Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Possible bug in filtering of indels #96

Open
gevro opened this issue May 9, 2024 · 38 comments
Open

Possible bug in filtering of indels #96

gevro opened this issue May 9, 2024 · 38 comments

Comments

@gevro
Copy link

gevro commented May 9, 2024

Hi,
In recent samples analyzed with v3.5.5, we see very high indel burdens.

I found several examples of indels that overlap the NOISE mask, but were not filtered out - they still show up with FILTER=PASS.

$ tabix NOISE.sorted.GRCh38.bed.gz chr1:43861432-43861436
chr1 43861434 43861453

In results.indel.vcf.gz:
chr1 43861434 . GCTGTCAGGACTTGTATAGA G 225.417 PASS INDEL;IDV=8;IMF=1;DP=8;VDB=1.33331e-05;SGB=-0.651104;MQSBZ=0;BQBZ=0;MQ0F=0;AC=1;AN=1;DP4=0,0,8,0;MQ=60;QPOS=97;RB=chr1,43861337,43861899,GGC,TAT;BBEG=43861337;BEND=43861899;DEPTH_FWD=5;DEPTH_REV=3;DEPTH_NORM_FWD=12;DEPTH_NORM_REV=12;DPLX_ASXS=119;DPLX_CLIP=0;DPLX_NM=19;BULK_ASXS=90;BULK_NM=0;NN=[0:118:0];SEQ=GGTGTGGAGCTGTCAGGA GT:PL:DP:DV:SP:DP4 1:255,0:8:8:0:0,0,8,0
chr1 43861434 . GCTGTCAGGACTTGTATAGA G 225.417 PASS INDEL;IDV=8;IMF=1;DP=8;VDB=0.125998;SGB=-0.651104;MQSBZ=0;BQBZ=0;MQ0F=0;AC=1;AN=1;DP4=0,0,4,4;MQ=60;QPOS=97;RB=chr1,43861337,43861546,AAG,TGA;BBEG=43861337;BEND=43861546;DEPTH_FWD=4;DEPTH_REV=4;DEPTH_NORM_FWD=12;DEPTH_NORM_REV=12;DPLX_ASXS=109;DPLX_CLIP=0;DPLX_NM=19;BULK_ASXS=90;BULK_NM=0;NN=[0:118:0];SEQ=GGTGTGGAGCTGTCAGGA GT:PL:DP:DV:SP:DP4 1:255,0:8:8:0:0,0,4,4

I am confident that I ran the pipeline with NOISE.sorted.GRCh38.bed.gz.

Is there a possible bug in applying the NOISE (and/or SNP) masks to indel results?

Thanks

@gevro
Copy link
Author

gevro commented May 9, 2024

Also, when you all created the human SNP filters, does it also include indels above a certain population AF threshold, or only SNPs? Per your paper you include population frequent indels that do not have the PASS flag in gnomad, but do you include indels that DO have the PASS flag in the SNP mask?

@gevro
Copy link
Author

gevro commented May 9, 2024

Just to add further confirmation - within that same sample there is an indel that was MASKED properly by the NOISE mask:
$ tabix NOISE.sorted.GRCh38.bed.gz chr1:4304586-4304592
chr1 4304586 4304598

In results.indel.vcf.gz:
chr1 4304586 . CGTGTGTGTGTGT C 225.417 MASKED INDEL;IDV=11;IMF=1;DP=11;VDB=2.26006e-08;SGB=-0.676189;MQSBZ=0;MQ0F=0;AC=1;AN=1;DP4=0,0,0,11;MQ=60;QPOS=58;RB=chr1,4304440,4304644,GAG,CTG;BBEG=4304440;BEND=4304644;DEPTH_FWD=5;DEPTH_REV=6;DEPTH_NORM_FWD=0;DEPTH_NORM_REV=15;DPLX_ASXS=84;DPLX_CLIP=0;DPLX_NM=14.2;BULK_ASXS=109;BULK_NM=1;NN=[0:209:0];SEQ=GATGTACACGTGTGTGTG GT:PL:DP:DV:SP:DP4 1:255,0:11:11:0:0,0,0,11

So this shows that the noise mask was applied correctly during the run configuration. So that leaves the question why the above indel (chr1 43861434) was not masked.

