - description: | - Text to print before the help message - - post_help_text: - type: string - description: | - Text to print after the help message - - validate_params: - type: boolean - description: | - Validate the parameters and error if invalid. - - schema_filename: - type: string - description: | - The filename of the schema to validate against. -output: - - dummy_emit: - type: boolean - description: | - Dummy emit to make nf-core subworkflows lint happy -authors: - - "@adamrtalbot" -maintainers: - - "@adamrtalbot" - - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test deleted file mode 100644 index 5784a33f..00000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test +++ /dev/null @@ -1,200 +0,0 @@ -nextflow_workflow { - - name "Test Workflow UTILS_NFVALIDATION_PLUGIN" - script "../main.nf" - workflow "UTILS_NFVALIDATION_PLUGIN" - tag "subworkflows" - tag "subworkflows_nfcore" - tag "plugin/nf-validation" - tag "'plugin/nf-validation'" - tag "utils_nfvalidation_plugin" - tag "subworkflows/utils_nfvalidation_plugin" - - test("Should run nothing") { - - when { - - params { - monochrome_logs = true - test_data = '' - } - - workflow { - """ - help = false - workflow_command = null - pre_help_text = null - post_help_text = null - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success } - ) - } - } - - test("Should run help") { - - - when { - - params { - monochrome_logs = true - test_data = '' - } - workflow { - """ - help = true - workflow_command = null - pre_help_text = null - post_help_text = null - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.exitStatus == 0 }, - { assert workflow.stdout.any { it.contains('Input/output options') } }, - { assert workflow.stdout.any { it.contains('--outdir') } } - ) - } - } - - test("Should run help with command") { - - when { - - params { - monochrome_logs = true - test_data = '' - } - workflow { - """ - help = true - workflow_command = "nextflow run noorg/doesntexist" - pre_help_text = null - post_help_text = null - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.exitStatus == 0 }, - { assert workflow.stdout.any { it.contains('nextflow run noorg/doesntexist') } }, - { assert workflow.stdout.any { it.contains('Input/output options') } }, - { assert workflow.stdout.any { it.contains('--outdir') } } - ) - } - } - - test("Should run help with extra text") { - - - when { - - params { - monochrome_logs = true - test_data = '' - } - workflow { - """ - help = true - workflow_command = "nextflow run noorg/doesntexist" - pre_help_text = "pre-help-text" - post_help_text = "post-help-text" - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.exitStatus == 0 }, - { assert workflow.stdout.any { it.contains('pre-help-text') } }, - { assert workflow.stdout.any { it.contains('nextflow run noorg/doesntexist') } }, - { assert workflow.stdout.any { it.contains('Input/output options') } }, - { assert workflow.stdout.any { it.contains('--outdir') } }, - { assert workflow.stdout.any { it.contains('post-help-text') } } - ) - } - } - - test("Should validate params") { - - when { - - params { - monochrome_logs = true - test_data = '' - outdir = 1 - } - workflow { - """ - help = false - workflow_command = null - pre_help_text = null - post_help_text = null - validate_params = true - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.failed }, - { assert workflow.stdout.any { it.contains('ERROR ~ ERROR: Validation of pipeline parameters failed!') } } - ) - } - } -} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml deleted file mode 100644 index 60b1cfff..00000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/utils_nfvalidation_plugin: - - subworkflows/nf-core/utils_nfvalidation_plugin/** diff --git a/workflows/smrnaseq.nf b/workflows/smrnaseq.nf index 94fdb3a3..3b8c65fe 100644 --- a/workflows/smrnaseq.nf +++ b/workflows/smrnaseq.nf @@ -3,10 +3,9 @@ IMPORT MODULES / SUBWORKFLOWS / FUNCTIONS ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ - include { FASTQC } from '../modules/nf-core/fastqc/main' include { MULTIQC } from '../modules/nf-core/multiqc/main' -include { paramsSummaryMap } from 'plugin/nf-validation' +include { paramsSummaryMap } from 'plugin/nf-schema' include { paramsSummaryMultiqc } from '../subworkflows/nf-core/utils_nfcore_pipeline' include { softwareVersionsToYAML } from '../subworkflows/nf-core/utils_nfcore_pipeline' include { methodsDescriptionText } from '../subworkflows/local/utils_nfcore_smrnaseq_pipeline' @@ -21,12 +20,10 @@ workflow SMRNASEQ { take: ch_samplesheet // channel: samplesheet read in from --input - main: ch_versions = Channel.empty() ch_multiqc_files = Channel.empty() - // // MODULE: Run FastQC // @@ -42,11 +39,12 @@ workflow SMRNASEQ { softwareVersionsToYAML(ch_versions) .collectFile( storeDir: "${params.outdir}/pipeline_info", - name: 'nf_core_pipeline_software_mqc_versions.yml', + name: 'nf_core_' + 'pipeline_software_' + 'mqc_' + 'versions.yml', sort: true, newLine: true ).set { ch_collated_versions } + // // MODULE: MultiQC // @@ -59,18 +57,19 @@ workflow SMRNASEQ { Channel.fromPath(params.multiqc_logo, checkIfExists: true) : Channel.empty() + summary_params = paramsSummaryMap( workflow, parameters_schema: "nextflow_schema.json") ch_workflow_summary = Channel.value(paramsSummaryMultiqc(summary_params)) - + ch_multiqc_files = ch_multiqc_files.mix( + ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) + ch_multiqc_custom_methods_description = params.multiqc_methods_description ? file(params.multiqc_methods_description, checkIfExists: true) : file("$projectDir/assets/methods_description_template.yml", checkIfExists: true) ch_methods_description = Channel.value( methodsDescriptionText(ch_multiqc_custom_methods_description)) - ch_multiqc_files = ch_multiqc_files.mix( - ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) ch_multiqc_files = ch_multiqc_files.mix(ch_collated_versions) ch_multiqc_files = ch_multiqc_files.mix( ch_methods_description.collectFile( @@ -83,12 +82,14 @@ workflow SMRNASEQ { ch_multiqc_files.collect(), ch_multiqc_config.toList(), ch_multiqc_custom_config.toList(), - ch_multiqc_logo.toList() + ch_multiqc_logo.toList(), + [], + [] ) - emit: - multiqc_report = MULTIQC.out.report.toList() // channel: /path/to/multiqc_report.html + emit:multiqc_report = MULTIQC.out.report.toList() // channel: /path/to/multiqc_report.html versions = ch_versions // channel: [ path(versions.yml) ] + } /* From 5c31fea5a1a96d5a39575cdf92fb8eac46cbbbac Mon Sep 17 00:00:00 2001 From: nschcolnicov Date: Tue, 8 Oct 2024 13:34:13 +0000 Subject: [PATCH 10/27] Pulled from dev --- .github/workflows/ci.yml | 1 - nextflow_schema.json | 2 +- subworkflows/local/mirna_quant.nf | 5 +---- 3 files changed, 2 insertions(+), 6 deletions(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index ab5c55c4..4aa11ba1 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -67,7 +67,6 @@ jobs: nf-test test \ --ci \ --shard ${{ matrix.shard }}/${{ env.SHARDS }} \ - --changed-since HEAD^ \ --profile "+${{ matrix.profile }}" \ --filter pipeline \ --junitxml=test.xml diff --git a/nextflow_schema.json b/nextflow_schema.json index 7193a432..885df121 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -43,7 +43,7 @@ }, "save_intermediates": { "type": "boolean", - "description": "Save all intermediate files (e.g. fastq, bams) to output directory", + "description": "Save all intermediate files (e.g. fastq, bams) of all steps of the pipeline to output directory", "fa_icon": "fas fa-save" } } diff --git a/subworkflows/local/mirna_quant.nf b/subworkflows/local/mirna_quant.nf index 1ab42539..51a9b9a3 100644 --- a/subworkflows/local/mirna_quant.nf +++ b/subworkflows/local/mirna_quant.nf @@ -101,10 +101,7 @@ workflow MIRNA_QUANT { .map{ gtf, species -> [ [id:species.toString()], gtf, species ] } .collect() - BAM_STATS_MIRNA_MIRTOP( - BOWTIE_MAP_SEQCLUSTER.out.bam, - FORMAT_HAIRPIN.out.formatted_fasta, - ch_mirna_gtf_species ) + BAM_STATS_MIRNA_MIRTOP(BOWTIE_MAP_SEQCLUSTER.out.bam, FORMAT_HAIRPIN.out.formatted_fasta, ch_mirna_gtf_species ) ch_mirtop_logs = BAM_STATS_MIRNA_MIRTOP.out.stats_log ch_versions = ch_versions.mix(BAM_STATS_MIRNA_MIRTOP.out.versions) From 118c61c1d69d75298a186559ccdcdfa97171fd49 Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Wed, 9 Oct 2024 11:07:39 +0000 Subject: [PATCH 11/27] Template update for nf-core/tools version 3.0.1 --- .editorconfig | 4 - .github/CONTRIBUTING.md | 2 +- .github/workflows/awsfulltest.yml | 6 +- .github/workflows/linting.yml | 4 +- .nf-core.yml | 2 +- .prettierignore | 1 - docs/output.md | 1 - modules.json | 6 +- modules/nf-core/multiqc/environment.yml | 2 +- modules/nf-core/multiqc/main.nf | 4 +- .../nf-core/multiqc/tests/main.nf.test.snap | 26 +- nextflow.config | 8 +- .../utils_nfcore_smrnaseq_pipeline/main.nf | 12 +- .../nf-core/utils_nextflow_pipeline/main.nf | 46 ++- .../nf-core/utils_nfcore_pipeline/main.nf | 279 ++++++++++-------- 15 files changed, 209 insertions(+), 194 deletions(-) diff --git a/.editorconfig b/.editorconfig index e1058815..72dda289 100644 --- a/.editorconfig +++ b/.editorconfig @@ -11,7 +11,6 @@ indent_style = space [*.{md,yml,yaml,html,css,scss,js}] indent_size = 2 - # These files are edited and tested upstream in nf-core/modules [/modules/nf-core/**] charset = unset @@ -26,12 +25,9 @@ insert_final_newline = unset trim_trailing_whitespace = unset indent_style = unset - - [/assets/email*] indent_size = unset - # ignore python and markdown [*.{py,md}] indent_style = unset diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index 2e48f9a3..09ba835d 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -90,7 +90,7 @@ Once there, use `nf-core pipelines schema build` to add to `nextflow_schema.json ### Default processes resource requirements -Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/master/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels. +Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/main/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels. The process resources can be passed on to the tool dynamically within the process with the `${task.cpus}` and `${task.memory}` variables in the `script:` block. diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index a269d0e7..10c19be1 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -14,16 +14,18 @@ on: jobs: run-platform: name: Run AWS full tests - if: github.repository == 'nf-core/smrnaseq' && github.event.review.state == 'approved' + # run only if the PR is approved by at least 2 reviewers and against the master branch or manually triggered + if: github.repository == 'nf-core/smrnaseq' && github.event.review.state == 'approved' && github.event.pull_request.base.ref == 'master' || github.event_name == 'workflow_dispatch' runs-on: ubuntu-latest steps: - uses: octokit/request-action@v2.x id: check_approvals with: - route: GET /repos/${{ github.repository }}/pulls/${{ github.event.review.number }}/reviews + route: GET /repos/${{ github.repository }}/pulls/${{ github.event.pull_request.number }}/reviews env: GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} - id: test_variables + if: github.event_name != 'workflow_dispatch' run: | JSON_RESPONSE='${{ steps.check_approvals.outputs.data }}' CURRENT_APPROVALS_COUNT=$(echo $JSON_RESPONSE | jq -c '[.[] | select(.state | contains("APPROVED")) ] | length') diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index b882838a..a502573c 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -42,10 +42,10 @@ jobs: architecture: "x64" - name: read .nf-core.yml - uses: pietrobolcato/action-read-yaml@1.0.0 + uses: pietrobolcato/action-read-yaml@1.1.0 id: read_yml with: - config: ${{ github.workspace }}/.nf-core.yaml + config: ${{ github.workspace }}/.nf-core.yml - name: Install dependencies run: | diff --git a/.nf-core.yml b/.nf-core.yml index 1d204498..46543473 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -3,7 +3,7 @@ lint: nextflow_config: - config_defaults: - params.fastp_known_mirna_adapters -nf_core_version: 3.0.0 +nf_core_version: 3.0.1 org_path: null repository_type: pipeline template: diff --git a/.prettierignore b/.prettierignore index 610e5069..437d763d 100644 --- a/.prettierignore +++ b/.prettierignore @@ -1,4 +1,3 @@ - email_template.html adaptivecard.json slackreport.json diff --git a/docs/output.md b/docs/output.md index 0026ca8d..ce7a8964 100644 --- a/docs/output.md +++ b/docs/output.md @@ -14,7 +14,6 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d - [FastQC](#fastqc) - Raw read QC - [MultiQC](#multiqc) - Aggregate report describing results and QC from the whole pipeline - - [Pipeline information](#pipeline-information) - Report metrics generated during the workflow execution ### FastQC diff --git a/modules.json b/modules.json index ae6989f1..28e19d5e 100644 --- a/modules.json +++ b/modules.json @@ -12,7 +12,7 @@ }, "multiqc": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "b8d36829fa84b6e404364abff787e8b07f6d058c", "installed_by": ["modules"] } } @@ -21,12 +21,12 @@ "nf-core": { "utils_nextflow_pipeline": { "branch": "master", - "git_sha": "d20fb2a9cc3e2835e9d067d1046a63252eb17352", + "git_sha": "9d05360da397692321d377b6102d2fb22507c6ef", "installed_by": ["subworkflows"] }, "utils_nfcore_pipeline": { "branch": "master", - "git_sha": "2fdce49d30c0254f76bc0f13c55c17455c1251ab", + "git_sha": "772684d9d66f37b650c8ba5146ac1ee3ecba2acb", "installed_by": ["subworkflows"] }, "utils_nfschema_plugin": { diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml index f1cd99b0..6f5b867b 100644 --- a/modules/nf-core/multiqc/environment.yml +++ b/modules/nf-core/multiqc/environment.yml @@ -2,4 +2,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::multiqc=1.24.1 + - bioconda::multiqc=1.25.1 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index b9ccebdb..9724d2f3 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -3,8 +3,8 @@ process MULTIQC { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.25--pyhdfd78af_0' : - 'biocontainers/multiqc:1.25--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.25.1--pyhdfd78af_0' : + 