Orville Bennett Master's Thesis.txt

Expressing human Orai3 in insect cells for
pharmacological studies
A thesis submitted in partial fulfillment
of the requirements for the degree of
Master of Science

by

Orville R. Bennett
B.S., University of Hartford, 2005

2011
Wright State University

Wright State University
SCHOOL OF GRADUATE STUDIES
December 17, 2011
I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY Orville R. Bennett ENTITLED Expressing human Orai3 in insect cells for
pharmacological studies BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science.

J. Ashot Kozak, Ph. D.
Thesis Director

Timothy Cope, Ph. D.
Chair, Department of Neuroscience,
Cell Biology and Physiology
Committee on
Final Examination

J. Ashot Kozak, Ph. D.

Thomas Brown, Ph. D.

Adrian Corbett, Ph. D.

Robert Putnam, Ph. D.

Andrew Hsu, Ph.D.
Dean, School of Graduate Studies

ABSTRACT
Bennett, Orville. M.S., Department of Neuroscience, Cell Biology and Physiology, Wright State
University, 2011. Expressing human Orai3 in insect cells for pharmacological studies.

The Orai3 protein, forms a Ca2+ channel with a pharmacological profile distinct from
its close relative, the store-operated Ca2+ channel Orai1. Though closely related to Orai1,
the function of Orai3 in humans is still unclear. This study attempts to contribute to the
body of knowledge by undertaking a pharmacological analysis of Orai3 in insect cells. We
describe here the creation of a vector capable of expressing the mammalian Orai3 gene
on an insect background. We demonstrate the ability to induce gene expression of Orai3
in these insect cells, and then assess the effectiveness of this system by characterizing the
pharmacological properties with the drug 2-Aminoethyl diphenylborinate (2-APB). The results show that the current strategy used to express Orai3 will require additional refinement
before the system can be considered generally useful for pharmacological studies, because
expression of Orai3 may be affected by native proteins. The interference of expression
seems confined to Orai Ca2+ channels, as mammalian STIM1 was also expressed and a
response to 2-APB, albeit unexpected, was observed.

iii

Contents

1

2

Introduction
1.1 Background . . . . . . . . . . . . . . .
1.1.1 Calcium Signaling . . . . . . .
1.1.2 Store-Operated Calcium Entry .
1.2 STIM1 . . . . . . . . . . . . . . . . . .
1.3 Orai3 . . . . . . . . . . . . . . . . . .
1.4 Drosophila S2 cells . . . . . . . . . . .
1.5 Metallothionein . . . . . . . . . . . . .
1.6 Chemical reagents used . . . . . . . . .
1.6.1 2-Aminoethoxyphenyl Borate .
1.6.2 Cyclopiazonic Acid . . . . . . .
1.6.3 Ethylene glycol tetraacetic acid
1.6.4 Fura-2 . . . . . . . . . . . . . .
1.6.5 Probenecid . . . . . . . . . . .
1.7 Specific Aims . . . . . . . . . . . . . .
1.7.1 Specific Aim #1 . . . . . . . .
1.7.2 Specific Aim #2 . . . . . . . .
1.7.3 Specific Aim #3 . . . . . . . .
1.8 Significance . . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

Materials and Methods
2.1 Materials . . . . . . . . . . . . . . . . . . . . . . .
2.1.1 Restriction enzymes . . . . . . . . . . . . .
2.1.2 Primers . . . . . . . . . . . . . . . . . . . .
2.1.3 Drosophila resources . . . . . . . . . . . . .
2.2 Methods . . . . . . . . . . . . . . . . . . . . . . . .
2.2.1 Maintenance of cell lines . . . . . . . . . . .
2.2.2 Creation of Drosophila expression constructs
2.2.3 Transfection of S2 cells . . . . . . . . . . . .
2.2.4 RT-PCR and cDNA synthesis . . . . . . . .
2.2.5 Ca2+ imaging experiments . . . . . . . . . .

iv

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

1
2
2
3
4
5
6
7
8
8
9
10
10
12
13
13
13
14
14

.
.
.
.
.
.
.
.
.
.

15
15
16
16
17
19
19
19
22
22
23

3

Results
3.1 Creating inducible vectors . . . . . . . . . . . . . . . . . . . . . . . . . .
3.2 Demonstrating inducible expression . . . . . . . . . . . . . . . . . . . . .
3.3 Effective measurement of Ca2+ transients . . . . . . . . . . . . . . . . . .

4

Discussion
47
4.1 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49

Bibliography

26
26
31
35

51

v

List of Figures

1.1

Structures of chemical reagents used in this study. . . . . . . . . . . . . . .

2.1

Map of the puc-HygroMT vector . . . . . . . . . . . . . . . . . . . . . . . 17

3.1
3.2
3.3
3.4
3.5
3.6
3.7
3.8
3.9

Restriction digests confirm the insertion of Orai3 into puc-HygroMT .
Restriction digests confirm the insertion of STIM1 into puc-HygroMT
Orai3 expression is inducible in S2 cells . . . . . . . . . . . . . . . .
STIM1 expression is inducible in S2 cells . . . . . . . . . . . . . . .
Absence of probenecid gives poor Ca2+ imaging results in S2 cells . .
Probenecid improves Ca2+ imaging in S2 cells . . . . . . . . . . . . .
Addition of Probenecid improves Ca2+ recordings . . . . . . . . . . .
Ca2+ measurements in transfected S2 cells perfused with 2-APB . . .
Cytoplasmic Ca2+ content in transfected S2 cells . . . . . . . . . . .

vi

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

8

27
29
31
33
35
37
39
41
45

List of Tables

2.1
2.2
2.3
2.4
2.5
2.6

List of Cloning Reagents . .
List of PCR Cloning Primers
List of RT-PCR Primers . . .
List of Cell Culture Reagents
List of Chemical Reagents .
List of Instruments . . . . .

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

vii

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

15
16
16
16
18
18

Acknowledgement
I would like to extend my thanks to yada yada yada (maybe your parents?)
More thankful yada...
Even more yada...

viii

Dedicated to
Laura Bennett. This one’s fer you kid.

ix

Introduction
In 1983, Streb et al. (40) showed that stimulation with inositol (1,4,5)-trisphosphate (IP3)
triggered calcium (Ca2+ ) release from the endoplasmic reticulum (ER). Later, in 1986, Putney (32), proposed that depletion of intracellular Ca2+ concentration ([Ca2+ ]i ) signaled the
plasma membrane Ca2+ entry channels to open (41). This and other early studies (17, 51)
formed the basis for what we now refer to as store-operated calcium entry (SOCE). Initially, the more popular term used was capacitive calcium entry (CCE). Over 20 years later,
other major players in this story were revealed. Stromal interaction molecule 1 (STIM1),
was found to affect SOC influx in an RNAi screen and identified as the ER calcium sensor
(34, 22, 50). Shortly thereafter the store-operated calcium channel, Orai1, was found and
identified (14, 30, 43, 49, 38).
There are two mammalian homologs of Orai1, Orai2 and Orai3, whose functions have
not yet been ascertained (34, 43, 41, 38). It is possible that Orai2 and Orai3 are expressed
in a tissue-specific manner. This seems to be the case with estrogen receptor-positive (ER+)
breast cancer cells, which have been shown to use Orai3 as their store-operated Ca2+ channel (28, 10). The demonstrable involvement of Orai3 in a disease state as prevalent as
breast cancer, underscores the importance of further studies of these Orai channels whose
function in the body is not yet understood. The presented study sets the foundation for
pharmacological characterization of the Orai3 Ca2+ channel, using Drosophila S2 cells as
a heterologous expression system. This system is expected to be of more general use for
physiological and pharmacological studies of all Orai channels. We begin by introducing
1

calcium signaling through store-operated channels in non-excitable cells.

1.1

Background

1.1.1

Calcium Signaling

Ca2+ is an incredibly versatile signaling molecule, affecting all parts of the cellular signaling machinery. Ca2+ signaling is critical to such processes as exocytosis, transcription,
cardiac function, mitosis and apoptosis (4, 5, 16, 38). The speed of these processes range
from seconds to days (4).
Since Ca2+ can enter the cell’s cytoplasm by influx at the plasma membrane or release
from internal stores, such as those within the ER (4, 5, 38), it is necessary to maintain
a balance between the two pathways. This is to prevent Ca2+ from accumulating where
it should not, which would activate or deactivate cellular processes at inopportune times.
Ca2+ concentration is regulated through activation of different ion channels. The most
studied Ca2+ ion channels in the ER are the IP3 and ryanodine receptors (IP3R, RYR)
(5, 6, 21, 33). These channels are activated by additional second messengers.
“On” mechanisms are the means by which Ca2+ is released from internal stores into
the cytoplasm. “On” mechanisms depend on Ca2+ channels (5) which may be voltageoperated channels (VOCs), receptor-operated channels (ROCs), and/or store-operated channels (SOCs) (5).
“Off” mechanisms also exist to quickly lower [Ca2+ ]i , and this is done through various
pumps and exchangers (5). The plasma membrane Ca2+ -ATPase and Na+ /Ca2+ exchanger
(if present) move Ca2+ out of the cell, while the sarco-endoplasmic reticulum Ca2+ ATPase
(SERCA) will pump Ca2+ back into the ER, replenishing the cell’s internal stores (5).
Orai1, the recently identified Calcium-Release Activated Calcium (CRAC) channel,
is a store-operated Ca2+ channel (30, 43, 14, 49, 38). Orai3 is closely related to Orai1

2

(14, 41, 16), and is thought to be involved in store-operated calcium entry (SOCE). When
SOCs open they allow Ca2+ into the cytosol. This leads to [Ca2+ ]i increasing from nanomolar to micromolar levels (5). This Ca2+ is both stimulatory and inhibitory (5) since Ca2+
acts as a signal for such a wide array of cellular processes. Spatial regulation becomes
very important in allowing for control of stimulatory and inhibitory Ca2+ -dependent mechanisms. Ca2+ -binding proteins act as buffers and allow the cell to control the local [Ca2+ ]i .
Cytosolic Ca2+ buffers such as parvalbumin, calbindin-D, and calreticulin (5), along with
Ca2+ pumps and exchangers are important in regulation of [Ca2+ ]i .
In addition to their buffering capacity, cytosolic Ca2+ binding proteins can also act
as Ca2+ sensors (5). Ca2+ sensors, such as troponin C, calmodulin, phospholipase C and
recoverin respond to changes in [Ca2+ ]i . They do so with the aid of four EF hand motifs and
will bind Ca2+ to undergo conformational changes, and then activate downstream processes
(5). This mechanism of detecting changes in [Ca2+ ]i should be emphasized, as it will
become relevant for another player in the SOCE mechanism, STIM1.

1.1.2

Store-Operated Calcium Entry

Store-operated calcium entry is an interesting, yet simple process. Broken down to its
simplest form, it is a process which signals for Ca2+ to be allowed into the cell when more
is needed (32, 5, 21). SOCE is triggered by the loss of Ca2+ from the cell’s own internal
ER Ca2+ stores. ER Ca2+ sensors detect the loss of Ca2+ , migrate close to the plasma
membrane (PM), and signal PM Ca2+ channels to open. This further increases the [Ca2+ ]i
and allows for replenishing the stores (41), as well as providing Ca2+ necessary for various
cellular processes (4, 5, 16, 38).
Store-operated Ca2+ channels in lymphocytes are responsible for Ca2+ entering from
extracellular fluid (i.e. blood) (21, 5, 16). T-cell receptor engagement activates the enzyme phospholipase C gamma (PLCγ ). PLCγ will then hydrolyze phosphatidylinositol
4,5-bisphosphate (PIP2) in the membrane resulting in soluble IP3, and membrane bound
3

diacylglycerol (DAG) (5, 21). IP3 binds to IP3R opening it and allowing Ca2+ out of the
ER down its concentration gradient (38, 41, 21). This sustained Ca2+ influx is necessary for
gene transcription driven by nuclear factor of activated T-cells (NF-AT) (42, 5, 21, 16). NFAT, a transcription factor, is activated when an immune response is necessary, and drives
the transcription of IL-2 genes (42, 21, 16). The importance of Ca2+ to this process is a
result of NF-AT’s dependence on calcineurin for activation.
The Ca2+ influx triggered by SOCE results in Ca2+ and calmodulin binding to the
protein phosphatase calcineurin, activating it. Activated calcineurin then dephosphorylates
NF-AT, allowing it to move into the nucleus (42, 2). Once inside the nucleus, NF-AT
is able to bind the promoter region of interleukin and proliferation genes enabling their
transcription; in effect triggering immune response (42, 5, 16). Notice that for efficient
NF-AT activation, the Ca2+ elevation needs to be sustained, lasting 1-2 hours (42, 5, 21).