@gevro
Copy link
Author

gevro commented May 10, 2024

Another strange thing -- another sample analyzed in the same batch has the same indel artifact and it was masked:

chr1 43861434 . GCTGTCAGGACTTGTATAGA G 225.417 MASKED INDEL;IDV=15;IMF=0.9375;DP=16;VDB=0.0148393;SGB=-0.689466;RPBZ=-1;MQBZ=0;MQSBZ=0;BQBZ=0;SCBZ=0;MQ0F=0;AC=1;AN=1;DP4=0,0,8,8;MQ=60;QPOS=97;RB=chr1,43861337,43861545,AAG,GTG;BBEG=43861337;BEND=43861545;DEPTH_FWD=10;DEPTH_REV=6;DEPTH_NORM_FWD=13;DEPTH_NORM_REV=14;DPLX_ASXS=107;DPLX_CLIP=0;DPLX_NM=19.8;BULK_ASXS=109;BULK_NM=0;NN=[0:153:0];SEQ=GGTGTGGAGCTGTCAGGA GT:PL:DP:DV:SP:DP4 1:255,0:16:16:0:0,0,8,8

So it isn't clear why in one sample it was correctly masked by the NOISE mask, and not in another sample. The code to run the analyses of these samples was the same.

The only thing I can think of is if there is something in the indel masking code that "rescues" an indel even though it is in a region of the masks.

@fa8sanger
Copy link
Collaborator

fa8sanger commented May 10, 2024 via email

@fa8sanger
Copy link
Collaborator

fa8sanger commented May 10, 2024 via email

@gevro
Copy link
Author

gevro commented May 10, 2024

Thanks, however, I'm seeing a very large number of these examples to the point that artifacts outnumber real indels. What are the key parameters or lines of code that do this? And what was the motivation to make it more intricate versus filtering out those regions directly?

@gevro
Copy link
Author

gevro commented May 10, 2024

Also, is this issue only relevant for indel filtering or also snv filtering?

@gevro
Copy link
Author

gevro commented May 10, 2024

Sorry for all the questions, but also, is there anything in the final VCF results that can allow me to determine which of these indel sites had this issue versus not? Or is this only determinable internally at the time of filtering?

@fa8sanger
Copy link
Collaborator

fa8sanger commented May 10, 2024 via email

@fa8sanger
Copy link
Collaborator

fa8sanger commented May 10, 2024 via email

@fa8sanger
Copy link
Collaborator

fa8sanger commented May 10, 2024 via email

@gevro
Copy link
Author

gevro commented May 10, 2024

Do you mean those artifacts are cause by this rare circumstance? I wouldn’t expect so
Yes, I'm seeing quite a few of these artifacts. It doesn't seem that rare. In the meantime I will manually intersect the indel calls with the SNP and NOISE masks again post-analysis. I'm not sure I understand why in some samples it would be a more prevalent issue vs other samples.

@gevro
Copy link
Author

gevro commented Jun 3, 2024

Hi,
I think I found a possible contributor to the higher than expected indel rates. I think there might be a coordinate bug in your NOISE.sorted.GRCh38.bed.gz file.

