diff --git a/.editorconfig b/.editorconfig index 9b990088..dd9ffa53 100644 --- a/.editorconfig +++ b/.editorconfig @@ -18,7 +18,12 @@ end_of_line = unset insert_final_newline = unset trim_trailing_whitespace = unset indent_style = unset -indent_size = unset +[/subworkflows/nf-core/**] +charset = unset +end_of_line = unset +insert_final_newline = unset +trim_trailing_whitespace = unset +indent_style = unset [/assets/email*] indent_size = unset @@ -28,5 +33,5 @@ indent_size = unset indent_style = unset # ignore python -[*.{py}] +[*.{py,md}] indent_style = unset diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index a1a371bc..3c8cf6d6 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -14,7 +14,10 @@ jobs: runs-on: ubuntu-latest steps: - name: Launch workflow via tower - uses: seqeralabs/action-tower-launch@v2 + uses: seqeralabs/action-tower-launch@922e5c8d5ac4e918107ec311d2ebbd65e5982b3d # v2 + # TODO nf-core: You can customise AWS full pipeline tests as required + # Add full size test data (but still relatively small datasets for few samples) + # on the `test_full.config` test runs with only one set of parameters with: workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} @@ -28,7 +31,7 @@ jobs: } profiles: test_full - - uses: actions/upload-artifact@v4 + - uses: actions/upload-artifact@5d5d22a31266ced268874388b861e4b58bb5c2f3 # v4 with: name: Tower debug log file path: | diff --git a/.github/workflows/awstest.yml b/.github/workflows/awstest.yml index 5386cbc0..3ed287c5 100644 --- a/.github/workflows/awstest.yml +++ b/.github/workflows/awstest.yml @@ -12,7 +12,7 @@ jobs: steps: # Launch workflow using Tower CLI tool action - name: Launch workflow via tower - uses: seqeralabs/action-tower-launch@v2 + uses: seqeralabs/action-tower-launch@922e5c8d5ac4e918107ec311d2ebbd65e5982b3d # v2 with: workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} @@ -25,7 +25,7 @@ jobs: } profiles: test - - uses: actions/upload-artifact@v4 + - uses: actions/upload-artifact@5d5d22a31266ced268874388b861e4b58bb5c2f3 # v4 with: name: Tower debug log file path: | diff --git a/.github/workflows/branch.yml b/.github/workflows/branch.yml index e6f6941e..5deaba55 100644 --- a/.github/workflows/branch.yml +++ b/.github/workflows/branch.yml @@ -19,7 +19,7 @@ jobs: # NOTE - this doesn't currently work if the PR is coming from a fork, due to limitations in GitHub actions secrets - name: Post PR comment if: failure() - uses: mshick/add-pr-comment@v2 + uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 with: message: | ## This PR is against the `master` branch :x: diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 55ae6171..64fcab5e 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -33,19 +33,16 @@ jobs: - "test_index" steps: - name: Check out pipeline code - uses: actions/checkout@v4 + uses: actions/checkout@b4ffde65f46336ab88eb53be808477a3936bae11 # v4 - name: Install Nextflow - uses: nf-core/setup-nextflow@v1 + uses: nf-core/setup-nextflow@b9f764e8ba5c76b712ace14ecbfcef0e40ae2dd8 # v1 with: version: "${{ matrix.NXF_VER }}" - - name: Free Disk Space (Ubuntu) - uses: jlumbroso/free-disk-space@v1.3.1 + - name: Disk space cleanup + uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 - name: Run pipeline with test data run: | nextflow run ${GITHUB_WORKSPACE} -profile ${{ matrix.profile }},docker --outdir ./results - - - name: Free Disk Space for Phil - Because Science! - uses: jlumbroso/free-disk-space@v1.3.1 diff --git a/.github/workflows/clean-up.yml b/.github/workflows/clean-up.yml index e37cfda5..0b6b1f27 100644 --- a/.github/workflows/clean-up.yml +++ b/.github/workflows/clean-up.yml @@ -10,7 +10,7 @@ jobs: issues: write pull-requests: write steps: - - uses: actions/stale@v9 + - uses: actions/stale@28ca1036281a5e5922ead5184a1bbf96e5fc984e # v9 with: stale-issue-message: "This issue has been tagged as awaiting-changes or awaiting-feedback by an nf-core contributor. Remove stale label or add a comment otherwise this issue will be closed in 20 days." stale-pr-message: "This PR has been tagged as awaiting-changes or awaiting-feedback by an nf-core contributor. Remove stale label or add a comment if it is still useful." diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml index 8a330045..f823210d 100644 --- a/.github/workflows/download_pipeline.yml +++ b/.github/workflows/download_pipeline.yml @@ -6,6 +6,11 @@ name: Test successful pipeline download with 'nf-core download' # - the head branch of the pull request is updated, i.e. if fixes for a release are pushed last minute to dev. on: workflow_dispatch: + inputs: + testbranch: + description: "The specific branch you wish to utilize for the test execution of nf-core download." + required: true + default: "dev" pull_request: types: - opened @@ -23,13 +28,13 @@ jobs: runs-on: ubuntu-latest steps: - name: Install Nextflow - uses: nf-core/setup-nextflow@v1 + uses: nf-core/setup-nextflow@b9f764e8ba5c76b712ace14ecbfcef0e40ae2dd8 # v1 - - uses: actions/setup-python@v5 + - uses: actions/setup-python@0a5c61591373683505ea898e09a3ea4f39ef2b9c # v5 with: python-version: "3.11" architecture: "x64" - - uses: eWaterCycle/setup-singularity@v7 + - uses: eWaterCycle/setup-singularity@931d4e31109e875b13309ae1d07c70ca8fbc8537 # v7 with: singularity-version: 3.8.3 @@ -42,13 +47,13 @@ jobs: run: | echo "REPO_LOWERCASE=${GITHUB_REPOSITORY,,}" >> ${GITHUB_ENV} echo "REPOTITLE_LOWERCASE=$(basename ${GITHUB_REPOSITORY,,})" >> ${GITHUB_ENV} - echo "REPO_BRANCH=${GITHUB_REF#refs/heads/}" >> ${GITHUB_ENV} + echo "REPO_BRANCH=${{ github.event.inputs.testbranch || 'dev' }}" >> ${GITHUB_ENV} - name: Download the pipeline env: NXF_SINGULARITY_CACHEDIR: ./ run: | - nf-core download ${{ env.REPO_LOWERCASE }} \ + nf-core download ${{ env.REPO_LOWERCASE }} \ --revision ${{ env.REPO_BRANCH }} \ --outdir ./${{ env.REPOTITLE_LOWERCASE }} \ --compress "none" \ diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index 81cd098e..748b4311 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -14,10 +14,10 @@ jobs: pre-commit: runs-on: ubuntu-latest steps: - - uses: actions/checkout@v4 + - uses: actions/checkout@b4ffde65f46336ab88eb53be808477a3936bae11 # v4 - name: Set up Python 3.11 - uses: actions/setup-python@v5 + uses: actions/setup-python@0a5c61591373683505ea898e09a3ea4f39ef2b9c # v5 with: python-version: 3.11 cache: "pip" @@ -32,12 +32,12 @@ jobs: runs-on: ubuntu-latest steps: - name: Check out pipeline code - uses: actions/checkout@v4 + uses: actions/checkout@b4ffde65f46336ab88eb53be808477a3936bae11 # v4 - name: Install Nextflow - uses: nf-core/setup-nextflow@v1 + uses: nf-core/setup-nextflow@b9f764e8ba5c76b712ace14ecbfcef0e40ae2dd8 # v1 - - uses: actions/setup-python@v5 + - uses: actions/setup-python@0a5c61591373683505ea898e09a3ea4f39ef2b9c # v5 with: python-version: "3.11" architecture: "x64" @@ -60,7 +60,7 @@ jobs: - name: Upload linting log file artifact if: ${{ always() }} - uses: actions/upload-artifact@v4 + uses: actions/upload-artifact@5d5d22a31266ced268874388b861e4b58bb5c2f3 # v4 with: name: linting-logs path: | diff --git a/.github/workflows/linting_comment.yml b/.github/workflows/linting_comment.yml index 147bcd10..b706875f 100644 --- a/.github/workflows/linting_comment.yml +++ b/.github/workflows/linting_comment.yml @@ -11,7 +11,7 @@ jobs: runs-on: ubuntu-latest steps: - name: Download lint results - uses: dawidd6/action-download-artifact@v3 + uses: dawidd6/action-download-artifact@f6b0bace624032e30a85a8fd9c1a7f8f611f5737 # v3 with: workflow: linting.yml workflow_conclusion: completed @@ -21,7 +21,7 @@ jobs: run: echo "pr_number=$(cat linting-logs/PR_number.txt)" >> $GITHUB_OUTPUT - name: Post PR comment - uses: marocchino/sticky-pull-request-comment@v2 + uses: marocchino/sticky-pull-request-comment@331f8f5b4215f0445d3c07b4967662a32a2d3e31 # v2 with: GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} number: ${{ steps.pr_number.outputs.pr_number }} diff --git a/.github/workflows/release-announcements.yml b/.github/workflows/release-announcements.yml index 21ac3f06..c3674af2 100644 --- a/.github/workflows/release-announcements.yml +++ b/.github/workflows/release-announcements.yml @@ -9,6 +9,11 @@ jobs: toot: runs-on: ubuntu-latest steps: + - name: get topics and convert to hashtags + id: get_topics + run: | + curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ' > $GITHUB_OUTPUT + - uses: rzr/fediverse-action@master with: access-token: ${{ secrets.MASTODON_ACCESS_TOKEN }} @@ -20,11 +25,13 @@ jobs: Please see the changelog: ${{ github.event.release.html_url }} + ${{ steps.get_topics.outputs.GITHUB_OUTPUT }} #nfcore #openscience #nextflow #bioinformatics + send-tweet: runs-on: ubuntu-latest steps: - - uses: actions/setup-python@v5 + - uses: actions/setup-python@0a5c61591373683505ea898e09a3ea4f39ef2b9c # v5 with: python-version: "3.10" - name: Install dependencies @@ -56,7 +63,7 @@ jobs: bsky-post: runs-on: ubuntu-latest steps: - - uses: zentered/bluesky-post-action@v0.1.0 + - uses: zentered/bluesky-post-action@80dbe0a7697de18c15ad22f4619919ceb5ccf597 # v0.1.0 with: post: | Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! diff --git a/.gitignore b/.gitignore index 5124c9ac..4109b5c9 100644 --- a/.gitignore +++ b/.gitignore @@ -6,3 +6,4 @@ results/ testing/ testing* *.pyc +execution_trace* diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index 2cc08ad8..cb6b62c8 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -13,6 +13,8 @@ report_section_order: export_plots: true +disable_version_detection: true + module_order: - fastqc: name: "FastQC (raw)" diff --git a/assets/schema_input.json b/assets/schema_input.json index 5041ee60..892b1996 100644 --- a/assets/schema_input.json +++ b/assets/schema_input.json @@ -10,25 +10,22 @@ "sample": { "type": "string", "pattern": "^\\S+$", - "errorMessage": "Sample name must be provided and cannot contain spaces" + "errorMessage": "Sample name must be provided and cannot contain spaces", + "meta": ["id"] }, "fastq_1": { "type": "string", + "format": "file-path", + "exists": true, "pattern": "^\\S+\\.f(ast)?q\\.gz$", "errorMessage": "FastQ file for reads 1 must be provided, cannot contain spaces and must have extension '.fq.gz' or '.fastq.gz'" }, "fastq_2": { - "errorMessage": "FastQ file for reads 2 cannot contain spaces and must have extension '.fq.gz' or '.fastq.gz'", - "anyOf": [ - { - "type": "string", - "pattern": "^\\S+\\.f(ast)?q\\.gz$" - }, - { - "type": "string", - "maxLength": 0 - } - ] + "type": "string", + "format": "file-path", + "exists": true, + "pattern": "^\\S+\\.f(ast)?q\\.gz$", + "errorMessage": "FastQ file for reads 2 cannot contain spaces and must have extension '.fq.gz' or '.fastq.gz'" } }, "required": ["sample", "fastq_1"] diff --git a/bin/check_samplesheet.py b/bin/check_samplesheet.py deleted file mode 100755 index 94077cd4..00000000 --- a/bin/check_samplesheet.py +++ /dev/null @@ -1,126 +0,0 @@ -#!/usr/bin/env python - -# This script is based on the example at: https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/samplesheet/samplesheet_test_illumina_amplicon.csv - -import os -import sys -import errno -import argparse - - -def parse_args(args=None): - Description = "Reformat nf-core/smrnaseq samplesheet file and check its contents." - Epilog = "Example usage: python check_samplesheet.py " - - parser = argparse.ArgumentParser(description=Description, epilog=Epilog) - parser.add_argument("FILE_IN", help="Input samplesheet file.") - parser.add_argument("FILE_OUT", help="Output file.") - return parser.parse_args(args) - - -def make_dir(path): - if len(path) > 0: - try: - os.makedirs(path) - except OSError as exception: - if exception.errno != errno.EEXIST: - raise exception - - -def print_error(error, context="Line", context_str=""): - error_str = "ERROR: Please check samplesheet -> {}".format(error) - if context != "" and context_str != "": - error_str = "ERROR: Please check samplesheet -> {}\n{}: '{}'".format( - error, context.strip(), context_str.strip() - ) - print(error_str) - sys.exit(1) - - -def check_samplesheet(file_in, file_out): - """ - This function checks that the samplesheet follows the following structure: - sample,fastq_1 - SAMPLE_PE,SAMPLE_PE_RUN1_1.fastq.gz - SAMPLE_PE,SAMPLE_PE_RUN2_1.fastq.gz - SAMPLE_SE,SAMPLE_SE_RUN1_1.fastq.gz - For an example see: - https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/samplesheet/samplesheet_test_illumina_amplicon.csv - """ - - sample_mapping_dict = {} - with open(file_in, "r") as fin: - ## Check header - MIN_COLS = 2 - HEADER = ["sample", "fastq_1"] - header = [x.strip('"') for x in fin.readline().strip().split(",")] - if any([item not in header for item in HEADER]): - missing = [item for item in HEADER if item not in header] - print_error("ERROR: Please check samplesheet header. Missing columns: '{}'".format(",".join(missing))) - sys.exit(1) - - ## Check sample entries - for line_number, line in enumerate(fin): - lspl = [x.strip().strip('"') for x in line.strip().split(",")] - row = {k: v for k, v in zip(header, lspl)} - - # Check valid number of columns per row - if len(lspl) != len(header): - print_error( - "Invalid number of columns found - header has {} columns, content has {}. Number of rows {})".format( - len(header), len(lspl), line_number - ), - f"Line #{line_number+2}", - line, - ) - - ## Check sample name entries - sample = row.get("sample", "").replace(" ", "_") - if not sample: - print_error("Sample entry has not been specified!", f"Line #{line_number+2}", line) - - ## Check FastQ file extension - fastq = row.get("fastq_1", None) - if fastq: - if fastq.find(" ") != -1: - print_error("FastQ file contains spaces!", f"Line #{line_number+2}", line) - if not fastq.endswith(".fastq.gz") and not fastq.endswith(".fq.gz"): - print_error( - "FastQ file does not have extension '.fastq.gz' or '.fq.gz'!", - "Line", - line, - ) - - ## Create sample mapping dictionary - sample_info = {"single_end": "1", "fastq_1": fastq} - if sample not in sample_mapping_dict: - sample_mapping_dict[sample] = [sample_info] - else: - if sample_info in sample_mapping_dict[sample]: - print_error("Samplesheet contains duplicate rows!", "Line", line) - else: - sample_mapping_dict[sample].append(sample_info) - - ## Write validated samplesheet with appropriate columns - output_cols = ["id", "intrasample_id", "single_end", "fastq_1"] - if len(sample_mapping_dict) > 0: - out_dir = os.path.dirname(file_out) - make_dir(out_dir) - with open(file_out, "w") as fout: - fout.write(",".join(output_cols) + "\n") - for sample in sorted(sample_mapping_dict.keys()): - for intrasample_id, val in enumerate(sample_mapping_dict[sample]): - sample_info = {**{"id": sample, "intrasample_id": str(intrasample_id)}, **val} - outrow = [sample_info.get(colname, None) for colname in output_cols] - fout.write(",".join(outrow) + "\n") - else: - print_error("No entries to process!", "Samplesheet: {}".format(file_in)) - - -def main(args=None): - args = parse_args(args) - check_samplesheet(args.FILE_IN, args.FILE_OUT) - - -if __name__ == "__main__": - sys.exit(main()) diff --git a/conf/modules.config b/conf/modules.config index fb26908e..f7a50622 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -26,7 +26,7 @@ process { // // Input preparation // - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:INPUT_CHECK:SAMPLESHEET_CHECK' { + withName: 'NFCORE_SMRNASEQ:INPUT_CHECK:SAMPLESHEET_CHECK' { publishDir = [ path: { "${params.outdir}/pipeline_info" }, mode: params.publish_dir_mode, @@ -187,7 +187,7 @@ process { // // CONTAMINANT_FILTER // - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:CONTAMINANT_FILTER:.*' { + withName: 'NFCORE_SMRNASEQ:CONTAMINANT_FILTER:.*' { publishDir = [ path: { "${params.outdir}/contaminant_filter/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }, mode: params.publish_dir_mode, @@ -198,35 +198,35 @@ process { // // MIRNA_QUANT // - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:MIRNA_QUANT:FORMAT_.