README.md

RNA secondary structure predictor

This predictor uses MLP (from two python deep learning libraries - mxnet and lasagne), genetic algorithm and MFT net to make predictions about RNA secondary structure.

Dependencies

• Python 3.5 (not tested on previous versions)
• mxnet and Lasagne (if you want to use Naïve Predictor)
• numpy
• matplotlib

How to use it

Clone this repository, import one of the predictors and start to play! The simplest example of usage may look like this:

from MFTPredictor import MFTPredictor
import rna

p = MFTPredictor()
result = p.predict(rna.Molecule("GGCCUGAGGAGACUCAGAAGCC"))
result.show()

For more examples check examples.ipynb.