I am seeing for example many of this indel artifact:

  CHROM     POS   ID REF ALT    QUAL FILTER
1  chr1 5287895 <NA>   G  GC 92.4151   PASS
2  chr1 5287895 <NA>   G  GC 108.415   PASS
3  chr1 5287895 <NA>   G  GC 130.416   PASS
4  chr1 5287895 <NA>   G  GC 173.416   PASS
                                                                                                                                                                                                                                                                                                                                      INFO
1       INDEL;IDV=4;IMF=1;DP=4;VDB=0.0058656;SGB=-0.556411;MQSBZ=0;BQBZ=0;MQ0F=0;AC=1;AN=1;DP4=0,0,4,0;MQ=60;QPOS=121;RB=chr1,5287774,5288396,ATG,AAT;BBEG=5287774;BEND=5288396;DEPTH_FWD=2;DEPTH_REV=2;DEPTH_NORM_FWD=15;DEPTH_NORM_REV=0;DPLX_ASXS=115;DPLX_CLIP=0;DPLX_NM=1;BULK_ASXS=101;BULK_NM=0;NN=[0:175:0];SEQ=TTGGCAGTGAGCTGCTGT
2           INDEL;IDV=5;IMF=1;DP=5;VDB=0.00187095;SGB=-0.590765;BQBZ=-2;MQ0F=0;AC=1;AN=1;DP4=0,0,5,0;MQ=60;QPOS=122;RB=chr1,5287773,5288395,TAA,CCC;BBEG=5287773;BEND=5288395;DEPTH_FWD=2;DEPTH_REV=3;DEPTH_NORM_FWD=15;DEPTH_NORM_REV=0;DPLX_ASXS=109;DPLX_CLIP=0;DPLX_NM=2.3;BULK_ASXS=101;BULK_NM=0;NN=[0:175:0];SEQ=TTGGCAGTGAGCTGCTGT
3     INDEL;IDV=7;IMF=1;DP=7;VDB=6.71664e-05;SGB=-0.636426;BQBZ=-1.1547;MQ0F=0;AC=1;AN=1;DP4=0,0,7,0;MQ=60;QPOS=122;RB=chr1,5287773,5288537,TAT,CCT;BBEG=5287773;BEND=5288537;DEPTH_FWD=4;DEPTH_REV=3;DEPTH_NORM_FWD=15;DEPTH_NORM_REV=0;DPLX_ASXS=104;DPLX_CLIP=0;DPLX_NM=3.3;BULK_ASXS=101;BULK_NM=0;NN=[0:175:0];SEQ=TTGGCAGTGAGCTGCTGT
4 INDEL;IDV=13;IMF=1;DP=13;VDB=2.26006e-08;SGB=-0.683931;BQBZ=-1.96666;MQ0F=0;AC=1;AN=1;DP4=0,0,13,0;MQ=60;QPOS=121;RB=chr1,5287774,5288395,AAG,TGG;BBEG=5287774;BEND=5288395;DEPTH_FWD=9;DEPTH_REV=4;DEPTH_NORM_FWD=15;DEPTH_NORM_REV=0;DPLX_ASXS=112;DPLX_CLIP=0;DPLX_NM=1.5;BULK_ASXS=101;BULK_NM=0;NN=[0:175:0];SEQ=TTGGCAGTGAGCTGCTGT

This artifact is apparent in gnomAD: https://gnomad.broadinstitute.org/variant/1-5287895-G-GC?dataset=gnomad_r3

Note that the position in 1-based coordinates in gnomAD is: chr1:5287895

However, in NOISE.sorted.GRCh38.bed.gz, the coordinates are:
chr1 5287895 5287896

And it is not in SNP.sorted.GRCh38.bed.gz

So there might be a coordinate bug in the code that generated the NOISE mask. Maybe also in the SNP mask for some subset of it?

It also depends how your NanoSeq pipeline interprets these masks -- I'm assuming as 0-based coordinate BED files? If so, then only the NOISE mask needs to be fixed. Are you able to share the code that generated the NOISE mask, and I can try to help fix the bug to generate a new one?

Thanks

@gevro
Copy link
Author

gevro commented Jun 3, 2024

Addendum: I'm not 100% sure but I think this coordinate bug might only be happening with NOISE mask sites that correspond to indels in gnomAD. And not FILTERED gnomAD substitution sites.

I wonder if maybe in your code that generated the NOISE mask for gnomAD indels, that you set the coordinate to the base after the REF position. For example for the gnomAD indel site above of:
chr1:5287895 G > GC, you set it to chr1:5287896. And then in the NOISE bed file it is set to chr1 5287895 5287896.