'biocontainers/multiqc:1.25.1--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap index b779e469..2fcbb5ff 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -2,14 +2,14 @@ "multiqc_versions_single": { "content": [ [ - "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-07-10T12:41:34.562023" + "timestamp": "2024-10-02T17:51:46.317523" }, "multiqc_stub": { "content": [ @@ -17,25 +17,25 @@ "multiqc_report.html", "multiqc_data", "multiqc_plots", - "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-07-10T11:27:11.933869532" + "timestamp": "2024-10-02T17:52:20.680978" }, "multiqc_versions_config": { "content": [ [ - "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-07-10T11:26:56.709849369" + "timestamp": "2024-10-02T17:52:09.185842" } -} +} \ No newline at end of file diff --git a/nextflow.config b/nextflow.config index 02c653a0..12df5c46 100644 --- a/nextflow.config +++ b/nextflow.config @@ -12,10 +12,12 @@ params { // TODO nf-core: Specify your pipeline's command line flags // Input options input = null + // References genome = null igenomes_base = 's3://ngi-igenomes/igenomes/' igenomes_ignore = false + // MultiQC options multiqc_config = null multiqc_title = null @@ -36,6 +38,7 @@ params { show_hidden = false version = false pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/' + // Config options config_profile_name = null config_profile_description = null @@ -44,9 +47,9 @@ params { custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" config_profile_contact = null config_profile_url = null + // Schema validation default options validate_params = true - } // Load base.config by default for all pipelines @@ -161,6 +164,7 @@ includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${pa // Load nf-core/smrnaseq custom profiles from different institutions. // TODO nf-core: Optionally, you can add a pipeline-specific nf-core config at https://github.com/nf-core/configs // includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/smrnaseq.config" : "/dev/null" + // Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile // Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled // Set to your registry if you have a mirror of containers @@ -172,6 +176,7 @@ charliecloud.registry = 'quay.io' // Load igenomes.config if required includeConfig !params.igenomes_ignore ? 'conf/igenomes.config' : 'conf/igenomes_ignored.config' + // Export these variables to prevent local Python/R libraries from conflicting with those in the container // The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container. // See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable. @@ -263,4 +268,3 @@ validation { // Load modules.config for DSL2 module specific options includeConfig 'conf/modules.config' - diff --git a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf index 8897e7d1..d734647f 100644 --- a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf @@ -18,9 +18,9 @@ include { UTILS_NFCORE_PIPELINE } from '../../nf-core/utils_nfcore_pipeline' include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW TO INITIALISE PIPELINE -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow PIPELINE_INITIALISATION { @@ -99,9 +99,9 @@ workflow PIPELINE_INITIALISATION { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW FOR PIPELINE COMPLETION -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow PIPELINE_COMPLETION { @@ -147,9 +147,9 @@ workflow PIPELINE_COMPLETION { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // // Check and validate pipeline parameters diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf index 28e32b20..2b0dc67a 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -3,13 +3,12 @@ // /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NEXTFLOW_PIPELINE { - take: print_version // boolean: print version dump_parameters // boolean: dump parameters @@ -22,7 +21,7 @@ workflow UTILS_NEXTFLOW_PIPELINE { // Print workflow version and exit on --version // if (print_version) { - log.info "${workflow.manifest.name} ${getWorkflowVersion()}" + log.info("${workflow.manifest.name} ${getWorkflowVersion()}") System.exit(0) } @@ -45,9 +44,9 @@ workflow UTILS_NEXTFLOW_PIPELINE { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -72,11 +71,11 @@ def getWorkflowVersion() { // Dump pipeline parameters to a JSON file // def dumpParametersToJSON(outdir) { - def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') - def filename = "params_${timestamp}.json" - def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") - def jsonStr = groovy.json.JsonOutput.toJson(params) - temp_pf.text = groovy.json.JsonOutput.prettyPrint(jsonStr) + def timestamp = new java.util.Date().format('yyyy-MM-dd_HH-mm-ss') + def filename = "params_${timestamp}.json" + def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") + def jsonStr = groovy.json.JsonOutput.toJson(params) + temp_pf.text = groovy.json.JsonOutput.prettyPrint(jsonStr) nextflow.extension.FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") temp_pf.delete() @@ -91,9 +90,14 @@ def checkCondaChannels() { try { def config = parser.load("conda config --show channels".execute().text) channels = config.channels - } catch(NullPointerException | IOException e) { - log.warn "Could not verify conda channel configuration." - return + } + catch (NullPointerException e) { + log.warn("Could not verify conda channel configuration.") + return null + } + catch (IOException e) { + log.warn("Could not verify conda channel configuration.") + return null } // Check that all channels are present @@ -106,19 +110,13 @@ def checkCondaChannels() { required_channels_in_order.eachWithIndex { channel, index -> if (index < required_channels_in_order.size() - 1) { - channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index+1])) + channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index + 1])) } } if (channels_missing | channel_priority_violation) { - log.warn "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + - " There is a problem with your Conda configuration!\n\n" + - " You will need to set-up the conda-forge and bioconda channels correctly.\n" + - " Please refer to https://bioconda.github.io/\n" + - " The observed channel order is \n" + - " ${channels}\n" + - " but the following channel order is required:\n" + - " ${required_channels_in_order}\n" + - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + log.warn( + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + " There is a problem with your Conda configuration!\n\n" + " You will need to set-up the conda-forge and bioconda channels correctly.\n" + " Please refer to https://bioconda.github.io/\n" + " The observed channel order is \n" + " ${channels}\n" + " but the following channel order is required:\n" + " ${required_channels_in_order}\n" + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + ) } } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf index cbd8495b..b78273ca 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -3,13 +3,12 @@ // /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NFCORE_PIPELINE { - take: nextflow_cli_args @@ -22,9 +21,9 @@ workflow UTILS_NFCORE_PIPELINE { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -33,12 +32,9 @@ workflow UTILS_NFCORE_PIPELINE { def checkConfigProvided() { def valid_config = true as Boolean if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { - log.warn "[$workflow.manifest.name] You are attempting to run the pipeline without any custom configuration!\n\n" + - "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + - " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + - " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + - " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + - "Please refer to the quick start section and usage docs for the pipeline.\n " + log.warn( + "[${workflow.manifest.name}] You are attempting to run the pipeline without any custom configuration!\n\n" + "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + "Please refer to the quick start section and usage docs for the pipeline.\n " + ) valid_config = false } return valid_config @@ -49,12 +45,14 @@ def checkConfigProvided() { // def checkProfileProvided(nextflow_cli_args) { if (workflow.profile.endsWith(',')) { - error "The `-profile` option cannot end with a trailing comma, please remove it and re-run the pipeline!\n" + - "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + error( + "The `-profile` option cannot end with a trailing comma, please remove it and re-run the pipeline!\n" + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + ) } if (nextflow_cli_args[0]) { - log.warn "nf-core pipelines do not accept positional arguments. The positional argument `${nextflow_cli_args[0]}` has been detected.\n" + - "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + log.warn( + "nf-core pipelines do not accept positional arguments. The positional argument `${nextflow_cli_args[0]}` has been detected.\n" + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + ) } } @@ -70,13 +68,7 @@ def workflowCitation() { manifest_doi.each { doi_ref -> temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" } - return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + - "* The pipeline\n" + - temp_doi_ref + "\n" + - "* The nf-core framework\n" + - " https://doi.org/10.1038/s41587-020-0439-x\n\n" + - "* Software dependencies\n" + - " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" + return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + "* The pipeline\n" + temp_doi_ref + "\n" + "* The nf-core framework\n" + " https://doi.org/10.1038/s41587-020-0439-x\n\n" + "* Software dependencies\n" + " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" } // @@ -102,7 +94,7 @@ def getWorkflowVersion() { // def processVersionsFromYAML(yaml_file) { def yaml = new org.yaml.snakeyaml.Yaml() - def versions = yaml.load(yaml_file).collectEntries { k, v -> [ k.tokenize(':')[-1], v ] } + def versions = yaml.load(yaml_file).collectEntries { k, v -> [k.tokenize(':')[-1], v] } return yaml.dumpAsMap(versions).trim() } @@ -112,8 +104,8 @@ def processVersionsFromYAML(yaml_file) { def workflowVersionToYAML() { return """ Workflow: - $workflow.manifest.name: ${getWorkflowVersion()} - Nextflow: $workflow.nextflow.version + ${workflow.manifest.name}: ${getWorkflowVersion()} + Nextflow: ${workflow.nextflow.version} """.stripIndent().trim() } @@ -121,11 +113,7 @@ def workflowVersionToYAML() { // Get channel of software versions used in pipeline in YAML format // def softwareVersionsToYAML(ch_versions) { - return ch_versions - .unique() - .map { version -> processVersionsFromYAML(version) } - .unique() - .mix(Channel.of(workflowVersionToYAML())) + return ch_versions.unique().map { version -> processVersionsFromYAML(version) }.unique().mix(Channel.of(workflowVersionToYAML())) } // @@ -133,25 +121,31 @@ def softwareVersionsToYAML(ch_versions) { // def paramsSummaryMultiqc(summary_params) { def summary_section = '' - summary_params.keySet().each { group -> - def group_params = summary_params.get(group) // This gets the parameters of that particular group - if (group_params) { - summary_section += "

    $group

    \n" - summary_section += "
    \n" - group_params.keySet().sort().each { param -> - summary_section += "
    $param
    ${group_params.get(param) ?: 'N/A'}
    \n" + summary_params + .keySet() + .each { group -> + def group_params = summary_params.get(group) + // This gets the parameters of that particular group + if (group_params) { + summary_section += "

    ${group}

    \n" + summary_section += "
    \n" + group_params + .keySet() + .sort() + .each { param -> + summary_section += "
    ${param}
    ${group_params.get(param) ?: 'N/A'}
    \n" + } + summary_section += "
    \n" } - summary_section += "
    \n" } - } - def yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" as String - yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" - yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" - yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" - yaml_file_text += "plot_type: 'html'\n" - yaml_file_text += "data: |\n" - yaml_file_text += "${summary_section}" + def yaml_file_text = "id: '${workflow.manifest.name.replace('/', '-')}-summary'\n" as String + yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" + yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" + yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" + yaml_file_text += "plot_type: 'html'\n" + yaml_file_text += "data: |\n" + yaml_file_text += "${summary_section}" return yaml_file_text } @@ -199,54 +193,54 @@ def logColours(monochrome_logs=true) { colorcodes['hidden'] = monochrome_logs ? '' : "\033[8m" // Regular Colors - colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" - colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" - colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" - colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" - colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" - colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" - colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" - colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" + colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" + colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" + colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" + colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" + colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" + colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" + colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" + colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" // Bold - colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" - colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" - colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" - colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" - colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" - colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" - colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" - colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" + colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" + colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" + colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" + colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" + colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" + colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" + colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" + colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" // Underline - colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" - colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" - colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" - colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" - colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" - colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" - colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" - colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" + colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" + colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" + colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" + colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" + colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" + colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" + colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" + colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" // High Intensity - colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" - colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" - colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" - colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" - colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" - colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" - colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" - colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" + colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" + colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" + colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" + colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" + colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" + colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" + colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" + colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" // Bold High Intensity - colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" - colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" - colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" - colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" - colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" - colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" - colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" - colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" + colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" + colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" + colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" + colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" + colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" + colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" + colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" + colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" return colorcodes } @@ -261,14 +255,15 @@ def attachMultiqcReport(multiqc_report) { mqc_report = multiqc_report.getVal() if (mqc_report.getClass() == ArrayList && mqc_report.size() >= 1) { if (mqc_report.size() > 1) { - log.warn "[$workflow.manifest.name] Found multiple reports from process 'MULTIQC', will use only one" + log.warn("[${workflow.manifest.name}] Found multiple reports from process 'MULTIQC', will use only one") } mqc_report = mqc_report[0] } } - } catch (all) { + } + catch (Exception all) { if (multiqc_report) { - log.warn "[$workflow.manifest.name] Could not attach MultiQC report to summary email" + log.warn("[${workflow.manifest.name}] Could not attach MultiQC report to summary email") } } return mqc_report @@ -280,26 +275,35 @@ def attachMultiqcReport(multiqc_report) { def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs=true, multiqc_report=null) { // Set up the e-mail variables - def subject = "[$workflow.manifest.name] Successful: $workflow.runName" + def subject = "[${workflow.manifest.name}] Successful: ${workflow.runName}" if (!workflow.success) { - subject = "[$workflow.manifest.name] FAILED: $workflow.runName" + subject = "[${workflow.manifest.name}] FAILED: ${workflow.runName}" } def summary = [:] - summary_params.keySet().sort().each { group -> - summary << summary_params[group] - } + summary_params + .keySet() + .sort() + .each { group -> + summary << summary_params[group] + } def misc_fields = [:] misc_fields['Date Started'] = workflow.start misc_fields['Date Completed'] = workflow.complete misc_fields['Pipeline script file path'] = workflow.scriptFile misc_fields['Pipeline script hash ID'] = workflow.scriptId - if (workflow.repository) misc_fields['Pipeline repository Git URL'] = workflow.repository - if (workflow.commitId) misc_fields['Pipeline repository Git Commit'] = workflow.commitId - if (workflow.revision) misc_fields['Pipeline Git branch/tag'] = workflow.revision - misc_fields['Nextflow Version'] = workflow.nextflow.version - misc_fields['Nextflow Build'] = workflow.nextflow.build + if (workflow.repository) { + misc_fields['Pipeline repository Git URL'] = workflow.repository + } + if (workflow.commitId) { + misc_fields['Pipeline repository Git Commit'] = workflow.commitId + } + if (workflow.revision) { + misc_fields['Pipeline Git branch/tag'] = workflow.revision + } + misc_fields['Nextflow Version'] = workflow.nextflow.version + misc_fields['Nextflow Build'] = workflow.nextflow.build misc_fields['Nextflow Compile Timestamp'] = workflow.nextflow.timestamp def email_fields = [:] @@ -337,7 +341,7 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi // Render the sendmail template def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit - def smail_fields = [ email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes() ] + def smail_fields = [email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes()] def sf = new File("${workflow.projectDir}/assets/sendmail_template.txt") def sendmail_template = engine.createTemplate(sf).make(smail_fields) def sendmail_html = sendmail_template.toString() @@ -346,30 +350,32 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi def colors = logColours(monochrome_logs) as Map if (email_address) { try { - if (plaintext_email) { throw new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') } + if (plaintext_email) { +new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') } // Try to send HTML e-mail using sendmail def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") sendmail_tf.withWriter { w -> w << sendmail_html } - [ 'sendmail', '-t' ].execute() << sendmail_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (sendmail)-" - } catch (all) { + ['sendmail', '-t'].execute() << sendmail_html + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (sendmail)-") + } + catch (Exception all) { // Catch failures and try with plaintext - def mail_cmd = [ 'mail', '-s', subject, '--content-type=text/html', email_address ] + def mail_cmd = ['mail', '-s', subject, '--content-type=text/html', email_address] mail_cmd.execute() << email_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (mail)-" + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (mail)-") } } // Write summary e-mail HTML to a file def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") output_hf.withWriter { w -> w << email_html } - nextflow.extension.FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html"); + nextflow.extension.FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html") output_hf.delete() // Write summary e-mail TXT to a file def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") output_tf.withWriter { w -> w << email_txt } - nextflow.extension.FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt"); + nextflow.extension.FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt") output_tf.delete() } @@ -380,12 +386,14 @@ def completionSummary(monochrome_logs=true) { def colors = logColours(monochrome_logs) as Map if (workflow.success) { if (workflow.stats.ignoredCount == 0) { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Pipeline completed successfully${colors.reset}-" - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-" + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Pipeline completed successfully${colors.reset}-") + } + else { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-") } - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.red} Pipeline completed with errors${colors.reset}-" + } + else { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.red} Pipeline completed with errors${colors.reset}-") } } @@ -394,21 +402,30 @@ def completionSummary(monochrome_logs=true) { // def imNotification(summary_params, hook_url) { def summary = [:] - summary_params.keySet().sort().each { group -> - summary << summary_params[group] - } + summary_params + .keySet() + .sort() + .each { group -> + summary << summary_params[group] + } def misc_fields = [:] - misc_fields['start'] = workflow.start - misc_fields['complete'] = workflow.complete - misc_fields['scriptfile'] = workflow.scriptFile - misc_fields['scriptid'] = workflow.scriptId - if (workflow.repository) misc_fields['repository'] = workflow.repository - if (workflow.commitId) misc_fields['commitid'] = workflow.commitId - if (workflow.revision) misc_fields['revision'] = workflow.revision - misc_fields['nxf_version'] = workflow.nextflow.version - misc_fields['nxf_build'] = workflow.nextflow.build - misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp + misc_fields['start'] = workflow.start + misc_fields['complete'] = workflow.complete + misc_fields['scriptfile'] = workflow.scriptFile + misc_fields['scriptid'] = workflow.scriptId + if (workflow.repository) { + misc_fields['repository'] = workflow.repository + } + if (workflow.commitId) { + misc_fields['commitid'] = workflow.commitId + } + if (workflow.revision) { + misc_fields['revision'] = workflow.revision + } + misc_fields['nxf_version'] = workflow.nextflow.version + misc_fields['nxf_build'] = workflow.nextflow.build + misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp def msg_fields = [:] msg_fields['version'] = getWorkflowVersion() @@ -433,13 +450,13 @@ def imNotification(summary_params, hook_url) { def json_message = json_template.toString() // POST - def post = new URL(hook_url).openConnection(); + def post = new URL(hook_url).openConnection() post.setRequestMethod("POST") post.setDoOutput(true) post.setRequestProperty("Content-Type", "application/json") - post.getOutputStream().write(json_message.getBytes("UTF-8")); - def postRC = post.getResponseCode(); - if (! postRC.equals(200)) { - log.warn(post.getErrorStream().getText()); + post.getOutputStream().write(json_message.getBytes("UTF-8")) + def postRC = post.getResponseCode() + if (!postRC.equals(200)) { + log.warn(post.getErrorStream().getText()) } } From 6b92ae283b30889ef14d10a99753c3d2e081b0ac Mon Sep 17 00:00:00 2001 From: atrigila <18577080+atrigila@users.noreply.github.com> Date: Thu, 10 Oct 2024 13:42:02 +0000 Subject: [PATCH 12/27] validate input params --- .../utils_nfcore_smrnaseq_pipeline/main.nf | 34 +++++++++++++++++++ 1 file changed, 34 insertions(+) diff --git a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf index 81d9b80a..0e85dc20 100644 --- a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf @@ -163,6 +163,40 @@ workflow PIPELINE_COMPLETION { // def validateInputParameters() { genomeExistsError() + + if (!params.mirgenedb && !params.mirtrace_species) { + error("Reference species for miRTrace is not defined via the --mirtrace_species parameter.") + } + + if (!params.mirgenedb) { + // Validate mature miRNA fasta file + if (!params.mature) { + error("Mature miRNA fasta file not found. Please specify using the '--mature' parameter.") + } + // Validate hairpin miRNA fasta file + if (!params.hairpin) { + error("Hairpin miRNA fasta file not found. Please specify using the '--hairpin' parameter.") + } + } else { + // Validate MirGeneDB species + if (!params.mirgenedb_species) { + error("You specified to be using MirGeneDB, but the MirGeneDB species is not set. Please specify using the '--mirgenedb_species' parameter.") + } + // Validate MirGeneDB mature miRNA fasta file + if (!params.mirgenedb_mature) { + error("You specified to be using MirGeneDB, but the mature miRNA fasta file is not found. Please provide the file using the '--mirgenedb_mature' parameter.") + } + // Validate MirGeneDB hairpin miRNA fasta file + if (!params.mirgenedb_hairpin) { + error("You specified to be using MirGeneDB, but the hairpin miRNA fasta file is not found. Please provide the file using the '--mirgenedb_hairpin' parameter.") + } + // Validate MirGeneDB GFF file + if (!params.mirgenedb_gff) { + error("You specified to be using MirGeneDB, but the GFF file is not found. Please provide the file using the '--mirgenedb_gff' parameter.") + } + } + + } // Validate channels from input samplesheet From d5248656878465b820c1eeb7a4d21f8f38b9cff0 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Fri, 11 Oct 2024 10:55:29 +0000 Subject: [PATCH 13/27] Final update of modules and subworkflows --- modules.json | 8 +- modules/nf-core/multiqc/main.nf | 2 +- .../nf-core/multiqc/tests/main.nf.test.snap | 2 +- modules/nf-core/samtools/sort/main.nf | 10 +- .../nf-core/samtools/sort/tests/main.nf.test | 64 ++++++++++++ .../samtools/sort/tests/main.nf.test.snap | 99 ++++++++++++++++++- .../nf-core/utils_nextflow_pipeline/main.nf | 30 +++--- .../nf-core/utils_nfcore_pipeline/main.nf | 10 +- 8 files changed, 193 insertions(+), 32 deletions(-) diff --git a/modules.json b/modules.json index c137d862..3875beb2 100644 --- a/modules.json +++ b/modules.json @@ -98,7 +98,7 @@ }, "multiqc": { "branch": "master", - "git_sha": "b8d36829fa84b6e404364abff787e8b07f6d058c", + "git_sha": "cf17ca47590cc578dfb47db1c2a44ef86f89976d", "installed_by": ["modules"] }, "samtools/flagstat": { @@ -118,7 +118,7 @@ }, "samtools/sort": { "branch": "master", - "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", + "git_sha": "b7800db9b069ed505db3f9d91b8c72faea9be17b", "installed_by": ["bam_sort_stats_samtools", "modules"] }, "samtools/stats": { @@ -193,12 +193,12 @@ }, "utils_nextflow_pipeline": { "branch": "master", - "git_sha": "9d05360da397692321d377b6102d2fb22507c6ef", + "git_sha": "3aa0aec1d52d492fe241919f0c6100ebf0074082", "installed_by": ["subworkflows"] }, "utils_nfcore_pipeline": { "branch": "master", - "git_sha": "772684d9d66f37b650c8ba5146ac1ee3ecba2acb", + "git_sha": "1b6b9a3338d011367137808b49b923515080e3ba", "installed_by": ["subworkflows"] }, "utils_nfschema_plugin": { diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 9724d2f3..cc0643e1 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -52,7 +52,7 @@ process MULTIQC { stub: """ mkdir multiqc_data - touch multiqc_plots + mkdir multiqc_plots touch multiqc_report.html cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap index 261dc0fa..2fcbb5ff 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -38,4 +38,4 @@ }, "timestamp": "2024-10-02T17:52:09.185842" } -} +} \ No newline at end of file diff --git a/modules/nf-core/samtools/sort/main.nf b/modules/nf-core/samtools/sort/main.nf index acfd9252..caf3c61a 100644 --- a/modules/nf-core/samtools/sort/main.nf +++ b/modules/nf-core/samtools/sort/main.nf @@ -12,11 +12,11 @@ process SAMTOOLS_SORT { tuple val(meta2), path(fasta) output: - tuple val(meta), path("*.bam"), emit: bam, optional: true - tuple val(meta), path("*.cram"), emit: cram, optional: true - tuple val(meta), path("*.crai"), emit: crai, optional: true - tuple val(meta), path("*.csi"), emit: csi, optional: true - path "versions.yml" , emit: versions + tuple val(meta), path("*.bam"), emit: bam, optional: true + tuple val(meta), path("*.cram"), emit: cram, optional: true + tuple val(meta), path("*.crai"), emit: crai, optional: true + tuple val(meta), path("*.csi"), emit: csi, optional: true + path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test b/modules/nf-core/samtools/sort/tests/main.nf.test index c2ea9c72..b05e6691 100644 --- a/modules/nf-core/samtools/sort/tests/main.nf.test +++ b/modules/nf-core/samtools/sort/tests/main.nf.test @@ -39,6 +39,40 @@ nextflow_process { } } + test("multiple bam") { + + config "./nextflow.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true) + ] + ]) + input[1] = Channel.of([ + [ id:'fasta' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + process.out.bam, + process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, + process.out.versions + ).match()} + ) + } + } + test("cram") { config "./nextflow_cram.config" @@ -98,6 +132,36 @@ nextflow_process { } } + test("multiple bam - stub") { + + config "./nextflow.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true) + ] + ]) + input[1] = Channel.of([ + [ id:'fasta' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + test("cram - stub") { options "-stub" diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test.snap b/modules/nf-core/samtools/sort/tests/main.nf.test.snap index 2d6b2900..469891fe 100644 --- a/modules/nf-core/samtools/sort/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/sort/tests/main.nf.test.snap @@ -159,6 +159,101 @@ }, "timestamp": "2024-09-16T08:50:19.061912443" }, + "multiple bam": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,8a16ba90c7d294cbb4c33ac0f7127a12" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.csi" + ] + ], + [ + "versions.yml:md5,2659b187d681241451539d4c53500b9f" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.09.0" + }, + "timestamp": "2024-10-08T11:59:55.479443" + }, + "multiple bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,8a16ba90c7d294cbb4c33ac0f7127a12" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.csi:md5,d185916eaff9afeb4d0aeab3310371f9" + ] + ], + "4": [ + "versions.yml:md5,2659b187d681241451539d4c53500b9f" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,8a16ba90c7d294cbb4c33ac0f7127a12" + ] + ], + "crai": [ + + ], + "cram": [ + + ], + "csi": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.csi:md5,d185916eaff9afeb4d0aeab3310371f9" + ] + ], + "versions": [ + "versions.yml:md5,2659b187d681241451539d4c53500b9f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.09.0" + }, + "timestamp": "2024-10-08T11:36:13.781404" + }, "bam": { "content": [ [ @@ -185,8 +280,8 @@ ], "meta": { "nf-test": "0.9.0", - "nextflow": "24.04.4" + "nextflow": "24.09.0" }, - "timestamp": "2024-09-16T08:49:43.971158333" + "timestamp": "2024-10-08T11:59:46.372244" } } \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf index 2b0dc67a..0fcbf7b3 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -3,9 +3,9 @@ // /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NEXTFLOW_PIPELINE { @@ -44,9 +44,9 @@ workflow UTILS_NEXTFLOW_PIPELINE { } /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -106,17 +106,19 @@ def checkCondaChannels() { def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean // Check that they are in the right order - def channel_priority_violation = false - - required_channels_in_order.eachWithIndex { channel, index -> - if (index < required_channels_in_order.size() - 1) { - channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index + 1])) - } - } + def channel_priority_violation = required_channels_in_order != channels.findAll { ch -> ch in required_channels_in_order } if (channels_missing | channel_priority_violation) { - log.warn( - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + " There is a problem with your Conda configuration!\n\n" + " You will need to set-up the conda-forge and bioconda channels correctly.\n" + " Please refer to https://bioconda.github.io/\n" + " The observed channel order is \n" + " ${channels}\n" + " but the following channel order is required:\n" + " ${required_channels_in_order}\n" + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" - ) + log.warn """\ + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + There is a problem with your Conda configuration! + You will need to set-up the conda-forge and bioconda channels correctly. + Please refer to https://bioconda.github.io/ + The observed channel order is + ${channels} + but the following channel order is required: + ${required_channels_in_order} + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + """.stripIndent(true) } } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf index b78273ca..5cb7bafe 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -3,9 +3,9 @@ // /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NFCORE_PIPELINE { @@ -21,9 +21,9 @@ workflow UTILS_NFCORE_PIPELINE { } /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -62,7 +62,7 @@ def checkProfileProvided(nextflow_cli_args) { def workflowCitation() { def temp_doi_ref = "" def manifest_doi = workflow.manifest.doi.tokenize(",") - // Using a loop to handle multiple DOIs + // Handling multiple DOIs // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers // Removing ` ` since the manifest.doi is a string and not a proper list manifest_doi.each { doi_ref -> From 75cc53b891f3c3291f9daf0ff829f605710e0573 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Fri, 11 Oct 2024 10:57:26 +0000 Subject: [PATCH 14/27] Remove one more todo --- nextflow.config | 1 - 1 file changed, 1 deletion(-) diff --git a/nextflow.config b/nextflow.config index 3a734460..6da805f4 100644 --- a/nextflow.config +++ b/nextflow.config @@ -234,7 +234,6 @@ profiles { includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/nfcore_custom.config" : "/dev/null" // Load nf-core/smrnaseq custom profiles from different institutions. -// TODO nf-core: Optionally, you can add a pipeline-specific nf-core config at https://github.com/nf-core/configs // includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/smrnaseq.config" : "/dev/null" // Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile // Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled From 6bde0c1ed53a657bd85cc195c21e153f0633dce4 Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Fri, 11 Oct 2024 11:53:29 +0000 Subject: [PATCH 15/27] Template update for nf-core/tools version 3.0.2 --- .github/workflows/ci.yml | 60 +++++++++++++------ .../workflows/template_version_comment.yml | 21 ++++--- .gitignore | 1 + .nf-core.yml | 2 +- main.nf | 2 +- modules.json | 6 +- modules/nf-core/multiqc/main.nf | 2 +- nextflow.config | 4 +- .../utils_nfcore_smrnaseq_pipeline/main.nf | 4 +- .../nf-core/utils_nextflow_pipeline/main.nf | 30 +++++----- .../nf-core/utils_nfcore_pipeline/main.nf | 10 ++-- workflows/smrnaseq.nf | 2 - 12 files changed, 86 insertions(+), 58 deletions(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 33d2ae00..db493791 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -11,6 +11,8 @@ on: env: NXF_ANSI_LOG: false + NXF_SINGULARITY_CACHEDIR: ${{ github.workspace }}/.singularity + NXF_SINGULARITY_LIBRARYDIR: ${{ github.workspace }}/.singularity concurrency: group: "${{ github.workflow }}-${{ github.event.pull_request.number || github.ref }}" @@ -18,7 +20,7 @@ concurrency: jobs: test: - name: Run pipeline with test data + name: "Run pipeline with test data (${{ matrix.NXF_VER }} | ${{ matrix.test_name }} | ${{ matrix.profile }})" # Only run on push if this is the nf-core dev branch (merged PRs) if: "${{ github.event_name != 'push' || (github.event_name == 'push' && github.repository == 'nf-core/smrnaseq') }}" runs-on: ubuntu-latest @@ -27,33 +29,57 @@ jobs: NXF_VER: - "24.04.2" - "latest-everything" + profile: + - "conda" + - "docker" + - "singularity" + test_name: + - "test" + isMaster: + - ${{ github.base_ref == 'master' }} + # Exclude conda and singularity on dev + exclude: + - isMaster: false + profile: "conda" + - isMaster: false + profile: "singularity" steps: - name: Check out pipeline code uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 - - name: Install Nextflow + - name: Set up Nextflow uses: nf-core/setup-nextflow@v2 with: version: "${{ matrix.NXF_VER }}" - - name: Disk space cleanup - uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 + - name: Set up Apptainer + if: matrix.profile == 'singularity' + uses: eWaterCycle/setup-apptainer@main - - name: Run pipeline with test data (docker) - # TODO nf-core: You can customise CI pipeline run tests as required - # For example: adding multiple test runs with different parameters - # Remember that you can parallelise this by using strategy.matrix + - name: Set up Singularity + if: matrix.profile == 'singularity' run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker --outdir ./results + mkdir -p $NXF_SINGULARITY_CACHEDIR + mkdir -p $NXF_SINGULARITY_LIBRARYDIR + + - name: Set up Miniconda + if: matrix.profile == 'conda' + uses: conda-incubator/setup-miniconda@a4260408e20b96e80095f42ff7f1a15b27dd94ca # v3 + with: + miniconda-version: "latest" + auto-update-conda: true + conda-solver: libmamba + channels: conda-forge,bioconda - - name: Run pipeline with test data (singularity) - # TODO nf-core: You can customise CI pipeline run tests as required + - name: Set up Conda + if: matrix.profile == 'conda' run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,singularity --outdir ./results - if: "${{ github.base_ref == 'master' }}" + echo $(realpath $CONDA)/condabin >> $GITHUB_PATH + echo $(realpath python) >> $GITHUB_PATH + + - name: Clean up Disk space + uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 - - name: Run pipeline with test data (conda) - # TODO nf-core: You can customise CI pipeline run tests as required + - name: "Run pipeline with test data ${{ matrix.NXF_VER }} | ${{ matrix.test_name }} | ${{ matrix.profile }}" run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,conda --outdir ./results - if: "${{ github.base_ref == 'master' }}" + nextflow run ${GITHUB_WORKSPACE} -profile ${{ matrix.test_name }},${{ matrix.profile }} --outdir ./results diff --git a/.github/workflows/template_version_comment.yml b/.github/workflows/template_version_comment.yml index 9dea41f0..e8aafe44 100644 --- a/.github/workflows/template_version_comment.yml +++ b/.github/workflows/template_version_comment.yml @@ -10,9 +10,11 @@ jobs: steps: - name: Check out pipeline code uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + with: + ref: ${{ github.event.pull_request.head.sha }} - name: Read template version from .nf-core.yml - uses: pietrobolcato/action-read-yaml@1.0.0 + uses: nichmor/minimal-read-yaml@v0.0.2 id: read_yml with: config: ${{ github.workspace }}/.nf-core.yml @@ -24,20 +26,21 @@ jobs: - name: Check nf-core outdated id: nf_core_outdated - run: pip list --outdated | grep nf-core + run: echo "OUTPUT=$(pip list --outdated | grep nf-core)" >> ${GITHUB_ENV} - name: Post nf-core template version comment uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 if: | - ${{ steps.nf_core_outdated.outputs.stdout }} =~ 'nf-core' + contains(env.OUTPUT, 'nf-core') with: repo-token: ${{ secrets.NF_CORE_BOT_AUTH_TOKEN }} allow-repeats: false message: | - ## :warning: Newer version of the nf-core template is available. - - Your pipeline is using an old version of the nf-core template: ${{ steps.read_yml.outputs['nf_core_version'] }}. - Please update your pipeline to the latest version. - - For more documentation on how to update your pipeline, please see the [nf-core documentation](https://github.com/nf-core/tools?tab=readme-ov-file#sync-a-pipeline-with-the-template) and [Synchronisation documentation](https://nf-co.re/docs/contributing/sync). + > [!WARNING] + > Newer