1.2

STIM1

Stromal interaction molecule 1 (STIM1), initially discovered as a membrane protein (44),
was shown to be the Ca2+ sensor within the ER (34, 22, 50, 38). The related STIM2
and Drosophila STIM (dStim) were also discovered later (44). STIM1 and STIM2 are
single-pass transmembrane proteins (16). Both are ER membrane localized proteins, until
emptying of the ER Ca2+ store causes translocation into, or close to, the PM (16).
STIM1 functions as a Ca2+ sensor by binding Ca2+ with its EF hand (44, 22), a motif
also present in cytosolic Ca2+ sensors (see above). Upon Ca2+ depletion, ER-localized
STIM1 will migrate to sites at or near the PM and bind Orai1, activating the channel. Once
activated, Orai channels permit the flow of Ca2+ into the cell. To date, only Orai1 has been
shown to be both necessary and sufficient for Ca2+ entry (14, 38). STIM2, a homolog of
STIM1, was found by one group to be an inhibitor of STIM1-mediated SOCE (39). dStim,
the Drosophila homolog of STIM1, is also an important regulator of SOCE and plays a role

4

in Drosophila development (13).

1.3

Orai3

As mentioned above, Orai3 is a homolog of Orai1, the long sought after store-operated
calcium (SOC) channel (14, 16). Even now, years after its discovery, the field still has a
poor understanding of Orai3’s native function and this is why studying Orai3 is important.
Though Orai channels behave similarly as Ca2+ entry channels, they have different
pharmacological responses. In mammalian cells, for example, interactions with the drug
2-aminoethoxyphenyl borate (2-APB) generate different cellular responses depending on
the protein to which it binds. While Orai1 will see slight activation upon introduction of <
10 µM 2-APB, introduction of higher concentrations result in deactivation (14, 15, 30, 48),
and blockade of SOCE. In contrast, Orai3 is activated by concentrations around and above
50 µM 2-APB(15, 48). These contrasting responses will be exploited in this study.
The Orai family of proteins displays a wide expression profile, which includes T-cells
and kidney (16). In HEK293 cells, knock down of Orai1 using siRNA reduced SOCE (16).
Knock down of Orai2 or Orai3 did not significantly affect SOCE, however (16). These
experiments in HEK cells are suggestive of Orai1’s importance in initiating SOCE. As
long as Orai1 is present in the membrane, SOCE will take place normally. Overexpression
experiments of Orai1 showing Ca2+ influx lasting minutes support this idea (16, 48). Ca2+
influx on the order of hours is necessary for gene transcription, however (2).
Expression of Orai3 and STIM1 in T-cells from Severe combined immunodeficiency
(SCID) patients results in marginal increases in SOCE, far lower than when Orai1 and
STIM1 are overexpressed (16). In SCID patient fibroblasts only Orai3 showed a minor
increase in SOCE over basal levels (16). Orai2 and STIM1 expression did not result in any
increase over the basal SCID T-cell levels. These experiments indicate that while Orai2
and Orai3 are, at some level, capable of supporting SOCE, in these human cell types they

5

are not the primary mediators of SOCE.
These results may be taken to suggest that Orai3 is potentially important to SOCE in
cell types that do not rely on Orai1 for sustained Ca2+ levels, as T-cells do. An example
of this has been displayed for ER+ cancer cells. This shows that Orai3, by itself, is an
important target of scientific inquiry, and that finding approaches to ease its study is a
relevant and valuable endeavor. We begin this process by attempting to create a model
system for studying pharmacological effects on Orai3.

1.4

Drosophila S2 cells

Drosophila cell line 2 (S2) has risen to prominence due to the ease of expressing proteins
from other organisms in them. S2 cells have been used for both transient and stable expression of recombinant proteins (36). They are also easy to transfect and allow multiple
copies of plasmid DNA to stably integrate into the genome (36). This property results in
high levels of protein production which make them so attractive to use. The S2 cell line is
derived from late stage Drosophila melanogaster embryos (37, 36). Schneider, the creator,
described them as macrophage-like (36) and evidence for their immune lineage includes
the following: (i) they undergo phagocytosis (36); (ii) produce antibacterial peptides (36);
(iii) like mammalian macrophages prefer media with more carbonate (36), and (iv) will
phagocytize other dying S2s.
Another reason why S2 cells present an attractive target for protein expression is related to the possibility of finely regulating protein expression through the use of vectors
with strong, inducible promoters (36, 46). An additional contributing factor to the use of
S2 cells in this study was the prevalence of multiple isoforms of Orai and STIM genes
in mammalian cells. Humans alone have three Orais: Orai1, Orai2 and Orai3; and two
STIMs: STIM1 and STIM2. In contrast, S2 cells have only one Orai (dOrai) and one
STIM (dStim) isoform, but still carry out SOCE. Depletion of ER calcium is detected by

6

dStim and which signals for extracellular Ca2+ influx through dOrai in the PM (38).
The S2 cell population is known to display stable behavior over time (3). As with
other immortalized cells, they can be frozen and used at later times. Another advantage
is that it is possible to follow the responses of a population immediately after adding a
drug (3). The expression of genes, either transiently or stably has been well documented.
The silencing of gene function by RNA interference (RNAi ) is also relatively simple and
well characterized in these cells (34). All of these factors make the Drosophila Expression
System (DES) very attractive to work with.
In our studies we will be introducing genes and testing their function. Ultimately, our
goal is to generate stable cell lines expressing our mammalian genes, and use this system
for the purpose of drug discovery. DES also allows for fine grained control of genes of
interest (GOI) by using appropriate promoters to drive gene expression. In our system, we
have selected the metallothionein promoter to drive expression of our GOIs in a regulated
fashion. The introduction of mammalian ion channels and receptors using such a system
has been demonstrated previously (36, 18, 1, 20, 29).

1.5

Metallothionein

The Drosophila metallothionein (Mtn) promoter is a strong inducible promoter (36, 7, 26,
46). Experimentally Cu2+ at concentrations ≥ 500 µM will strongly activate Mtn; with
basal activity being reported as close to undetectable (36). At the concentrations of Cu2+
that will induce the Mtn promoter, S2 cells can grow and make proteins (36).

7

(a) Fura2-AM

(b) CPA

(c) Probenecid

(d) 2-APB

Figure 1.1: Structures of chemical reagents used in this study.

1.6

Chemical reagents used

1.6.1

2-Aminoethoxyphenyl Borate

2-aminoethoxyphenyl borate (2-APB) (CAS Number: 524-95-8, (C6 H5 )2 BOCH2 CH2 NH2 )
is a drug which has multiple effects on a variety of cellular organelles. It is an inhibitor of
IP3Rs and SERCA pumps, and has both activating and inhibitory effects on channels (31, 6,
10). As mentioned above, its effect on Orai1 channels is to activate them at concentrations
< 10 µM, while inhibiting at higher concentrations (31, 14, 16, 15). This dual effect is
limited to Orai1, whereas for Orai3, 2-APB only activates at concentrations ≥ 50 µM (16).
The contrasting responses with 2-APB is often used to dissect functional differences in
cells expressing multiple Orai isoforms (14, 15, 30, 48). There is precedent then for the use
of 2-APB to help extract useful information about Orai3. Obtaining even more information
on Orai3 through the use of 2-APB is possible. If interactions between Orai3 channels
8

and 2-APB are direct, crystal structures with 2-APB could help define the structure of this
binding site. Such information may be helpful in finding the natural modulator of Orai3’s
SOCE activating function. It is evident then, that the question of whether Orai3 interacts
directly with 2-APB is worthy of study. By expressing Orai3 in a Drosophila expression
system, it becomes possible to obtain enough protein to do the type of crystallographic
studies mentioned above. This study then is also important as it can provide the foundation
for future structural studies, and its utility is not limited to pharmacological studies.

1.6.2

Cyclopiazonic Acid

Cyclopiazonic Acid (CPA) (CAS Number: 18172-33-3, C20 H20 N2 O3 ) is a specific inhibitor
of the endoplasmic reticulum’s Ca2+ ATPase (27). It has been shown to be specific for the
SERCA pump, and has been shown not to affect other ATPases or calcium pumps (27).
The affinity of CPA for its substrate is ∼ 120 nM. The use of CPA allows for manipulation
of SERCA pumps and, by extension, the ER Ca2+ store content (33, chap. 2). Inhibition of
the SERCA pump by CPA leads to release of the ER Ca2+ pools physiologically under the
control of IP3R channels, (33, chap. 2). The SERCA pump inhibition reveals a persistent
Ca2+ leak from the ER, and makes it the predominant force driving Ca2+ movement. The
result is an increase of cytoplasmic Ca2+ as Ca2+ leaks from ER into cytoplasm. Ca2+
release occurs relatively quickly (minutes), as CPA is membrane permeant (33).
CPA is added in a Ca2+ free solution containing a Ca2+ chelator. We then switch to a
solution that contains Ca2+ , with no CPA. By emptying the cell’s intracellular stores first,
we may then reasonably assume that any subsequent increase in [Ca2+ ]i is the result of
Ca2+ coming into the cell from the external solution.

9

1.6.3

Ethylene glycol tetraacetic acid

Ethylene Glycol Tetraacetic Acid (EGTA) is a cation chelator with a preference for Ca2+
over Mg2+ , Na+ and K+ (19). It is used experimentally to bind available Ca2+ in the
extracellular solution, making it unavailable for entry into the cell. This ensures that when
[Ca2+ ]i increases are observed during perfusion with an EGTA containing solution, we can
assume that these increases are the result of intracellular Ca2+ release, and not extracellular
Ca2+ entry (19, 33).

1.6.4

Fura-2

The ability to measure [Ca2+ ]i changes comes from the use of Fura-2. Fura-2 is a calcium
indicator whose ability to bind calcium is the result of a tetracarboxylic acid core. It is a
BAPTA derivative, which in turn, is based on EGTA’s structure (19, 33).
Fura-2 is a dual excitation indicator with a Kd of 145 nM for Ca2+ . At low [Ca2+ ]
excitation peaks at approximately 370 nm, while binding Ca2+ changes the excitation peak
to 340 nm. Emission, meanwhile, is monitored at 510 nm. This results in Ca2+ binding
leading to an increase in fluorescence at 510nm, when Fura-2 is excited at 340 nm. There
is a corresponding decrease in fluorescence at 510 nm, when excited at 380 nm if Ca2+ is
bound. By exciting both wavelengths in quick succession, Ca2+ binding changes can be
monitored. This is referred to as a ratiometric approach, and has advantages over single
wavelength excitation (discussed in ref.19).
The advantages are that the signal is not dependent on the dye concentration, illumination intensity or optical path-length because we get normalized values from the ratios of the
two wavelengths. Dye leakage and photobleaching both lead to a loss of indicator during
the experiment. Ratiometric measurements are therefore an improvement over the singlewavelength readings with respect to these issues as well. In a single wavelength setup, the
dye concentration would gradually decrease, leading to a seeming decrease in Ca2+ signal.

