Skip to content

Latest commit

 

History

History
259 lines (200 loc) · 21.7 KB

README.md

File metadata and controls

259 lines (200 loc) · 21.7 KB

tronko

A rapid phylogeny-based method for accurate community profiling of large-scale metabarcoding datasets

In the tronko package there are two modules: tronko-build and tronko-assign. tronko-build is for building custom reference databases that tronko-assign uses as input. We have two reference databases currently available for download with tronko-assign. Cytochrome oxidase I (COI) which was custom built with CRUX using forward primer GGWACWGGWTGAACWGTWTAYCCYCC and reverse primer TANACYTCnGGRTGNCCRAARAAYCA. 16S which was custom built with CRUX using forward primer GTGCCAGCMGCCGCGGTAA and reverse primer GACTACHVGGGTATCTAATCC. DOI

Alignment-based and composition-based assignment methods calculate the lowest common ancestor (LCA) using data only in the leaf nodes of a phylogeny (A). The advantage of Tronko is that it stores fractional likelihoods in all nodes of a phylogeny and calculates the LCA based on all nodes in the tree (B).

tronko-build

tronko-build is for building custom reference databases to be used with tronko-assign.

tronko-build [OPTIONS] -d [OUTPUT DIRECTORY]

	-h, usage:
	-d [DIRECTORY], REQUIRED, full path to output directory
	-y, use a partition directory (you want to partition or you have multiple clusters)
	-l, use only single tree (do not partition)
	-t [FILE], compatible only with -l, rooted phylogenetic tree [FILE: Newick]
	-m [FILE], comptabile only with -l, multiple sequence alignment [FILE: FASTA]
	-x [FILE], taxonomy file [FILE: FASTA_header	domain;phylum;class;order;family;genus;species, use only with -l]
	-e [DIRECTORY], compatible only with -y, directory for reading multiple clusters
	-n [INT], compatible only with -y, number of partitions in read directory
	-b [INT], comptabile only with -y, restart partitions with partition number [default: 0]
	-s, compatible only with -y, partition using sum-of-pairs score [can't use with -f, use with -s]
	-u [FLOAT], compatible only with -y, minimum threshold for sum of pairs score [default: 0.5]
	-v, compatible only with -y, partition using minimum number of leaf nodes [can't use with -s, use with -f]
	-f [INT], don't partition less than the minimum number of leaf nodes [can't use with -s, use with -v, use only with -y]
	-g, don't flag missing data
	-c, [INT] Number of FAMSA threads to use (0 means use all threads) [default: 1]
	-p, break the db build into two steps
	-r, remove unused trees and copy trees from initial partition directory [can only be used with -p]
	-i, [STRING] set the prefix for output partitions in -d

tronko-assign

tronko-assign is for species assignment of queries. It requires a tronko-build database.

tronko-assign [OPTIONS] -r -f [TRONKO-BUILD DB FILE] -a [REF FASTA FILE] -o [OUTPUT FILE]

	-h, usage:
	-r, REQUIRED, use a reference
	-f [FILE], REQUIRED, path to reference database file, can be gzipped
	-a [FILE], REQUIRED, path to reference fasta file (for bwa database)
	-o [FILE], REQUIRED, path to output file
	-p, use paired-end reads
	-s, use single reads
	-v, when using single reads, reverse-complement it
	-z, when using paired-end reads,  reverse-complement the second read
	-g [FILE], compatible only with -s, path to single-end reads file
	-1 [FILE], compatible only with -p, path to paired-end forward read file
	-2 [FILE], compatible only with -p, path to paired-end reverse read file
	-c [INT], LCA cut-off to use [default:5]
	-C [INT], number of cores [default:1]
	-L [INT], number of lines to read for assignment [default:50000]
	-P, print alignments to stdout
	-w, use Needleman-Wunsch Alignment Algorithm (default: WFA)
	-q, Query is FASTQ [default is FASTA]
	-e, Use only a portion of the reference sequences
	-n [INT], compatible only with -e, Padding (Number of bases) to use in the portion of the reference sequences
	-5 [FILE], Print tree number and leaf number and exit
	-6, Skip the bwa build if database already exists
	-u, Score constant [default: 0.01]

Tronko uses the Wavefront Alignment Algorithm (version 2) or Needleman-Wunsch Algorithm for semi-global alignments. It uses bwa for alignment to leaf nodes, and uses David Leeds' hashmap for hashmap implementation in C. tronko-assign does not reverse complement your reads automatically. You must use options -v or -z to reverse complement your read for better alignment to the reference database. For more information on the direction of your reads based on your library prep, please refer to this helpful blog here: http://onetipperday.blogspot.com/2012/07/how-to-tell-which-library-type-to-use.html.