However, the NanoSeq pipeline calls this indel with POS = 5287895, and then your NanoSeq pipeline doesn't know which of the NOISE mask sites are indels, so it doesn't filter the call.

I'm assuming the solution would be to instead put the gnomAD indel-related NOISE mask sites using the position corresponding to the REF POS, i.e. in the above situation as chr1 5287894 5287895 in BED coordinates, which corresponds to chr1:5287895 in 1-based coordinates.

I can fix this if you send me the code that generated the GRCh38 NOISE mask.

Thanks

@fa8sanger
Copy link
Collaborator

I am attaching two files, one explaining how the masks were built and one with the perl code used
get_subs_above_AF_v3.pl.txt
GENERATION OF THE SNP MASK FOR BOTSEQ.txt
get_subs_above_AF_v3.GRCh38.pl.txt

@fa8sanger
Copy link
Collaborator

fa8sanger commented Jun 3, 2024

Let me know if you find a problem, please. I added "txt" to the perl scripts to be able to attach them here

@fa8sanger
Copy link
Collaborator

I think you are right, I may have not handled insertions properly for the masks

@gevro
Copy link
Author

gevro commented Jun 3, 2024

I think I see where the bug is. But to fix this, it will help me to also understand internally in the nanoseq pipeline how insertion and deletion coordinates are represented against which the masks are applied? For example, for deletions in VCF coordinates, the first base of the POS is actually not deleted. The question is if in the nanoseq pipeline, that is also how coordinates are represented or do you represent the deleted bases only?

And for insertions in the nanoseq pipeline do you use the base in the reference that is before the insertion to represent the insertion, similar to how VCFs POS value represents insertions?

@fa8sanger
Copy link
Collaborator

Unless it's urgent for you, leave this with me. I'll investigate this a bit more to check coordinates are always handled the same way, and then I'll generate those masks again

@gevro
Copy link
Author

gevro commented Jun 3, 2024

Ok thanks. Regardless of the bug fix, I'm curious about the answers to these two questions for future reference?

  • In the nanoseq pipeline internally, how are deletion coordinates represented at the moment of NOISE masking -- in the same way as in VCF POS format (i.e., the REF base before the deletion), or the actual deleted bases?
  • In the nanoseq pipeline internally, are insertion coordinates specified at the moment of NOISE masking in the same way as in VCF POS format, i.e. the REF base preceding the inserted bases?

Note also that it looks like the hg38 NOISE mask is much smaller in terms of total # of bases than the hg19 NOISE mask, so I wonder if some other component is missing in hg38.

@fa8sanger
Copy link
Collaborator

In the nanoseq pipeline each of the deleted bases would be called separately.
Regarding insertion coordinates, I'd like to investigate this more

@gevro
Copy link
Author

gevro commented Jun 3, 2024

Ok, sure. Let me know if I can help. Not to bias you as you investigate, but just for my reference, my guess is these lines should be start = pos - 1 and end = pos, instead of the current:

			} elsif(length($alt) > length($ref)) {
				$type  = "ins";
				$start = $pos;
				$end   = $pos+1;

@fa8sanger
Copy link
Collaborator

fa8sanger commented Jun 5, 2024

I've uploaded the new masks to the usual repository, within a directory named New_5thJune2024 (link).

I opted for keeping the previously masked base and adding the previous one. Hence the current masks now mask an additional 169,913 bps

@gevro
Copy link
Author

gevro commented Jun 5, 2024

Thanks very much. Just a few questions:

  • Confirming this bug only affected the NOISE mask gnomad insertions, specifically they were missing the base before the indel?
  • Why is the # of bases covered by the NOISE mask for hg38 = 10348611 and for hg19 = 22474160?