10

In the ratiometric setup, the effect of dye leakage or photobleached signals is mitigated by
taking the ratios of these measurements. The ratios should remain constant regardless of
the dye concentration or signal intensity. As an added bonus, ratiometric measurements
also increase sensitivity. (19, 33).
One noteworthy drawback is that Fura-2 fluorescence can be quenched by Cu2+ (33,
26). Since we use CuSO4 to induce gene expression in S2 cells, this is directly relevant
to our study. Care therefore is taken with measurements from CuSO4 -induced S2 cells.
These cells are spun down, washed in PBS, and then re-suspended in S2 media containing
no CuSO4 to minimize quenching.

Fura-2-AM
Ca2+ indicators are, necessarily, charged molecules. In spite of this, we need them to cross
the lipophilic PM. Since diffusional transport of these large, charged molecules across the
lipophilic membrane would be extremely slow, other methods are used to speed up the
process. By esterification of the -COOH groups of Fura-2, these groups are made lipophilic
and thus membrane permeant. Indicators with these modifications already made are usually
available as acetoxymethyl (AM) esters. Such is the case here, and the Fura-2-AM variant
is used to load the dye into our S2 cells. Once inside the cell, cytosolic esterases are needed
to remove the AM groups. Once these groups are removed, Fura-2 regains its charge, and
may no longer freely cross the PM.
One caveat of this method is that cell types with poor esterase activity will display poor
loading (19). Another is that cellular processes, presumably designed to maintain ionic
equilibrium, may pump the de-esterified, charged compound out of the cell. To combat this
problem, the anion transporters responsible for this process can be blocked. This strategy
was found to be necessary for S2 cells (9, 46). Probenecid was used for this purpose in our
study.

11

1.6.5

Probenecid

Probenecid (CAS Number: 57-66-9, C13 H19 NO4 S) is a nonspecific inhibitor of anion transport (9, 24). The reason for wanting to inhibit anion transport is to prevent cells from
transporting the Fura-2 dye out of the cytosol. Many cell types are capable of sequestering the dye into different compartments, and also of transporting the dye out of the
cell (11). There are a number of methods proposed for how Fura-2’s cytosolic concentration could be reduced (11, 9). Of those, the hypothesis that anion transporters, which
probenecid would block, are responsible seems most plausible in Drosophila S2 cells (9).
Murine macrophages have also shown a propensity for Fura-2 leakage (11). In the mouse
macrophage model, the anion transporters were again been implicated in Fura-2 leakage
and blocking anion transport in mouse macrophages prevented Fura-2 sequestration and
secretion (11). It is easy to see then that S2 cells, which are also of macrophage origin (36),
would have a similar response.
Drosophila S2 cells have, in fact, been shown to exhibit poor loading of Fura-2, alleviated by probenecid (9). In our experiments we also experienced similar difficulties with
loading the S2 cells in the absence of an anion blocker. Addition of 2.5 mM of probenecid
alleviated this problem, increasing the number of cells loaded with Fura-2.

The mode of action of Probenecid
Probenecid is thought to act by inhibiting the clearance of ions (24). It has also been reported that the drug has non-specific effects, among them an altering of the Ca homeostasis
(24). Such information is important to be aware of, as Ca2+ measurements are the output
from the experiments in our study. Care needs to be taken then, to ensure that the Ca2+
measurements would not be affected by probenecid. We address this by doing short 45minute incubations in probenecid similar to other published studies (9, 34, 46), followed
by washing these cells in our perfusion solution without probenecid.
Probenecid is soluble at basic pH. It is therefore dissolved in a solution of NaOH.
12

This necessitates titrating the dye-loading solution back to the desired pH, after adding
probenecid (11). In mouse macrophage experiments, no unexpected effects on cell viability
after a 3-hour incubation with probenecid were observed (11). While there are caveats to
its use, incubation at room temperature and for short periods, does not appear to affect cell
function or viability (9, 11, 47).

1.7

Specific Aims

Before attempting to characterize Orai3 Ca2+ channels in Drosophila S2 cells, we needed
to create the insect vector which contained our mammalian GOI. Standard molecular biology techniques were used to achieve this. The pharmacological characterization was done
by measuring the effect of 2-APB on heterologously expressed Orai3 activity. We hypothesized that gene expression of mammalian Orai3 in Drosophila S2 cells would result in
Ca2+ channels that behave similar to those in mammalian cells expressing Orai3 genes,
when administered with 2-APB.

1.7.1

Specific Aim #1

As mentioned earlier, Drosophila S2 cells provide a good system for expressing proteins
from other organisms. The pucHygroMT vector was chosen to express our mammalian
genes in S2 cells. Specific aim #1 is to create vector constructs using pucHygroMT which
express Orai3 and STIM1 in Drosophila S2 cells.

1.7.2

Specific Aim #2

After creating these vector constructs it will be necessary to determine if they are capable
of expressing the desired genes. Specific aim #2 is to show that we can successfully express
heterologous genes in Drosophila S2 cells.
13

1.7.3

Specific Aim #3

It is our desire to ultimately use this system for drug discovery. For this to be possible
we need to assess the effects which different drugs have in our system. This will be done
using Ca2+ measurements taken in transfected Drosophila S2 cells. Specific aim #3 is to
determine whether 2-APB has the same effect on the heterologously expressed Orai3 in
S2s that it has in mammalian cells. 2-APB is a pharmacological agent with defined effects
on the Orai3 Ca2+ channel. By looking at the effect of 2-APB on heterologously expressed
Orai3, we will be able to determine whether the model requires refinement, or is suitable
as is.

1.8

Significance

As stated above, Orai3 Ca2+ channels have been implicated in a specific subset of breast
cancer. It is tempting to envision a scenario where we can specifically target a breast
cancer for treatment (10). This will require some method to test the efficacy of drugs being
used, however. If successful, creating a model system in Drosophila has the possibility
to simplify drug testing, and as a result speed the process up. This could benefit research
of, not only breast cancer, but also other disease states involving SOCE. Cancers, such
as leukemia, and even autoimmune diseases such as rheumatoid arthritis or lupus, arising
from defects of the immune system stand to benefit from this work.
A successful Drosophila expression system provides benefits to biochemical analysis
of Orai channels as well. Techniques such as x-ray crystallography require large amounts
of protein. Such quantities are not easily achieved when working with mammalian cells,
but become feasible with a Drosophila expression system. This study is also significant
as it opens the possibility for extending the body of knowledge on Orai channels in both
functional and structural fields of research.

14

Materials and Methods

2.1

Materials
Table 2.1: List of Cloning Reagents

Manufacturer
5 Prime
Agilent Technologies
Sigma-Aldrich
Fermentas
IBI Scientific
Invitrogen
Lucigen
Promega
Research Products
International (RPI)
New England Biolabs

Item
PerfectPrep EndoFree Plasmid Maxi Kit
Agarose Gelextract Mini Kit
Easy-A One-Tube RT-PCR Kit
TRI Reagent®
DNase I, RNase-free
Ethidium Bromide (EtBr)
MAX Efficiency® DH10β Competent cells
2.5 mM dNTP Mix
EconoTaq PLUS GREEN 2X Master Mix
PureYield™ Plasmid Miniprep System
Agarose
Tryptone
Yeast Extract
Antarctic Phosphatase
T4 DNA Ligase
Various restriction enzymes

15

Location
Gaithersburg, MD
Santa Clara, CA
Louis, MO
Glen Burnie, MD
Peosta, IA
Carlsbad, CA
Middleton, WI
Madison, WI
Mount Prospect, IL

Ipswich, MA

2.1.1

Restriction enzymes

The following is a list of the restriction enzymes used. All were purchased from NEB:(i) SalI;
(ii) XbaI; (iii) NruI; (iv) BamHI; (v) StuI; (vi) XhoI; (vii) ApaI; and (viii) KpnI.
Table 2.2: List of PCR Cloning Primers
Primer
Orai3
Orai3
Stim1
Stim1

start salI
end xbaI
start salI
end xbaI

Sequence
TGCCGAGTCGACATGAAGGGCGGCGAGGGG
TGCCGATCTAGATCACACAGCCTGCAGCTCCCC
TGCCGAGTCGACATGGATGTATGCGTCCGTC
TGCCGATCTAGAGCCTACTTCTTAAGAGGCTTCTT

Table 2.3: List of RT-PCR Primers
Primer
orai3 rtpcr fwd
orai3 rtpcr rev
hstim1 end fwd
hstim1 rev
rp49-fwd
rp49-rev
HygBP3
HygBP4

2.1.2

Sequence
GAGTGACCACGAGTACCCACC
GGGTACCATGATGGCTGTGG
TTGGATTCTTCCCGTTCTCACAGC
GCCTACTTCTTAAGAGGCTTCTT
ATCGGTTACGGATCGAACAA
GACAATCTCCTTGCGCTTCT
CCTGAACTCACCGCGACGTCTGTCG
AGGCAGGTCTTGCAACGTGACACC

Size
508 bp
228 bp
165 bp
303 bp

Primers

All primers were purchased from Integrated DNA Technologies (Coralville, IA).
Table 2.4: List of Cell Culture Reagents
Manufacturer
Atlanta Biologicals
Lonza

Item
Fetal Bovine Serum - catalog no. S11050
Schneider’s Drosophila Medium

16

Location
Lawrenceville, GA
Walkersville, MD

2.1.3

Drosophila resources

Drosophila Schneider line 2 (S2) cells, the pucHygroMT plasmid and the puc18-actgfp plasmid were all purchased from the Drosophila Genomics Resource Center (Bloomington, IN). Figure 2.1 shows a schematic of the pucHygroMT vector, with possible sites
of insertion in the MCS.

copia promote
r

gr

om

yc

in

res

istance marker

pUC-hygroMT
7000 bp

H

MT

pro

mo

y

ter

XhoI

NruI

SalI

XbaI

BamHI

Figure 2.1: Map of the pucHygroMT vector. pucHygroMT contains SalI and XbaI
sites which were used to insert both Orai3 and STIM1 into the MCS.

17

Table 2.5: List of Chemical Reagents
Manufacturer
Acros Organics

Fisher Scientific

Invitrogen
Mirus Bio LLC
MP Biomedicals
Sigma-Aldrich

Item
Ethylene Glycol Tetraacetic Acid (EGTA)
4-(2-hydroxyethyl)-1-piperazineethanesulfonic
acid (HEPES)
HEPES Sodium Salt (HEPES-Na)
Paraformaldehyde 96%
Sodium Chloride (NaCl)
Cupric Sulfate Pentahydrate (CuSO4 ·5H2 O)
Dimethyl Sulfoxide (DMSO)
D-glucose
Hydrochloric Acid (HCl) 10N
Potassium Chloride (KCl)
Sodium Hydroxide (NaOH) 10N
Fura-2 AM
TransIT® -2020 Transfection Reagent
Agar
Probenecid
2-Aminoethyl diphenylborinate (2-APB)
Cyclopiazonic Acid (CPA)
Pluronic® F-127
Fluka Analytical 1.0 M CaCl2
Fluka Analytical 1.0 M MgCl2

Location
Geel, Belgium

Fair Lawn, NJ

Carlsbad, CA
Madison, WI
Solon, OH
St. Louis, MO

Table 2.6: List of Instruments
Manufacturer
Applied Biosystems
Denver Instruments
Sutter Instrument
Thermo Fisher Scientific
Intracellular Imaging Inc.
B & B Microscopes, Ltd.

Item
2720 Thermal Cycler
UltraBasic pH/mV meter
Lambda 10-B
NanoDrop ND 1000
175 W Xenon Lamp
Olympus CKX41 Inverted Microscope

18

Location
Foster City, CA
Bohemia, NY
Novato, CA
Wilmington, DE
Cincinnati, OH
Pittsburgh, PA

2.2

Methods

2.2.1

Maintenance of cell lines

Drosophila S2 cells were cultured at 27 °C in Schneider’s Drosophila medium supplemented with 10% fetal bovine serum (FBS).