version of the nf-core template is available. + > + > Your pipeline is using an old version of the nf-core template: ${{ steps.read_yml.outputs['nf_core_version'] }}. + > Please update your pipeline to the latest version. + > + > For more documentation on how to update your pipeline, please see the [nf-core documentation](https://github.com/nf-core/tools?tab=readme-ov-file#sync-a-pipeline-with-the-template) and [Synchronisation documentation](https://nf-co.re/docs/contributing/sync). # diff --git a/.gitignore b/.gitignore index 5124c9ac..a42ce016 100644 --- a/.gitignore +++ b/.gitignore @@ -6,3 +6,4 @@ results/ testing/ testing* *.pyc +null/ diff --git a/.nf-core.yml b/.nf-core.yml index 46543473..98e8cdf5 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -3,7 +3,7 @@ lint: nextflow_config: - config_defaults: - params.fastp_known_mirna_adapters -nf_core_version: 3.0.1 +nf_core_version: 3.0.2 org_path: null repository_type: pipeline template: diff --git a/main.nf b/main.nf index 006141b6..db61cd5a 100644 --- a/main.nf +++ b/main.nf @@ -76,7 +76,7 @@ workflow { params.outdir, params.input ) - + // // WORKFLOW: Run main workflow // diff --git a/modules.json b/modules.json index 28e19d5e..a004f80a 100644 --- a/modules.json +++ b/modules.json @@ -12,7 +12,7 @@ }, "multiqc": { "branch": "master", - "git_sha": "b8d36829fa84b6e404364abff787e8b07f6d058c", + "git_sha": "cf17ca47590cc578dfb47db1c2a44ef86f89976d", "installed_by": ["modules"] } } @@ -21,12 +21,12 @@ "nf-core": { "utils_nextflow_pipeline": { "branch": "master", - "git_sha": "9d05360da397692321d377b6102d2fb22507c6ef", + "git_sha": "3aa0aec1d52d492fe241919f0c6100ebf0074082", "installed_by": ["subworkflows"] }, "utils_nfcore_pipeline": { "branch": "master", - "git_sha": "772684d9d66f37b650c8ba5146ac1ee3ecba2acb", + "git_sha": "1b6b9a3338d011367137808b49b923515080e3ba", "installed_by": ["subworkflows"] }, "utils_nfschema_plugin": { diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 9724d2f3..cc0643e1 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -52,7 +52,7 @@ process MULTIQC { stub: """ mkdir multiqc_data - touch multiqc_plots + mkdir multiqc_plots touch multiqc_report.html cat <<-END_VERSIONS > versions.yml diff --git a/nextflow.config b/nextflow.config index 12df5c46..e75d5191 100644 --- a/nextflow.config +++ b/nextflow.config @@ -254,10 +254,10 @@ validation { """ afterText = """${manifest.doi ? "* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} * The nf-core framework - https://doi.org/10.1038/s41587-020-0439-x + https://doi.org/10.1038/s41587-020-0439-x * Software dependencies - https://github.com/${manifest.name}/blob/master/CITATIONS.md + https://github.com/${manifest.name}/blob/master/CITATIONS.md """ } summary { diff --git a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf index d734647f..e680481f 100644 --- a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf @@ -47,7 +47,6 @@ workflow PIPELINE_INITIALISATION { workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1 ) - // // Validate parameters and generate parameter summary to stdout // @@ -56,7 +55,6 @@ workflow PIPELINE_INITIALISATION { validate_params, null ) - // // Check config provided to the pipeline @@ -64,6 +62,7 @@ workflow PIPELINE_INITIALISATION { UTILS_NFCORE_PIPELINE ( nextflow_cli_args ) + // // Custom validation for pipeline parameters // @@ -110,7 +109,6 @@ workflow PIPELINE_COMPLETION { email // string: email address email_on_fail // string: email address sent on pipeline failure plaintext_email // boolean: Send plain-text email instead of HTML - outdir // path: Path to output directory where results will be published monochrome_logs // boolean: Disable ANSI colour codes in log output hook_url // string: hook URL for notifications diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf index 2b0dc67a..0fcbf7b3 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -3,9 +3,9 @@ // /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NEXTFLOW_PIPELINE { @@ -44,9 +44,9 @@ workflow UTILS_NEXTFLOW_PIPELINE { } /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -106,17 +106,19 @@ def checkCondaChannels() { def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean // Check that they are in the right order - def channel_priority_violation = false - - required_channels_in_order.eachWithIndex { channel, index -> - if (index < required_channels_in_order.size() - 1) { - channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index + 1])) - } - } + def channel_priority_violation = required_channels_in_order != channels.findAll { ch -> ch in required_channels_in_order } if (channels_missing | channel_priority_violation) { - log.warn( - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + " There is a problem with your Conda configuration!\n\n" + " You will need to set-up the conda-forge and bioconda channels correctly.\n" + " Please refer to https://bioconda.github.io/\n" + " The observed channel order is \n" + " ${channels}\n" + " but the following channel order is required:\n" + " ${required_channels_in_order}\n" + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" - ) + log.warn """\ + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + There is a problem with your Conda configuration! + You will need to set-up the conda-forge and bioconda channels correctly. + Please refer to https://bioconda.github.io/ + The observed channel order is + ${channels} + but the following channel order is required: + ${required_channels_in_order} + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + """.stripIndent(true) } } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf index b78273ca..5cb7bafe 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -3,9 +3,9 @@ // /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NFCORE_PIPELINE { @@ -21,9 +21,9 @@ workflow UTILS_NFCORE_PIPELINE { } /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -62,7 +62,7 @@ def checkProfileProvided(nextflow_cli_args) { def workflowCitation() { def temp_doi_ref = "" def manifest_doi = workflow.manifest.doi.tokenize(",") - // Using a loop to handle multiple DOIs + // Handling multiple DOIs // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers // Removing ` ` since the manifest.doi is a string and not a proper list manifest_doi.each { doi_ref -> diff --git a/workflows/smrnaseq.nf b/workflows/smrnaseq.nf index 3b8c65fe..7c6d4d1f 100644 --- a/workflows/smrnaseq.nf +++ b/workflows/smrnaseq.nf @@ -57,13 +57,11 @@ workflow SMRNASEQ { Channel.fromPath(params.multiqc_logo, checkIfExists: true) : Channel.empty() - summary_params = paramsSummaryMap( workflow, parameters_schema: "nextflow_schema.json") ch_workflow_summary = Channel.value(paramsSummaryMultiqc(summary_params)) ch_multiqc_files = ch_multiqc_files.mix( ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) - ch_multiqc_custom_methods_description = params.multiqc_methods_description ? file(params.multiqc_methods_description, checkIfExists: true) : file("$projectDir/assets/methods_description_template.yml", checkIfExists: true) From b266fc69addb8d8b524f4e1b9bf12d341a2a0964 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Fri, 11 Oct 2024 14:57:09 +0000 Subject: [PATCH 16/27] Also remove .nf-test directory --- .gitignore | 2 ++ 1 file changed, 2 insertions(+) diff --git a/.gitignore b/.gitignore index a42ce016..a04cf068 100644 --- a/.gitignore +++ b/.gitignore @@ -6,4 +6,6 @@ results/ testing/ testing* *.pyc +.nf-test/ +.nf-test.log null/ From dce528b44abbe034ab33a6c03084289a877e0331 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Fri, 11 Oct 2024 14:59:38 +0000 Subject: [PATCH 17/27] Fix merge issue --- workflows/smrnaseq.nf | 1 - 1 file changed, 1 deletion(-) diff --git a/workflows/smrnaseq.nf b/workflows/smrnaseq.nf index 7ecba83f..d7161c9b 100644 --- a/workflows/smrnaseq.nf +++ b/workflows/smrnaseq.nf @@ -246,7 +246,6 @@ workflow NFCORE_SMRNASEQ { .collectFile( storeDir: "${params.outdir}/pipeline_info", name: 'nf_core_' + 'pipeline_software_' + 'mqc_' + 'versions.yml', - name: 'nf_core_' + 'pipeline_software_' + 'mqc_' + 'versions.yml', sort: true, newLine: true ).set { ch_collated_versions } From c3c490e6de05c94f0a6b3625ed78186be2201d34 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Fri, 11 Oct 2024 15:01:41 +0000 Subject: [PATCH 18/27] Fixing duplicate imports --- subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf | 4 ---- 1 file changed, 4 deletions(-) diff --git a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf index 5b36d64f..4a0bf9aa 100644 --- a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf @@ -8,9 +8,6 @@ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -include { UTILS_NFSCHEMA_PLUGIN } from '../../nf-core/utils_nfschema_plugin' -include { paramsSummaryMap } from 'plugin/nf-schema' -include { samplesheetToList } from 'plugin/nf-schema' include { UTILS_NFSCHEMA_PLUGIN } from '../../nf-core/utils_nfschema_plugin' include { paramsSummaryMap } from 'plugin/nf-schema' include { samplesheetToList } from 'plugin/nf-schema' @@ -19,7 +16,6 @@ include { completionSummary } from '../../nf-core/utils_nfcore_pipeline' include { imNotification } from '../../nf-core/utils_nfcore_pipeline' include { UTILS_NFCORE_PIPELINE } from '../../nf-core/utils_nfcore_pipeline' include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' -include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ From cfe34d6e8d56efcc45cd05499b9ff7000fafe6bd Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Fri, 11 Oct 2024 15:05:22 +0000 Subject: [PATCH 19/27] Hopefully fix --- subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf index 4a0bf9aa..13c76918 100644 --- a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf @@ -111,7 +111,7 @@ workflow PIPELINE_INITIALISATION { three_prime_adapter = ch_three_prime_adapter // channel: [ val(string) ] phred_offset = ch_phred_offset // channel: [ val(string) ] } - +} /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ From f7baad5f8e29c89850a4ec4a77a78ea780dbcbbe Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Fri, 11 Oct 2024 15:17:01 +0000 Subject: [PATCH 20/27] Finding more issues --- .../utils_nfcore_smrnaseq_pipeline/main.nf | 21 ------------------- 1 file changed, 21 deletions(-) diff --git a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf index 13c76918..04e2623c 100644 --- a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf @@ -57,8 +57,6 @@ workflow PIPELINE_INITIALISATION { // // Validate parameters and generate parameter summary to stdout // - UTILS_NFSCHEMA_PLUGIN ( - workflow, UTILS_NFSCHEMA_PLUGIN ( workflow, validate_params, @@ -97,9 +95,6 @@ workflow PIPELINE_INITIALISATION { .groupTuple() .map { samplesheet -> validateInputSamplesheet(samplesheet) - .map { samplesheet -> - validateInputSamplesheet(samplesheet) - } .map { meta, fastqs -> return [ meta, fastqs.flatten() ] @@ -148,15 +143,6 @@ workflow PIPELINE_COMPLETION { monochrome_logs, multiqc_report.toList() ) - completionEmail( - summary_params, - email, - email_on_fail, - plaintext_email, - outdir, - monochrome_logs, - multiqc_report.toList() - ) } completionSummary(monochrome_logs) @@ -225,7 +211,6 @@ def validateInputSamplesheet(input) { // Check that multiple runs of the same sample are of the same datatype i.e. single-end / paired-end def endedness_ok = metas.collect{ meta -> meta.single_end }.unique().size == 1 - def endedness_ok = metas.collect{ meta -> meta.single_end }.unique().size == 1 if (!endedness_ok) { error("Please check input samplesheet -> Multiple runs of a sample must be of the same datatype i.e. single-end or paired-end: ${metas[0].id}") } @@ -335,10 +320,6 @@ def methodsDescriptionText(mqc_methods_yaml) { manifest_doi.each { doi_ref -> temp_doi_ref += "(doi: ${doi_ref.replace("https://doi.org/", "").replace(" ", "")}), " } - def manifest_doi = meta.manifest_map.doi.tokenize(",") - manifest_doi.each { doi_ref -> - temp_doi_ref += "(doi: ${doi_ref.replace("https://doi.org/", "").replace(" ", "")}), " - } meta["doi_text"] = temp_doi_ref.substring(0, temp_doi_ref.length() - 2) } else meta["doi_text"] = "" meta["nodoi_text"] = meta.manifest_map.doi ? "" : "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