@fa8sanger
Copy link
Collaborator

  1. yes, I confirm that
  2. for GRCh37 we also included information from our available panel of normal: "The noise mask also contains sites with elevated error-rates. For each genomic position, error-rates were estimated for each site using the fraction of mismatched bases across a panel of 448 in-house sequenced samples. Sites with error-rates > 0.01 were incorporated into the noise mask". We didn't have this for GRCh38

@gevro
Copy link
Author

gevro commented Jun 14, 2024

Hi, I think I found another bug for the NOISE mask filtering. It looks like deletions are not being filtered properly.

Take for example this gnomad vcf deletion variant:
chr17 76924456 . GGTGGGAAGCAGGTAACCA G
https://gnomad.broadinstitute.org/variant/17-76924456-GGTGGGAAGCAGGTAACCA-G?dataset=gnomad_r3

This was not filtered even though the NOISE mask bed file had this:
chr17 76924456 76924474

Specifically, the deletion in the NOISE mask bed file includes only the deleted bases, i.e. it spans chr17 76924456 76924474 in 0-based coordinates, which is chr17:76924457-76924474 in 1-based coordinates. Therefore, the NOISE mask does not include the 1-based coordinate chr17:76924456.

This suggests that the Nanoseq pipeline is not using NOISE mask regions properly to filter deletions.

An easy fix is to include in the NOISE mask for deletions also the preceding base. Though technically Nanoseq should have filtered these deletions.

Thanks

@fa8sanger
Copy link
Collaborator

fa8sanger commented Jun 15, 2024 via email

@gevro
Copy link
Author

gevro commented Jun 15, 2024

Thanks. I'll try to rerun with an extra 1 preceding base in the NOISE mask for deletions confirm.

Regarding the possibility of contamination: we know the vast majority of these indel artifacts are not contamination due to our study design. We have a set of samples from different individuals, with two independent biological somatic samples from each individual and undiluted nanoseq germline from a different tissue than the somatic samples. We either see these indel artifacts only in one somatic sample, or often in both somatic samples of the same individual but not any of the samples of any of the other individuals. If this were contamination, it would be improbable that they tend to show up concordantly in both somatic samples of the same individual. Our FREEMIX values are also very low.

There are two explanations I can think of: 1) these are early mosaic variants that did not show up in the undiluted germline data of that individual. 2) I noticed these tend to happen in regions with lower germline data read depth, near our cutoff limit of 15 reads. Perhaps indels affect PCR efficiency so one allele is not amplified as well and stochastically will not show up in germline data regions with lower read depth. An analysis of the width of the VAF distribution of indels vs snps in germline data might support this, if I find time to do this.

@fa8sanger
Copy link
Collaborator

fa8sanger commented Jun 15, 2024 via email

@gevro
Copy link
Author

gevro commented Jun 16, 2024

Sorry for not clarifying - some of these indels that show up > 1 time per sample in both somatic samples of an individual are in gnomad, but many also are not. I agree the ones in gnomad must be germline. The ones that are not in gnomad I think could be either germline but not detected in the germline sample, or they are early developmental mosaics or later clonal expansions that are in reality not in the germline sample that is from a different tissue than the somatic samples.

I looked in IGV at some of the ones that are in gnomad, which should be germline, but I don't see any sign of them in the raw reads. The only explanation I can think of is maybe PCR slightly skewed against amplifying the indel-containing allele. If this is the case, the prediction would be that the VAF distribution of true gnomad/germline indels is wider or has a lower VAF tail compared to the SNV VAF distribution, and the fix would be requiring a slightly higher read depth for indels. I can keep investigating and will let you know if I figure anything else out.

@gevro
Copy link
Author

gevro commented Jun 17, 2024

Hi, Just an update - I finished the rerun of the nanoseq pipeline with two NOISE masks that differ as follows: 1) gnomad deletions do contain the non-deleted preceding REF base (i.e. the POS column position in the gnomad VCF) and 2) gnomad deletions that do not contain the preceding REF base, i.e. the BED regions span only the actual deleted bases.