2.2.2

Creation of Drosophila expression constructs

Molecular Cloning
We needed to express mammalian genes (Orai3, Stim1) on a Drosophila background, a
process which required some molecular biology finesse. We chose to accomplish this by
transferring these genes to a Drosophila vector. We selected the pucHygroMT plasmid as
our vector, whereas Orai3 and Stim1 were the kind gifts of Dr. Stefan Feske, NYU School
of Medicine.
pucHygroMT (see figure 2.1) contains a metallothionein promoter before the multiple cloning site (MCS), allowing for the induction of expression of genes placed in the
MCS. It also provides the necessary genes for driving constitutive hygromycin B resistance.
Also, pucHygroMT was available at a significantly lower cost compared to alternative
vectors from commercial suppliers. Additionally, the use of this vector for induction and
creation of stable lines has previously been documented (12).
Our genes of interest – mammalian Orai3 and Stim1 – were placed in the pucHygroMT plasmid using SalI and XbaI sites. The inserts for our genes of interest were
created by polymerase chain reaction (PCR) using the primers listed in Table 2.2. The
Orai3 start salI and Orai3 end xbaI primers were used for the Orai3 insert.
The Stim1 insert was generated using Stim1 start salI and Stim1 end xbaI
primers. The forward primer for each insert contained a SalI restriction site (GTCGAC),
preceded by an NruI restriction site (TGCCGA). The reverse primer for each insert had an
19

XbaI restriction site (TCTAGA), preceded by an NruI restriction site (TGCCGA).
Each PCR reaction consisted of: (i) 1X Easy-A reaction buffer; (ii) .2 mM dNTPs;
(iii) 2 µM forward; and (iv) 2 µM reverse primers; (v) 2 µL Easy-A PCR enzyme; (vi) 50100 ng of template DNA; and (vii) nuclease-free water up to 100 µL.
The PCR reaction thermocycler parameters for each amplicon were as follows:
Orai3, (i) an initial denaturation step at 95 °C for 3 minutes; (ii) 27 cycles of denaturation at 95 °C for 40 seconds, followed by annealing at 65 °C for 30 seconds, then extension
at 72 °C for 1 minute; and (iii) a final extension of 72 °C for 7 minutes.
Stim1, (i) an initial denaturation step at 95 °C for 3 minutes; (ii) 27 cycles of denaturation at 95 °C for 40 seconds, followed by an annealing step at 65 °C for 30 seconds, then
extension at 72 °C for 130 seconds; and (iii) a final extension of 72 °C for 7 minutes were
performed.
After the PCR reactions were completed, the amplicons were digested with SalI and
XbaI, then ligated into a similarly digested pucHygroMT vector (see details below).

Engineering Drosophila vector contructs
Each PCR product and the pucHygroMT vector were digested by SalI and XbaI restriction enzymes. The vector digest was followed by treatment with Antarctic Phosphatase,
according to the manufacturer’s instructions. Phosphatase treatment removed the 5 phosphate group at the end of the digested vector DNA. This helped prevent spontaneous recircularization and increased the amount of vector available to ligate with the insert. The
digested vector and digested PCR amplicons were run on a 0.8% 1X TAE agarose gel for
90 minutes at 80 V. Following electrophoresis, the DNA band was excised under UV illumination. The vector and insert DNA were then purified using the Agarose GelExtract
Mini kit. After purifying the DNA, a ligation reaction was performed with T4 DNA ligase
following the manufacturer’s specifications. The insert to vector ratios in the ligations were
9:1 (by volume). After a 15 minute incubation at 25 °C, the ligation mixture was used to
20

transform DH10β competent cells. The ligated constructs were renamed to indicate the
inserts, thus pucHygMT-Orai3 contained Orai3, while pucHygMT-STIM1 contained
Stim1.

Transformation of ligated DNA
A 15 ml round-bottom tube was chilled on ice, prior to addition of 100 µL thawed DH10β
cells. Subsequently, 4 µL of the ligation mixture was added, mixed gently by flicking, then
chilled on ice for 30 minutes. Next, the tube was incubated at 42 °C for 45 seconds, then
quickly transferred to ice for 90 seconds. After this, 900 µL of SOC medium was added.
A one hour incubation at 37 °C followed, with shaking at 250 RPM. 200 µL of this transformation mixture was plated on LB-Agar plates containing 100 µg/mL of the antibiotic
ampicillin (+Amp). The resulting LB-Agar +Amp plates were placed in an incubator at 37
°C overnight. After 16-18 hrs the plates were transferred to 4 °C. Individual colonies from
these plates were used to start miniprep cultures and obtain plasmid DNA.

Minipreparation of plasmid DNA
Single colonies were picked and added to 4 ml of LB supplemented with 100 µg/mL of
ampicillin. This mixture was placed in an incubator at 37 °C, with shaking at 250 rpm, for
16-18 hours. A miniprep procedure was performed according to the instructions provided
with the Pureyield™ Plasmid Miniprep System. DNA concentrations were estimated using
a NanoDrop ND 1000 spectrophotometer.

Maxipreparation of plasmid DNA
A maxiprep culture consisting of 100 ml of LB, supplemented with 100 µg/ml of ampicillin was started, using 100 µL of the miniprep culture. This mixture was placed in an
incubator at 37 °C, with shaking at 250 rpm, for 16-18 hours. A maxiprep procedure was

21

performed according to the protocol of the PerfectPrep EndoFree Plasmid Maxi kit. DNA
concentrations were estimated using a NanoDrop ND 1000 spectrophotometer.

2.2.3

Transfection of S2 cells

S2 cells were transfected with TransIT® -2020 transfection reagent according to the manufacturer’s instructions. Briefly, one day prior to transfection, S2 cells were plated at 80%
confluency in a 6-well tissue culture plate. pucHygMT-Orai3 vector transfections were
done with 1 µg of DNA per well. Transfections involving pucHygMT-STIM1 used 2
µg of DNA per well. pucHygMT-STIM1 and pucHygMT-Orai3 co-transfections were
performed at a 2:1 ratio (Stim1:Orai3).
As a positive control for transfection, 0.25 µg of the green fluorescent protein (GFP)
vector puc18-act-gfp, was co-transfected with the above constructs. A ratio of 3 µL
of TransIT® -2020 was used per 1 µg of maxiprepped DNA.

Induction of transfected S2 cells with CuSO4
Drosophila S2 cells were induced by the addition of 750 µM CuSO4 one or two days posttransfection.

2.2.4

RT-PCR and cDNA synthesis

Total RNA was isolated from transfected S2 cells, two days post-induction, using TRI
reagent® as per the manufacturer’s instructions. Traces of contaminating DNA were removed using RNase-free DNase I. For each µg of RNA, 1 µL of DNase I was added. First
strand cDNA synthesis was performed using the MMLV reverse transcriptase (RT). Briefly,
1 µg of mRNA was reverse transcribed into cDNA during a 30 minute incubation at 45 °C.
This cDNA served as the template for successive PCR reactions.

22

The RT reaction mixture contained: (i) 1X MMLV buffer; (ii) .8 mM dNTPs; (iii) 1
µg of template RNA; (iv) 2 µL MMLV RT; and (v) nuclease-free water up to 50 µL. RT
reactions were also performed on samples with the RT omitted – to determine whether any
contaminating DNA was still present.
PCR reactions were performed in a 2720 Thermal Cycler. The Drosophila housekeeping gene, ribosomal protein 49 (rp49), was used as a positive control to determine whether
cDNA was made in the preceding RT reaction (7, 23).
Each PCR reaction contained: (i) 1x Easy-A reaction buffer; (ii) .3 mM dNTPs; (iii) 1
µM forward; and (iv) 1 µM reverse primers; (v) .5 µL Easy-A PCR enzyme; (vi) 5 µL
of cDNA template from the (no-)RT reaction; and (vii) nuclease-free water up to 50 µL.
The sequences of these RT-PCR primers (23, 25, 45), and expected band sizes are given in
Table 2.3.
The PCR reaction parameters are as follows:
Orai3 and Stim1, (i) an initial denaturation step at 95 °C for 3 minutes; (ii) 30 cycles
of denaturation at 95 °C for 30 seconds, then annealing at 55 °C for 30 seconds, then
extension at 72 °C for 1 minute; and (iii) a final extension of 72 °C for 10 minutes was
performed.
HygBP, (i) an initial denaturation step at 95 °C for 3 minutes; (ii) 30 cycles of denaturation at 95 °C for 30 seconds, then annealing at 65 °C for 30 seconds, then extension at
72 °C for 30 seconds; and (iii) a final extension of 72 °C for 10 minutes was performed.
rp49, (i) an initial denaturation step at 94 °C for 3 minutes; (ii) 30 cycles of denaturation at 94 °C for 45 seconds, then annealing at 50 °C for 1 minute, then extension at 72 °C
for 1 minute 30 seconds; and (iii) a final extension of 72 °C for 7 minutes was performed.

2.2.5

Ca2+ imaging experiments

Two primary solutions were used for the Ca2+ imaging experiments. The first, designated 2
Ca, contained (in mM): 2 CaCl2 , 4 MgCl2 , 150 NaCl, 5 KCl, 10 HEPES and, 10 D-glucose
23

at pH 7.2 (50). The second solution 1 EGTA, contained (in mM), 1 EGTA, 6 MgCl2 ,
150 NaCl, 5 KCl, 10 HEPES and, 10 D-glucose at pH 7.2 (50). The dye loading solution
referred to below was comprised of 2 Ca, 0.02% Pluronic F-127, 2.5 mM probenecid and
4 µM Fura2-AM.
Cytosolic Ca2+ signals were measured in the following way: S2 cells, cultured at 27
°C, were placed in 35 mm glass-bottom chambers made by J. Ashot Kozak, Ph. D. After
30 minutes at room temperature, the old medium was removed, and the cells washed in 1X
DPBS twice. After the wash, the dye-loading solution was added to the cells and they were
incubated at room temperature for 45 minutes. The cells were then washed twice with the
2 Ca solution, and used for imaging.
Ca2+ imaging was performed on the stage of an Olympus CKX41 inverted microscope, attached to a Dell Optiplex 745C computer. Cells were perfused at a rate of approximately 4 mL/min using the solutions indicated in the figures below. Loaded cells were
exposed to light of 340 nm and 380 nm wavelengths, and emitted light at 510 nm was
recorded. The UV light source was a 175 W Xenon arc lamp. The wavelengths were selected using filters in the Lambda 10-B SmartShutter which was controlled by the InCytIM
2 software (Intracellular Imaging, Cincinnati, OH).

Selection of data for analysis
The traces were selected based on the following criteria: (i) there was a visible response
to CPA introduction; (ii) the initial perfusion with 2 Ca was relatively stable over time;
(iii) the absolute values of the measurements at 340 nm and 380 nm were ≥ 40 during
initial perfusion with 2 Ca; and (iv) the 340 nm and 380 nm recordings mirrored each other
as time progressed.

24

Statistical analysis of imaging experiment data
Error bars shown on the traces depict the standard error of the mean. Area under the curve
analysis was performed using Origin 8 software. Statistical analysis of the area under the
curve data was performed using one way ANOVA with SAS software. Differences were
considered significant if p values were < 0.05. The p values of < 0.001 were denoted by
the *** characters.