Example output

The output file is a tab-delimited text file where only the forward readname is retained (if using paired-end reads). The output displays the taxonomic path for assignment, the score, the number of forward read mismatches with the bwa hit, the number of reverse read mismatches with the bwa hit, the tree number for the best assignment (0 if using 1 tree), and the node number the read (or reads in the case of paired-end reads) was assigned to. For single-end reads, the Reverse_Mismatch will always be 0 and the Forward_Mismatch is the number of read mismatches with the bwa hit.

Readname	Taxonomic_Path	Score	Forward_Mismatch	Reverse_Mismatch	Tree_Number	Node_Number
GU572157.1_8_1	Eukaryota;Chordata;Aves;Charadriiformes;Alcidae;Uria;Uria aalge	-54.258690	5.000000	4.00000	0	1095
GU572157.1_7_1	Eukaryota;Chordata;Aves;Charadriiformes;Alcidae;Uria;Uria aalge	-42.871226	1.000000	6.00000	0	1095
GU572157.1_6_1	Eukaryota;Chordata;Aves;Charadriiformes;Alcidae;Uria;Uria aalge	-59.952407	7.000000	3.00000	0	1098
GU572157.1_5_1	Eukaryota;Chordata;Aves;Charadriiformes;Alcidae;Uria;Uria aalge	-31.483761	2.000000	4.00000	0	1095
GU572157.1_4_1	Eukaryota;Chordata;Aves;Charadriiformes;Alcidae;Uria;Uria aalge	-31.483761	2.000000	3.00000	0	1095
GU572157.1_3_1	Eukaryota;Chordata;Aves;Charadriiformes;Alcidae;Uria;Uria aalge	-54.258690	2.000000	7.00000	0	1095

INSTALLATION

  1. Clone the GitHub repo, e.g. with git clone https://github.com/lpipes/tronko.git
  2. Run make in the tronko-build and tronko-assign directories.
  3. Copy the tronko-build and tronko-assign binaries to your path.

tronko-assign uses pthreads and zlib as its dependencies. tronko-build only has dependencies if using the partition procedure for the initial trees. These are raxmlHPC-PTHREADS, famsa, nw_reroot from Newick utilties, fasta2phyml.pl, and sed, which must be installed in your path.

cd tronko/tronko-build
make
../tronko-assign
make

SINGULARITY CONTAINER

To use the container download:

singularity pull library://lpipes/tronko/tronko:1.0

To run tronko-assign with the container:

singularity exec --bind <root-dir-to-bind-to-container> tronko_1.0.sif tronko-assign

To run tronko-build with the container:

singularity exec --bind <root-dir-to-bind-to-container> tronko_1.0.sif tronko-build

tronko-assign Usage

Tronko does not detect the correct orientation of the reads. If your reverse read needs to be reverse complemented use the option -z. The default options of Tronko assume that your reads are in FASTA format. If you want to assign reads in FASTQ format, use the option -q. You will also need a FASTA file (not gzipped) of all of your reference sequences in the reference database (use the option -a). tronko-assign will create a bwa index of the reference sequences with the extension of *.fasta.ann, etc. If you already have the bwa index files present in the same directory and naming scheme as your reference sequences, you can choose skip the bwa index build use -6. The reads (and reference database file) can be gzipped or not gzipped. Assigning paired-end reads in FASTA format:

tronko-assign -r -f [tronko-build REFERENCE DB FILE] -p -1 [FORWARD READS FASTA] -2 [REVERSE READS FASTA] -a [REFERENCE SEQUENCES FASTA] -o [OUTPUT FILE]

Assigning single-end reads in FASTA format:

tronko-assign -r -f [tronko-build REFERENCE DB FILE] -s -g [READS FASTA] -a [REFERENCE SEQUENCES FASTA] -o [OUTPUT FILE]

tronko-build Usage

tronko-build Simple Usage (using 1 phylogenetic tree)

tronko-build -l -t [Rooted Newick Tree] -m [Multiple Sequence Alignment FASTA] -x [TAXONOMY FILE] -d [FULL PATH TO OUTPUT DIRECTORY] 