*' { + withName: 'NFCORE_SMRNASEQ:MIRNA_QUANT:FORMAT_.*' { publishDir = [ path: { "${params.outdir}/mirna_quant/reference" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:MIRNA_QUANT:PARSE_.*' { + withName: 'NFCORE_SMRNASEQ:MIRNA_QUANT:PARSE_.*' { publishDir = [ path: { "${params.outdir}/mirna_quant/reference" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:MIRNA_QUANT:INDEX_MATURE' { + withName: 'NFCORE_SMRNASEQ:MIRNA_QUANT:INDEX_MATURE' { publishDir = [ path: { "${params.outdir}/bowtie_index/mirna_mature" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:MIRNA_QUANT:INDEX_HAIRPIN' { + withName: 'NFCORE_SMRNASEQ:MIRNA_QUANT:INDEX_HAIRPIN' { publishDir = [ path: { "${params.outdir}/bowtie_index/mirna_hairpin" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:MIRNA_QUANT:BOWTIE_MAP_MATURE' { + withName: 'NFCORE_SMRNASEQ:MIRNA_QUANT:BOWTIE_MAP_MATURE' { publishDir = [ path: { "${params.outdir}/mirna_quant/bam/mature" }, mode: params.publish_dir_mode, @@ -234,7 +234,7 @@ process { enabled: params.save_aligned_mirna_quant ] } - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:MIRNA_QUANT:BAM_STATS_MATURE:.*' { + withName: 'NFCORE_SMRNASEQ:MIRNA_QUANT:BAM_STATS_MATURE:.*' { ext.prefix = { "${meta.id}.sorted" } publishDir = [ path: { "${params.outdir}/mirna_quant/bam/mature" }, @@ -242,7 +242,7 @@ process { saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:MIRNA_QUANT:BOWTIE_MAP_HAIRPIN' { + withName: 'NFCORE_SMRNASEQ:MIRNA_QUANT:BOWTIE_MAP_HAIRPIN' { publishDir = [ path: { "${params.outdir}/mirna_quant/bam/hairpin" }, mode: params.publish_dir_mode, @@ -250,7 +250,7 @@ process { enabled: params.save_aligned_mirna_quant ] } - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:MIRNA_QUANT:BAM_STATS_HAIRPIN:.*' { + withName: 'NFCORE_SMRNASEQ:MIRNA_QUANT:BAM_STATS_HAIRPIN:.*' { ext.prefix = { "${meta.id}.sorted" } publishDir = [ path: { "${params.outdir}/mirna_quant/bam/hairpin" }, @@ -272,7 +272,7 @@ process { saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:MIRNA_QUANT:BOWTIE_MAP_SEQCLUSTER' { + withName: 'NFCORE_SMRNASEQ:MIRNA_QUANT:BOWTIE_MAP_SEQCLUSTER' { publishDir = [ path: { "${params.outdir}/mirna_quant/bam/seqcluster" }, mode: params.publish_dir_mode, @@ -288,7 +288,7 @@ process { saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:MIRNA_QUANT:TABLE_MERGE' { + withName: 'NFCORE_SMRNASEQ:MIRNA_QUANT:TABLE_MERGE' { publishDir = [ path: { "${params.outdir}/mirna_quant/mirtop" }, mode: params.publish_dir_mode, @@ -300,7 +300,7 @@ process { // // GENOME_QUANT // - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:GENOME_QUANT:BAM_SORT_STATS_SAMTOOLS:SAMTOOLS_.*' { + withName: 'NFCORE_SMRNASEQ:GENOME_QUANT:BAM_SORT_STATS_SAMTOOLS:SAMTOOLS_.*' { ext.prefix = { "${meta.id}.sorted" } publishDir = [ path: { "${params.outdir}/genome_quant/bam" }, @@ -308,7 +308,7 @@ process { saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:GENOME_QUANT:BAM_SORT_STATS_SAMTOOLS:BAM_STATS_SAMTOOLS:.*' { + withName: 'NFCORE_SMRNASEQ:GENOME_QUANT:BAM_SORT_STATS_SAMTOOLS:BAM_STATS_SAMTOOLS:.*' { ext.prefix = { "${meta.id}.sorted" } publishDir = [ path: { "${params.outdir}/genome_quant/bam" }, @@ -316,7 +316,7 @@ process { pattern: "*.{stats,flagstat,idxstats}" ] } - withName: 'NFCORE_SMRNASEQ:SMRNASEQ:GENOME_QUANT:BOWTIE_MAP_GENOME' { + withName: 'NFCORE_SMRNASEQ:GENOME_QUANT:BOWTIE_MAP_GENOME' { publishDir = [ path: { "${params.outdir}/genome_quant/bam" }, mode: params.publish_dir_mode, diff --git a/lib/NfcoreTemplate.groovy b/lib/NfcoreTemplate.groovy deleted file mode 100755 index e248e4c3..00000000 --- a/lib/NfcoreTemplate.groovy +++ /dev/null @@ -1,356 +0,0 @@ -// -// This file holds several functions used within the nf-core pipeline template. -// - -import org.yaml.snakeyaml.Yaml -import groovy.json.JsonOutput -import nextflow.extension.FilesEx - -class NfcoreTemplate { - - // - // Check AWS Batch related parameters have been specified correctly - // - public static void awsBatch(workflow, params) { - if (workflow.profile.contains('awsbatch')) { - // Check params.awsqueue and params.awsregion have been set if running on AWSBatch - assert (params.awsqueue && params.awsregion) : "Specify correct --awsqueue and --awsregion parameters on AWSBatch!" - // Check outdir paths to be S3 buckets if running on AWSBatch - assert params.outdir.startsWith('s3:') : "Outdir not on S3 - specify S3 Bucket to run on AWSBatch!" - } - } - - // - // Warn if a -profile or Nextflow config has not been provided to run the pipeline - // - public static void checkConfigProvided(workflow, log) { - if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { - log.warn "[$workflow.manifest.name] You are attempting to run the pipeline without any custom configuration!\n\n" + - "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + - " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + - " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + - " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + - "Please refer to the quick start section and usage docs for the pipeline.\n " - } - } - - // - // Generate version string - // - public static String version(workflow) { - String version_string = "" - - if (workflow.manifest.version) { - def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' - version_string += "${prefix_v}${workflow.manifest.version}" - } - - if (workflow.commitId) { - def git_shortsha = workflow.commitId.substring(0, 7) - version_string += "-g${git_shortsha}" - } - - return version_string - } - - // - // Construct and send completion email - // - public static void email(workflow, params, summary_params, projectDir, log, multiqc_report=[]) { - - // Set up the e-mail variables - def subject = "[$workflow.manifest.name] Successful: $workflow.runName" - if (!workflow.success) { - subject = "[$workflow.manifest.name] FAILED: $workflow.runName" - } - - def summary = [:] - for (group in summary_params.keySet()) { - summary << summary_params[group] - } - - def misc_fields = [:] - misc_fields['Date Started'] = workflow.start - misc_fields['Date Completed'] = workflow.complete - misc_fields['Pipeline script file path'] = workflow.scriptFile - misc_fields['Pipeline script hash ID'] = workflow.scriptId - if (workflow.repository) misc_fields['Pipeline repository Git URL'] = workflow.repository - if (workflow.commitId) misc_fields['Pipeline repository Git Commit'] = workflow.commitId - if (workflow.revision) misc_fields['Pipeline Git branch/tag'] = workflow.revision - misc_fields['Nextflow Version'] = workflow.nextflow.version - misc_fields['Nextflow Build'] = workflow.nextflow.build - misc_fields['Nextflow Compile Timestamp'] = workflow.nextflow.timestamp - - def email_fields = [:] - email_fields['version'] = NfcoreTemplate.version(workflow) - email_fields['runName'] = workflow.runName - email_fields['success'] = workflow.success - email_fields['dateComplete'] = workflow.complete - email_fields['duration'] = workflow.duration - email_fields['exitStatus'] = workflow.exitStatus - email_fields['errorMessage'] = (workflow.errorMessage ?: 'None') - email_fields['errorReport'] = (workflow.errorReport ?: 'None') - email_fields['commandLine'] = workflow.commandLine - email_fields['projectDir'] = workflow.projectDir - email_fields['summary'] = summary << misc_fields - - // On success try attach the multiqc report - def mqc_report = null - try { - if (workflow.success) { - mqc_report = multiqc_report.getVal() - if (mqc_report.getClass() == ArrayList && mqc_report.size() >= 1) { - if (mqc_report.size() > 1) { - log.warn "[$workflow.manifest.name] Found multiple reports from process 'MULTIQC', will use only one" - } - mqc_report = mqc_report[0] - } - } - } catch (all) { - if (multiqc_report) { - log.warn "[$workflow.manifest.name] Could not attach MultiQC report to summary email" - } - } - - // Check if we are only sending emails on failure - def email_address = params.email - if (!params.email && params.email_on_fail && !workflow.success) { - email_address = params.email_on_fail - } - - // Render the TXT template - def engine = new groovy.text.GStringTemplateEngine() - def tf = new File("$projectDir/assets/email_template.txt") - def txt_template = engine.createTemplate(tf).make(email_fields) - def email_txt = txt_template.toString() - - // Render the HTML template - def hf = new File("$projectDir/assets/email_template.html") - def html_template = engine.createTemplate(hf).make(email_fields) - def email_html = html_template.toString() - - // Render the sendmail template - def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit - def smail_fields = [ email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "$projectDir", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes() ] - def sf = new File("$projectDir/assets/sendmail_template.txt") - def sendmail_template = engine.createTemplate(sf).make(smail_fields) - def sendmail_html = sendmail_template.toString() - - // Send the HTML e-mail - Map colors = logColours(params.monochrome_logs) - if (email_address) { - try { - if (params.plaintext_email) { throw GroovyException('Send plaintext e-mail, not HTML') } - // Try to send HTML e-mail using sendmail - def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") - sendmail_tf.withWriter { w -> w << sendmail_html } - [ 'sendmail', '-t' ].execute() << sendmail_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (sendmail)-" - } catch (all) { - // Catch failures and try with plaintext - def mail_cmd = [ 'mail', '-s', subject, '--content-type=text/html', email_address ] - if ( mqc_report != null && mqc_report.size() <= max_multiqc_email_size.toBytes() ) { - mail_cmd += [ '-A', mqc_report ] - } - mail_cmd.execute() << email_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (mail)-" - } - } - - // Write summary e-mail HTML to a file - def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") - output_hf.withWriter { w -> w << email_html } - FilesEx.copyTo(output_hf.toPath(), "${params.outdir}/pipeline_info/pipeline_report.html"); - output_hf.delete() - - // Write summary e-mail TXT to a file - def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") - output_tf.withWriter { w -> w << email_txt } - FilesEx.copyTo(output_tf.toPath(), "${params.outdir}/pipeline_info/pipeline_report.txt"); - output_tf.delete() - } - - // - // Construct and send a notification to a web server as JSON - // e.g. Microsoft Teams and Slack - // - public static void IM_notification(workflow, params, summary_params, projectDir, log) { - def hook_url = params.hook_url - - def summary = [:] - for (group in summary_params.keySet()) { - summary << summary_params[group] - } - - def misc_fields = [:] - misc_fields['start'] = workflow.start - misc_fields['complete'] = workflow.complete - misc_fields['scriptfile'] = workflow.scriptFile - misc_fields['scriptid'] = workflow.scriptId - if (workflow.repository) misc_fields['repository'] = workflow.repository - if (workflow.commitId) misc_fields['commitid'] = workflow.commitId - if (workflow.revision) misc_fields['revision'] = workflow.revision - misc_fields['nxf_version'] = workflow.nextflow.version - misc_fields['nxf_build'] = workflow.nextflow.build - misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp - - def msg_fields = [:] - msg_fields['version'] = NfcoreTemplate.version(workflow) - msg_fields['runName'] = workflow.runName - msg_fields['success'] = workflow.success - msg_fields['dateComplete'] = workflow.complete - msg_fields['duration'] = workflow.duration - msg_fields['exitStatus'] = workflow.exitStatus - msg_fields['errorMessage'] = (workflow.errorMessage ?: 'None') - msg_fields['errorReport'] = (workflow.errorReport ?: 'None') - msg_fields['commandLine'] = workflow.commandLine.replaceFirst(/ +--hook_url +[^ ]+/, "") - msg_fields['projectDir'] = workflow.projectDir - msg_fields['summary'] = summary << misc_fields - - // Render the JSON template - def engine = new groovy.text.GStringTemplateEngine() - // Different JSON depending on the service provider - // Defaults to "Adaptive Cards" (https://adaptivecards.io), except Slack which has its own format - def json_path = hook_url.contains("hooks.slack.com") ? "slackreport.json" : "adaptivecard.json" - def hf = new File("$projectDir/assets/${json_path}") - def json_template = engine.createTemplate(hf).make(msg_fields) - def json_message = json_template.toString() - - // POST - def post = new URL(hook_url).openConnection(); - post.setRequestMethod("POST") - post.setDoOutput(true) - post.setRequestProperty("Content-Type", "application/json") - post.getOutputStream().write(json_message.getBytes("UTF-8")); - def postRC = post.getResponseCode(); - if (! postRC.equals(200)) { - log.warn(post.getErrorStream().getText()); - } - } - - // - // Dump pipeline parameters in a json file - // - public static void dump_parameters(workflow, params) { - def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') - def filename = "params_${timestamp}.json" - def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") - def jsonStr = JsonOutput.toJson(params) - temp_pf.text = JsonOutput.prettyPrint(jsonStr) - - FilesEx.copyTo(temp_pf.toPath(), "${params.outdir}/pipeline_info/params_${timestamp}.json") - temp_pf.delete() - } - - // - // Print pipeline summary on completion - // - public static void summary(workflow, params, log) { - Map colors = logColours(params.monochrome_logs) - if (workflow.success) { - if (workflow.stats.ignoredCount == 0) { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Pipeline completed successfully${colors.reset}-" - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-" - } - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.red} Pipeline completed with errors${colors.reset}-" - } - } - - // - // ANSII Colours used for terminal logging - // - public static Map logColours(Boolean monochrome_logs) { - Map colorcodes = [:] - - // Reset / Meta - colorcodes['reset'] = monochrome_logs ? '' : "\033[0m" - colorcodes['bold'] = monochrome_logs ? '' : "\033[1m" - colorcodes['dim'] = monochrome_logs ? '' : "\033[2m" - colorcodes['underlined'] = monochrome_logs ? '' : "\033[4m" - colorcodes['blink'] = monochrome_logs ? '' : "\033[5m" - colorcodes['reverse'] = monochrome_logs ? '' : "\033[7m" - colorcodes['hidden'] = monochrome_logs ? '' : "\033[8m" - - // Regular Colors - colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" - colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" - colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" - colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" - colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" - colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" - colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" - colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" - - // Bold - colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" - colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" - colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" - colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" - colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" - colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" - colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" - colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" - - // Underline - colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" - colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" - colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" - colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" - colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" - colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" - colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" - colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" - - // High Intensity - colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" - colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" - colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" - colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" - colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" - colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" - colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" - colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" - - // Bold High Intensity - colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" - colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" - colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" - colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" - colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" - colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" - colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" - colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" - - return colorcodes - } - - // - // Does what is says on the tin - // - public static String dashedLine(monochrome_logs) { - Map colors = logColours(monochrome_logs) - return "-${colors.dim}----------------------------------------------------${colors.reset}-" - } - - // - // nf-core logo - // - public static String logo(workflow, monochrome_logs) { - Map colors = logColours(monochrome_logs) - String workflow_version = NfcoreTemplate.version(workflow) - String.format( - """\n - ${dashedLine(monochrome_logs)} - ${colors.green},--.