25

Results

3.1

Creating inducible vectors

Orai3 and STIM1 inserts were created as indicated in the methods. The inserts and pucHygroMT vector were then digested to facilitate ligation. After ligation of pucHygroMT
and inserts and transformation, DNA obtained by maxipreparation was digested to confirm
that the desired constructs were generated. These results of these digests are given below.
Figure 3.1 shows the results of digesting the pucHygMT-Orai3 construct after electrophoresis on a 0.8% agarose gel. The marker lane, shows DNA bands of known sizes,
used for estimating the sizes of bands in experimental lanes. Lane 1 shows bands obtained when both pucHygroMT vector and the Orai3 PCR amplicon are digested with
SalI+XbaI. The pucHygroMT vector map gives its size as 7000 bp. Based on comparison with the DNA marker, doubly digested pucHygroMT is estimated to be ∼7000
bp. This implies a difference of only a few bases between the SalI and XbaI sites in the
MCS. The Orai3 PCR amplicon, after digestion, is 894 bp. This comes from the 888 bp
size of Orai3, plus the bases for the digested SalI and XbaI restriction sites. The size of
pucHygMT-Orai3 is estimated to be 7888 bp. This comes from the ∼7000 bp size of
the digested vector and the 888 bp Orai3 insert (restriction sites in the Orai3 amplicon are
not added to the total, as they are already accounted for in the vector).
We tested if the insertion of pucHygMT-Orai3 was successful by doing restriction
digests and comparing the sizes of the obtained bands, with the calculated size. The double
26

M

1

2

3

4

+
+
+
−
−
−

−
−
−
+
+
−

−
−
−
+
−
+

−
−
−
+
−
−

bp
10000
8000
6000
4000
3000
2000

1000
750
puc-HygroMT
ORAI3 insert
StuI + XbaI
pucHygMT-Orai3
BamHI + XhoI
KpnI + XhoI

Figure 3.1: Restriction digests confirm the insertion of Orai3 into puc-HygroMT.
Lane M shows the DNA ladder, with the sizes of the corresponding bands to their left.
Lane 1 shows a SalI+XbaI double digest of both pucHygroMT and the Orai3 PCR
amplicon. The double digested pucHygroMT, ∼7000 bp in size, is the higher of the two
bands. Orai3, which is 894 bp in size, is the lower band. Lane 2 shows the result of
a BamHI+XhoI double digest of pucHygMT-Orai3. The complete vector is ∼7888
bp. From a 931 bp fragment and the remainder of the vector, ∼6957 bp. Lane 3 shows
the result of a KpnI+XhoI double digest of pucHygMT-Orai3. This gives a 796 bp
band and a remaining ∼7092 bp band. Lane 4 shows the undigested pucHygMT-Orai3,
yielding supercoiled and open circular DNA species.

digest of pucHygMT-Orai3 with BamHI and XhoI is shown in lane 2 of Figure 3.1.
Digestion with these enzymes is expected to yield a 931 bp and ∼6957 bp bands. Observed
bands are approximately this size, based on comparison with our DNA marker, and the
digested DNA in lane 1. Our 931 bp band is at roughly the same point as the 894 bp Orai3
insert, both just below the 1000 bp mark.
To test if the insert was placed in the correct orientation, we digesting with one enzyme

27

that cut in the vector, and another that cut in the insert. Lane 3 of Figure 3.1 shows the result
of a KpnI and XhoI double digest of pucHygMT-Orai3. Here we see the ∼7888 bp
vector producing the expected 796 bp and ∼7092 bp bands. The last lane shows undigested
pucHygMT-Orai3. We are therefore able to observe the supercoiled and open circular
DNA species of the vector in lane 4 (35). Taken together, Figure 3.1 shows that Orai3
was inserted into pucHygroMT, and more importantly, in the correct direction. Further
confirmation was obtained after direct sequencing of pucHygMT-Orai3.

28

bp
10000
8000
6000
4000
3000

M

1

2

3

+
−
+
−

+
+
−
−

4

2000
1000
pucHygMT-STIM1
SalI + XbaI
BamHI + StuI
StuI + XhoI

+
−
−
+

+
−
−
−

Figure 3.2: Restriction digests confirm the insertion of STIM1 into puc-HygroMT.
Lane 1 shows a StuI+XhoI digest of pucHygMT-STIM1. The ∼7000 bp pucHygroMT and 2060 bp STIM1 create a ∼9060 bp construct. StuI+XhoI digestion gives
1016 bp and ∼8044 bp bands. Lane 2 shows the result of a BamHI+StuI digest of pucHygMT-STIM1. This yields 1087 bp and ∼7973 bp bands. Lane 3 is the SalI+XbaI
digest of pucHygMT-STIM1. A 2066 bp band and a ∼6994 bp band are the result. Linearized pucHygMT-STIM1, at ∼9060 bp is also present. Lane 4 shows the undigested
pucHygMT-STIM1. We see supercoiled and open circular vector DNA species here.

We again confirmed successful creation of our STIM1 construct with restriction digests. Figure 3.2 shows the results of pucHygMT-STIM1 digests after electrophoresis on
a 0.8% agarose gel. Again, the marker lane shows DNA of known sizes, and is used to
estimate the band size in subsequent lanes.
In lane 1 the StuI+XhoI digest provides confirmation of STIM1 insertion into pucHygMT-STIM1. The StuI site is specific to STIM1 while the XhoI site is specific to the
vector. Two bands, sized at ∼8044 bp and 1016 bp were expected and observed. In lane 2,
the StuI and BamHI digest provide additional confirmation of properly inserted STIM1.
In this digest reaction the BamHI site is present in the vector. This digest yields the anticipated bands at ∼7973 bp and 1087 bp. Insertion of STIM1 in the reverse direction would
29

have yielded different sizes. These results confirm that our insert is present in the correct
orientation. We can see that our gel is also able to resolve the difference between 1016
bp and 1087 bp (though not between 1016 bp and 1000 bp) providing further confirmation
that our inserts are oriented correctly.
The SalI and XbaI digest in lane 3 further supports our claims. The 2066 bp
STIM1 and ∼6994 bp vector fragments are visible. A third band, the linearized pucHygMT-STIM1 vector, is also visible at ∼9060 bp. That the ∼8 kb (7973 bp) band in
lane 2, fits between our expected ∼7 kb and ∼9 kb bands in lane 3 also supports our assertion that pucHygMT-STIM1 contains STIM1 in the desired orientation. Lane 4 shows
undigested pucHygMT-STIM1 with supercoiled and open circular DNA species (35).

30

3.2

Demonstrating inducible expression
bp
1000
750
500
400
300
200
100

1

M

3

2

4

5
A

rp49p
HygBP

B

165 bp
303 bp

750 µM CuSO4
RT
Orai3 DNA
Orai3 RNA

−
−
+
−

C

+
+
−
+

+
−
−
+

−
+
−
+

−
−
−
+

Figure 3.3: Orai3 expression is inducible in Drosophila S2 cells using 750 µM CuSO4 .
(A) In lanes 1-5 the Orai3 RT-PCR primer pair are used (see table 2.3) Lane 1 shows the
band from a positive control PCR reaction. Orai3 DNA is used as the template. Lanes 2-5
show RT-PCRs using RNA from isolated pucHygMT-Orai3 transfected S2 cells. Lanes
2-3: S2 cells were induced with 750 µM CuSO4 . 508 bp band only present when RT is
added. Lane 4-5: S2 cells were not induced with CuSO4 . No band present after RT-PCR.
(B) RT-PCR of the same samples as in A, using rp49 primers. We see rp49 bands at 165
bp only in the lanes where RT was added to the reaction. (C) RT-PCR of the same samples
as in A, with HygBP primers. HygBP bands at 303 bp are seen only in the lanes where RT
was added to the reaction.

The RT-PCR reactions in Figure 3.3 were performed on RNA collected from pucHygMT-Orai3-transfected (Orai3+) S2 cells. Figure 3.3 shows that induction of Orai3
RNA in these S2 cells is successful. Panel A shows that DNA positive control and RNA
induction bands are the same size, 508 bp. No observable band is present when CuSO4 was
not added to Orai3+ S2 cells in lanes 4 and 5. This suggests negligible levels of Orai3 gene
expression when under control of the metallothionein promoter.

31

Panel B shows rp49 RNA present in equal amounts for Orai3+ cells with or without
CuSO4 . The rp49 RT-PCR measures the expression of the housekeeping gene rp49, and
serves as a positive control for RT-PCR from Orai3+ S2s. Panel C shows more HygBP
RNA in Orai3+ S2 cells with no CuSO4 added. This is suggestive of a pipetting error
occurring. Panels A, B and C all showed no evidence of DNA contamination of these
RT-PCR reactions, as lanes where RT was omitted had not produce bands.
Some lower bands were observed in all the RT-PCR reactions and are likely the result
of primer-dimer products. Such phenomenon has been documented elsewhere (8).

32

bp
1000
750
500
400
300
200
100

M

1

3

2

4

5
A

rp49
HygBP

B

165 bp
303 bp

750 µM CuSO4
RT
STIM1 DNA
STIM1 RNA

−
−
+
−

C

+
+
−
+

+
−
−
+

−
+
−
+

−
−
−
+

Figure 3.4: STIM1 expression is inducible in Drosophila S2 cells using 750 µM CuSO4
(A) In lanes 1-5 the STIM1 RT-PCR primer pair are used (see table 2.3). Lane 1 shows the
positive control PCR band using STIM1 template DNA. Lanes 2-5 show RT-PCRs using
RNA from isolated pucHygMT-STIM1 transfected S2 cells. Lanes 2-3: S2 cells induced
with 750 µM CuSO4 . 228 bp band present only when RT added. Lanes 4-5: S2 cells not
induced with CuSO4 . Faint band at 228 bp seen when RT added. (B) RT-PCR using rp49
primers yields bands only in the lanes with RT added. (C) RT-PCR using HygBP primers
yields bands only in the lanes where RT added.

The RT-PCR reactions in figure 3.4 were performed on RNA collected from pucHygMT-STIM1-transfected (STIM1+) S2 cells. Figure 3.4 shows that induction of STIM1
RNA in these S2 cells is successful. Panel A shows that DNA positive control and RNA
induction bands are the same size. Both show up in the region where we would expect to
see a 228 bp band. A faint band in the uninduced STIM1 RT-PCR reaction is visible in lane
4 of panel A. This suggests a basal level of expression for STIM1 when under the control
of the metallothionein promoter.
Panels B and C show that more RNA was present in RT-PCR reactions of uninduced
STIM1+ S2 cells, when compared to RNA from CuSO4 induced STIM1+ S2 cells. This
was present in both panels B and C, suggesting an error in estimating the RNA concentra33

tion using the NanoDrop spectrophotometer. This adds further support for the successful
induction of STIM1 RNA from CuSO4 induced STIM1+ cells. More RNA was present
in the uninduced RT-PCR reactions, yet a much brighter STIM1 band was present in the
CuSO4 induced lane.
There was no evidence of DNA contamination of the RT-PCR reactions, as lanes without RT, produced no bands.

34

3.3

Effective measurement of Ca2+ transients

A

E ffe c tiv e m e a s u r e m e n t o f S O C E is r e d u c e d in a b s e n c e o f P r o b e n e c id
2 .8

2 C a

2 .6

1 E G T A
2 0 µM C P A

2 C a

2 C a
2 0 0 µM

2 -A P B

2 .4

R a tio [4 0 ] [3 4 0 /3 8 0 ]

2 .2
2 .0
1 .8
1 .6
1 .4
1 .2
1 .0
0 .8
0 .0
0

2 0 0

4 0 0

6 0 0

8 0 0

1 0 0 0

tim e ( s )

B

3 4 0 a n d 3 8 0 w a v e le n g th s in a b s e n c e o f p r o b e n e c id - C e ll 4 0
1 3 0
1 2 0

2 C a

1 E G T A
2 0 µM C P A

2 C a

2 C a
2 0 0 µM

3 4 0 [4 0 ]
3 8 0 [4 0 ]
2 -A P B

1 1 0
1 0 0

W a v e le n g th

9 0
8 0
7 0
6 0
5 0
4 0
3 0
2 0
1 0
0

2 0 0

4 0 0

6 0 0

8 0 0

1 0 0 0

tim e ( s )

Figure 3.5: The absence of probenecid results in poor Ca2+ imaging results in S2 cells.
(A) The ratio of the 340 nm and 380 nm wavelengths of an individual cell during the course
of one perfusion experiment where probenecid was omitted from the incubation solution.
(B) The individual 340 nm and 380 nm wavelength values, which produced the ratio seen
in A.