The taxonomy file is a .txt file that has the following format:

FASTA_header\tdomain;phylum;class;order;family;genus;species

The tree file, MSA file, and the taxonomy file must all contain identical corresponding names. The MSA file should not contain any line breaks. To remove line breaks we recommend

sed -i ':a; $!N; /^>/!s/\n\([^>]\)/\1/; ta; P; D' test.fasta

tronko-build example datasets

An example dataset for a single tree is provided in tronko-build/example_datasets/single_tree. The dataset includes 1466 COI sequences from the order Charadriiformes. The MSA is tronko-build/example_datasets/single_tree/Charadriiformes_MSA.fasta, the taxonomy file is tronko-build/example_datasets/single_tree/Charadriiformes_taxonomy.txt, and the tree file is tronko-build/example_datasets/single_tree/RAxML_bestTree.Charadriiformes.reroot. To build the reference database for tronko-assign for this dataset, run tronko-build with the following command (-l specifies using a single tree):

tronko-build -l -m tronko-build/example_datasets/single_tree/Charadriiformes_MSA.fasta -x tronko-build/example_datasets/single_tree/Charadriiformes_taxonomy.txt -t tronko-build/example_datasets/single_tree/RAxML_bestTree.Charadriiformes.reroot -d tronko-build/example_datasets/single_tree

An example dataset for multiple trees is provided in tronko-build/example_datasets/multiple_trees/one_MSA. The dataset includes 99 COI sequences from different species. The MSA is tronko-build/example_datasets/multiple_trees/one_MSA/1_MSA.fasta, the taxonomy file is tronko-build/example_datasets/multiple_trees/one_MSA/1_taxonomy.txt, and the tree file is tronko-build/example_datasets/multiple_trees/one_MSA/RAxML_bestTree.1.reroot. To build the reference database and partition it using the Sum-of-Pairs score (see manuscript), run tronko-build with the following command [-d is REQUIRED and must contain the full path NOT relative path):

tronko-build -y -e tronko-build/example_datasets/multiple_trees/one_MSA -n 1 -d [FULL PATH TO OUTPUT DIRECTORY] -s

An example dataset to not partition multiple tree is provided in tronko-build/example_datasets/multiple_trees/multiple_MSA. The dataset include 99 COI sequences from different species. To build the reference database and not partition the database, set the -f parameter higher than the number of sequences in the dataset. Run tronko-build with the following command [Make sure -d is supplied with the full path to the output directory]:

tronko-build -y -e tronko-build/example_datasets/multiple_trees/multiple_MSA -n 5 -d outdir_multiple_MSA -v -f 500

A successful run will produce a tronko-assign reference database named reference_tree.txt in the output directory. The reference_tree.txt database file is what is used to run tronko-assign.

tronko-assign example datasets

An example dataset for tronko-assign is provided in example_datasets/single_tree. This dataset contains single-end reads (example_datasets/single_tree/missingreads_singleend_150bp_2error.fasta) and paired-end reads (forward read: example_datasets/single_tree/missingreads_pairedend_150bp_2error_read1.fasta and reverse read: example_datasets/single_tree/missingreads_pairedend_150bp_2error_read2.fasta). For the single-end reads, there are 164 150bp reads with 2% simulated error/polymorphisms from the following sequence (taxonomically classified on NCBI as Uria aalge):

>GU572157.1
CCTGGCTGGTAATCTAGCCCATGCCGGAGCTTCAGTGGATTTAGCAATCTTCTCCCTTCACTTAGCAGGTGTATCATCTATTCTAGGCGCTATCAACTTTATCACAACAGCCATCAACATAAAGCCTCCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCAGTACTTATCACTGCTGTCCTACTACTACTCTCACTCCCAGTACTTGCTGCTGGTATCACTATATTACTAACAGATCGAAACTTAAACACAACATTCTTTGATCCAGCTGGAGGTGGTGACCCAGTACTTTACCAACACCTCTTC