NOISE mask (1) removed nanoseq deletion calls that correspond to the gnomad-annotated deletions but NOISE mask (2) did not. This indicates that somewhere in the Nanoseq pipeline, it is filtering out NOISE mask deletions in a way that requires the NOISE mask to also include the preceding reference non-deleted base. Easy work-around is just using NOISE mask (1) either during the nanoseq pipeline or for post-pipeline filtering, but wanted to let you know since in your next iteration of NOISE mask filtering, this would probably be good to adjust.

Thanks!

@fa8sanger
Copy link
Collaborator

fa8sanger commented Jun 17, 2024 via email

@fa8sanger
Copy link
Collaborator

fa8sanger commented Jun 17, 2024 via email

@gevro
Copy link
Author

gevro commented Jun 17, 2024

I found an example also of a one base deletion that was removed by NOISE mask (1) but not NOISE mask (2).

Indel present when using NOISE mask (2) but absent with NOISE mask (1):
chr1 173705618 . GT G 67.4148 PASS INDEL;IDV=4;IMF=1;DP=4;VDB=0.0058656;SGB=-0.556411;BQBZ=-1.41421;MQ0F=0;AC=1;AN=1;DP4=0,0,0,4;MQ=60;QPOS=10;RB=chr1,173705035,173705628,GAG,ATT;BBEG=173705035;BEND=173705628;DEPTH_FWD=2;DEPTH_REV=2;DEPTH_NORM_FWD=0;DEPTH_NORM_REV=24;DPLX_ASXS=83;DPLX_CLIP=0;DPLX_NM=2.5;BULK_ASXS=94;BULK_NM=1;NN=[0:175:0];SEQ=TGCGCTGTGTTTGCACCA GT:PL:DP:DV:SP:DP4 1:97,0:4:4:0:0,0,0,4

NOISE mask (2) had this region:
chr1 173705618 173705619
-> This should have filtered out the deletion, because the deleted 'T' base is chr1:173705619 in 1-based coordinates and is chr 1 173705618 173705619 in 0-based BED coordinates.

NOISE mask (1) had this region:
chr1 173705617 173705619
-> This filtered out the deletion, presumably because the nanoseq pipeline was looking at the non-deleted preceding 'G' reference base at position chr1:173705618 in 1-based coordinates, which is chr1 173705617 173705618 in 0-based coordinates.

gnomad entry: https://gnomad.broadinstitute.org/variant/1-173705618-GT-G?dataset=gnomad_r3

Note, I'm experimenting with a different NOISE mask for hg38 than your code generates, since I wanted to use gnomad v3.1.2 and filter out some segdups and other noisy regions explicitly, since your 'shearwater' reference is not available for hg38. But the findings above regardless still show some filtering issue.

I will send you the details by direct email.

@fa8sanger
Copy link
Collaborator

fa8sanger commented Jun 17, 2024 via email

@gevro
Copy link
Author

gevro commented Jun 17, 2024

Ok. Let me know if I can provide any other info.

@fa8sanger
Copy link
Collaborator

fa8sanger commented Jun 17, 2024 via email

@gevro
Copy link
Author

gevro commented Jun 17, 2024

I am wondering too. Matched germline and somatic samples were all aligned in the exact same bwa pipeline. And sequenced all on the same instrument type (Novaseq X). I see plenty of indels in the matched normal, and it's just a relatively small (~10) of these that I see per sample. If there was some more radical depletion of indels in the matched normal, there would be many more somatic indel calls.

We actually check posts-deduplication coverage on all our matched normal and they are fine, all at least 30x post-deduplication, and usually much more. Regardless, the required minimum read depth in the pipeline for germline should eliminate that as the reason.

It could also be that the reason I'm noticing these is because of our study design where we have > 1 somatic sample from each person? That makes them easier to spot. And also because of the gnomad indel filtering bug which also brought out more of them. Possible that without those two things, I would never have noticed.

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
None yet
Projects
None yet
Development

No branches or pull requests

2 participants