35

Figure 3.5A shows a recording from an individual S2 cell which was loaded without
probenecid present in the dye-loading solution (DLS). Figure 3.5B shows the individual
340 and 380 nm wavelength values that produced the trace in A. Though the trace of the
ratio hides it, we see that both wavelengths values start decreasing immediately after the
start of the experiment. The decreasing values continues to the end of the experiment. The
decay likely reflects the leakage of Fura-2 which takes place in S2 cells if probenecid is
absent in the DLS (11). The Ca2+ ratios reported after SOCE, upon reintroduction of 2
Ca are also shown to be low here. This is most likely an artifact caused by less Fura-2
availability, thereby limiting the amount of Ca2+ which can be measured in the cytosol.

36

A

M e a s u r e m e n t o f S O C E is im p r o v e d b y a d d itio n o f 2 .5 m M
2 C a

3 .8
3 .6

1 E G T A
2 0 µM C P A

2 C a

2 C a
2 0 0 µM

P r o b e n e c id

2 -A P B

3 .4
3 .2

R a tio [1 9 ] [3 4 0 /3 8 0 ]

3 .0
2 .8
2 .6
2 .4
2 .2
2 .0
1 .8
1 .6
1 .4
1 .2
1 .0
0 .8
0 .0
0

2 0 0

4 0 0

6 0 0

8 0 0

1 0 0 0

tim e ( s )

B

3 4 0 a n d 3 8 0 w a v e le n g th s in 2 .5 m M
1 3 0

2 C a

1 2 0

1 E G T A
2 0 µM C P A

p r o b e n e c id - C e ll 1 9
3 4 0 [1 9 ]
3 8 0 [1 9 ]

2 C a

2 C a
2 0 0 µM

2 -A P B

1 1 0
1 0 0

W a v e le n g th

9 0
8 0
7 0
6 0
5 0
4 0
3 0
2 0
1 0
0

2 0 0

4 0 0

6 0 0

8 0 0

1 0 0 0

tim e ( s )

Figure 3.6: The presence of 2.5 mM probenecid results in much improved Ca2+ imaging in S2 cells. (A) The ratio of the 340 nm and 380 nm wavelengths of an individual cell
during the course of a perfusion experiment where 2.5 mM probenecid was included in
the incubation solution. (B) The individual 340 nm and 380 nm wavelength values, which
produced the ratio seen in A.

37

Figure 3.6A shows a sample recording from a cell incubated with DLS containing
2.5 mM probenecid. The ratio is robust and provides better resolution than the trace in
figure 3.5. Figure 3.6B gives the individual 340 nm and 380 nm wavelengths which were
used to obtain the ratio in A. We are able to clearly see the reciprocal nature of the 340
nm and 380 nm wavelength values. The steady decline of the values over the course of
the experiment is no longer apparent. Probenecid has stopped or greatly slowed leakage
of Fura-2 from the cytosol. As a result, we are able to record higher Ca2+ transients as
more Fura-2 is available as the experiment proceeds, compared to cells loaded without
probenecid. This is readily apparent in the SOCE portion of the trace.

38

CE is reduced in absence of Probenecid

00

2 Ca

Effective measurement of SOCE is reduced in absence of Probenecid

A

2.8

2 Ca
200 µM 2-APB

2 Ca

2.6

1 EGTA
20 µM CPA

2 Ca

2 Ca
200 µM 2-APB

2.4
2.2

F 340/380

2.0
1.8
1.6
1.4
1.2
1.0
0.8
0.0

600

800

0

1000

200

400

600

800

1000

time (s)
Only 10.5% (n = 6) of cells responded without probenecid.

time (s)
n at RT °C responded without probenecid.

B

Figure 3.7: Addition of Probenecid improves Ca2+ recordings. (A) Recordings taken
from a population of cells incubated in dye-loading solution that did not contain probenecid
(B) Recordings taken from a population of cells incubated in dye-loading solution that
contained 2.5 mM probenecid.

39

Figure 3.7 shows a population of cells loaded without (A) and with (B) probenecid.
We are able to observe a larger Ca2+ transient, due to more Fura-2 being available. Also,
addition of probenecid results in more cells meeting the selection criteria for data collection. This can be attributed to Fura-2 retention in probenecid-treated S2 cells. The result is
more dye being available at the start of the experiment, and as it progresses.
Unhealthy cells, cells with damaged or otherwise compromised plasma membranes
may also be omitted from the data set in a reliable, unbiased manner after probenecid
treatment. Such cells would still display characteristics of cells not treated with probenecid,
such as pronounced, constant dye leakage.
Conditions for selecting data were formulated after looking at the individual 340 nm
and 380 nm wavelength values for probenecid-treated and untreated cells. Three out of six
of the cells in A, had either 340 nm or 380 nm wavelength values below 40. This led us
to use 40 as a cutoff value for data selection. For the S2 cells selected, both the 340 nm
and 380 nm wavelength values stayed at or above 40 during the initial 2 Ca perfusion. This
allowed for elimination of cells which were leaky, even after treatment with probenecid
which, for reasons explained above, were deemed undesirable.

40

A

E ffe c t o f 2 - A P B o n S O C E in m o c k tr a n s fe c te d S 2 s
3 .0

1 E G T A
2 0 µM C P A

2 C a

2 .8

2 C a

2 C a
5 0 µM

2 -A P B

2 C a
2 0 0 µM

2 -A P B

2 .6
2 .4

F 3 4 0 /F 3 8 0

2 .2
2 .0
1 .8
1 .6
1 .4
1 .2
1 .0
0 .8
0 .0

n = 3 6
0

2 0 0

4 0 0

6 0 0

8 0 0

1 0 0 0

1 2 0 0

tim e ( s )

B

E ffe c t o f 2 - A P B o n S O C E in o r a i3 tr a n s fe c te d S 2 s
3 .0
2 .8

2 C a

1 E G T A
2 0 µM C P A

2 C a

2 C a
5 0 µM

2 -A P B

2 C a
2 0 0 µM

2 -A P B

2 .6
2 .4

F 3 4 0 /F 3 8 0

2 .2
2 .0
1 .8
1 .6
1 .4
1 .2
1 .0
0 .8
0 .0
0

n = 4 4
2 0 0

4 0 0

6 0 0

8 0 0

1 0 0 0

1 2 0 0

tim e ( s )

Figure 3.8: Ca2+ measurements in transfected S2 cells perfused with 2-APB. The lines
above the trace are labeled with the solutions perfused during those times. A) Sample
trace of mock-transfected S2s showing the effect of 2-APB on SOCE. B) Sample trace of
Orai3-transfected S2s showing the effect of 2-APB on SOCE.

41

C

E ffe c t o f 2 - A P B o n S O C E in o r a i3 /s tim 1 c o - tr a n s fe c te d S 2 s
3 .0

2 C a

2 .8

1 E G T A
2 0 µM C P A

2 C a

2 C a
5 0 µM

2 -A P B

2 C a
2 0 0 µM

2 -A P B

2 .6
2 .4

F 3 4 0 /F 3 8 0

2 .2
2 .0
1 .8
1 .6
1 .4
1 .2
1 .0
0 .8
0 .0

n = 4 0
0

2 0 0

4 0 0

6 0 0

8 0 0

1 0 0 0

1 2 0 0

tim e ( s )

D

E ffe c t o f 2 - A P B o n S O C E in s tim 1 tr a n s fe c te d S 2 s
3 .0
2 .8

2 C a

1 E G T A
2 0 µM C P A

2 C a

2 C a
5 0 µM

2 -A P B

2 C a
2 0 0 µM

2 -A P B

2 .6
2 .4

F 3 4 0 /F 3 8 0

2 .2
2 .0
1 .8
1 .6
1 .4
1 .2
1 .0
0 .8
0 .0
0

n = 3 7
2 0 0

4 0 0

6 0 0

8 0 0

1 0 0 0

1 2 0 0

tim e ( s )

Figure 3.8: Ca2+ measurements in transfected S2 cells perfused with 2-APB. The lines
above the trace are labeled with the solutions perfused during those times. C) Sample trace
of Orai3+STIM1-transfected S2s showing the effect of 2-APB on SOCE. D) Sample trace
of STIM1-transfected S2s showing the effect of 2-APB on SOCE.

42

The composite in Figure 3.8 shows representative traces for Ca2+ imaging experiments where S2 cells have been mock-transfected or transfected with Orai3, STIM1, or
Orai3+STIM1. In Figure 3.8A we see a sample trace giving the result of an experiment
done on mock-transfected S2s. Initially, the 2 Ca perfusion of these mock-transfected S2s
is relatively stable. Upon introduction of 20 µM CPA in 1 EGTA, we observe an increase
in the F340/F380 ratio. This indicates an increase in cytosolic free Ca2+ , resulting from
leakage of Ca2+ from the ER. This Ca2+ leak achieves a maximum and subsequently declines. The decline phase is indicative of Ca2+ being pumped out of the cell, shuttled to
non-ER compartments, such as the mitochondria, or being bound by cytosolic Ca2+ chelators. Transport of Ca2+ to the ER is prevented by CPA, which blocks the SERCA pump.
After 7 minutes of perfusion in 1 EGTA/20 µM CPA, Ca2+ is reintroduced. The mocktransfected S2s then undergo SOCE, and a second Ca2+ transient forms at this stage. The
maximal Ca2+ entry after 2 Ca reintroduction is greater than maximal Ca2+ release from the
ER. The dOrai channels responsible for SOCE in S2 cells are able to open quickly, allowing
Ca2+ into the cell shortly after switching to the 2 Ca solution. We eventually begin to see
less Ca2+ recorded, which can be attributed to dOrai channels closing, slowing Ca2+ entry.
After 4 minutes in 2 Ca, 50 µM 2-APB is added to the perfusion solution. We see for
the mock-transfected S2 cells, that the gradual decline in Ca2+ becomes sharper, shortly after addition of 2-APB. This is expected because at these concentrations 2-APB is inhibitory
for dOrai. The decline in Ca2+ continues during the 4 minutes in 50 µM 2-APB.
After 4 minutes in 2 Ca with 50 µM 2-APB, the 2-APB concentration is increased
to 200 µM 2-APB. This solution was perfused across the cells for another 4 minutes and
then the experiment was stopped. During this time we observe what seems to be a slight
increase. The overlap of the error bars along the trace indicate that, while there is a trend
toward an increase, further analysis is required to determine its significance. In order to
address the question of what happens to Ca2+ , the area under the curve was calculated for
each 4 minute section after store-depletion occurred for each group of transfected cells.

43

Figure 3.8B shows a sample trace of an experiment on Orai3-transfected S2s. The
initial and store-depletion phases are similar to those in the mock-transfected S2s. 2 Ca
reintroduction shows the swift onset of SOCE. The expected increase in Ca2+ after addition
of 50 µM 2-APB is not seen, however. Addition of 200 µM 2-APB seemed to result in a
marginal increase in Ca2+ entry. The Ca2+ content of this 200 µM 2-APB phase was
analyzed further and no significant change from the mock was found (see figure 3.9).
Since no distinct effect of 2-APB was observed in S2s transfected with Orai3 only,
Orai3+STIM1 transfections were performed. A sample trace for one of these experiments
is provided in Figure 3.8C. The store-depletion and SOCE phases again seem similar to
that of the mock- and Orai3-transfected cells. When treated with 50 and 200 µM 2-APB,
no clear trend was visible compared to the mock- or Orai3-transfected cells.
In Figure 3.8D a similar experiment was performed, but on STIM1-transfected S2s.
Here, the store-depletion and SOCE phases after 2 Ca reintroduction are similar to mock
and other transfections. Interestingly, addition of 50 µM 2-APB in the STIM1 only transfected cells, was less effective at slowing Ca2+ entry than in the other transfections. When
200 µ 2-APB was added, a clear increase in cytosolic Ca2+ was observed.