${colors.black}/${colors.green},-.${colors.reset} - ${colors.blue} ___ __ __ __ ___ ${colors.green}/,-._.--~\'${colors.reset} - ${colors.blue} |\\ | |__ __ / ` / \\ |__) |__ ${colors.yellow}} {${colors.reset} - ${colors.blue} | \\| | \\__, \\__/ | \\ |___ ${colors.green}\\`-._,-`-,${colors.reset} - ${colors.green}`._,._,\'${colors.reset} - ${colors.purple} ${workflow.manifest.name} ${workflow_version}${colors.reset} - ${dashedLine(monochrome_logs)} - """.stripIndent() - ) - } -} diff --git a/lib/Utils.groovy b/lib/Utils.groovy deleted file mode 100644 index 8d030f4e..00000000 --- a/lib/Utils.groovy +++ /dev/null @@ -1,47 +0,0 @@ -// -// This file holds several Groovy functions that could be useful for any Nextflow pipeline -// - -import org.yaml.snakeyaml.Yaml - -class Utils { - - // - // When running with -profile conda, warn if channels have not been set-up appropriately - // - public static void checkCondaChannels(log) { - Yaml parser = new Yaml() - def channels = [] - try { - def config = parser.load("conda config --show channels".execute().text) - channels = config.channels - } catch(NullPointerException | IOException e) { - log.warn "Could not verify conda channel configuration." - return - } - - // Check that all channels are present - // This channel list is ordered by required channel priority. - def required_channels_in_order = ['conda-forge', 'bioconda', 'defaults'] - def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean - - // Check that they are in the right order - def channel_priority_violation = false - def n = required_channels_in_order.size() - for (int i = 0; i < n - 1; i++) { - channel_priority_violation |= !(channels.indexOf(required_channels_in_order[i]) < channels.indexOf(required_channels_in_order[i+1])) - } - - if (channels_missing | channel_priority_violation) { - log.warn "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + - " There is a problem with your Conda configuration!\n\n" + - " You will need to set-up the conda-forge and bioconda channels correctly.\n" + - " Please refer to https://bioconda.github.io/\n" + - " The observed channel order is \n" + - " ${channels}\n" + - " but the following channel order is required:\n" + - " ${required_channels_in_order}\n" + - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" - } - } -} diff --git a/lib/WorkflowMain.groovy b/lib/WorkflowMain.groovy deleted file mode 100755 index 451d298f..00000000 --- a/lib/WorkflowMain.groovy +++ /dev/null @@ -1,86 +0,0 @@ -// -// This file holds several functions specific to the main.nf workflow in the nf-core/smrnaseq pipeline -// - -import nextflow.Nextflow - -class WorkflowMain { - - // - // Citation string for pipeline - // - public static String citation(workflow) { - return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + - "* The pipeline\n" + - " https://zenodo.org/badge/latestdoi/140590861\n\n" + - "* The nf-core framework\n" + - " https://doi.org/10.1038/s41587-020-0439-x\n\n" + - "* Software dependencies\n" + - " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" - } - - - // - // Validate parameters and print summary to screen - // - public static void initialise(workflow, params, log, args) { - - //Detect Protocol setting, set this early before help so help shows proper adapters etc pp - WorkflowSmrnaseq.formatProtocol(params,log) - - // Print help to screen if required - if (params.help) { - log.info help(workflow, params) - System.exit(0) - } - - // Print workflow version and exit on --version - if (params.version) { - String workflow_version = NfcoreTemplate.version(workflow) - log.info "${workflow.manifest.name} ${workflow_version}" - System.exit(0) - } - - // Check that a -profile or Nextflow config has been provided to run the pipeline - NfcoreTemplate.checkConfigProvided(workflow, log) - // Check that the profile doesn't contain spaces and doesn't end with a trailing comma - checkProfile(workflow.profile, args, log) - - // Check that conda channels are set-up correctly - if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) { - Utils.checkCondaChannels(log) - } - - // Check AWS batch settings - NfcoreTemplate.awsBatch(workflow, params) - - // Check input has been provided - if (!params.input) { - Nextflow.error("Please provide an input samplesheet to the pipeline e.g. '--input samplesheet.csv'") - } - - } - // - // Get attribute from genome config file e.g. fasta - // - public static Object getGenomeAttribute(params, attribute) { - if (params.genomes && params.genome && params.genomes.containsKey(params.genome)) { - if (params.genomes[ params.genome ].containsKey(attribute)) { - return params.genomes[ params.genome ][ attribute ] - } - } - return null - } - - // - // Exit pipeline if --profile contains spaces - // - private static void checkProfile(profile, args, log) { - if (profile.endsWith(',')) { - Nextflow.error "Profile cannot end with a trailing comma. Please remove the comma from the end of the profile string.\nHint: A common mistake is to provide multiple values to `-profile` separated by spaces. Please use commas to separate profiles instead,e.g., `-profile docker,test`." - } - if (args[0]) { - log.warn "nf-core pipelines do not accept positional arguments. The positional argument `${args[0]}` has been detected.\n Hint: A common mistake is to provide multiple values to `-profile` separated by spaces. Please use commas to separate profiles instead,e.g., `-profile docker,test`." - } - } -} diff --git a/lib/WorkflowSmrnaseq.groovy b/lib/WorkflowSmrnaseq.groovy deleted file mode 100755 index b07c388a..00000000 --- a/lib/WorkflowSmrnaseq.groovy +++ /dev/null @@ -1,158 +0,0 @@ -// -// This file holds several functions specific to the workflow/smrnaseq.nf in the nf-core/smrnaseq pipeline -// - -import nextflow.Nextflow -import groovy.text.SimpleTemplateEngine - -class WorkflowSmrnaseq { - - // - // Check and validate parameters - // - public static void initialise(params, log) { - - genomeExistsError(params, log) - } - - // - // Get workflow summary for MultiQC - // - public static String paramsSummaryMultiqc(workflow, summary) { - String summary_section = '' - for (group in summary.keySet()) { - def group_params = summary.get(group) // This gets the parameters of that particular group - if (group_params) { - summary_section += "

$group

\n" - summary_section += "
\n" - for (param in group_params.keySet()) { - summary_section += "
$param
${group_params.get(param) ?: 'N/A'}
\n" - } - summary_section += "
\n" - } - } - - String yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" - yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" - yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" - yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" - yaml_file_text += "plot_type: 'html'\n" - yaml_file_text += "data: |\n" - yaml_file_text += "${summary_section}" - return yaml_file_text - } - - // - // Generate methods description for MultiQC - // - - public static String toolCitationText(params) { - - // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "Tool (Foo et al. 2023)" : "", - // Uncomment function in methodsDescriptionText to render in MultiQC report - def citation_text = [ - "Tools used in the workflow included:", - "FastQC (Andrews 2010),", - "MultiQC (Ewels et al. 2016)", - "." - ].join(' ').trim() - - return citation_text - } - - public static String toolBibliographyText(params) { - - // TODO Optionally add bibliographic entries to this list. - // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "
  • Author (2023) Pub name, Journal, DOI
    • " : "", - // Uncomment function in methodsDescriptionText to render in MultiQC report - def reference_text = [ - "
  • Andrews S, (2010) FastQC, URL: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
    • ", - "
  • Ewels, P., Magnusson, M., Lundin, S., & KΓ€ller, M. (2016). MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics , 32(19), 3047–3048. doi: /10.1093/bioinformatics/btw354
    • " - ].join(' ').trim() - - return reference_text - } - - public static String methodsDescriptionText(run_workflow, mqc_methods_yaml, params) { - // Convert to a named map so can be used as with familar NXF ${workflow} variable syntax in the MultiQC YML file - def meta = [:] - meta.workflow = run_workflow.toMap() - meta["manifest_map"] = run_workflow.manifest.toMap() - - // Pipeline DOI - meta["doi_text"] = meta.manifest_map.doi ? "(doi: ${meta.manifest_map.doi})" : "" - meta["nodoi_text"] = meta.manifest_map.doi ? "": "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
    • " - - // Tool references - meta["tool_citations"] = "" - meta["tool_bibliography"] = "" - - // TODO Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled! - //meta["tool_citations"] = toolCitationText(params).replaceAll(", \\.", ".").replaceAll("\\. \\.", ".").replaceAll(", \\.", ".") - //meta["tool_bibliography"] = toolBibliographyText(params) - - - def methods_text = mqc_methods_yaml.text - - def engine = new SimpleTemplateEngine() - def description_html = engine.createTemplate(methods_text).make(meta) - - return description_html - } - - // - // Exit pipeline if incorrect --genome key provided - // - private static void genomeExistsError(params, log) { - if (params.genomes && params.genome && !params.genomes.containsKey(params.genome)) { - def error_string = "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + - " Genome '${params.genome}' not found in any config files provided to the pipeline.\n" + - " Currently, the available genome keys are:\n" + - " ${params.genomes.keySet().join(", ")}\n" + - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" - Nextflow.error(error_string) - } - } - - /* - * Format the protocol - * Given the protocol parameter (params.protocol), - * this function formats the protocol such that it is fit for the respective - * subworkflow - */ - public static String formatProtocol(params,log) { - - switch(params.protocol){ - case 'illumina': - params.putIfAbsent("clip_r1", 0); - params.putIfAbsent("three_prime_clip_r1",0); - params.putIfAbsent("three_prime_adapter", "TGGAATTCTCGGGTGCCAAGG"); - break - case 'nextflex': - params.putIfAbsent("clip_r1", 4); - params.putIfAbsent("three_prime_clip_r1", 4); - params.putIfAbsent("three_prime_adapter", "TGGAATTCTCGGGTGCCAAGG"); - break - case 'qiaseq': - params.putIfAbsent("clip_r1",0); - params.putIfAbsent("three_prime_clip_r1",0); - params.putIfAbsent("three_prime_adapter","AACTGTAGGCACCATCAAT"); - break - case 'cats': - params.putIfAbsent("clip_r1",3); - params.putIfAbsent("three_prime_clip_r1", 0); - params.putIfAbsent("three_prime_adapter", "AAAAAAAA"); - break - case 'custom': - params.putIfAbsent("clip_r1", params.clip_r1) - params.putIfAbsent("three_prime_clip_r1", params.three_prime_clip_r1) - default: - log.warn "Please make sure to specify all required clipping and trimming parameters, otherwise only adapter detection will be performed." - } - - log.warn "Running with Protocol ${params.protocol}" - log.warn "Therefore using Adapter: ${params.three_prime_adapter}" - log.warn "Clipping ${params.clip_r1} bases from R1" - log.warn "And clipping ${params.three_prime_clip_r1} bases from 3' end" - } -} diff --git a/main.nf b/main.nf index 48735936..cd13268a 100644 --- a/main.nf +++ b/main.nf @@ -13,63 +13,70 @@ nextflow.enable.dsl = 2 /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - GENOME PARAMETER VALUES + IMPORT FUNCTIONS / MODULES / SUBWORKFLOWS / WORKFLOWS ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ - -params.fasta = WorkflowMain.getGenomeAttribute(params, 'fasta') -params.mirtrace_species = WorkflowMain.getGenomeAttribute(params, 'mirtrace_species') -params.bowtie_index = WorkflowMain.getGenomeAttribute(params, 'bowtie') - +include { NFCORE_SMRNASEQ } from './workflows/smrnaseq' +include { PIPELINE_INITIALISATION } from './subworkflows/local/utils_nfcore_smrnaseq_pipeline' +include { PIPELINE_COMPLETION } from './subworkflows/local/utils_nfcore_smrnaseq_pipeline' +include { getGenomeAttribute } from './subworkflows/local/utils_nfcore_smrnaseq_pipeline' /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - VALIDATE & PRINT PARAMETER SUMMARY + GENOME PARAMETER VALUES ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -include { validateParameters; paramsHelp } from 'plugin/nf-validation' - -// Print help message if needed -if (params.help) { - def logo = NfcoreTemplate.logo(workflow, params.monochrome_logs) - def citation = '\n' + WorkflowMain.citation(workflow) + '\n' - def String command = "nextflow run ${workflow.manifest.name} --input samplesheet.csv --genome GRCh37 -profile docker" - log.info logo + paramsHelp(command) + citation + NfcoreTemplate.dashedLine(params.monochrome_logs) - System.exit(0) -} - -// Validate input parameters -if (params.validate_params) { - validateParameters() -} - -WorkflowMain.initialise(workflow, params, log, args) +params.fasta = getGenomeAttribute('fasta') +params.mirtrace_species = getGenomeAttribute('mirtrace_species') +params.bowtie_index = getGenomeAttribute('bowtie') /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - NAMED WORKFLOW FOR PIPELINE + RUN MAIN WORKFLOW ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ +workflow { -include { SMRNASEQ } from './workflows/smrnaseq' + main: + ch_versions = Channel.empty() -workflow NFCORE_SMRNASEQ { - SMRNASEQ () -} + // + // SUBWORKFLOW: Run initialisation tasks + // + PIPELINE_INITIALISATION ( + params.version, + params.help, + params.validate_params, + params.monochrome_logs, + args, + params.outdir, + params.input + ) + + // + // WORKFLOW: Run main workflow + // + NFCORE_SMRNASEQ ( + Channel.of(file(params.input, checkIfExists: true)), + PIPELINE_INITIALISATION.out.samplesheet, + ch_versions + ) + + // + // SUBWORKFLOW: Run completion tasks + // + PIPELINE_COMPLETION ( + params.email, + params.email_on_fail, + params.plaintext_email, + params.outdir, + params.monochrome_logs, + params.hook_url, + NFCORE_SMRNASEQ.out.multiqc_report + ) -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - RUN ALL WORKFLOWS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ -// -// WORKFLOW: Execute a single named workflow for the pipeline -// See: https://github.com/nf-core/rnaseq/issues/619 -// -workflow { - NFCORE_SMRNASEQ () } /* diff --git a/modules.json b/modules.json index bdad7a91..ce269067 100644 --- a/modules.json +++ b/modules.json @@ -95,6 +95,44 @@ "installed_by": ["subworkflows"] } } + }, + "subworkflows": { + "nf-core": { + "utils_nextflow_pipeline": { + "branch": "master", + "git_sha": "cd08c91373cd00a73255081340e4914485846ba1", + "installed_by": ["subworkflows"] + }, + "utils_nfcore_pipeline": { + "branch": "master", + "git_sha": "262b17ed2aad591039f914951659177e6c39a8d8", + "installed_by": ["subworkflows"] + }, + "utils_nfvalidation_plugin": { + "branch": "master", + "git_sha": "cd08c91373cd00a73255081340e4914485846ba1", + "installed_by": ["subworkflows"] + } + } + }, + "subworkflows": { + "nf-core": { + "utils_nextflow_pipeline": { + "branch": "master", + "git_sha": "cd08c91373cd00a73255081340e4914485846ba1", + "installed_by": ["subworkflows"] + }, + "utils_nfcore_pipeline": { + "branch": "master", + "git_sha": "262b17ed2aad591039f914951659177e6c39a8d8", + "installed_by": ["subworkflows"] + }, + "utils_nfvalidation_plugin": { + "branch": "master", + "git_sha": "cd08c91373cd00a73255081340e4914485846ba1", + "installed_by": ["subworkflows"] + } + } } } } diff --git a/modules/local/samplesheet_check.nf b/modules/local/samplesheet_check.nf deleted file mode 100644 index 351d2322..00000000 --- a/modules/local/samplesheet_check.nf +++ /dev/null @@ -1,31 +0,0 @@ -process SAMPLESHEET_CHECK { - tag "$samplesheet" - label 'process_single' - - conda "conda-forge::python=3.8.3" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/python:3.8.3' : - 'biocontainers/python:3.8.3' }" - - input: - path samplesheet - - output: - path '*.csv' , emit: csv - path "versions.yml", emit: versions - - when: - task.ext.when == null || task.ext.when - - script: // This script is bundled with the pipeline, in nf-core/smrnaseq/bin/ - """ - check_samplesheet.py \\ - $samplesheet \\ - samplesheet.valid.csv - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - python: \$(python --version | sed 's/Python //g') - END_VERSIONS - """ -} diff --git a/modules/nf-core/custom/dumpsoftwareversions/environment.yml b/modules/nf-core/custom/dumpsoftwareversions/environment.yml deleted file mode 100644 index b48ced26..00000000 --- a/modules/nf-core/custom/dumpsoftwareversions/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: custom_dumpsoftwareversions -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::multiqc=1.20 diff --git a/modules/nf-core/custom/dumpsoftwareversions/main.nf b/modules/nf-core/custom/dumpsoftwareversions/main.nf deleted file mode 100644 index 105f9265..00000000 --- a/modules/nf-core/custom/dumpsoftwareversions/main.nf +++ /dev/null @@ -1,24 +0,0 @@ -process CUSTOM_DUMPSOFTWAREVERSIONS { - label 'process_single' - - // Requires `pyyaml` which does not have a dedicated container but is in the MultiQC container - conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.20--pyhdfd78af_0' : - 'biocontainers/multiqc:1.20--pyhdfd78af_0' }" - - input: - path versions - - output: - path "software_versions.yml" , emit: yml - path "software_versions_mqc.yml", emit: mqc_yml - path "versions.yml" , emit: versions - - when: - task.ext.when == null || task.ext.when - - script: - def args = task.ext.args ?: '' - template 'dumpsoftwareversions.py' -} diff --git a/modules/nf-core/custom/dumpsoftwareversions/meta.yml b/modules/nf-core/custom/dumpsoftwareversions/meta.yml deleted file mode 100644 index 5f15a5fd..00000000 --- a/modules/nf-core/custom/dumpsoftwareversions/meta.yml +++ /dev/null @@ -1,37 +0,0 @@ -# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json -name: custom_dumpsoftwareversions -description: Custom module used to dump software versions within the nf-core pipeline template -keywords: - - custom - - dump - - version -tools: - - custom: - description: Custom module used to dump software versions within the nf-core pipeline template - homepage: https://github.com/nf-core/tools - documentation: https://github.com/nf-core/tools - licence: ["MIT"] -input: - - versions: - type: file - description: YML file containing software versions - pattern: "*.yml" -output: - - yml: - type: file - description: Standard YML file containing software versions - pattern: "software_versions.yml" - - mqc_yml: - type: file - description: MultiQC custom content YML file containing software versions - pattern: "software_versions_mqc.yml" - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" -authors: - - "@drpatelh" - - "@grst" -maintainers: - - "@drpatelh" - - "@grst" diff --git a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py b/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py deleted file mode 100755 index da033408..00000000 --- a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py +++ /dev/null @@ -1,101 +0,0 @@ -#!/usr/bin/env python - - -"""Provide functions to merge multiple versions.yml files.""" - - -import yaml -import platform -from textwrap import dedent - - -def _make_versions_html(versions): - """Generate a tabular HTML output of all versions for MultiQC.""" - html = [ - dedent( - """\\ - - - - - - - - - - """ - ) - ] - for process, tmp_versions in sorted(versions.items()): - html.append("") - for i, (tool, version) in enumerate(sorted(tmp_versions.items())): - html.append( - dedent( - f"""\\ - - - - - - """ - ) - ) - html.append("") - html.append("
    Process Name Software Version
    {process if (i == 0) else ''}{tool}{version}
    ") - return "\\n".join(html) - - -def main(): - """Load all version files and generate merged output.""" - versions_this_module = {} - versions_this_module["${task.process}"] = { - "python": platform.python_version(), - "yaml": yaml.__version__, - } - - with open("$versions") as f: - versions_by_process = yaml.load(f, Loader=yaml.BaseLoader) | versions_this_module - - # aggregate versions by the module name (derived from fully-qualified process name) - versions_by_module = {} - for process, process_versions in versions_by_process.items(): - module = process.split(":")[-1] - try: - if versions_by_module[module] != process_versions: - raise AssertionError( - "We assume that software versions are the same between all modules. " - "If you see this error-message it means you discovered an edge-case " - "and should open an issue in nf-core/tools. " - ) - except KeyError: - versions_by_module[module] = process_versions - - versions_by_module["Workflow"] = { - "Nextflow": "$workflow.nextflow.version", - "$workflow.manifest.name": "$workflow.manifest.version", - } - - versions_mqc = { - "id": "software_versions", - "section_name": "${workflow.manifest.name} Software Versions", - "section_href": "https://github.com/${workflow.manifest.name}", - "plot_type": "html", - "description": "are collected at run time from the software output.", - "data": _make_versions_html(versions_by_module), - } - - with open("software_versions.yml", "w") as f: - yaml.dump(versions_by_module, f, default_flow_style=False) - with open("software_versions_mqc.yml", "w") as f: - yaml.dump(versions_mqc, f, default_flow_style=False) - - with open("versions.yml", "w") as f: - yaml.dump(versions_this_module, f, default_flow_style=False) - - -if __name__ == "__main__": - main() diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test deleted file mode 100644 index b1e1630b..00000000 --- a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test +++ /dev/null @@ -1,43 +0,0 @@ -nextflow_process { - - name "Test Process CUSTOM_DUMPSOFTWAREVERSIONS" - script "../main.nf" - process "CUSTOM_DUMPSOFTWAREVERSIONS" - tag "modules" - tag "modules_nfcore" - tag "custom" - tag "dumpsoftwareversions" - tag "custom/dumpsoftwareversions" - - test("Should run without failures") { - when { - process { - """ - def tool1_version = ''' - TOOL1: - tool1: 0.11.9 - '''.stripIndent() - - def tool2_version = ''' - TOOL2: - tool2: 1.9 - '''.stripIndent() - - input[0] = Channel.of(tool1_version, tool2_version).collectFile() - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.mqc_yml[0]).readLines()[0..10], - file(process.out.yml[0]).readLines()[0..7] - ).match() - } - ) - } - } -} diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap deleted file mode 100644 index 5f59a936..00000000 --- a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap +++ /dev/null @@ -1,33 +0,0 @@ -{ - "Should run without failures": { - "content": [ - [ - "versions.yml:md5,76d454d92244589d32455833f7c1ba6d" - ], - [ - "data: \"\\n\\n \\n \\n \\n \\n \\n \\n \\n\\", - " \\n\\n\\n \\n \\n\\", - " \\ \\n\\n\\n\\n \\n \\", - " \\ \\n \\n\\n\\n\\n\\", - " \\n\\n \\n \\n\\", - " \\ \\n\\n\\n\\n\\n\\n \\n\\", - " \\ \\n \\n\\n\\n\\n\\", - " \\n\\n \\n \\n\\" - ], - [ - "CUSTOM_DUMPSOFTWAREVERSIONS:", - " python: 3.11.7", - " yaml: 5.4.1", - "TOOL1:", - " tool1: 0.11.9", - "TOOL2:", - " tool2: '1.9'", - "Workflow:" - ] - ], - "timestamp": "2024-01-09T23:01:18.710682" - } -} \ No newline at end of file diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml deleted file mode 100644 index 405aa24a..00000000 --- a/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -custom/dumpsoftwareversions: - - modules/nf-core/custom/dumpsoftwareversions/** diff --git a/nextflow.config b/nextflow.config index 0f802b0b..272b7372 100644 --- a/nextflow.config +++ b/nextflow.config @@ -30,6 +30,7 @@ params { mirgenedb_species = null save_aligned = false save_aligned_mirna_quant = true + bowtie_index = null // UMI handling with_umi = false @@ -67,11 +68,17 @@ params { pirna = null other_contamination = null + // References + genome = null + igenomes_base = 's3://ngi-igenomes/igenomes/' + igenomes_ignore = false + + // MultiQC options - multiqc_config = null - multiqc_title = null - multiqc_logo = null - max_multiqc_email_size = '25.MB' + multiqc_config = null + multiqc_title = null + multiqc_logo = null + max_multiqc_email_size = '25.MB' multiqc_methods_description = null // Boilerplate options @@ -86,12 +93,12 @@ params { version = false // Config options - custom_config_version = 'master' - custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" - config_profile_description = null - config_profile_contact = null - config_profile_url = null - config_profile_name = null + config_profile_name = null + config_profile_description = null + custom_config_version = 'master' + custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" + config_profile_contact = null + config_profile_url = null // Max resource options @@ -100,14 +107,6 @@ params { max_cpus = 16 max_time = '240.h' - - // Schema validation default options - validationFailUnrecognisedParams = false - validationLenientMode = false - validationSchemaIgnoreParams = 'genomes' - validationShowHiddenParams = false - validate_params = true - // Schema validation default options validationFailUnrecognisedParams = false validationLenientMode = false @@ -246,7 +245,6 @@ singularity.registry = 'quay.io' // Nextflow plugins plugins { - id 'nf-validation@1.1.3' // Validation of pipeline parameters and creation of an input channel from a sample sheet } diff --git a/nextflow_schema.json b/nextflow_schema.json index 4b78a7df..cf2d0382 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -16,6 +16,7 @@ "type": "string", "format": "file-path", "exists": true, + "schema": "assets/schema_input.json", "mimetype": "text/csv", "pattern": "^\\S+\\.csv$", "description": "Path to comma-separated file containing information about the samples in the experiment.", diff --git a/pyproject.toml b/pyproject.toml index 7d08e1c8..56110621 100644 --- a/pyproject.toml +++ b/pyproject.toml @@ -3,11 +3,13 @@ [tool.ruff] line-length = 120 target-version = "py38" -select = ["I", "E1", "E4", "E7", "E9", "F", "UP", "N"] cache-dir = "~/.cache/ruff" -[tool.ruff.isort] +[tool.ruff.lint] +select = ["I", "E1", "E4", "E7", "E9", "F", "UP", "N"] + +[tool.ruff.lint.isort] known-first-party = ["nf_core"] -[tool.ruff.per-file-ignores] +[tool.ruff.lint.per-file-ignores] "__init__.py" = ["E402", "F401"] diff --git a/subworkflows/local/input_check.nf b/subworkflows/local/input_check.nf deleted file mode 100644 index c7720312..00000000 --- a/subworkflows/local/input_check.nf +++ /dev/null @@ -1,32 +0,0 @@ -// -// Check input samplesheet and get read channels -// - -include { SAMPLESHEET_CHECK } from '../../modules/local/samplesheet_check' - -workflow INPUT_CHECK { - take: - samplesheet // file: /path/to/samplesheet.csv - - main: - ch_versions = Channel.empty() - SAMPLESHEET_CHECK ( samplesheet ) - .csv - .splitCsv ( header:true, sep:',' ) - .map { create_fastq_channel(it) } - .set { reads } - ch_versions.mix(SAMPLESHEET_CHECK.out.versions) - - emit: - reads // channel: [ val(meta), [ reads ] ] - versions = ch_versions // channel: [ versions.yml ] -} - -// Function to get list of [ meta, [ fastq_1 ] ] -def create_fastq_channel(LinkedHashMap row) { - def meta = row.findAll {it.key != "fastq_1"} - if (!file(row.fastq_1).exists()) { - exit 1, "ERROR: Please check input samplesheet -> Read 1 FastQ file does not exist!\n${row.fastq_1}" - } - return [ meta, [ file(row.fastq_1) ] ] -} diff --git a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf new file mode 100644 index 00000000..af31a5ea --- /dev/null +++ b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf @@ -0,0 +1,291 @@ +// +// Subworkflow with functionality specific to the nf-core/pipeline pipeline +// + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + IMPORT FUNCTIONS / MODULES / SUBWORKFLOWS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +include { UTILS_NFVALIDATION_PLUGIN } from '../../nf-core/utils_nfvalidation_plugin' +include { paramsSummaryMap } from 'plugin/nf-validation' +include { fromSamplesheet } from 'plugin/nf-validation' +include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' +include { completionEmail } from '../../nf-core/utils_nfcore_pipeline' +include { completionSummary } from '../../nf-core/utils_nfcore_pipeline' +include { dashedLine } from '../../nf-core/utils_nfcore_pipeline' +include { nfCoreLogo } from '../../nf-core/utils_nfcore_pipeline' +include { imNotification } from '../../nf-core/utils_nfcore_pipeline' +include { UTILS_NFCORE_PIPELINE } from '../../nf-core/utils_nfcore_pipeline' +include { workflowCitation } from '../../nf-core/utils_nfcore_pipeline' + +/* +======================================================================================== + SUBWORKFLOW TO INITIALISE PIPELINE +======================================================================================== +*/ + +workflow PIPELINE_INITIALISATION { + + take: + version // boolean: Display version and exit + help // boolean: Display help text + validate_params // boolean: Boolean whether to validate parameters against the schema at runtime + monochrome_logs // boolean: Do not use coloured log outputs + nextflow_cli_args // array: List of positional nextflow CLI args + outdir // string: The output directory where the results will be saved + input // string: Path to input samplesheet + + main: + + ch_versions = Channel.empty() + + // + // Print version and exit if required and dump pipeline parameters to JSON file + // + UTILS_NEXTFLOW_PIPELINE ( + version, + true, + outdir, + workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1 + ) + //Detect Protocol setting, set this early before help so help shows proper adapters etc pp + formatProtocol(params,log) + // + // Validate parameters and generate parameter summary to stdout + // + pre_help_text = nfCoreLogo(monochrome_logs) + post_help_text = '\n' + workflowCitation() + '\n' + dashedLine(monochrome_logs) + def String workflow_command = "nextflow run ${workflow.manifest.name} -profile --input samplesheet.csv --outdir " + UTILS_NFVALIDATION_PLUGIN ( + help, + workflow_command, + pre_help_text, + post_help_text, + validate_params, + "nextflow_schema.json" + ) + + // + // Check config provided to the pipeline + // + UTILS_NFCORE_PIPELINE ( + nextflow_cli_args + ) + // + // Custom validation for pipeline parameters + // + validateInputParameters() + + // + // Create channel from input file provided through params.input + // + Channel + .fromSamplesheet("input") + .map { + meta, fastq_1, fastq_2 -> + if (!fastq_2) { + return [ meta.id, meta + [ single_end:true ], [ fastq_1 ] ] + } else { + return [ meta.id, meta + [ single_end:false ], [ fastq_1, fastq_2 ] ] + } + } + .groupTuple() + .map { + validateInputSamplesheet(it) + } + .map { + meta, fastqs -> + return [ meta, fastqs.flatten() ] + } + .set { ch_samplesheet } + + emit: + samplesheet = ch_samplesheet + versions = ch_versions +} + +/* +======================================================================================== + SUBWORKFLOW FOR PIPELINE COMPLETION +======================================================================================== +*/ + +workflow PIPELINE_COMPLETION { + + take: + email // string: email address + email_on_fail // string: email address sent on pipeline failure + plaintext_email // boolean: Send plain-text email instead of HTML + outdir // path: Path to output directory where results will be published + monochrome_logs // boolean: Disable ANSI colour codes in log output + hook_url // string: hook URL for notifications + multiqc_report // string: Path to MultiQC report + + main: + + summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") + + // + // Completion email and summary + // + workflow.onComplete { + if (email || email_on_fail) { + completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs, multiqc_report.toList()) + } + + completionSummary(monochrome_logs) + + if (hook_url) { + imNotification(summary_params, hook_url) + } + } +} + +/* +======================================================================================== + FUNCTIONS +======================================================================================== +*/ +// +// Check and validate pipeline parameters +// +def validateInputParameters() { + genomeExistsError() + +}// +// Validate channels from input samplesheet +// +def validateInputSamplesheet(input) { + def (metas, fastqs) = input[1..2] + + // Check that multiple runs of the same sample are of the same datatype i.e. single-end / paired-end + def endedness_ok = metas.collect{ it.single_end }.unique().size == 1 + if (!endedness_ok) { + error("Please check input samplesheet -> Multiple runs of a sample must be of the same datatype i.e. single-end or paired-end: ${metas[0].id}") + } + + return [ metas[0], fastqs ] +} +// +// Get attribute from genome config file e.g. fasta +// +def getGenomeAttribute(attribute) { + if (params.genomes && params.genome && params.genomes.containsKey(params.genome)) { + if (params.genomes[ params.genome ].containsKey(attribute)) { + return params.genomes[ params.genome ][ attribute ] + } + } + return null +} + +// +// Exit pipeline if incorrect --genome key provided +// +def genomeExistsError() { + if (params.genomes && params.genome && !params.genomes.containsKey(params.genome)) { + def error_string = "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + + " Genome '${params.genome}' not found in any config files provided to the pipeline.\n" + + " Currently, the available genome keys are:\n" + + " ${params.genomes.keySet().join(", ")}\n" + + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + error(error_string) + } +}// +// Generate methods description for MultiQC +// +def toolCitationText() { + // TODO nf-core: Optionally add in-text citation tools to this list. + // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "Tool (Foo et al. 2023)" : "", + // Uncomment function in methodsDescriptionText to render in MultiQC report + def citation_text = [ + "Tools used in the workflow included:", + "FastQC (Andrews 2010),", + "MultiQC (Ewels et al. 2016)", + "." + ].join(' ').trim() + + return citation_text +} + +def toolBibliographyText() { + // TODO nf-core: Optionally add bibliographic entries to this list. + // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "
  • Author (2023) Pub name, Journal, DOI
    • " : "", + // Uncomment function in methodsDescriptionText to render in MultiQC report + def reference_text = [ + "
  • Andrews S, (2010) FastQC, URL: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
    • ", + "
  • Ewels, P., Magnusson, M., Lundin, S., & KΓ€ller, M. (2016). MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics , 32(19), 3047–3048. doi: /10.1093/bioinformatics/btw354
    • " + ].join(' ').trim() + + return reference_text +} + +def methodsDescriptionText(mqc_methods_yaml) { + // Convert to a named map so can be used as with familar NXF ${workflow} variable syntax in the MultiQC YML file + def meta = [:] + meta.workflow = workflow.toMap() + meta["manifest_map"] = workflow.manifest.toMap() + + // Pipeline DOI + meta["doi_text"] = meta.manifest_map.doi ? "(doi: ${meta.manifest_map.doi})" : "" + meta["nodoi_text"] = meta.manifest_map.doi ? "": "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
    • " + + // Tool references + meta["tool_citations"] = "" + meta["tool_bibliography"] = "" + + // TODO nf-core: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled! + // meta["tool_citations"] = toolCitationText().replaceAll(", \\.", ".").replaceAll("\\. \\.", ".").replaceAll(", \\.", ".") + // meta["tool_bibliography"] = toolBibliographyText() + + + def methods_text = mqc_methods_yaml.text + + def engine = new groovy.text.SimpleTemplateEngine() + def description_html = engine.createTemplate(methods_text).make(meta) + + return description_html.toString() +} + +/* +* Format the protocol +* Given the protocol parameter (params.protocol), +* this function formats the protocol such that it is fit for the respective +* subworkflow +*/ +def formatProtocol(params,log) { + + switch(params.protocol){ + case 'illumina': + params.putIfAbsent("clip_r1", 0); + params.putIfAbsent("three_prime_clip_r1",0); + params.putIfAbsent("three_prime_adapter", "TGGAATTCTCGGGTGCCAAGG"); + break + case 'nextflex': + params.putIfAbsent("clip_r1", 4); + params.putIfAbsent("three_prime_clip_r1", 4); + params.putIfAbsent("three_prime_adapter", "TGGAATTCTCGGGTGCCAAGG"); + break + case 'qiaseq': + params.putIfAbsent("clip_r1",0); + params.putIfAbsent("three_prime_clip_r1",0); + params.putIfAbsent("three_prime_adapter","AACTGTAGGCACCATCAAT"); + break + case 'cats': + params.putIfAbsent("clip_r1",3); + params.putIfAbsent("three_prime_clip_r1", 0); + params.putIfAbsent("three_prime_adapter", "AAAAAAAA"); + break + case 'custom': + params.putIfAbsent("clip_r1", params.clip_r1) + params.putIfAbsent("three_prime_clip_r1", params.three_prime_clip_r1) + default: + log.warn "Please make sure to specify all required clipping and trimming parameters, otherwise only adapter detection will be performed." + } + + log.warn "Running with Protocol ${params.protocol}" + log.warn "Therefore using Adapter: ${params.three_prime_adapter}" + log.warn "Clipping ${params.clip_r1} bases from R1" + log.warn "And clipping ${params.three_prime_clip_r1} bases from 3' end" + } diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf new file mode 100644 index 00000000..ac31f28f --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -0,0 +1,126 @@ +// +// Subworkflow with functionality that may be useful for any Nextflow pipeline +// + +import org.yaml.snakeyaml.Yaml +import groovy.json.JsonOutput +import nextflow.extension.FilesEx + +/* +======================================================================================== + SUBWORKFLOW DEFINITION +======================================================================================== +*/ + +workflow UTILS_NEXTFLOW_PIPELINE { + + take: + print_version // boolean: print version + dump_parameters // boolean: dump parameters + outdir // path: base directory used to publish pipeline results + check_conda_channels // boolean: check conda channels + + main: + + // + // Print workflow version and exit on --version + // + if (print_version) { + log.info "${workflow.manifest.name} ${getWorkflowVersion()}" + System.exit(0) + } + + // + // Dump pipeline parameters to a JSON file + // + if (dump_parameters && outdir) { + dumpParametersToJSON(outdir) + } + + // + // When running with Conda, warn if channels have not been set-up appropriately + // + if (check_conda_channels) { + checkCondaChannels() + } + + emit: + dummy_emit = true +} + +/* +======================================================================================== + FUNCTIONS +======================================================================================== +*/ + +// +// Generate version string +// +def getWorkflowVersion() { + String version_string = "" + if (workflow.manifest.version) { + def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' + version_string += "${prefix_v}${workflow.manifest.version}" + } + + if (workflow.commitId) { + def git_shortsha = workflow.commitId.substring(0, 7) + version_string += "-g${git_shortsha}" + } + + return version_string +} + +// +// Dump pipeline parameters to a JSON file +// +def dumpParametersToJSON(outdir) { + def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') + def filename = "params_${timestamp}.json" + def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") + def jsonStr = JsonOutput.toJson(params) + temp_pf.text = JsonOutput.prettyPrint(jsonStr) + + FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") + temp_pf.delete() +} + +// +// When running with -profile conda, warn if channels have not been set-up appropriately +// +def checkCondaChannels() { + Yaml parser = new Yaml() + def channels = [] + try { + def config = parser.load("conda config --show channels".execute().text) + channels = config.channels + } catch(NullPointerException | IOException e) { + log.warn "Could not verify conda channel configuration." + return + } + + // Check that all channels are present + // This channel list is ordered by required channel priority. + def required_channels_in_order = ['conda-forge', 'bioconda', 'defaults'] + def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean + + // Check that they are in the right order + def channel_priority_violation = false + def n = required_channels_in_order.size() + for (int i = 0; i < n - 1; i++) { + channel_priority_violation |= !(channels.indexOf(required_channels_in_order[i]) < channels.indexOf(required_channels_in_order[i+1])) + } + + if (channels_missing | channel_priority_violation) { + log.warn "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + + " There is a problem with your Conda configuration!\n\n" + + " You will need to set-up the conda-forge and bioconda channels correctly.\n" + + " Please refer to https://bioconda.github.io/\n" + + " The observed channel order is \n" + + " ${channels}\n" + + " but the following channel order is required:\n" + + " ${required_channels_in_order}\n" + + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + } +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/meta.yml b/subworkflows/nf-core/utils_nextflow_pipeline/meta.yml new file mode 100644 index 00000000..e5c3a0a8 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/meta.yml @@ -0,0 +1,38 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "UTILS_NEXTFLOW_PIPELINE" +description: Subworkflow with functionality that may be useful for any Nextflow pipeline +keywords: + - utility + - pipeline + - initialise + - version +components: [] +input: + - print_version: + type: boolean + description: | + Print the version of the pipeline and exit + - dump_parameters: + type: boolean + description: | + Dump the parameters of the pipeline to a JSON file + - output_directory: + type: directory + description: Path to output dir to write JSON file to. + pattern: "results/" + - check_conda_channel: + type: boolean + description: | + Check if the conda channel priority is correct. +output: + - dummy_emit: + type: boolean + description: | + Dummy emit to make nf-core subworkflows lint happy +authors: + - "@adamrtalbot" + - "@drpatelh" +maintainers: + - "@adamrtalbot" + - "@drpatelh" + - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test new file mode 100644 index 00000000..8ed4310c --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test @@ -0,0 +1,54 @@ + +nextflow_function { + + name "Test Functions" + script "subworkflows/nf-core/utils_nextflow_pipeline/main.nf" + config "subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config" + tag 'subworkflows' + tag 'utils_nextflow_pipeline' + tag 'subworkflows/utils_nextflow_pipeline' + + test("Test Function getWorkflowVersion") { + + function "getWorkflowVersion" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function dumpParametersToJSON") { + + function "dumpParametersToJSON" + + when { + function { + """ + // define inputs of the function here. Example: + input[0] = "$outputDir" + """.stripIndent() + } + } + + then { + assertAll( + { assert function.success } + ) + } + } + + test("Test Function checkCondaChannels") { + + function "checkCondaChannels" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap new file mode 100644 index 00000000..db2030f8 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap @@ -0,0 +1,12 @@ +{ + "Test Function getWorkflowVersion": { + "content": [ + "v9.9.9" + ], + "timestamp": "2024-01-19T11:32:36.031083" + }, + "Test Function checkCondaChannels": { + "content": null, + "timestamp": "2024-01-19T11:32:50.456" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test new file mode 100644 index 00000000..f7c54bc6 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test @@ -0,0 +1,123 @@ +nextflow_workflow { + + name "Test Workflow UTILS_NEXTFLOW_PIPELINE" + script "../main.nf" + config "subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config" + workflow "UTILS_NEXTFLOW_PIPELINE" + tag 'subworkflows' + tag 'utils_nextflow_pipeline' + tag 'subworkflows/utils_nextflow_pipeline' + + test("Should run no inputs") { + + when { + params { + outdir = "tests/results" + } + workflow { + """ + print_version = false + dump_parameters = false + outdir = null + check_conda_channels = false + + input[0] = print_version + input[1] = dump_parameters + input[2] = outdir + input[3] = check_conda_channels + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should print version") { + + when { + params { + outdir = "tests/results" + } + workflow { + """ + print_version = true + dump_parameters = false + outdir = null + check_conda_channels = false + + input[0] = print_version + input[1] = dump_parameters + input[2] = outdir + input[3] = check_conda_channels + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert workflow.stdout.contains("nextflow_workflow v9.9.9") } + ) + } + } + + test("Should dump params") { + + when { + params { + outdir = "$outputDir" + } + workflow { + """ + print_version = false + dump_parameters = true + outdir = params.outdir + check_conda_channels = false + + input[0] = false + input[1] = true + input[2] = params.outdir + input[3] = false + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should not create params JSON if no output directory") { + + when { + params { + outdir = "$outputDir" + } + workflow { + """ + print_version = false + dump_parameters = true + outdir = params.outdir + check_conda_channels = false + + input[0] = false + input[1] = true + input[2] = null + input[3] = false + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config new file mode 100644 index 00000000..53574ffe --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config @@ -0,0 +1,9 @@ +manifest { + name = 'nextflow_workflow' + author = """nf-core""" + homePage = 'https://127.0.0.1' + description = """Dummy pipeline""" + nextflowVersion = '!