    • " @@ -358,5 +339,3 @@ def methodsDescriptionText(mqc_methods_yaml) { return description_html.toString() } - - From 3746326d4cb3072e908adf67c273790df9900df2 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Fri, 11 Oct 2024 15:17:50 +0000 Subject: [PATCH 21/27] Date++ --- CHANGELOG.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 8a498c39..32568137 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,7 +3,7 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). -## v2.4.0 - 2024-10-08 - Navy Iron Boxer +## v2.4.0 - 2024-10-14 - Navy Iron Boxer - [[#349]](https://github.com/nf-core/smrnaseq/pull/349) - Fix [MIRTOP_QUANT conda issue](https://github.com/nf-core/smrnaseq/issues/347) - change conda-base to conda-forge channel. - [[#350]](https://github.com/nf-core/smrnaseq/pull/350) - Fix [MIRTOP_QUANT conda issue](https://github.com/nf-core/smrnaseq/issues/347) - set python version to 3.7 to fix pysam issue. From 3092c8205bd30a034c3387b10c7257c3c9c139bd Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Sun, 13 Oct 2024 09:47:37 +0000 Subject: [PATCH 22/27] Remove some lines --- subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf | 3 +-- 1 file changed, 1 insertion(+), 2 deletions(-) diff --git a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf index 04e2623c..c40bcc55 100644 --- a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf @@ -200,8 +200,6 @@ def validateInputParameters() { error("You specified to be using MirGeneDB, but the GFF file is not found. Please provide the file using the '--mirgenedb_gff' parameter.") } } - - } // Validate channels from input samplesheet @@ -339,3 +337,4 @@ def methodsDescriptionText(mqc_methods_yaml) { return description_html.toString() } + From 019487bd268dd3c870b15b80f92043c0a43f09c7 Mon Sep 17 00:00:00 2001 From: Alexander Peltzer Date: Sun, 13 Oct 2024 09:57:31 +0000 Subject: [PATCH 23/27] Update modules --- modules.json | 28 ++++++++++++---------------- 1 file changed, 12 insertions(+), 16 deletions(-) diff --git a/modules.json b/modules.json index 30c64e02..6f19df08 100644 --- a/modules.json +++ b/modules.json @@ -8,8 +8,7 @@ "bioawk": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"], - "patch": "modules/nf-core/bioawk/bioawk.diff" + "installed_by": ["modules"] }, "blat": { "branch": "master", @@ -49,7 +48,7 @@ "fastp": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["fastq_fastqc_umitools_fastp", "modules"] + "installed_by": ["fastq_fastqc_umitools_fastp"] }, "fastqc": { "branch": "master", @@ -104,27 +103,27 @@ "samtools/flagstat": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["bam_stats_samtools", "modules"] + "installed_by": ["bam_stats_samtools"] }, "samtools/idxstats": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["bam_stats_samtools", "modules"] + "installed_by": ["bam_stats_samtools"] }, "samtools/index": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["bam_sort_stats_samtools", "modules"] + "installed_by": ["bam_sort_stats_samtools"] }, "samtools/sort": { "branch": "master", "git_sha": "b7800db9b069ed505db3f9d91b8c72faea9be17b", - "installed_by": ["bam_sort_stats_samtools", "modules"] + "installed_by": ["bam_sort_stats_samtools"] }, "samtools/stats": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["bam_stats_samtools", "modules"] + "installed_by": ["bam_stats_samtools"] }, "seqcluster/collapse": { "branch": "master", @@ -139,8 +138,7 @@ "seqkit/grep": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"], - "patch": "modules/nf-core/seqkit/grep/seqkit-grep.diff" + "installed_by": ["modules"] }, "seqkit/replace": { "branch": "master", @@ -155,7 +153,7 @@ "umitools/extract": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["fastq_fastqc_umitools_fastp", "modules"] + "installed_by": ["fastq_fastqc_umitools_fastp"] }, "untar": { "branch": "master", @@ -202,11 +200,9 @@ "installed_by": ["subworkflows"] }, "utils_nfschema_plugin": { - "utils_nfschema_plugin": { - "branch": "master", - "git_sha": "bbd5a41f4535a8defafe6080e00ea74c45f4f96c", - "installed_by": ["subworkflows"] - } + "branch": "master", + "git_sha": "bbd5a41f4535a8defafe6080e00ea74c45f4f96c", + "installed_by": ["subworkflows"] } } } From 4805060ef685aa965355de4997e145157b156a6f Mon Sep 17 00:00:00 2001 From: atrigila <18577080+atrigila@users.noreply.github.com> Date: Sun, 13 Oct 2024 20:30:59 +0000 Subject: [PATCH 24/27] remove duplicates from new template --- nextflow.config | 43 ------------------------------------------- 1 file changed, 43 deletions(-) diff --git a/nextflow.config b/nextflow.config index d03d2919..c45ce2f9 100644 --- a/nextflow.config +++ b/nextflow.config @@ -106,7 +106,6 @@ params { // Schema validation default options validate_params = true - validate_params = true } // Load base.config by default for all pipelines @@ -126,7 +125,6 @@ profiles { shifter.enabled = false charliecloud.enabled = false conda.channels = ['conda-forge', 'bioconda'] - conda.channels = ['conda-forge', 'bioconda'] apptainer.enabled = false } mamba { @@ -248,11 +246,6 @@ docker.registry = 'quay.io' podman.registry = 'quay.io' singularity.registry = 'quay.io' charliecloud.registry = 'quay.io' -apptainer.registry = 'quay.io' -docker.registry = 'quay.io' -podman.registry = 'quay.io' -singularity.registry = 'quay.io' -charliecloud.registry = 'quay.io' // Load igenomes.config if required includeConfig !params.igenomes_ignore ? 'conf/igenomes.config' : 'conf/igenomes_ignored.config' @@ -354,41 +347,5 @@ validation { } } -// Nextflow plugins -plugins { - id 'nf-schema@2.1.1' // Validation of pipeline parameters and creation of an input channel from a sample sheet -} - -validation { - defaultIgnoreParams = ["genomes"] - help { - enabled = true - command = "nextflow run $manifest.name -profile --input samplesheet.csv --outdir " - fullParameter = "help_full" - showHiddenParameter = "show_hidden" - beforeText = """ --\033[2m----------------------------------------------------\033[0m- - \033[0;32m,--.\033[0;30m/\033[0;32m,-.\033[0m -\033[0;34m ___ __ __ __ ___ \033[0;32m/,-._.--~\'\033[0m -\033[0;34m |\\ | |__ __ / ` / \\ |__) |__ \033[0;33m} {\033[0m -\033[0;34m | \\| | \\__, \\__/ | \\ |___ \033[0;32m\\`-._,-`-,\033[0m - \033[0;32m`._,._,\'\033[0m -\033[0;35m ${manifest.name} ${manifest.version}\033[0m --\033[2m----------------------------------------------------\033[0m- -""" - afterText = """${manifest.doi ? "* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} -* The nf-core framework - https://doi.org/10.1038/s41587-020-0439-x - -* Software dependencies - https://github.com/${manifest.name}/blob/master/CITATIONS.md -""" - } - summary { - beforeText = validation.help.beforeText - afterText = validation.help.afterText - } -} - // Load modules.config for DSL2 module specific options includeConfig 'conf/modules.config' From acd4b0ddbc58e2989d8ed3b3996abbe725c26f2f Mon Sep 17 00:00:00 2001 From: atrigila <18577080+atrigila@users.noreply.github.com> Date: Sun, 13 Oct 2024 20:44:47 +0000 Subject: [PATCH 25/27] remove extra argument, add missing { --- subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf index c40bcc55..bda2a7cf 100644 --- a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf @@ -61,7 +61,6 @@ workflow PIPELINE_INITIALISATION { workflow, validate_params, null - null ) @@ -95,6 +94,7 @@ workflow PIPELINE_INITIALISATION { .groupTuple() .map { samplesheet -> validateInputSamplesheet(samplesheet) + } .map { meta, fastqs -> return [ meta, fastqs.flatten() ] @@ -106,7 +106,7 @@ workflow PIPELINE_INITIALISATION { three_prime_adapter = ch_three_prime_adapter // channel: [ val(string) ] phred_offset = ch_phred_offset // channel: [ val(string) ] } -} + /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ From 8380496a7aac42f96269f2249f2eb68ce1ec3fa3 Mon Sep 17 00:00:00 2001 From: atrigila <18577080+atrigila@users.noreply.github.com> Date: Sun, 13 Oct 2024 20:57:08 +0000 Subject: [PATCH 26/27] correct schema structure --- nextflow_schema.json | 978 +++++++++++++++++++++---------------------- 1 file changed, 488 insertions(+), 490 deletions(-) diff --git a/nextflow_schema.json b/nextflow_schema.json index 8c78a7bf..dc5a3c3f 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -5,507 +5,505 @@ "description": "Small RNA-Seq Best Practice Analysis Pipeline.", "type": "object", "$defs": { - "$defs": { - "input_output_options": { - "title": "Input/output options", - "type": "object", - "fa_icon": "fas fa-terminal", - "description": "Define where the pipeline should find input data and save output data.", - "required": ["input", "outdir"], - "properties": { - "input": { - "type": "string", - "format": "file-path", - "exists": true, - "schema": "assets/schema_input.json", - "mimetype": "text/csv", - "pattern": "^\\S+\\.csv$", - "description": "Path to comma-separated file containing information about the samples in the experiment.", - "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See [usage docs](https://nf-co.re/smrnaseq/usage#samplesheet-input).", - "fa_icon": "fas fa-file-csv" - }, - "outdir": { - "type": "string", - "format": "directory-path", - "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.", - "fa_icon": "fas fa-folder-open" - }, - "email": { - "type": "string", - "description": "Email address for completion summary.", - "fa_icon": "fas fa-envelope", - "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.", - "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$" - }, - "multiqc_title": { - "type": "string", - "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.", - "fa_icon": "fas fa-file-signature" - }, - "save_intermediates": { - "type": "boolean", - "description": "Save all intermediate files (e.g. fastq, bams) of all steps of the pipeline to output directory", - "fa_icon": "fas fa-save" - } - } - }, - "umi_options": { - "title": "UMI options", - "type": "object", - "description": "Options for processing reads with unique molecular identifiers", - "default": "", - "properties": { - "with_umi": { - "type": "boolean", - "fa_icon": "fas fa-barcode", - "description": "Enable UMI-based read deduplication." - }, - "umitools_extract_method": { - "type": "string", - "default": "string", - "fa_icon": "fas fa-barcode", - "description": "UMI pattern to use. Can be either 'string' (default) or 'regex'.", - "help_text": "More details can be found in the [UMI-tools documentation](https://umi-tools.readthedocs.io/en/latest/reference/extract.html#extract-method).\n" - }, - "umitools_method": { - "type": "string", - "default": "dir", - "description": "UMI grouping method", - "fa_icon": "fas fa-layer-group", - "help_text": "Available options are dir, cc, adj" - }, - "skip_umi_extract_before_dedup": { - "type": "boolean", - "fa_icon": "fas fa-compress-alt", - "description": "Skip the UMI extraction from the reads before deduplication. Please note, if this parameter is set to false, the reads will be deduplicated solely on insert sequence. UMIs might be extracted after deduplication depending on the set umitools_bc_pattern nevertheless if with_umi is set to True.", - "default": true - }, - "umitools_bc_pattern": { - "type": "string", - "fa_icon": "fas fa-barcode", - "help_text": "More details can be found in the [UMI-tools documentation](https://umi-tools.readthedocs.io/en/latest/reference/extract.html#extract-method).", - "description": "The UMI barcode pattern to use e.g. 'NNNNNN' indicates that the first 6 nucleotides of the read are from the UMI." - }, - "umi_discard_read": { - "type": "integer", - "fa_icon": "fas fa-barcode", - "description": "After UMI barcode extraction discard either R1 or R2 by setting this parameter to 1 or 2, respectively." - }, - "save_umi_intermeds": { - "type": "boolean", - "fa_icon": "fas fa-save", - "description": "If this option is specified, intermediate FastQ and BAM files produced by UMI-tools are also saved in the results directory." - } - }, - "fa_icon": "fas fa-barcode" - }, - "reference_genome_options": { - "title": "Reference genome options", - "type": "object", - "fa_icon": "fas fa-dna", - "description": "Reference genome related files and options required for the workflow.", - "properties": { - "genome": { - "type": "string", - "description": "Name of iGenomes reference.", - "fa_icon": "fas fa-book", - "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details." - }, - "mirgenedb": { - "type": "boolean", - "description": "Boolean whether MirGeneDB should be used instead of miRBase", - "help_text": "This allows you to use MirGeneDB instead of miRBase as the database. \n Note that you will need to set the additional flags `--mirgenedb_species`, `--mirgenedb_gff`, `--mirgenedb_mature` and `--mirgenedb_hairpin`" - }, - "mirtrace_species": { - "type": "string", - "description": "Species for miRTrace.", - "help_text": "This is automatically set when using `--genome`. Example values: `hsa`, `mmu`...\n Note that mirTrace relies on miRBase for its species reference. See available references [here](https://www.mirbase.org/help/genome_summary.shtml).", - "fa_icon": "fas fa-journal-whills" - }, - "mirgenedb_species": { - "type": "string", - "description": "Species of MirGeneDB.", - "help_text": "This replaces the value of `--mirtrace_species` if `--mirgenedb` is used. \n Note the difference in case for species names used in MirGeneDB and miRBase. See https://www.mirgenedb.org/browse for more information." - }, - "fasta": { - "type": "string", - "format": "file-path", - "exists": true, - "mimetype": "text/plain", - "pattern": "^\\S+\\.fn?a(sta)?(\\.gz)?$", - "description": "Path to FASTA genome file.", - "help_text": "This parameter is *mandatory* if `--genome` is not specified. If you don't have a BWA index available this will be generated for you automatically. Combine with `--save_reference` to save BWA index for future runs.", - "fa_icon": "far fa-file-code" - }, - "mirna_gtf": { - "type": "string", - "description": "GFF/GTF file with coordinates positions of precursor and miRNAs.", - "help_text": "miRBase `.gff3` file, typically downloaded from [`https://mirbase.org/download/CURRENT/genomes/`](https://mirbase.org/download/CURRENT/genomes/)\n\nIf using iGenomes with `--genome` this file will be downloaded from miRBase automatically during the pipeline run.\n\n", - "fa_icon": "fas fa-address-book" - }, - "mirgenedb_gff": { - "type": "string", - "description": "GFF/GTF file with coordinates positions of precursor and miRNAs.", - "help_text": "MirGeneDB `.gff3` file, typically downloaded from [`https://mirgenedb.org/download`]. This replaces the value of --mirna_gff if --mirgenedb is used." - }, - "mature": { - "type": "string", - "description": "Path to FASTA file with mature miRNAs.", - "fa_icon": "fas fa-wheelchair", - "help_text": "Typically this will be the `mature.fa` file from miRBase. Can be given either as a plain text `.fa` file or a compressed `.gz` file.\n\nDefaults to the current miRBase release URL, from which the file will be downloaded.", - "default": "https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/mature.fa" - }, - "mirgenedb_mature": { - "type": "string", - "description": "Path to FASTA file with MirGeneDB mature miRNAs.", - "help_text": "This file needs to be downloaded from [`https://mirgenedb.org/download`]. Can be given either as a plain text `.fa` file or a compressed `.gz` file." - }, - "hairpin": { - "type": "string", - "description": "Path to FASTA file with miRNAs precursors.", - "fa_icon": "fab fa-cuttlefish", - "help_text": "Typically this will be the `mature.fa` file from miRBase. Can be given either as a plain text `.fa` file or a compressed `.gz` file.\n\nDefaults to the current miRBase release URL, from which the file will be downloaded.", - "default": "https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/hairpin.fa" - }, - "mirgenedb_hairpin": { - "type": "string", - "description": "Path to FASTA file with miRNAs precursors.", - "help_text": "This file needs to be downloaded from [`https://mirgenedb.org/download`]. Can be given either as a plain text `.fa` file or a compressed `.gz` file.