diff --git a/bio-seq/src/kmer/mod.rs b/bio-seq/src/kmer/mod.rs
index 437cf18..dbe8b25 100644
--- a/bio-seq/src/kmer/mod.rs
+++ b/bio-seq/src/kmer/mod.rs
@@ -542,7 +542,7 @@ impl<A: Codec + Complement, const K: usize> ReverseComplement for Kmer<A, K> {
 /// This is a wrapper for the `dna!` macro that returns a `Kmer`:
 /// ```
 /// # use bio_seq::prelude::*;
-/// let kmer: Kmer<Dna, 8> = dna!("ACGTACGT").into();
+/// let kmer: Kmer<Dna, 8> = kmer!("ACGTACGT");
 /// ```
 #[macro_export]
 macro_rules! kmer {
diff --git a/bio-seq/src/lib.rs b/bio-seq/src/lib.rs
index 2bfbff9..00328fc 100644
--- a/bio-seq/src/lib.rs
+++ b/bio-seq/src/lib.rs
@@ -53,7 +53,7 @@
 //! let seq: &'static SeqSlice<Dna> = dna!("CGCTAGCTACGATCGCAT");
 //!
 //! // Sequences can also be copied into `Kmer`s:
-//! let kmer: Kmer<Dna, 18> = dna!("CGCTAGCTACGATCGCAT").into();
+//! let kmer: Kmer<Dna, 18> = dna!("CGCTAGCTACGATCGCAT").try_into().unwrap();
 //! // or with the kmer! macro:
 //! let kmer = kmer!("CGCTAGCTACGATCGCAT");
 //!
diff --git a/bio-seq/src/seq/mod.rs b/bio-seq/src/seq/mod.rs
index bf574af..7855a67 100644
--- a/bio-seq/src/seq/mod.rs
+++ b/bio-seq/src/seq/mod.rs
@@ -12,19 +12,20 @@
 //! use bio_seq::prelude::*;
 //! use bio_seq::seq;
 //!
-//! let reference: Seq<Dna> = dna!("ACGTTCGCATGCTACGACGATC").into();
+//! let reference = dna!("ACGTTCGCATGCTACGACGATC");
 //!
-//! let mut table: HashMap<Seq<Dna>, &SeqSlice<Dna>> = HashMap::new();
-//! table.insert(dna!("ACGTT").into(), &reference[2..5]);
-//! table.insert(dna!("ACACCCCC").into(), &reference[6..]);
+//! let mut table: HashMap<&SeqSlice<Dna>, usize> = HashMap::new();
+//!
+//! // Associate some kind of count with sequences as keys:
+//! table.insert(dna!("ACGTT"), 1);
+//! table.insert(dna!("ACACCCCC"), 0);
 //!
 //! // The query is a short window in the reference `Seq`
 //! let query: &SeqSlice<Dna> = &reference[..5];
 //!
-//! // The keys of the hashmap are `Seq`, but since `Seq` can be borrowed as a SeqSlice we can call `HashMap::get` on another slice.
 //! if let Some(value) = table.get(&query) {
 //!        // `SeqSlice` implements `Display`
-//!        println!("{value}");
+//!        println!("{query}: {value}");
 //! }
 //! ```
 pub mod index;