>=23.04.0' + version = '9.9.9' + doi = 'https://doi.org/10.5281/zenodo.5070524' +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml b/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml new file mode 100644 index 00000000..f8476112 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/utils_nextflow_pipeline: + - subworkflows/nf-core/utils_nextflow_pipeline/** diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf new file mode 100644 index 00000000..a8b55d6f --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -0,0 +1,440 @@ +// +// Subworkflow with utility functions specific to the nf-core pipeline template +// + +import org.yaml.snakeyaml.Yaml +import nextflow.extension.FilesEx + +/* +======================================================================================== + SUBWORKFLOW DEFINITION +======================================================================================== +*/ + +workflow UTILS_NFCORE_PIPELINE { + + take: + nextflow_cli_args + + main: + valid_config = checkConfigProvided() + checkProfileProvided(nextflow_cli_args) + + emit: + valid_config +} + +/* +======================================================================================== + FUNCTIONS +======================================================================================== +*/ + +// +// Warn if a -profile or Nextflow config has not been provided to run the pipeline +// +def checkConfigProvided() { + valid_config = true + if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { + log.warn "[$workflow.manifest.name] You are attempting to run the pipeline without any custom configuration!\n\n" + + "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + + " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + + " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + + " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + + "Please refer to the quick start section and usage docs for the pipeline.\n " + valid_config = false + } + return valid_config +} + +// +// Exit pipeline if --profile contains spaces +// +def checkProfileProvided(nextflow_cli_args) { + if (workflow.profile.endsWith(',')) { + error "The `-profile` option cannot end with a trailing comma, please remove it and re-run the pipeline!\n" + + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + } + if (nextflow_cli_args[0]) { + log.warn "nf-core pipelines do not accept positional arguments. The positional argument `${nextflow_cli_args[0]}` has been detected.\n" + + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + } +} + +// +// Citation string for pipeline +// +def workflowCitation() { + return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + + "* The pipeline\n" + + " ${workflow.manifest.doi}\n\n" + + "* The nf-core framework\n" + + " https://doi.org/10.1038/s41587-020-0439-x\n\n" + + "* Software dependencies\n" + + " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" +} + +// +// Generate workflow version string +// +def getWorkflowVersion() { + String version_string = "" + if (workflow.manifest.version) { + def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' + version_string += "${prefix_v}${workflow.manifest.version}" + } + + if (workflow.commitId) { + def git_shortsha = workflow.commitId.substring(0, 7) + version_string += "-g${git_shortsha}" + } + + return version_string +} + +// +// Get software versions for pipeline +// +def processVersionsFromYAML(yaml_file) { + Yaml yaml = new Yaml() + versions = yaml.load(yaml_file).collectEntries { k, v -> [ k.tokenize(':')[-1], v ] } + return yaml.dumpAsMap(versions).trim() +} + +// +// Get workflow version for pipeline +// +def workflowVersionToYAML() { + return """ + Workflow: + $workflow.manifest.name: ${getWorkflowVersion()} + Nextflow: $workflow.nextflow.version + """.stripIndent().trim() +} + +// +// Get channel of software versions used in pipeline in YAML format +// +def softwareVersionsToYAML(ch_versions) { + return ch_versions + .unique() + .map { processVersionsFromYAML(it) } + .unique() + .mix(Channel.of(workflowVersionToYAML())) +} + +// +// Get workflow summary for MultiQC +// +def paramsSummaryMultiqc(summary_params) { + def summary_section = '' + for (group in summary_params.keySet()) { + def group_params = summary_params.get(group) // This gets the parameters of that particular group + if (group_params) { + summary_section += "

    $group

    \n" + summary_section += "
    \n" + for (param in group_params.keySet()) { + summary_section += "
    $param
    ${group_params.get(param) ?: 'N/A'}
    \n" + } + summary_section += "
    \n" + } + } + + String yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" + yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" + yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" + yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" + yaml_file_text += "plot_type: 'html'\n" + yaml_file_text += "data: |\n" + yaml_file_text += "${summary_section}" + + return yaml_file_text +} + +// +// nf-core logo +// +def nfCoreLogo(monochrome_logs=true) { + Map colors = logColours(monochrome_logs) + String.format( + """\n + ${dashedLine(monochrome_logs)} + ${colors.green},--.${colors.black}/${colors.green},-.${colors.reset} + ${colors.blue} ___ __ __ __ ___ ${colors.green}/,-._.--~\'${colors.reset} + ${colors.blue} |\\ | |__ __ / ` / \\ |__) |__ ${colors.yellow}} {${colors.reset} + ${colors.blue} | \\| | \\__, \\__/ | \\ |___ ${colors.green}\\`-._,-`-,${colors.reset} + ${colors.green}`._,._,\'${colors.reset} + ${colors.purple} ${workflow.manifest.name} ${getWorkflowVersion()}${colors.reset} + ${dashedLine(monochrome_logs)} + """.stripIndent() + ) +} + +// +// Return dashed line +// +def dashedLine(monochrome_logs=true) { + Map colors = logColours(monochrome_logs) + return "-${colors.dim}----------------------------------------------------${colors.reset}-" +} + +// +// ANSII colours used for terminal logging +// +def logColours(monochrome_logs=true) { + Map colorcodes = [:] + + // Reset / Meta + colorcodes['reset'] = monochrome_logs ? '' : "\033[0m" + colorcodes['bold'] = monochrome_logs ? '' : "\033[1m" + colorcodes['dim'] = monochrome_logs ? '' : "\033[2m" + colorcodes['underlined'] = monochrome_logs ? '' : "\033[4m" + colorcodes['blink'] = monochrome_logs ? '' : "\033[5m" + colorcodes['reverse'] = monochrome_logs ? '' : "\033[7m" + colorcodes['hidden'] = monochrome_logs ? '' : "\033[8m" + + // Regular Colors + colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" + colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" + colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" + colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" + colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" + colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" + colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" + colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" + + // Bold + colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" + colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" + colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" + colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" + colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" + colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" + colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" + colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" + + // Underline + colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" + colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" + colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" + colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" + colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" + colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" + colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" + colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" + + // High Intensity + colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" + colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" + colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" + colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" + colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" + colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" + colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" + colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" + + // Bold High Intensity + colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" + colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" + colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" + colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" + colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" + colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" + colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" + colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" + + return colorcodes +} + +// +// Attach the multiqc report to email +// +def attachMultiqcReport(multiqc_report) { + def mqc_report = null + try { + if (workflow.success) { + mqc_report = multiqc_report.getVal() + if (mqc_report.getClass() == ArrayList && mqc_report.size() >= 1) { + if (mqc_report.size() > 1) { + log.warn "[$workflow.manifest.name] Found multiple reports from process 'MULTIQC', will use only one" + } + mqc_report = mqc_report[0] + } + } + } catch (all) { + if (multiqc_report) { + log.warn "[$workflow.manifest.name] Could not attach MultiQC report to summary email" + } + } + return mqc_report +} + +// +// Construct and send completion email +// +def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs=true, multiqc_report=null) { + + // Set up the e-mail variables + def subject = "[$workflow.manifest.name] Successful: $workflow.runName" + if (!workflow.success) { + subject = "[$workflow.manifest.name] FAILED: $workflow.runName" + } + + def summary = [:] + for (group in summary_params.keySet()) { + summary << summary_params[group] + } + + def misc_fields = [:] + misc_fields['Date Started'] = workflow.start + misc_fields['Date Completed'] = workflow.complete + misc_fields['Pipeline script file path'] = workflow.scriptFile + misc_fields['Pipeline script hash ID'] = workflow.scriptId + if (workflow.repository) misc_fields['Pipeline repository Git URL'] = workflow.repository + if (workflow.commitId) misc_fields['Pipeline repository Git Commit'] = workflow.commitId + if (workflow.revision) misc_fields['Pipeline Git branch/tag'] = workflow.revision + misc_fields['Nextflow Version'] = workflow.nextflow.version + misc_fields['Nextflow Build'] = workflow.nextflow.build + misc_fields['Nextflow Compile Timestamp'] = workflow.nextflow.timestamp + + def email_fields = [:] + email_fields['version'] = getWorkflowVersion() + email_fields['runName'] = workflow.runName + email_fields['success'] = workflow.success + email_fields['dateComplete'] = workflow.complete + email_fields['duration'] = workflow.duration + email_fields['exitStatus'] = workflow.exitStatus + email_fields['errorMessage'] = (workflow.errorMessage ?: 'None') + email_fields['errorReport'] = (workflow.errorReport ?: 'None') + email_fields['commandLine'] = workflow.commandLine + email_fields['projectDir'] = workflow.projectDir + email_fields['summary'] = summary << misc_fields + + // On success try attach the multiqc report + def mqc_report = attachMultiqcReport(multiqc_report) + + // Check if we are only sending emails on failure + def email_address = email + if (!email && email_on_fail && !workflow.success) { + email_address = email_on_fail + } + + // Render the TXT template + def engine = new groovy.text.GStringTemplateEngine() + def tf = new File("${workflow.projectDir}/assets/email_template.txt") + def txt_template = engine.createTemplate(tf).make(email_fields) + def email_txt = txt_template.toString() + + // Render the HTML template + def hf = new File("${workflow.projectDir}/assets/email_template.html") + def html_template = engine.createTemplate(hf).make(email_fields) + def email_html = html_template.toString() + + // Render the sendmail template + def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit + def smail_fields = [ email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes() ] + def sf = new File("${workflow.projectDir}/assets/sendmail_template.txt") + def sendmail_template = engine.createTemplate(sf).make(smail_fields) + def sendmail_html = sendmail_template.toString() + + // Send the HTML e-mail + Map colors = logColours(monochrome_logs) + if (email_address) { + try { + if (plaintext_email) { throw GroovyException('Send plaintext e-mail, not HTML') } + // Try to send HTML e-mail using sendmail + def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") + sendmail_tf.withWriter { w -> w << sendmail_html } + [ 'sendmail', '-t' ].execute() << sendmail_html + log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (sendmail)-" + } catch (all) { + // Catch failures and try with plaintext + def mail_cmd = [ 'mail', '-s', subject, '--content-type=text/html', email_address ] + mail_cmd.execute() << email_html + log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (mail)-" + } + } + + // Write summary e-mail HTML to a file + def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") + output_hf.withWriter { w -> w << email_html } + FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html"); + output_hf.delete() + + // Write summary e-mail TXT to a file + def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") + output_tf.withWriter { w -> w << email_txt } + FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt"); + output_tf.delete() +} + +// +// Print pipeline summary on completion +// +def completionSummary(monochrome_logs=true) { + Map colors = logColours(monochrome_logs) + if (workflow.success) { + if (workflow.stats.ignoredCount == 0) { + log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Pipeline completed successfully${colors.reset}-" + } else { + log.info "-${colors.purple}[$workflow.manifest.name]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-" + } + } else { + log.info "-${colors.purple}[$workflow.manifest.name]${colors.red} Pipeline completed with errors${colors.reset}-" + } +} + +// +// Construct and send a notification to a web server as JSON e.g. Microsoft Teams and Slack +// +def imNotification(summary_params, hook_url) { + def summary = [:] + for (group in summary_params.keySet()) { + summary << summary_params[group] + } + + def misc_fields = [:] + misc_fields['start'] = workflow.start + misc_fields['complete'] = workflow.complete + misc_fields['scriptfile'] = workflow.scriptFile + misc_fields['scriptid'] = workflow.scriptId + if (workflow.repository) misc_fields['repository'] = workflow.repository + if (workflow.commitId) misc_fields['commitid'] = workflow.commitId + if (workflow.revision) misc_fields['revision'] = workflow.revision + misc_fields['nxf_version'] = workflow.nextflow.version + misc_fields['nxf_build'] = workflow.nextflow.build + misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp + + def msg_fields = [:] + msg_fields['version'] = getWorkflowVersion() + msg_fields['runName'] = workflow.runName + msg_fields['success'] = workflow.success + msg_fields['dateComplete'] = workflow.complete + msg_fields['duration'] = workflow.duration + msg_fields['exitStatus'] = workflow.exitStatus + msg_fields['errorMessage'] = (workflow.errorMessage ?: 'None') + msg_fields['errorReport'] = (workflow.errorReport ?: 'None') + msg_fields['commandLine'] = workflow.commandLine.replaceFirst(/ +--hook_url +[^ ]+/, "") + msg_fields['projectDir'] = workflow.projectDir + msg_fields['summary'] = summary << misc_fields + + // Render the JSON template + def engine = new groovy.text.GStringTemplateEngine() + // Different JSON depending on the service provider + // Defaults to "Adaptive Cards" (https://adaptivecards.io), except Slack which has its own format + def json_path = hook_url.contains("hooks.slack.com") ? "slackreport.json" : "adaptivecard.json" + def hf = new File("${workflow.projectDir}/assets/${json_path}") + def json_template = engine.createTemplate(hf).make(msg_fields) + def json_message = json_template.toString() + + // POST + def post = new URL(hook_url).openConnection(); + post.setRequestMethod("POST") + post.setDoOutput(true) + post.setRequestProperty("Content-Type", "application/json") + post.getOutputStream().write(json_message.getBytes("UTF-8")); + def postRC = post.getResponseCode(); + if (! postRC.equals(200)) { + log.warn(post.getErrorStream().getText()); + } +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/meta.yml b/subworkflows/nf-core/utils_nfcore_pipeline/meta.yml new file mode 100644 index 00000000..d08d2434 