44

C y to p la s m ic c a lc iu m

c o n te n t in tr a n s fe c te d S 2 c e lls

In te g r a l u n d e r c u r v e o f F u r a - 2 r a tio ( A U )

3 5 0

M o c k
O r a i3
O r a i3
S tim 1

3 0 0

2 5 0

***
***

2 0 0

***

(n
(n
+
(n

= 1
= 1
S tim
= 1

0 0
1 4
1
1 0

)
)
(n = 1 4 2 )
)

***
***
***

1 5 0

1 0 0

5 0
2 C a

2 C a + 5 0 2 -A P B

2 C a + 2 0 0 2 -A P B

D r u g P e r fu s io n
Figure 3.9: Cytoplasmic Ca2+ content in transfected S2 cells. The bars represent area
under the curve analysis for segments where 2 Ca, 2 Ca + 50 µM 2-APB, or 2 Ca +
200 µM 2-APB were used to perfuse transfected S2 cells. The transfection groups are
indicated in the legend. Significant differences between the transfected groups at the 0.05
significance level are indicated by ***. No significant difference was found between the 2
Ca perfusion group. Significant differences were found between the 2 Ca + 50 µM 2-APB
and 2 Ca + 200 µM 2-APB perfusion groups.

Figure 3.9 displays the results of area under the curve (AUC) analysis on the three
phases of treatment after store-depletion. By doing AUC analysis, the ratios generated by
Fura-2 recordings were translated into cytosolic Ca2+ content of arbitrary units. The three
groups in the bar graph correspond to perfusion with 2 Ca, 2 Ca + 50 µM 2-APB, and 2 Ca
+ 200 µM 2-APB. The perfusion time for each group was 4 minutes. A one way ANOVA
was used to determine if there were significant differences in the drug treatment groups. If
significant differences were found, Tukey’s studentized range test, was used to determine
45

where significant differences lie between the transfection groups.
The 2 Ca group represents an untreated period of SOCE in the transfection groups.
Statistical analysis showed no significant change in cytosolic Ca2+ for this group. Functional Orai3 Ca2+ channels were expected to increase the levels of cytosolic Ca2+ during
SOCE. That this was not observed may be due to the inability of Orai3 to express in the
membrane, a possibility addressed in the discussion.
The 2 Ca + 50 2-APB experiments did show significant differences in this treatment group. Significant differences existed between Orai3+STIM1-transfected cells and
the Orai3 only transfected group. There were also significant differences between STIM1
only transfected cells and Orai3 only transfected cells. For both of the groups described
above, the Orai3 only group showed much less cytosolic Ca2+ , which was unexpected.
A significant difference was also found between mock-transfected and STIM1-transfected
cells, with the STIM1-transfected group containing higher levels of cytosolic calcium than
the mock-transfected group. The significant differences for all of the above was p < 0.0001
at the 0.05 significance level.
The 2 Ca + 200 2-APB showed a small but significant difference only between the
STIM1-transfected cells and all the other groups. Again, an unexpected result which is
discussed further below.

46

Discussion
As demonstrated in figures 3.1 and 3.2 the ligation of the inserts and subsequent cloning of
pucHygMT-Orai3 and pucHygMT-STIM1 were successful. Drosophila vectors capable of expressing mammalian Orai3 and STIM1 genes in S2 cells were created, satisfying
specific aim #1.
Figures 3.3 and 3.4 then showed induction of Orai3 and STIM1 gene expression from
these vectors. This demonstrated that both vector constructs actually expressed these mammalian genes in Drosophila S2 cells, satisfying specific aim #2. Having carried out the
objectives in specific aims #1 and #2, we moved on to address specific aim #3: assessing
the effect of 2-APB on Orai3 channels. As mentioned previously concentrations of ≥ 50
µM 2-APB will activate mammalian Orai3 channels.
Initial attempts at taking Ca2+ measurements in S2 cells were thwarted by leakage of
Fura-2, the ratiometric dye being used, from these cells. As demonstrated in figures 3.5, 3.6
and 3.7 addition of the anion transport inhibitor probenecid was crucial to recording satisfactory calcium transients. We see that omission of probenecid led to ratio measurements
of SOCE transients which were lower than those recorded when probenecid was present.
The lower ratio maxima for SOCE transients was the result of less Fura-2 being present for
binding to Ca2+ due to a persistent leak. We see that addition of probenecid alleviated Fura2 leakage by blocking the transporters responsible, and resulted in better measurements of
S2 cell populations. This demonstrates that the use of probenecid for Ca2+ recordings of
Drosophila S2 cells is necessary for obtaining quality data.
47

After solving the issue of recording Ca2+ transients, assessing the effect of 2-APB
on S2 cells expressing Orai3 was possible. Our hypothesis, that gene expression of mammalian Orai3 in Drosophila S2s would result in Ca2+ channels that behaved similarly to
those in mammalian cells expressing Orai3 proved incorrect. As seen by the results presented in figures 3.8 and 3.9, Orai3 channel behavior in our Drosophila expression system
was anamalous. Aims #1 and two were achieved, but testing of aim #3 showed that the
expression model required further refinement.
An unexpected and interesting result from this study was the ability of STIM1 to cause
an increase in cytosolic Ca2+ . The results in figure 3.8 for the STIM1 only transfection hint
at less deactivation of dOrai occurring in 50 µM 2-APB compared to the mock transfection.
Addition of 200 µM 2-APB to STIM1 only transfected S2s resulted in a clear increase in
cytosolic calcium indicative of channel opening. One explanation is that another Ca2+
channel opened due to the combination of STIM1 and 2-APB. It may also be that 200 µM
2-APB is interacting with STIM1 leading to non-specific effects on dOrai. As this is only
present in the STIM1 transfected cells, and since STIM1 and Orai3+STIM1 transfected
S2s have the same amount of STIM1 (2 µg) this suggests an effector+2-APB interaction in
the absence of Orai3.
There are a few possibilities for why Orai3, either alone or with STIM1, did not display the expected Ca2+ increase after addition of 50 or 200 µM 2-APB. The most obvious
is that while Orai3 RNA production was induced with CuSO4 , actual protein production
did not occur. Another possibility is that the transfection efficiency was consistently low
with the TransIT-2020 reagent and pucHygMT-Orai3 DNA. This may have resulted in
poor expression of Orai3 and a paucity of Orai3 protein translation, leading to a deficiency
in Orai3 channels expressed at the cellular surface. Another possibility is that, because of
how closely related Orai3 and dOrai are, Orai3 forms heterodimers with dOrai, and adopts
a phenotype primarily dOrai in nature.
Given that STIM1 expression results in an unexpected phenotype, it is unlikely that

48

Orai3, the smaller protein which was made in a similar manner, does not express. It is more
likely that interactions with the closely related dOrai result in heteromeric channels, and it
is the output from those channels that we are investigating.
Transfection of Orai3 with STIM1 did lead to a significant increase in cytosolic Ca2+
compared to Orai3 only transfected cells (see figure 3.9). This suggests that dStim is not
sufficient for Orai3 function.
Future work on this project will involve testing the possibilities presented above, for
why Orai3 activation did not occur after 2-APB treatment. The generation of stable cell
lines using the hygromycin B resistance conferred by pucHygroMT is underway. Stable
lines expressing Orai3 and STIM1 will facilitate experiments needed to test these possibilities.
Protein expression of Orai3 can be tested by isolating proteins from transfected cells
and performing a Western Blot using antibodies to Orai3. Testing for interference from native dOrai by performing RNAi knockdown will address the issue of dOrai influencing the
Orai3 channel phenotypes. These types of experiments are also beneficial because Orai3
Ca2+ channel function can be assessed on a dOrai free background. Beyond the potential
issue of dOrai affecting Orai3 function and/or expression, RNAi knockdown of dOrai allows study of only Orai3 channels without any contributions from dOrai channels. This
will be useful for defining Orai3 channel function, as opposed to general SOCE channel
function, to which Orai3 may contribute.

4.1

Conclusion

The creation of an expression system for mammalian Orai Ca2+ channels to be used for
drug discovery purposes was begun in this study. The proteins selected to probe the feasibility of using such a system were the mammalian Orai3 Ca2+ channel, and mammalian
Ca2+ sensor STIM1. Constructs which expressed in S2 cells were created and were able

49

to successfully express genes from both mammalian Orai3, and mammalian STIM1. The
system was not able to reproduce the function of the Orai3 Ca2+ , in the presence of the
known effector 2-APB, highlighting the need for further refinement, before use in future
drug studies.
The system is effective in inducing the expression of Orai3 and STIM1, however,
and is currently being used to generate stable cell lines to further this study. The system
promises to be a very useful tool, for study of not just Orai3 channels, but the entire Orai
family. Given the importance of SOCE to immune cells, and related disease states, this
initial work and future studies based upon it, promise to be important vehicles for contributing to the body of knowledge in the field of Ca2+ entry. Study of diseases resulting
from disrupted Ca2+ homeostasis including forms of cancer and autoimmune diseases may
also benefit from the creation of this type of expression system.

50

Bibliography

1. A SMILD , M.

AND

W ILLUMSEN , N. J. 2000. Chloride channels in the plasma mem-

brane of a foetal Drosophila cell line, S2. P߬ gers Archiv : European journal of physiolu
ogy 439, 6, 759–64.
2. BAKSH , S. AND B URAKOFF , S. J. 2000. The role of calcineurin in lymphocyte activation. Seminars in immunology 12, 4, 405–15.
3. BAUM , B.

AND

C HERBAS , L. 2008. Drosophila cell lines as model systems and as an

experimental tool. In Drosophila: Methods and Protocols, C. Dahmann, Ed. Vol. 420.
Humana Press, Totowa, NJ, Chapter 25, 391–424.
4. B ERRIDGE , M. J., B OOTMAN , M. D.,

AND

RODERICK , H. L. 2003. Calcium sig-

nalling: dynamics, homeostasis and remodelling. Nature Reviews Molecular Cell Biology 4, 7, 517–529.
5. B ERRIDGE , M. J., L IPP, P., AND B OOTMAN , M. D. 2000. The versatility and universality of calcium signalling. Nature Reviews Molecular Cell Biology 1, 1, 11–21.
6. B ILMEN , J. G., W OOTTON , L. L., G ODFREY, R. E., S MART, O. S., AND M ICHELAN GELI ,

F. 2002. Inhibition of SERCA Ca2+ pumps by 2-aminoethoxydiphenyl borate

(2-APB). European Journal of Biochemistry 269, 15, 3678–3687.

51

7. B UNCH , T., G RINBLAT, Y., AND G OLDSTEIN , L. 1988. Characterization and use of the
Drosophila metallothionein promoter in cultured Drosophila melanogaster cells. Nucleic
acids research 16, 3, 1043–61.
8. C HUMAKOV, K. 1994. Reverse transcriptase can inhibit PCR and stimulate primerdimer formation. PCR Methods and Applications 4, 1, 62–64.
9. C ORDOVA , D., D ELPECH , V. R., S ATTELLE , D. B.,

AND

R AUH , J. J. 2003. Spa-

tiotemporal calcium signaling in a Drosophila melanogaster cell line stably expressing a
Drosophila muscarinic acetylcholine receptor. Invertebrate neuroscience 5, 1, 19–28.
10. D ELLIS , O., M ERCIER , P.,

AND

C HOMIENNE , C. 2011. The boron-oxygen core of

borinate esters is responsible for the store-operated calcium entry potentiation ability.
BMC pharmacology 11, 1, 1.
11. D I V IRGILIO , F., S TEINBERG , T. H.,

AND

S ILVERSTEIN , S. C. 1990. Inhibition

of Fura-2 sequestration and secretion with organic anion transport blockers. Cell calcium 11, 2-3, 57–62.
12. E BLE , J.