\nNote that MirGeneDB does not have a dedicated hairpin file. The equivalent is the `Precursor sequences`." - }, - "bowtie_index": { - "type": "string", - "description": "Path to a Bowtie 1 index directory", - "fa_icon": "fas fa-book", - "help_text": "Point to the directory created by Bowtie 1 when indexing. Bowtie 1 indices consist of six files:\n\n```bash\ngenome.1.ebwt, genome.2.ebwt, genome.3.ebwt, genome.4.ebwt, genome.rev.1.ebwt, genome.rev.2.ebwt\n```\n" - }, - "save_reference": { - "type": "boolean", - "description": "Save generated reference genome files to results.", - "help_text": "Saving generated references means that you can use them for future pipeline runs, reducing processing times.", - "fa_icon": "fas fa-save" - }, - "igenomes_ignore": { - "type": "boolean", - "description": "Do not load the iGenomes reference config.", - "fa_icon": "fas fa-ban", - "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`.", - "hidden": true - } + "input_output_options": { + "title": "Input/output options", + "type": "object", + "fa_icon": "fas fa-terminal", + "description": "Define where the pipeline should find input data and save output data.", + "required": ["input", "outdir"], + "properties": { + "input": { + "type": "string", + "format": "file-path", + "exists": true, + "schema": "assets/schema_input.json", + "mimetype": "text/csv", + "pattern": "^\\S+\\.csv$", + "description": "Path to comma-separated file containing information about the samples in the experiment.", + "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See [usage docs](https://nf-co.re/smrnaseq/usage#samplesheet-input).", + "fa_icon": "fas fa-file-csv" + }, + "outdir": { + "type": "string", + "format": "directory-path", + "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.", + "fa_icon": "fas fa-folder-open" + }, + "email": { + "type": "string", + "description": "Email address for completion summary.", + "fa_icon": "fas fa-envelope", + "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.", + "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$" + }, + "multiqc_title": { + "type": "string", + "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.", + "fa_icon": "fas fa-file-signature" + }, + "save_intermediates": { + "type": "boolean", + "description": "Save all intermediate files (e.g. fastq, bams) of all steps of the pipeline to output directory", + "fa_icon": "fas fa-save" } - }, - "trimming_options": { - "title": "Trimming options", - "type": "object", - "description": "Options for trimming reads and primers.", - "fa_icon": "fas fa-cut", - "properties": { - "clip_r1": { - "type": "integer", - "fa_icon": "fas fa-cut", - "description": "The number of basepairs to remove from the 5' end of read 1." - }, - "three_prime_clip_r1": { - "type": "integer", - "fa_icon": "fas fa-cut", - "description": "The number of basepairs to remove from the 3' end of read 1 AFTER adapter/quality trimming has been performed." - }, - "three_prime_adapter": { - "type": "string", - "fa_icon": "fas fa-text-width", - "description": "Sequencing adapter sequence to use for trimming.", - "default": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA" - }, - "trim_fastq": { - "type": "boolean", - "default": true, - "fa_icon": "fas fa-hand-scissors", - "description": "Trim FastQ files" - }, - "fastp_min_length": { - "type": "integer", - "default": 17, - "description": "Minimum filter length for raw reads.", - "fa_icon": "fas fa-ruler-horizontal" - }, - "fastp_max_length": { - "type": "integer", - "default": 100, - "description": "Maximum filter length for raw reads.", - "fa_icon": "fas fa-ruler-horizontal" - }, - "save_trimmed_fail": { - "type": "boolean", - "fa_icon": "fas fa-cloud-download-alt", - "description": "Save reads failing trimming" - }, - "fastp_known_mirna_adapters": { - "type": "string", - "format": "file-path", - "exists": true, - "mimetype": "text/plain", - "default": "${projectDir}/assets/known_adapters.fa", - "description": "Fasta with known miRNA adapter sequences for adapter trimming", - "fa_icon": "far fa-question-circle" - }, - "min_trimmed_reads": { - "type": "integer", - "default": 10, - "fa_icon": "far fa-window-minimize", - "description": "Minimum number of reads required in input file to use it" - }, - "save_merged": { - "type": "boolean", - "description": "Save merged reads.", - "default": false - }, - "phred_offset": { - "type": "integer", - "default": 33, - "description": "The PHRED quality offset to be used for any input fastq files. Default is 33, standard Illumina 1.8+ format." - } + } + }, + "umi_options": { + "title": "UMI options", + "type": "object", + "description": "Options for processing reads with unique molecular identifiers", + "default": "", + "properties": { + "with_umi": { + "type": "boolean", + "fa_icon": "fas fa-barcode", + "description": "Enable UMI-based read deduplication." + }, + "umitools_extract_method": { + "type": "string", + "default": "string", + "fa_icon": "fas fa-barcode", + "description": "UMI pattern to use. Can be either 'string' (default) or 'regex'.", + "help_text": "More details can be found in the [UMI-tools documentation](https://umi-tools.readthedocs.io/en/latest/reference/extract.html#extract-method).\n" + }, + "umitools_method": { + "type": "string", + "default": "dir", + "description": "UMI grouping method", + "fa_icon": "fas fa-layer-group", + "help_text": "Available options are dir, cc, adj" + }, + "skip_umi_extract_before_dedup": { + "type": "boolean", + "fa_icon": "fas fa-compress-alt", + "description": "Skip the UMI extraction from the reads before deduplication. Please note, if this parameter is set to false, the reads will be deduplicated solely on insert sequence. UMIs might be extracted after deduplication depending on the set umitools_bc_pattern nevertheless if with_umi is set to True.", + "default": true + }, + "umitools_bc_pattern": { + "type": "string", + "fa_icon": "fas fa-barcode", + "help_text": "More details can be found in the [UMI-tools documentation](https://umi-tools.readthedocs.io/en/latest/reference/extract.html#extract-method).", + "description": "The UMI barcode pattern to use e.g. 'NNNNNN' indicates that the first 6 nucleotides of the read are from the UMI." + }, + "umi_discard_read": { + "type": "integer", + "fa_icon": "fas fa-barcode", + "description": "After UMI barcode extraction discard either R1 or R2 by setting this parameter to 1 or 2, respectively." + }, + "save_umi_intermeds": { + "type": "boolean", + "fa_icon": "fas fa-save", + "description": "If this option is specified, intermediate FastQ and BAM files produced by UMI-tools are also saved in the results directory." } }, - "contamination_filtering": { - "title": "Contamination filter options", - "type": "object", - "description": "Options to remove contamination from the reads.", - "fa_icon": "fas fa-cut", - "properties": { - "filter_contamination": { - "type": "boolean", - "description": "Enables the contamination filtering." - }, - "rrna": { - "type": "string", - "format": "file-path", - "description": "Path to the rRNA fasta file to be used as contamination database." - }, - "trna": { - "type": "string", - "format": "file-path", - "description": "Path to the tRNA fasta file to be used as contamination database." - }, - "cdna": { - "type": "string", - "format": "file-path", - "description": "Path to the cDNA fasta file to be used as contamination database." - }, - "ncrna": { - "type": "string", - "format": "file-path", - "description": "Path to the ncRNA fasta file to be used as contamination database." - }, - "pirna": { - "type": "string", - "format": "file-path", - "description": "Path to the piRNA fasta file to be used as contamination database." - }, - "other_contamination": { - "type": "string", - "format": "file-path", - "description": "Path to an additional fasta file to be used as contamination database." - } + "fa_icon": "fas fa-barcode" + }, + "reference_genome_options": { + "title": "Reference genome options", + "type": "object", + "fa_icon": "fas fa-dna", + "description": "Reference genome related files and options required for the workflow.", + "properties": { + "genome": { + "type": "string", + "description": "Name of iGenomes reference.", + "fa_icon": "fas fa-book", + "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details." + }, + "mirgenedb": { + "type": "boolean", + "description": "Boolean whether MirGeneDB should be used instead of miRBase", + "help_text": "This allows you to use MirGeneDB instead of miRBase as the database. \n Note that you will need to set the additional flags `--mirgenedb_species`, `--mirgenedb_gff`, `--mirgenedb_mature` and `--mirgenedb_hairpin`" + }, + "mirtrace_species": { + "type": "string", + "description": "Species for miRTrace.", + "help_text": "This is automatically set when using `--genome`. Example values: `hsa`, `mmu`...\n Note that mirTrace relies on miRBase for its species reference. See available references [here](https://www.mirbase.org/help/genome_summary.shtml).", + "fa_icon": "fas fa-journal-whills" + }, + "mirgenedb_species": { + "type": "string", + "description": "Species of MirGeneDB.", + "help_text": "This replaces the value of `--mirtrace_species` if `--mirgenedb` is used. \n Note the difference in case for species names used in MirGeneDB and miRBase. See https://www.mirgenedb.org/browse for more information." + }, + "fasta": { + "type": "string", + "format": "file-path", + "exists": true, + "mimetype": "text/plain", + "pattern": "^\\S+\\.fn?a(sta)?(\\.gz)?$", + "description": "Path to FASTA genome file.", + "help_text": "This parameter is *mandatory* if `--genome` is not specified. If you don't have a BWA index available this will be generated for you automatically. Combine with `--save_reference` to save BWA index for future runs.", + "fa_icon": "far fa-file-code" + }, + "mirna_gtf": { + "type": "string", + "description": "GFF/GTF file with coordinates positions of precursor and miRNAs.", + "help_text": "miRBase `.gff3` file, typically downloaded from [`https://mirbase.org/download/CURRENT/genomes/`](https://mirbase.org/download/CURRENT/genomes/)\n\nIf using iGenomes with `--genome` this file will be downloaded from miRBase automatically during the pipeline run.\n\n", + "fa_icon": "fas fa-address-book" + }, + "mirgenedb_gff": { + "type": "string", + "description": "GFF/GTF file with coordinates positions of precursor and miRNAs.", + "help_text": "MirGeneDB `.gff3` file, typically downloaded from [`https://mirgenedb.org/download`]. This replaces the value of --mirna_gff if --mirgenedb is used." + }, + "mature": { + "type": "string", + "description": "Path to FASTA file with mature miRNAs.", + "fa_icon": "fas fa-wheelchair", + "help_text": "Typically this will be the `mature.fa` file from miRBase. Can be given either as a plain text `.fa` file or a compressed `.gz` file.\n\nDefaults to the current miRBase release URL, from which the file will be downloaded.", + "default": "https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/mature.fa" + }, + "mirgenedb_mature": { + "type": "string", + "description": "Path to FASTA file with MirGeneDB mature miRNAs.", + "help_text": "This file needs to be downloaded from [`https://mirgenedb.org/download`]. Can be given either as a plain text `.fa` file or a compressed `.gz` file." + }, + "hairpin": { + "type": "string", + "description": "Path to FASTA file with miRNAs precursors.", + "fa_icon": "fab fa-cuttlefish", + "help_text": "Typically this will be the `mature.fa` file from miRBase. Can be given either as a plain text `.fa` file or a compressed `.gz` file.\n\nDefaults to the current miRBase release URL, from which the file will be downloaded.", + "default": "https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/hairpin.fa" + }, + "mirgenedb_hairpin": { + "type": "string", + "description": "Path to FASTA file with miRNAs precursors.", + "help_text": "This file needs to be downloaded from [`https://mirgenedb.org/download`]. Can be given either as a plain text `.fa` file or a compressed `.gz` file.