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/meta.yml @@ -0,0 +1,24 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "UTILS_NFCORE_PIPELINE" +description: Subworkflow with utility functions specific to the nf-core pipeline template +keywords: + - utility + - pipeline + - initialise + - version +components: [] +input: + - nextflow_cli_args: + type: list + description: | + Nextflow CLI positional arguments +output: + - success: + type: boolean + description: | + Dummy output to indicate success +authors: + - "@adamrtalbot" +maintainers: + - "@adamrtalbot" + - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test new file mode 100644 index 00000000..1dc317f8 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test @@ -0,0 +1,134 @@ + +nextflow_function { + + name "Test Functions" + script "../main.nf" + config "subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "utils_nfcore_pipeline" + tag "subworkflows/utils_nfcore_pipeline" + + test("Test Function checkConfigProvided") { + + function "checkConfigProvided" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function checkProfileProvided") { + + function "checkProfileProvided" + + when { + function { + """ + input[0] = [] + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function workflowCitation") { + + function "workflowCitation" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function nfCoreLogo") { + + function "nfCoreLogo" + + when { + function { + """ + input[0] = false + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function dashedLine") { + + function "dashedLine" + + when { + function { + """ + input[0] = false + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function without logColours") { + + function "logColours" + + when { + function { + """ + input[0] = true + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function with logColours") { + function "logColours" + + when { + function { + """ + input[0] = false + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap new file mode 100644 index 00000000..10f948e6 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap @@ -0,0 +1,138 @@ +{ + "Test Function checkProfileProvided": { + "content": null, + "timestamp": "2024-02-09T15:43:55.145717" + }, + "Test Function checkConfigProvided": { + "content": [ + true + ], + "timestamp": "2024-01-19T11:34:13.548431224" + }, + "Test Function nfCoreLogo": { + "content": [ + "\n\n-\u001b[2m----------------------------------------------------\u001b[0m-\n \u001b[0;32m,--.\u001b[0;30m/\u001b[0;32m,-.\u001b[0m\n\u001b[0;34m ___ __ __ __ ___ \u001b[0;32m/,-._.--~'\u001b[0m\n\u001b[0;34m |\\ | |__ __ / ` / \\ |__) |__ \u001b[0;33m} {\u001b[0m\n\u001b[0;34m | \\| | \\__, \\__/ | \\ |___ \u001b[0;32m\\`-._,-`-,\u001b[0m\n \u001b[0;32m`._,._,'\u001b[0m\n\u001b[0;35m nextflow_workflow v9.9.9\u001b[0m\n-\u001b[2m----------------------------------------------------\u001b[0m-\n" + ], + "timestamp": "2024-01-19T11:34:38.840454873" + }, + "Test Function workflowCitation": { + "content": [ + "If you use nextflow_workflow for your analysis please cite:\n\n* The pipeline\n https://doi.org/10.5281/zenodo.5070524\n\n* The nf-core framework\n https://doi.org/10.1038/s41587-020-0439-x\n\n* Software dependencies\n https://github.com/nextflow_workflow/blob/master/CITATIONS.md" + ], + "timestamp": "2024-01-19T11:34:22.24352016" + }, + "Test Function without logColours": { + "content": [ + { + "reset": "", + "bold": "", + "dim": "", + "underlined": "", + "blink": "", + "reverse": "", + "hidden": "", + "black": "", + "red": "", + "green": "", + "yellow": "", + "blue": "", + "purple": "", + "cyan": "", + "white": "", + "bblack": "", + "bred": "", + "bgreen": "", + "byellow": "", + "bblue": "", + "bpurple": "", + "bcyan": "", + "bwhite": "", + "ublack": "", + "ured": "", + "ugreen": "", + "uyellow": "", + "ublue": "", + "upurple": "", + "ucyan": "", + "uwhite": "", + "iblack": "", + "ired": "", + "igreen": "", + "iyellow": "", + "iblue": "", + "ipurple": "", + "icyan": "", + "iwhite": "", + "biblack": "", + "bired": "", + "bigreen": "", + "biyellow": "", + "biblue": "", + "bipurple": "", + "bicyan": "", + "biwhite": "" + } + ], + "timestamp": "2024-01-19T11:35:04.418416984" + }, + "Test Function dashedLine": { + "content": [ + "-\u001b[2m----------------------------------------------------\u001b[0m-" + ], + "timestamp": "2024-01-19T11:34:55.420000755" + }, + "Test Function with logColours": { + "content": [ + { + "reset": "\u001b[0m", + "bold": "\u001b[1m", + "dim": "\u001b[2m", + "underlined": "\u001b[4m", + "blink": "\u001b[5m", + "reverse": "\u001b[7m", + "hidden": "\u001b[8m", + "black": "\u001b[0;30m", + "red": "\u001b[0;31m", + "green": "\u001b[0;32m", + "yellow": "\u001b[0;33m", + "blue": "\u001b[0;34m", + "purple": "\u001b[0;35m", + "cyan": "\u001b[0;36m", + "white": "\u001b[0;37m", + "bblack": "\u001b[1;30m", + "bred": "\u001b[1;31m", + "bgreen": "\u001b[1;32m", + "byellow": "\u001b[1;33m", + "bblue": "\u001b[1;34m", + "bpurple": "\u001b[1;35m", + "bcyan": "\u001b[1;36m", + "bwhite": "\u001b[1;37m", + "ublack": "\u001b[4;30m", + "ured": "\u001b[4;31m", + "ugreen": "\u001b[4;32m", + "uyellow": "\u001b[4;33m", + "ublue": "\u001b[4;34m", + "upurple": "\u001b[4;35m", + "ucyan": "\u001b[4;36m", + "uwhite": "\u001b[4;37m", + "iblack": "\u001b[0;90m", + "ired": "\u001b[0;91m", + "igreen": "\u001b[0;92m", + "iyellow": "\u001b[0;93m", + "iblue": "\u001b[0;94m", + "ipurple": "\u001b[0;95m", + "icyan": "\u001b[0;96m", + "iwhite": "\u001b[0;97m", + "biblack": "\u001b[1;90m", + "bired": "\u001b[1;91m", + "bigreen": "\u001b[1;92m", + "biyellow": "\u001b[1;93m", + "biblue": "\u001b[1;94m", + "bipurple": "\u001b[1;95m", + "bicyan": "\u001b[1;96m", + "biwhite": "\u001b[1;97m" + } + ], + "timestamp": "2024-01-19T11:35:13.436366565" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test new file mode 100644 index 00000000..8940d32d --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test @@ -0,0 +1,29 @@ +nextflow_workflow { + + name "Test Workflow UTILS_NFCORE_PIPELINE" + script "../main.nf" + config "subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config" + workflow "UTILS_NFCORE_PIPELINE" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "utils_nfcore_pipeline" + tag "subworkflows/utils_nfcore_pipeline" + + test("Should run without failures") { + + when { + workflow { + """ + input[0] = [] + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap new file mode 100644 index 00000000..d07ce54c --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap @@ -0,0 +1,15 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + true + ], + "valid_config": [ + true + ] + } + ], + "timestamp": "2024-01-19T11:35:22.538940073" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config new file mode 100644 index 00000000..d0a926bf --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config @@ -0,0 +1,9 @@ +manifest { + name = 'nextflow_workflow' + author = """nf-core""" + homePage = 'https://127.0.0.1' + description = """Dummy pipeline""" + nextflowVersion = '!>=23.04.0' + version = '9.9.9' + doi = 'https://doi.org/10.5281/zenodo.5070524' +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml b/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml new file mode 100644 index 00000000..ac8523c9 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/utils_nfcore_pipeline: + - subworkflows/nf-core/utils_nfcore_pipeline/** diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf b/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf new file mode 100644 index 00000000..2585b65d --- /dev/null +++ b/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf @@ -0,0 +1,62 @@ +// +// Subworkflow that uses the nf-validation plugin to render help text and parameter summary +// + +/* +======================================================================================== + IMPORT NF-VALIDATION PLUGIN +======================================================================================== +*/ + +include { paramsHelp } from 'plugin/nf-validation' +include { paramsSummaryLog } from 'plugin/nf-validation' +include { validateParameters } from 'plugin/nf-validation' + +/* +======================================================================================== + SUBWORKFLOW DEFINITION +======================================================================================== +*/ + +workflow UTILS_NFVALIDATION_PLUGIN { + + take: + print_help // boolean: print help + workflow_command // string: default commmand used to run pipeline + pre_help_text // string: string to be printed before help text and summary log + post_help_text // string: string to be printed after help text and summary log + validate_params // boolean: validate parameters + schema_filename // path: JSON schema file, null to use default value + + main: + + log.debug "Using schema file: ${schema_filename}" + + // Default values for strings + pre_help_text = pre_help_text ?: '' + post_help_text = post_help_text ?: '' + workflow_command = workflow_command ?: '' + + // + // Print help message if needed + // + if (print_help) { + log.info pre_help_text + paramsHelp(workflow_command, parameters_schema: schema_filename) + post_help_text + System.exit(0) + } + + // + // Print parameter summary to stdout + // + log.info pre_help_text + paramsSummaryLog(workflow, parameters_schema: schema_filename) + post_help_text + + // + // Validate parameters relative to the parameter JSON schema + // + if (validate_params){ + validateParameters(parameters_schema: schema_filename) + } + + emit: + dummy_emit = true +} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml b/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml new file mode 100644 index 00000000..3d4a6b04 --- /dev/null +++ b/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml @@ -0,0 +1,44 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "UTILS_NFVALIDATION_PLUGIN" +description: Use nf-validation to initiate and validate a pipeline +keywords: + - utility + - pipeline + - initialise + - validation +components: [] +input: + - print_help: + type: boolean + description: | + Print help message and exit + - workflow_command: + type: string + description: | + The command to run the workflow e.g. "nextflow run main.nf" + - pre_help_text: + type: string + description: | + Text to print before the help message + - post_help_text: + type: string + description: | + Text to print after the help message + - validate_params: + type: boolean + description: | + Validate the parameters and error if invalid. + - schema_filename: + type: string + description: | + The filename of the schema to validate against. +output: + - dummy_emit: + type: boolean + description: | + Dummy emit to make nf-core subworkflows lint happy +authors: + - "@adamrtalbot" +maintainers: + - "@adamrtalbot" + - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test new file mode 100644 index 00000000..517ee54e --- /dev/null +++ b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test @@ -0,0 +1,200 @@ +nextflow_workflow { + + name "Test Workflow UTILS_NFVALIDATION_PLUGIN" + script "../main.nf" + workflow "UTILS_NFVALIDATION_PLUGIN" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "plugin/nf-validation" + tag "'plugin/nf-validation'" + tag "utils_nfvalidation_plugin" + tag "subworkflows/utils_nfvalidation_plugin" + + test("Should run nothing") { + + when { + + params { + monochrome_logs = true + test_data = '' + } + + workflow { + """ + help = false + workflow_command = null + pre_help_text = null + post_help_text = null + validate_params = false + schema_filename = "$moduleTestDir/nextflow_schema.json" + + input[0] = help + input[1] = workflow_command + input[2] = pre_help_text + input[3] = post_help_text + input[4] = validate_params + input[5] = schema_filename + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should run help") { + + + when { + + params { + monochrome_logs = true + test_data = '' + } + workflow { + """ + help = true + workflow_command = null + pre_help_text = null + post_help_text = null + validate_params = false + schema_filename = "$moduleTestDir/nextflow_schema.json" + + input[0] = help + input[1] = workflow_command + input[2] = pre_help_text + input[3] = post_help_text + input[4] = validate_params + input[5] = schema_filename + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert workflow.exitStatus == 0 }, + { assert workflow.stdout.any { it.contains('Input/output options') } }, + { assert workflow.stdout.any { it.contains('--outdir') } } + ) + } + } + + test("Should run help with command") { + + when { + + params { + monochrome_logs = true + test_data = '' + } + workflow { + """ + help = true + workflow_command = "nextflow run noorg/doesntexist" + pre_help_text = null + post_help_text = null + validate_params = false + schema_filename = "$moduleTestDir/nextflow_schema.json" + + input[0] = help + input[1] = workflow_command + input[2] = pre_help_text + input[3] = post_help_text + input[4] = validate_params + input[5] = schema_filename + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert workflow.exitStatus == 0 }, + { assert workflow.stdout.any { it.contains('nextflow run noorg/doesntexist') } }, + { assert workflow.stdout.any { it.contains('Input/output options') } }, + { assert workflow.stdout.any { it.contains('--outdir') } } + ) + } + } + + test("Should run help with extra text") { + + + when { + + params { + monochrome_logs = true + test_data = '' + } + workflow { + """ + help = true + workflow_command = "nextflow run noorg/doesntexist" + pre_help_text = "pre-help-text" + post_help_text = "post-help-text" + validate_params = false + schema_filename = "$moduleTestDir/nextflow_schema.json" + + input[0] = help + input[1] = workflow_command + input[2] = pre_help_text + input[3] = post_help_text + input[4] = validate_params + input[5] = schema_filename + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert workflow.exitStatus == 0 }, + { assert workflow.stdout.any { it.contains('pre-help-text') } }, + { assert workflow.stdout.any { it.contains('nextflow run noorg/doesntexist') } }, + { assert workflow.stdout.any { it.contains('Input/output options') } }, + { assert workflow.stdout.any { it.contains('--outdir') } }, + { assert workflow.stdout.any { it.contains('post-help-text') } } + ) + } + } + + test("Should validate params") { + + when { + + params { + monochrome_logs = true + test_data = '' + outdir = 1 + } + workflow { + """ + help = false + workflow_command = null + pre_help_text = null + post_help_text = null + validate_params = true + schema_filename = "$moduleTestDir/nextflow_schema.json" + + input[0] = help + input[1] = workflow_command + input[2] = pre_help_text + input[3] = post_help_text + input[4] = validate_params + input[5] = schema_filename + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ ERROR: Validation of pipeline parameters failed!') } } + ) + } + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json new file mode 100644 index 00000000..7626c1c9 --- /dev/null +++ b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json @@ -0,0 +1,96 @@ +{ + "$schema": "http://json-schema.org/draft-07/schema", + "$id": "https://raw.githubusercontent.com/./master/nextflow_schema.json", + "title": ". pipeline parameters", + "description": "", + "type": "object", + "definitions": { + "input_output_options": { + "title": "Input/output options", + "type": "object", + "fa_icon": "fas fa-terminal", + "description": "Define where the pipeline should find input data and save output data.", + "required": ["outdir"], + "properties": { + "validate_params": { + "type": "boolean", + "description": "Validate parameters?", + "default": true, + "hidden": true + }, + "outdir": { + "type": "string", + "format": "directory-path", + "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.", + "fa_icon": "fas fa-folder-open" + }, + "test_data_base": { + "type": "string", + "default": "https://raw.githubusercontent.com/nf-core/test-datasets/modules", + "description": "Base