A .,

W UCHERPFENNIG , K. W., G AUTHIER , L., D ERSCH , P., K RUKONIS ,

E., I SBERG , R. R.,

AND

H EMLER , M. E. 1998. Recombinant soluble human alpha 3

beta 1 integrin: purification, processing, regulation, and specific binding to laminin-5 and
invasin in a mutually exclusive manner. Biochemistry 37, 31, 10945–55.
13. E ID , J.-P., A RIAS , A. M., ROBERTSON , H., H IME , G. R., AND D ZIADEK , M. 2008.
The Drosophila STIM1 orthologue, dSTIM, has roles in cell fate specification and tissue
patterning. BMC developmental biology 8, 1, 104.
14. F ESKE , S., G WACK , Y., P RAKRIYA , M., S RIKANTH , S., P UPPEL , S.-H., TANASA ,
B., H OGAN , P. G., L EWIS , R. S., DALY, M., AND R AO , A. 2006. A mutation in Orai1
causes immune deficiency by abrogating CRAC channel function. Nature 441, 7090,
179–185.
52

15. G OTO , J.-I., S UZUKI , A. Z., O ZAKI , S., M ATSUMOTO , N., NAKAMURA , T.,
E BISUI , E., F LEIG , A., P ENNER , R.,

AND

M IKOSHIBA , K. 2010. Two novel 2-

aminoethyl diphenylborinate (2-APB) analogues differentially activate and inhibit storeoperated Ca(2+) entry via STIM proteins. Cell calcium 47, 1, 1–10.
16. G WACK , Y., S RIKANTH , S., F ESKE , S., C RUZ -G UILLOTY, F., O H - HORA , M.,
N EEMS , D., H OGAN , P.,

AND

R AO , A. 2007. Biochemical and functional character-

ization of Orai proteins. Journal of Biological Chemistry 282, 22, 16232–43.
17. H OTH , M. AND P ENNER , R. 1992. Depletion of intracellular calcium stores activates
a calcium current in mast cells. Nature 355, 6358, 353–356.
18. J OHANSON , K., A PPELBAUM , E., D OYLE , M., H ENSLEY, P., Z HAO , B., A BDEL M EGUID , S., YOUNG , P., C OOK , R., C ARR , S., M ATICO , R.,

AND

OTHERS. 1995.

Binding Interactions of Human Interleukin 5 with Its Receptor α Subunit. Journal of
Biological Chemistry 270, 16, 9459–9471.
19. L AMBERT, D. G. 2006. Calcium signaling protocols, 2nd ed. Methods in molecular
biology. Humana Press, Totowa, NJ.
20. L ANSDELL , S. J., C OLLINS , T., YABE , A., G EE , V. J., G IBB , A. J., AND M ILLAR ,
N. S. 2008. Host-cell specific effects of the nicotinic acetylcholine receptor chaperone
RIC-3 revealed by a comparison of human and Drosophila RIC-3 homologues. Journal
of neurochemistry 105, 5, 1573–81.
21. L EWIS , R. S. 2001. Calcium signaling mechanisms in T lymphocytes. Annual review
of immunology 19, 497–521.
22. L IOU , J., K IM , M. L., H EO , W. D., J ONES , J. T., M YERS , J. W., F ERRELL , J. E.,
AND

M EYER , T. 2005. STIM is a Ca2+ sensor essential for Ca2+-store-depletion-

triggered Ca2+ influx. Current Biology 15, 13, 1235–1241.

53

23. L UCE -F EDROW, A., VON O HLEN , T., B OYLE , D., G ANTA , R. R.,

AND

C HAPES ,

S. K. 2008. Use of Drosophila S2 cells as a model for studying Ehrlichia chaffeensis
infections. Applied and environmental microbiology 74, 6, 1886–91.
24. M ASEREEUW, R., VAN P ELT , A., VAN O S , S., W ILLEMS , P., S MITS , P., AND RUS SEL ,

F. 2000. Probenecid interferes with renal oxidative metabolism: A potential pitfall

in its use as an inhibitor of drug transport. British journal of pharmacology 131, 1, 57–62.
25. M IGNEN , O., T HOMPSON , J. L.,

AND

S HUTTLEWORTH , T. J. 2008. Both Orai1

and Orai3 are essential components of the arachidonate-regulated Ca2+-selective (ARC)
channels. The Journal of physiology 586, 1, 185–95.
26. M ILLAR , N. S., BAYLIS , H. A ., R EAPER , C., B UNTING , R., M ASON , W. T.,

AND

S ATTELLE , D. B. 1995. Functional expression of a cloned Drosophila muscarinic acetylcholine receptor in a stable Drosophila cell line. The Journal of experimental biology 198, Pt 9, 1843–50.
27. M ONCOQ , K., T RIEBER , C. A .,

AND

YOUNG , H. S. 2007. The molecular basis for

cyclopiazonic acid inhibition of the sarcoplasmic reticulum calcium pump. The Journal
of biological chemistry 282, 13, 9748–57.
28. M OTIANI , R. K., A BDULLAEV, I. F., AND T REBAK , M. 2010. A novel native storeoperated calcium channel encoded by Orai3: selective requirement of Orai3 versus Orai1
in estrogen receptor-positive versus estrogen receptor-negative breast cancer cells. The
Journal of biological chemistry 285, 25, 19173–83.
29. P FEIFER , T. 1998. Expression of heterologous proteins in stable insect cell culture.
Current opinion in biotechnology 9, 5, 518–21.
30. P RAKRIYA , M., F ESKE , S., G WACK , Y., S RIKANTH , S., R AO , A.,

AND

H OGAN ,

P. G. 2006. Orai1 is an essential pore subunit of the CRAC channel. Nature 443, 7108,
230–233.
54

31. P RAKRIYA , M.

AND

L EWIS , R. S. 2001. Potentiation and inhibition of Ca(2+)

release-activated Ca(2+) channels by 2-aminoethyldiphenyl borate (2-APB) occurs independently of IP(3) receptors. The Journal of physiology 536, 1, 3–19.
32. P UTNEY, J. W. 1986. A model for receptor-regulated calcium entry. Cell Calcium 7, 1,
1–12.
33. P UTNEY, J. W. 2006. Calcium signaling, 2nd ed. Methods in signal transduction.
CRC Press, Boca Raton, FL.
34. ROOS , J., D I G REGORIO , P. J., Y EROMIN , A. V., O HLSEN , K., L IOUDYNO , M.,
Z HANG , S., S AFRINA , O., KOZAK , J. A., WAGNER , S. L., C AHALAN , M. D.,
V ELIC ELEBI , G., AND S TAUDERMAN , K. A . 2005. STIM1, an essential and conserved
¸
component of store-operated Ca2+ channel function. The Journal of cell biology 169, 3,
435–45.
35. S AMBROOK , J.

AND

RUSSELL , D. W. 2001. Molecular cloning: a laboratory man-

ual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
36. S CHETZ , J. A .

AND

S HANKAR , E. P. N. 2004. Protein expression in the Drosophila

Schneider 2 cell system. Current protocols in neuroscience Chapter 4, 4.16.1–15.
37. S CHNEIDER , I. 1972. Cell lines derived from late embryonic stages of Drosophila
melanogaster. Journal of embryology and experimental morphology 27, 2, 353–65.
38. S MYTH , J., H WANG , S., T OMITA , T., D E H AVEN , W., M ERCER , J.,

AND

P UTNEY,

J. 2010. Activation and regulation of store-operated calcium entry. Journal of Cellular
and Molecular Medicine 14, 10, 2337–2349.
39. S OBOLOFF , J., S PASSOVA , M. A., H EWAVITHARANA , T., H E , L.-P., X U , W., J OHN STONE ,

L. S., D ZIADEK , M. A.,

AND

G ILL , D. L. 2006. STIM2 is an inhibitor of

STIM1-mediated store-operated Ca2+ Entry. Current Biology 16, 14, 1465–1470.
55

40. S TREB , H., I RVINE , R. F., B ERRIDGE , M. J.,

AND

S CHULZ , I. 1983. Release of

Ca2+ from a nonmitochondrial intracellular store in pancreatic acinar cells by inositol1,4,5-trisphosphate. Nature 306, 5938, 67–69.
41. TAYLOR , C. 2006. Store-operated Ca2+ entry: a STIMulating stOrai. Trends in biochemical sciences 31, 11, 597–601.
42. T IMMERMAN , L. A., C LIPSTONE , N. A., H O , S. N., N ORTHROP, J. P., AND C RAB TREE ,

G. R. 1996. Rapid shuttling of NF-AT in discrimination of Ca2+ signals and

immunosuppression. Nature 383, 6603, 837–840.
43. V IG , M., P EINELT, C., B ECK , A., KOOMOA , D. L., R ABAH , D., KOBLAN H UBERSON , M., K RAFT, S., T URNER , H., F LEIG , A., P ENNER , R., AND K INET, J.-P.
2006. CRACM1 is a plasma membrane protein essential for store-operated Ca2+ entry.
Science 312, 5777, 1220–23.
44. W ILLIAMS , R., M ANJI , S., PARKER , N., H ANCOCK , M., VAN S TEKELENBURG ,
L., E ID , J., S ENIOR , P., K AZENWADEL , J., S HANDALA , T., S AINT, R., S MITH , P. J.,
AND

D ZIADEK , M. A. 2001. Identification and characterization of the STIM (stromal

interaction molecule) gene family: coding for a novel class of transmembrane proteins.
Biochemical Journal 357, 3, 673–685.
45. X U , Y.-B., L I , H.-P., Z HANG , J.-B., S ONG , B., C HEN , F.-F., D UAN , X.-J., X U , H.Q., AND L IAO , Y.-C. 2010. Disruption of the chitin synthase gene CHS1 from Fusarium
asiaticum results in an altered structure of cell walls and reduced virulence. Fungal
genetics and biology 47, 3, 205–15.
46. YAGODIN , S., P IVOVAROVA , N. B., A NDREWS , S. B., AND S ATTELLE , D. B. 1999.
Functional characterization of thapsigargin and agonist-insensitive acidic Ca2+ stores in
Drosophila melanogaster S2 cell lines. Cell calcium 25, 6, 429–38.

56

47. Y EROMIN , A. V., ROOS , J.,

A

S TAUDERMAN , K.,

AND

C AHALAN , M. D. 2004. A

store-operated calcium channel in Drosophila S2 cells. The Journal of general physiology 123, 2, 167–182.
48. Z HANG , S. L., KOZAK , J. A., J IANG , W., Y EROMIN , A. V., C HEN , J., Y U , Y.,
P ENNA , A., S HEN , W., C HI , V.,

AND

C AHALAN , M. D. 2008. Store-dependent and

-independent modes regulating Ca2+ release-activated Ca2+ channel activity of human
Orai1 and Orai3. The Journal of biological chemistry 283, 25, 17662–71.
49. Z HANG , S. L., Y EROMIN , A. V., Z HANG , X. H.-F., Y U , Y., S AFRINA , O., P ENNA ,
A., ROOS , J., S TAUDERMAN , K. A ., AND C AHALAN , M. D. 2006. Genome-wide RNAi
screen of Ca(2+) influx identifies genes that regulate Ca(2+) release-activated Ca(2+)
channel activity. Proceedings of the National Academy of Sciences of the United States
of America 103, 24, 9357–62.
50. Z HANG , S. L., Y U , Y., ROOS , J., KOZAK , J. A., D EERINCK , T. J., E LLISMAN ,
M. H., S TAUDERMAN , K. A.,

AND

C AHALAN , M. D. 2005. STIM1 is a Ca2+ sensor

that activates CRAC channels and migrates from the Ca2+ store to the plasma membrane.
Nature 437, 7060, 902–905.
51. Z WEIFACH , A.

AND

L EWIS , R. S. 1993. Mitogen-regulated Ca2+ current of T lym-

phocytes is activated by depletion of intracellular Ca2+ stores. Proceedings of the National Academy of Sciences of the United States of America 90, 13, 6295–99.

57