This particular sequence, GU572157.1, has been removed from the single tree example database. To obtain assignments, run tronko-assign with the single tree example database from tronko-build with the following command for the single-end reads (using the Needleman-Wunsch alignment and a default LCA cut-off of 5):

tronko-assign -r -f tronko-build/example_datasets/single_tree/reference_tree.txt -a tronko-build/example_datasets/single_tree/Charadriiformes.fasta -s -g example_datasets/single_tree/missingreads_singleend_150bp_2error.fasta -o example_datasets/single_tree/missingreads_singleend_150bp_2error_results.txt -w

To obtain assignments, run tronko-assign with the single tree example database from tronko-build with the following command for the paired-end reads (using the Needleman-Wunsch alignment and a default LCA cut-off of 5):

tronko-assign -r -f tronko-build/example_datasets/single_tree/reference_tree.txt -a tronko-build/example_datasets/single_tree/Charadriiformes.fasta -p -1 example_datasets/single_tree/missingreads_pairedend_150bp_2error_read1.fasta -2 example_datasets/single_tree/missingreads_pairedend_150bp_2error_read2.fasta -o example_datasets/single_tree/missingreads_pairedend_150bp_2error_results.txt -w

An example dataset for tronko-assign with multiple trees is provided in example_datasets/multiple_trees. This dataset contains single-end reads (example_datasets/multiple_trees/missingreads_singleend_150bp_2error.fasta) and paired-end reads (forward read: example_datasets/multiple_trees/missingreads_pairedend_150bp_2error_read1.fasta and reverse read: example_datasets/multiple_trees/missingreads_pairedend_150bp_2error_read2.fasta). For the single-end reads, there are 84 150bp reads with 2% simulated error/polymorphisms from the following sequence (taxonomically classified on NCBI as Sagitta elegans):

>KP857443.1
TTTGAGCACTGTGGGACATAGGGGTGGAGCAGTGGATTTGGGTATCTTCTCTTTGCACCTGGCTGGCGTTAGAAGAATCTTGGGGAGAGCTAATTTTATTACCACTATCACCAATATAAAAGGGGAAGGTATGACTATAGAACTCATGCCTTTATTCGTGTGGGCGGTGCTCCTCACGGCTGTCTTACTTTTACTCTCTCTACCTGTATTAGCTGGGGCTATCACAATGTTAC

This particular sequence, KP857443.1, has been removed from the multiple trees example databases. To obtain assignments, run tronko-assign with the multiple trees example database with partitions from tronko-build with the following command for the single-end reads (using the Needleman-Wunsch alignment -w and a default LCA cut-off of 5 -c 5):

tronko-assign -r -f out_oneMSA/reference_tree.txt -s -g example_datasets/multiple_trees/missingreads_singleend_150bp_2error.fasta -o example_datasets/multiple_trees/missingreads_singleend_150bp_2error_partition_results.txt -a tronko-build/example_datasets/multiple_trees/one_MSA/1.fasta

To assign paired-end reads on the same reference database run tronko-assign:

tronko-assign -r -f out_oneMSA/reference_tree.txt -p -1 example_datasets/multiple_trees/missingreads_pairedend_150bp_2error_read1.fasta -2 example_datasets/multiple_trees/missingreads_pairedend_150bp_2error_read2.fasta -o example_datasets/multiple_trees/missingreads_pairedend_150bp_2error_partition_results.txt -a -a tronko-build/example_datasets/multiple_trees/one_MSA/1.fasta

To obtain assignments, run tronko-assign with the multiple trees example database with multiple MSAs from tronko-build with the following command for the single-end reads (using the Needleman-Wunsch alignment -w and a default LCA cut-off of 5 -c 5):

tronko-assign -r -f outdir_multiple_MSA/reference_tree.txt -s -g example_datasets/multiple_trees/missingreads_singleend_150bp_2error.fasta -o example_datasets/multiple_trees/missingreads_singleend_150bp_2error_multiple_MSA_results.txt -a tronko-build/example_datasets/multiple_trees/one_MSA/1.fasta

To assign paired-end reads on the same reference database run tronko-assign:

tronko-assign -r -f outdir_multiple_MSA/reference_tree.txt -p -1 example_datasets/multiple_trees/missingreads_pairedend_150bp_2error_read1.fasta -2 example_datasets/multiple_trees/missingreads_pairedend_150bp_2error_read2.fasta -o example_datasets/multiple_trees/missingreads_pairedend_150bp_2error_multiple_MSA_results.txt -a tronko-build/example_datasets/multiple_trees/one_MSA/1.fasta