\nNote that MirGeneDB does not have a dedicated hairpin file. The equivalent is the `Precursor sequences`." + }, + "bowtie_index": { + "type": "string", + "description": "Path to a Bowtie 1 index directory", + "fa_icon": "fas fa-book", + "help_text": "Point to the directory created by Bowtie 1 when indexing. Bowtie 1 indices consist of six files:\n\n```bash\ngenome.1.ebwt, genome.2.ebwt, genome.3.ebwt, genome.4.ebwt, genome.rev.1.ebwt, genome.rev.2.ebwt\n```\n" + }, + "save_reference": { + "type": "boolean", + "description": "Save generated reference genome files to results.", + "help_text": "Saving generated references means that you can use them for future pipeline runs, reducing processing times.", + "fa_icon": "fas fa-save" + }, + "igenomes_ignore": { + "type": "boolean", + "description": "Do not load the iGenomes reference config.", + "fa_icon": "fas fa-ban", + "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`.", + "hidden": true } - }, - "skipping_pipeline_steps": { - "title": "Skipping pipeline steps", - "type": "object", - "description": "Switches to skip specific pipeline steps, if desired.", - "fa_icon": "fas fa-fast-forward", - "properties": { - "skip_fastqc": { - "type": "boolean", - "fa_icon": "fas fa-fast-forward", - "description": "Skip FastQC" - }, - "skip_mirdeep": { - "type": "boolean", - "fa_icon": "fas fa-fast-forward", - "description": "Skip miRDeep" - }, - "skip_multiqc": { - "type": "boolean", - "fa_icon": "fas fa-fast-forward", - "description": "Skip MultiQC" - }, - "skip_fastp": { - "type": "boolean", - "description": "Skip FastP", - "fa_icon": "fas fa-forward" - } + } + }, + "trimming_options": { + "title": "Trimming options", + "type": "object", + "description": "Options for trimming reads and primers.", + "fa_icon": "fas fa-cut", + "properties": { + "clip_r1": { + "type": "integer", + "fa_icon": "fas fa-cut", + "description": "The number of basepairs to remove from the 5' end of read 1." + }, + "three_prime_clip_r1": { + "type": "integer", + "fa_icon": "fas fa-cut", + "description": "The number of basepairs to remove from the 3' end of read 1 AFTER adapter/quality trimming has been performed." + }, + "three_prime_adapter": { + "type": "string", + "fa_icon": "fas fa-text-width", + "description": "Sequencing adapter sequence to use for trimming.", + "default": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA" + }, + "trim_fastq": { + "type": "boolean", + "default": true, + "fa_icon": "fas fa-hand-scissors", + "description": "Trim FastQ files" + }, + "fastp_min_length": { + "type": "integer", + "default": 17, + "description": "Minimum filter length for raw reads.", + "fa_icon": "fas fa-ruler-horizontal" + }, + "fastp_max_length": { + "type": "integer", + "default": 100, + "description": "Maximum filter length for raw reads.", + "fa_icon": "fas fa-ruler-horizontal" + }, + "save_trimmed_fail": { + "type": "boolean", + "fa_icon": "fas fa-cloud-download-alt", + "description": "Save reads failing trimming" + }, + "fastp_known_mirna_adapters": { + "type": "string", + "format": "file-path", + "exists": true, + "mimetype": "text/plain", + "default": "${projectDir}/assets/known_adapters.fa", + "description": "Fasta with known miRNA adapter sequences for adapter trimming", + "fa_icon": "far fa-question-circle" + }, + "min_trimmed_reads": { + "type": "integer", + "default": 10, + "fa_icon": "far fa-window-minimize", + "description": "Minimum number of reads required in input file to use it" + }, + "save_merged": { + "type": "boolean", + "description": "Save merged reads.", + "default": false + }, + "phred_offset": { + "type": "integer", + "default": 33, + "description": "The PHRED quality offset to be used for any input fastq files. Default is 33, standard Illumina 1.8+ format." } - }, - "institutional_config_options": { - "title": "Institutional config options", - "type": "object", - "fa_icon": "fas fa-university", - "description": "Parameters used to describe centralised config profiles. These should not be edited.", - "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.", - "properties": { - "custom_config_version": { - "type": "string", - "description": "Git commit id for Institutional configs.", - "default": "master", - "hidden": true, - "fa_icon": "fas fa-users-cog" - }, - "custom_config_base": { - "type": "string", - "description": "Base directory for Institutional configs.", - "default": "https://raw.githubusercontent.com/nf-core/configs/master", - "hidden": true, - "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.", - "fa_icon": "fas fa-users-cog" - }, - "config_profile_name": { - "type": "string", - "description": "Institutional config name.", - "hidden": true, - "fa_icon": "fas fa-users-cog" - }, - "config_profile_description": { - "type": "string", - "description": "Institutional config description.", - "hidden": true, - "fa_icon": "fas fa-users-cog" - }, - "config_profile_contact": { - "type": "string", - "description": "Institutional config contact information.", - "hidden": true, - "fa_icon": "fas fa-users-cog" - }, - "config_profile_url": { - "type": "string", - "description": "Institutional config URL link.", - "hidden": true, - "fa_icon": "fas fa-users-cog" - } + } + }, + "contamination_filtering": { + "title": "Contamination filter options", + "type": "object", + "description": "Options to remove contamination from the reads.", + "fa_icon": "fas fa-cut", + "properties": { + "filter_contamination": { + "type": "boolean", + "description": "Enables the contamination filtering." + }, + "rrna": { + "type": "string", + "format": "file-path", + "description": "Path to the rRNA fasta file to be used as contamination database." + }, + "trna": { + "type": "string", + "format": "file-path", + "description": "Path to the tRNA fasta file to be used as contamination database." + }, + "cdna": { + "type": "string", + "format": "file-path", + "description": "Path to the cDNA fasta file to be used as contamination database." + }, + "ncrna": { + "type": "string", + "format": "file-path", + "description": "Path to the ncRNA fasta file to be used as contamination database." + }, + "pirna": { + "type": "string", + "format": "file-path", + "description": "Path to the piRNA fasta file to be used as contamination database." + }, + "other_contamination": { + "type": "string", + "format": "file-path", + "description": "Path to an additional fasta file to be used as contamination database." } - }, - "generic_options": { - "title": "Generic options", - "type": "object", - "fa_icon": "fas fa-file-import", - "description": "Less common options for the pipeline, typically set in a config file.", - "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", - "properties": { - "version": { - "type": "boolean", - "description": "Display version and exit.", - "fa_icon": "fas fa-question-circle", - "hidden": true - }, - "publish_dir_mode": { - "type": "string", - "default": "copy", - "description": "Method used to save pipeline results to output directory.", - "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.", - "fa_icon": "fas fa-copy", - "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"], - "hidden": true - }, - "email_on_fail": { - "type": "string", - "description": "Email address for completion summary, only when pipeline fails.", - "fa_icon": "fas fa-exclamation-triangle", - "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$", - "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.", - "hidden": true - }, - "plaintext_email": { - "type": "boolean", - "description": "Send plain-text email instead of HTML.", - "fa_icon": "fas fa-remove-format", - "hidden": true - }, - "max_multiqc_email_size": { - "type": "string", - "description": "File size limit when attaching MultiQC reports to summary emails.", - "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$", - "default": "25.MB", - "fa_icon": "fas fa-file-upload", - "hidden": true - }, - "monochrome_logs": { - "type": "boolean", - "description": "Do not use coloured log outputs.", - "fa_icon": "fas fa-palette", - "hidden": true - }, - "hook_url": { - "type": "string", - "description": "Incoming hook URL for messaging service", - "fa_icon": "fas fa-people-group", - "help_text": "Incoming hook URL for messaging service. Currently, MS Teams and Slack are supported.", - "hidden": true - }, - "multiqc_config": { - "type": "string", - "format": "file-path", - "description": "Custom config file to supply to MultiQC.", - "fa_icon": "fas fa-cog", - "hidden": true - }, - "multiqc_logo": { - "type": "string", - "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file", - "fa_icon": "fas fa-image", - "hidden": true - }, - "multiqc_methods_description": { - "type": "string", - "description": "Custom MultiQC yaml file containing HTML including a methods description.", - "fa_icon": "fas fa-cog" - }, - "validate_params": { - "type": "boolean", - "description": "Boolean whether to validate parameters against the schema at runtime", - "default": true, - "fa_icon": "fas fa-check-square", - "hidden": true - }, - "pipelines_testdata_base_path": { - "type": "string", - "fa_icon": "far fa-check-circle", - "description": "Base URL or local path to location of pipeline test dataset files", - "default": "https://raw.githubusercontent.com/nf-core/test-datasets/", - "hidden": true - } + } + }, + "skipping_pipeline_steps": { + "title": "Skipping pipeline steps", + "type": "object", + "description": "Switches to skip specific pipeline steps, if desired.", + "fa_icon": "fas fa-fast-forward", + "properties": { + "skip_fastqc": { + "type": "boolean", + "fa_icon": "fas fa-fast-forward", + "description": "Skip FastQC" + }, + "skip_mirdeep": { + "type": "boolean", + "fa_icon": "fas fa-fast-forward", + "description": "Skip miRDeep" + }, + "skip_multiqc": { + "type": "boolean", + "fa_icon": "fas fa-fast-forward", + "description": "Skip MultiQC" + }, + "skip_fastp": { + "type": "boolean", + "description": "Skip FastP", + "fa_icon": "fas fa-forward" } } }, - "allOf": [ - { - "$ref": "#/$defs/input_output_options" - }, - { - "$ref": "#/$defs/umi_options" - }, - { - "$ref": "#/$defs/reference_genome_options" - }, - { - "$ref": "#/$defs/trimming_options" - }, - { - "$ref": "#/$defs/contamination_filtering" - }, - { - "$ref": "#/$defs/skipping_pipeline_steps" - }, - { - "$ref": "#/$defs/institutional_config_options" - }, - { - "$ref": "#/$defs/generic_options" + "institutional_config_options": { + "title": "Institutional config options", + "type": "object", + "fa_icon": "fas fa-university", + "description": "Parameters used to describe centralised config profiles. These should not be edited.", + "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.", + "properties": { + "custom_config_version": { + "type": "string", + "description": "Git commit id for Institutional configs.", + "default": "master", + "hidden": true, + "fa_icon": "fas fa-users-cog" + }, + "custom_config_base": { + "type": "string", + "description": "Base directory for Institutional configs.", + "default": "https://raw.githubusercontent.com/nf-core/configs/master", + "hidden": true, + "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.", + "fa_icon": "fas fa-users-cog" + }, + "config_profile_name": { + "type": "string", + "description": "Institutional config name.", + "hidden": true, + "fa_icon": "fas fa-users-cog" + }, + "config_profile_description": { + "type": "string", + "description": "Institutional config description.", + "hidden": true, + "fa_icon": "fas fa-users-cog" + }, + "config_profile_contact": { + "type": "string", + "description": "Institutional config contact information.", + "hidden": true, + "fa_icon": "fas fa-users-cog" + }, + "config_profile_url": { + "type": "string", + "description": "Institutional config URL link.", + "hidden": true, + "fa_icon": "fas fa-users-cog" + } } - ], - "properties": { - "igenomes_base": { - "type": "string", - "default": "s3://ngi-igenomes/igenomes/" + }, + "generic_options": { + "title": "Generic options", + "type": "object", + "fa_icon": "fas fa-file-import", + "description": "Less common options for the pipeline, typically set in a config file.", + "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", + "properties": { + "version": { + "type": "boolean", + "description": "Display version and exit.", + "fa_icon": "fas fa-question-circle", + "hidden": true + }, + "publish_dir_mode": { + "type": "string", + "default": "copy", + "description": "Method used to save pipeline results to output directory.", + "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.", + "fa_icon": "fas fa-copy", + "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"], + "hidden": true + }, + "email_on_fail": { + "type": "string", + "description": "Email address for completion summary, only when pipeline fails.", + "fa_icon": "fas fa-exclamation-triangle", + "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$", + "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.", + "hidden": true + }, + "plaintext_email": { + "type": "boolean", + "description": "Send plain-text email instead of HTML.", + "fa_icon": "fas fa-remove-format", + "hidden": true + }, + "max_multiqc_email_size": { + "type": "string", + "description": "File size limit when attaching MultiQC reports to summary emails.", + "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$", + "default": "25.MB", + "fa_icon": "fas fa-file-upload", + "hidden": true + }, + "monochrome_logs": { + "type": "boolean", + "description": "Do not use coloured log outputs.", + "fa_icon": "fas fa-palette", + "hidden": true + }, + "hook_url": { + "type": "string", + "description": "Incoming hook URL for messaging service", + "fa_icon": "fas fa-people-group", + "help_text": "Incoming hook URL for messaging service. Currently, MS Teams and Slack are supported.", + "hidden": true + }, + "multiqc_config": { + "type": "string", + "format": "file-path", + "description": "Custom config file to supply to MultiQC.", + "fa_icon": "fas fa-cog", + "hidden": true + }, + "multiqc_logo": { + "type": "string", + "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file", + "fa_icon": "fas fa-image", + "hidden": true + }, + "multiqc_methods_description": { + "type": "string", + "description": "Custom MultiQC yaml file containing HTML including a methods description.", + "fa_icon": "fas fa-cog" + }, + "validate_params": { + "type": "boolean", + "description": "Boolean whether to validate parameters against the schema at runtime", + "default": true, + "fa_icon": "fas fa-check-square", + "hidden": true + }, + "pipelines_testdata_base_path": { + "type": "string", + "fa_icon": "far fa-check-circle", + "description": "Base URL or local path to location of pipeline test dataset files", + "default": "https://raw.githubusercontent.com/nf-core/test-datasets/", + "hidden": true + } } } + }, + "allOf": [ + { + "$ref": "#/$defs/input_output_options" + }, + { + "$ref": "#/$defs/umi_options" + }, + { + "$ref": "#/$defs/reference_genome_options" + }, + { + "$ref": "#/$defs/trimming_options" + }, + { + "$ref": "#/$defs/contamination_filtering" + }, + { + "$ref": "#/$defs/skipping_pipeline_steps" + }, + { + "$ref": "#/$defs/institutional_config_options" + }, + { + "$ref": "#/$defs/generic_options" + } + ], + "properties": { + "igenomes_base": { + "type": "string", + "default": "s3://ngi-igenomes/igenomes/" + } } } From 5254daef834f91f1ed7a8d8656b44dc715bedfe7 Mon Sep 17 00:00:00 2001 From: atrigila <18577080+atrigila@users.noreply.github.com> Date: Sun, 13 Oct 2024 20:58:03 +0000 Subject: [PATCH 27/27] fix linting errors --- .gitignore | 2 -- 1 file changed, 2 deletions(-) diff --git a/.gitignore b/.gitignore index a04cf068..a42ce016 100644 --- a/.gitignore +++ b/.gitignore @@ -6,6 +6,4 @@ results/ testing/ testing* *.pyc -.nf-test/ -.nf-test.log null/