for test data directory", + "hidden": true + }, + "test_data": { + "type": "string", + "description": "Fake test data param", + "hidden": true + } + } + }, + "generic_options": { + "title": "Generic options", + "type": "object", + "fa_icon": "fas fa-file-import", + "description": "Less common options for the pipeline, typically set in a config file.", + "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", + "properties": { + "help": { + "type": "boolean", + "description": "Display help text.", + "fa_icon": "fas fa-question-circle", + "hidden": true + }, + "version": { + "type": "boolean", + "description": "Display version and exit.", + "fa_icon": "fas fa-question-circle", + "hidden": true + }, + "logo": { + "type": "boolean", + "default": true, + "description": "Display nf-core logo in console output.", + "fa_icon": "fas fa-image", + "hidden": true + }, + "singularity_pull_docker_container": { + "type": "boolean", + "description": "Pull Singularity container from Docker?", + "hidden": true + }, + "publish_dir_mode": { + "type": "string", + "default": "copy", + "description": "Method used to save pipeline results to output directory.", + "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.", + "fa_icon": "fas fa-copy", + "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"], + "hidden": true + }, + "monochrome_logs": { + "type": "boolean", + "description": "Use monochrome_logs", + "hidden": true + } + } + } + }, + "allOf": [ + { + "$ref": "#/definitions/input_output_options" + }, + { + "$ref": "#/definitions/generic_options" + } + ] +} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml new file mode 100644 index 00000000..60b1cfff --- /dev/null +++ b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/utils_nfvalidation_plugin: + - subworkflows/nf-core/utils_nfvalidation_plugin/** diff --git a/workflows/smrnaseq.nf b/workflows/smrnaseq.nf index bf7b4c49..9252fec0 100644 --- a/workflows/smrnaseq.nf +++ b/workflows/smrnaseq.nf @@ -1,38 +1,25 @@ /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - PRINT PARAMS SUMMARY + IMPORT MODULES / SUBWORKFLOWS / FUNCTIONS ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ - -include { paramsSummaryLog; paramsSummaryMap } from 'plugin/nf-validation' - -def logo = NfcoreTemplate.logo(workflow, params.monochrome_logs) -def citation = '\n' + WorkflowMain.citation(workflow) + '\n' -def summary_params = paramsSummaryMap(workflow) - -// Print parameter summary log to screen -log.info logo + paramsSummaryLog(workflow) + citation - - -WorkflowSmrnaseq.initialise(params, log) - -// Check input path parameters to see if they exist -def checkPathParamList = [ - params.input, - params.multiqc_config -] -for (param in checkPathParamList) { if (param) { file(param, checkIfExists: true) } } - -WorkflowSmrnaseq.initialise(params, log) - -// Check optional parameters -if (!params.mirtrace_species) { - exit 1, "Reference species for miRTrace is not defined via the --mirtrace_species parameter." -} - -// Genome options -def mirna_gtf_from_species = params.mirtrace_species ? "https://mirbase.org/download/CURRENT/genomes/${params.mirtrace_species}.gff3" : false -def mirna_gtf = params.mirna_gtf ?: mirna_gtf_from_species +include { CAT_FASTQ } from '../modules/nf-core/cat/fastq/main' +include { CONTAMINANT_FILTER } from '../subworkflows/local/contaminant_filter' +include { FASTQC } from '../modules/nf-core/fastqc/main' +include { FASTQ_FASTQC_UMITOOLS_FASTP } from '../subworkflows/nf-core/fastq_fastqc_umitools_fastp' +include { FASTP as FASTP_LENGTH_FILTER } from '../modules/nf-core/fastp' +include { GENOME_QUANT } from '../subworkflows/local/genome_quant' +include { INDEX_GENOME } from '../modules/local/bowtie_genome' +include { MIRNA_QUANT } from '../subworkflows/local/mirna_quant' +include { MIRDEEP2 } from '../subworkflows/local/mirdeep2' +include { MIRTRACE } from '../subworkflows/local/mirtrace' +include { MULTIQC } from '../modules/nf-core/multiqc/main' +include { UMICOLLAPSE as UMICOLLAPSE_FASTQ } from '../modules/nf-core/umicollapse/main' +include { UMITOOLS_EXTRACT } from '../modules/nf-core/umitools/extract/main' +include { UNTARFILES as UNTAR_BOWTIE_INDEX } from '../modules/nf-core/untarfiles' +include { paramsSummaryMap } from 'plugin/nf-validation' +include { paramsSummaryMultiqc } from '../subworkflows/nf-core/utils_nfcore_pipeline' +include { softwareVersionsToYAML } from '../subworkflows/nf-core/utils_nfcore_pipeline' /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -40,56 +27,10 @@ def mirna_gtf = params.mirna_gtf ?: mirna_gtf_from_species ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -ch_multiqc_config = Channel.fromPath("$projectDir/assets/multiqc_config.yml", checkIfExists: true) -ch_multiqc_custom_config = params.multiqc_config ? Channel.fromPath( params.multiqc_config, checkIfExists: true ) : Channel.empty() -ch_multiqc_logo = params.multiqc_logo ? Channel.fromPath( params.multiqc_logo, checkIfExists: true ) : Channel.empty() -ch_multiqc_custom_methods_description = params.multiqc_methods_description ? file(params.multiqc_methods_description, checkIfExists: true) : file("$projectDir/assets/methods_description_template.yml", checkIfExists: true) -ch_fastp_adapters = Channel.fromPath(params.fastp_known_mirna_adapters, checkIfExists: true).collect() // collect to consume for all incoming samples to FASTP - -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - IMPORT LOCAL MODULES/SUBWORKFLOWS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ - -// -// SUBWORKFLOW: Consisting of a mix of local and nf-core/modules -// -if (!params.mirgenedb) { - if (params.mature) { reference_mature = file(params.mature, checkIfExists: true) } else { exit 1, "Mature miRNA fasta file not found: ${params.mature}" } - if (params.hairpin) { reference_hairpin = file(params.hairpin, checkIfExists: true) } else { exit 1, "Hairpin miRNA fasta file not found: ${params.hairpin}" } -} else { - if (params.mirgenedb_mature) { reference_mature = file(params.mirgenedb_mature, checkIfExists: true) } else { exit 1, "Mature miRNA fasta file not found: ${params.mirgenedb_mature}" } - if (params.mirgenedb_hairpin) { reference_hairpin = file(params.mirgenedb_hairpin, checkIfExists: true) } else { exit 1, "Hairpin miRNA fasta file not found: ${params.mirgenedb_hairpin}" } - if (params.mirgenedb_gff) { mirna_gtf = file(params.mirgenedb_gff, checkIfExists: true) } else { exit 1, "MirGeneDB gff file not found: ${params.mirgenedb_gff}"} - if (!params.mirgenedb_species) { exit 1, "MirGeneDB species not set, please specify via the --mirgenedb_species parameter"} -} - -include { INPUT_CHECK } from '../subworkflows/local/input_check' -include { FASTQ_FASTQC_UMITOOLS_FASTP } from '../subworkflows/nf-core/fastq_fastqc_umitools_fastp' -include { FASTP as FASTP_LENGTH_FILTER } from '../modules/nf-core/fastp' -include { UNTARFILES as UNTAR_BOWTIE_INDEX } from '../modules/nf-core/untarfiles' -include { CONTAMINANT_FILTER } from '../subworkflows/local/contaminant_filter' -include { MIRNA_QUANT } from '../subworkflows/local/mirna_quant' -include { GENOME_QUANT } from '../subworkflows/local/genome_quant' -include { MIRDEEP2 } from '../subworkflows/local/mirdeep2' -include { INDEX_GENOME } from '../modules/local/bowtie_genome' -include { MIRTRACE } from '../subworkflows/local/mirtrace' - -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - IMPORT NF-CORE MODULES/SUBWORKFLOWS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ - -// -// MODULE: Installed directly from nf-core/modules -// -include { CAT_FASTQ } from '../modules/nf-core/cat/fastq/main' -include { MULTIQC } from '../modules/nf-core/multiqc/main' -include { CUSTOM_DUMPSOFTWAREVERSIONS } from '../modules/nf-core/custom/dumpsoftwareversions/main' -include { UMICOLLAPSE as UMICOLLAPSE_FASTQ } from '../modules/nf-core/umicollapse/main' -include { UMITOOLS_EXTRACT } from '../modules/nf-core/umitools/extract/main' +ch_multiqc_config = Channel.fromPath("$projectDir/assets/multiqc_config.yml", checkIfExists: true) +ch_multiqc_custom_config = params.multiqc_config ? Channel.fromPath( params.multiqc_config, checkIfExists: true ) : Channel.empty() +ch_multiqc_logo = params.multiqc_logo ? Channel.fromPath( params.multiqc_logo, checkIfExists: true ) : Channel.empty() +ch_fastp_adapters = Channel.fromPath(params.fastp_known_mirna_adapters, checkIfExists: true).collect() // collect to consume for all incoming samples to FASTP /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -97,35 +38,46 @@ include { UMITOOLS_EXTRACT } from '../modules/nf-core/umitools/e ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -// Info required for completion email and summary -def multiqc_report = [] +workflow NFCORE_SMRNASEQ { -workflow SMRNASEQ { + take: + ch_input // channel: samplesheet file as specified to --input + ch_samplesheet // channel: sample fastqs parsed from --input + ch_versions // channel: [ path(versions.yml) ] - ch_versions = Channel.empty() + main: + //Config checks + // Check optional parameters + if (!params.mirtrace_species) { + exit 1, "Reference species for miRTrace is not defined via the --mirtrace_species parameter." + } + // Genome options + def mirna_gtf_from_species = params.mirtrace_species ? "https://mirbase.org/download/CURRENT/genomes/${params.mirtrace_species}.gff3" : false + def mirna_gtf = params.mirna_gtf ?: mirna_gtf_from_species + + if (!params.mirgenedb) { + if (params.mature) { reference_mature = file(params.mature, checkIfExists: true) } else { exit 1, "Mature miRNA fasta file not found: ${params.mature}" } + if (params.hairpin) { reference_hairpin = file(params.hairpin, checkIfExists: true) } else { exit 1, "Hairpin miRNA fasta file not found: ${params.hairpin}" } + } else { + if (params.mirgenedb_mature) { reference_mature = file(params.mirgenedb_mature, checkIfExists: true) } else { exit 1, "Mature miRNA fasta file not found: ${params.mirgenedb_mature}" } + if (params.mirgenedb_hairpin) { reference_hairpin = file(params.mirgenedb_hairpin, checkIfExists: true) } else { exit 1, "Hairpin miRNA fasta file not found: ${params.mirgenedb_hairpin}" } + if (params.mirgenedb_gff) { mirna_gtf = file(params.mirgenedb_gff, checkIfExists: true) } else { exit 1, "MirGeneDB gff file not found: ${params.mirgenedb_gff}"} + if (!params.mirgenedb_species) { exit 1, "MirGeneDB species not set, please specify via the --mirgenedb_species parameter"} + } // - // SUBWORKFLOW: Read in samplesheet, validate and stage input files + // Create separate channels for samples that have single/multiple FastQ files to merge // - INPUT_CHECK ( - file(params.input) - ) - .reads - .dump(tag: 'group') - .branch { - meta, fastq -> - single : fastq.size() == 1 - return [ meta, fastq.flatten() ] - multiple: fastq.size() > 1 - return [ meta, fastq.flatten() ] - } - .set { ch_fastq } - ch_versions = ch_versions.mix(INPUT_CHECK.out.versions) - // TODO: OPTIONAL, you can use nf-validation plugin to create an input channel from the samplesheet with Channel.fromSamplesheet("input") - // See the documentation https://nextflow-io.github.io/nf-validation/samplesheets/fromSamplesheet/ - // ! There is currently no tooling to help you write a sample sheet schema + ch_samplesheet + .branch { + meta, fastqs -> + single : fastqs.size() == 1 + return [ meta, fastqs.flatten() ] + multiple: fastqs.size() > 1 + return [ meta, fastqs.flatten() ] + } + .set { ch_fastq } - // // MODULE: Concatenate FastQ files from same sample if required // CAT_FASTQ ( @@ -134,7 +86,8 @@ workflow SMRNASEQ { .reads .mix(ch_fastq.single) .set { ch_cat_fastq } - ch_versions = ch_versions.mix(CAT_FASTQ.out.versions.first().ifEmpty(null)) + + ch_versions = ch_versions.mix(CAT_FASTQ.out.versions.first()) mirna_adapters = params.with_umi ? [] : params.fastp_known_mirna_adapters @@ -155,7 +108,7 @@ workflow SMRNASEQ { ) ch_versions = ch_versions.mix(FASTQ_FASTQC_UMITOOLS_FASTP.out.versions) - ch_fasta = params.fasta ? file(params.fasta) : [] + ch_fasta = params.fasta ? file(params.fasta): [] ch_reads_for_mirna = FASTQ_FASTQC_UMITOOLS_FASTP.out.reads // even if bowtie index is specified, there still needs to be a fasta. @@ -171,7 +124,7 @@ workflow SMRNASEQ { } else { Channel.fromPath("${params.bowtie_index}**ebwt", checkIfExists: true).ifEmpty{ error "Bowtie1 index directory not found: ${params.bowtie_index}" }.filter { it != null }.set { ch_bowtie_index } } - } else { + } else { INDEX_GENOME ( [ [:], ch_fasta ] ) ch_versions = ch_versions.mix(INDEX_GENOME.out.versions) ch_bowtie_index = INDEX_GENOME.out.index @@ -217,7 +170,7 @@ workflow SMRNASEQ { // SUBWORKFLOW: MIRTRACE // MIRTRACE(ch_mirtrace_inputs) - ch_versions = ch_versions.mix(MIRTRACE.out.versions.ifEmpty(null)) + ch_versions = ch_versions.mix(MIRTRACE.out.versions) // // SUBWORKFLOW: remove contaminants from reads @@ -247,7 +200,7 @@ workflow SMRNASEQ { mirna_gtf, ch_reads_for_mirna ) - ch_versions = ch_versions.mix(MIRNA_QUANT.out.versions.ifEmpty(null)) + ch_versions = ch_versions.mix(MIRNA_QUANT.out.versions) // // GENOME @@ -274,23 +227,22 @@ workflow SMRNASEQ { } // - // MODULE: Pipeline reporting + // Collate and save software versions // - CUSTOM_DUMPSOFTWAREVERSIONS ( - ch_versions.unique().collectFile(name: 'collated_versions.yml') - ) + softwareVersionsToYAML(ch_versions) + .collectFile(storeDir: "${params.outdir}/pipeline_info", name: 'nf_core_smrnaseq_software_mqc_versions.yml', sort: true, newLine: true) + .set {ch_collated_versions} // // MODULE: MultiQC // + ch_multiqc_report = Channel.empty() if (!params.skip_multiqc) { - workflow_summary = WorkflowSmrnaseq.paramsSummaryMultiqc(workflow, summary_params) - ch_workflow_summary = Channel.value(workflow_summary) + summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") + ch_workflow_summary = Channel.value(paramsSummaryMultiqc(summary_params)) - methods_description = WorkflowSmrnaseq.methodsDescriptionText(workflow, ch_multiqc_custom_methods_description, params) - ch_methods_description = Channel.value(methods_description) ch_multiqc_files = Channel.empty() - ch_multiqc_files = ch_multiqc_files.mix(CUSTOM_DUMPSOFTWAREVERSIONS.out.mqc_yml.collect()) + ch_multiqc_files = ch_multiqc_files.mix(ch_collated_versions) ch_multiqc_files = ch_multiqc_files.mix(ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) ch_multiqc_files = ch_multiqc_files.mix(FASTQ_FASTQC_UMITOOLS_FASTP.out.fastqc_raw_zip.collect{it[1]}.ifEmpty([])) ch_multiqc_files = ch_multiqc_files.mix(FASTQ_FASTQC_UMITOOLS_FASTP.out.fastqc_trim_zip.collect{it[1]}.ifEmpty([])) @@ -311,35 +263,14 @@ workflow SMRNASEQ { ch_multiqc_custom_config.toList(), ch_multiqc_logo.toList() ) - multiqc_report = MULTIQC.out.report.toList() - } -} - + ch_multiqc_report = MULTIQC.out.report -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - COMPLETION EMAIL AND SUMMARY -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ - -workflow.onComplete { - if (params.email || params.email_on_fail) { - NfcoreTemplate.email(workflow, params, summary_params, projectDir, log, multiqc_report) - } - NfcoreTemplate.dump_parameters(workflow, params) - NfcoreTemplate.summary(workflow, params, log) - if (params.hook_url) { - NfcoreTemplate.IM_notification(workflow, params, summary_params, projectDir, log) } -} -workflow.onError { - if (workflow.errorReport.contains("Process requirement exceeds available memory")) { - println("πŸ›‘ Default resources exceed availability πŸ›‘ ") - println("πŸ’‘ See here on how to configure pipeline: https://nf-co.re/docs/usage/configuration#tuning-workflow-resources πŸ’‘") - } + emit: + multiqc_report = ch_multiqc_report // channel: /path/to/multiqc_report.html + versions = ch_versions // channel: [ path(versions.yml) ] } - /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ THE END
    Process Name \\", - " \\ Software Version
    CUSTOM_DUMPSOFTWAREVERSIONSpython3.11.7
    yaml5.4.1
    TOOL1tool10.11.9
    TOOL2tool21.9
    WorkflowNextflow