More on tronko-build Usage with multiple trees

tronko-build requires a multiple sequence alignment (FASTA format), rooted phylogenetic tree (Newick format), and a corresponding taxonomy file for each cluster build. All of the files should be in one directory and specify the directory with -e with each cluster being designated by a number. MSA files should be named [Number]_MSA.fasta, taxonomy files should be named [Number]_taxonomy.txt, and tree files should be named RAxML_bestTree.[Number].reroot. Example of the contents of a directory containing 3 clusters:

1_MSA.fasta
2_MSA.fasta
3_MSA.fasta
1_taxonomy.txt
2_taxonomy.txt
3_taxonomy.txt
RAxML_bestTree.1.reroot
RAxML_bestTree.2.reroot
RAxML_bestTree.3.reroot

Once you have the cluster files prepared and you have created an output directory (the program assumes the output directory already exists), an example command is

tronko-build -y -e [DIRECTORY CONTAINING MSA, TAX, and TREE FILES] -n [NUMBER OF PARTITIONS] -d [OUTPUT DIRECTORY] -s

For the example with 3 clusters, an example command partitioning by sum-of-pairs score would be:

tronko-build -y -e [DIRECTORY CONTAINING MSA, TAX, and TREE FILES] -n 3 -d output -s

The reference database file will be output to [OUTPUT DIRECTORY]/reference_tree.txt. The reference_tree.txt file is the reference database file that tronko-assign requires for assignment.

To partition the reference database further (see manuscript for details) the following dependencies are needed to be installed in your path (no dependencies needed for tronko-assign and for building a reference database with a single tree or without partitioning the database): raxmlHPC-PTHREADS, famsa, nw_reroot from Newick utilties, fasta2phyml.pl, and sed. Partitioning the database further is only needed when the underlying MSA is unreliable. An example command to create the reference database and partition a database that contains 100 initial clusters using the sum-of-squares approach:

tronko-build -y -e initial_clusters_directory -d outdir -n 100 -s

The reference_tree.txt file will be output to the outdir directory. An example command to create the reference database and partition a database that contains 100 initial clusters using a threshold for the number of leaf nodes (i.e., 500 leaf nodes):

tronko-build -y -e initial_clusters_directory -d outdir -n 100 -v -f 500

The reference_tree.txt file will be output to the outdir directory.

tronko-assign using pre-built 16S and COI databases

First download the databases from Zenodo (DOI). To assign FASTQ (-q) paired-end reads (-p) using the 16S database (and reverse-complement the reverse read -z) with Needleman-Wunsch (-w), 16 cores (-C 16), and an LCA cut-off of 5 (-c 5):

tronko-assign -r -q -p -z -w -C 16 -c 5 -f 16S_tronko_build.txt.gz -a 16S.fasta -1 16S_TW-DR-1-S88_F_filt.fastq.gz -2 16S_TW-DR-1-S88_R_filt.fastq.gz -o 16S_TW-DR-1-S88_results.txt 

With the CO1 database and same parameters:

tronko-assign -r -q -p -z -w -C 16 -c 5 -f CO1_tronko_build.txt.gz -a CO1.fasta -1 CO1_TW-DR-1-S88_F_filt.fastq.gz -2 CO1_TW-DR-1-S88_R_filt.fastq.gz -o CO1_TW-DR-1-S88_results.txt

Performance

We performed a leave-one-species-out test comparing Tronko (with LCA cut-offs for the score of 0, 5, 10, 15, and 20 with Needleman-Wunsch alignment) to kraken2, metaphlan2, and MEGAN for 1,467 COI sequences from 253 species from the order Charadriiformes using 150bp x 2 paired-end sequences and 150bp and 300bp single-end sequences using 0, 1, and 2% error/polymorphism. Using leave-one-species-out and simulating reads (both paired-end and single-end) with a 0-2% error (or polymorphism), Tronko detected the correct genus more accurately than the other methods even when using an aggressive cut-off (i.e., when cut-off=0) (D and G).

Citation

Pipes L, and Nielsen R (2022) A rapid phylogeny-based method for accurate community profiling of large-scale metabarcoding datasets. bioRXiv. https://www.biorxiv.org/content/10.1101/2022.12.06.519402v1