Skip to content

Latest commit

 

History

History
140 lines (130 loc) · 6.59 KB

CHANGELOG.md

File metadata and controls

140 lines (130 loc) · 6.59 KB
Raw

Changelog

version 5.0.0

  • Small changes were made to support miniwdl and miniwdl is now the recommended tool to run this pipeline.
  • Clever is now disabled by default for SV calling. It can be enabled by setting the Germline.svCalling.runClever input to true.
  • Fixed a bug in structural variant calling which led to all INV, INS and BND events to be deleted if duphold filtering was enabled.
  • Added a workaround for an issue with survivor's parsing of SVs detected by clever.
  • Updated default survivor version to 1.0.7.
  • Automatically create BWA index, faidx and sequence dictionary for reference fasta file if not provided. Automatically create dbsnpVCF index if not provided.
  • Tumor only samples (with no control) will now be analysed in the somatic variant calling pipeline.
  • GRIDSS results will now be included in survivor.
  • Adapters should be set by the user from now on. The default adapter AGATCGGAAGAG (illumina universal adapter short version) actually appears several times in the human genome. It is recommended to use the full adapter sequence instead:
    • forward reads: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
    • reverse reads: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
  • UMI deduplication is now performed using Picard UmiAwareMarkDuplicatesWithMateCigar. This requires FASTQ files to have the UMI appended to the read ID. These files can be generated by umi-tools extract.
  • Added the commonVariantSites and commonVariantSitesIndex inputs to the somatic worklow. This allows for a separate known variant list to be specified for use in CNV calling, instead of the usual dbSNP.

version 4.1.0

  • sample.wdl: Remove postUmiDedupMarkDuplicates.
  • dockerImages.yml: Update umitools (v1.1.1) image (include samtools for indexing).
  • Replace travis with github CI.
  • renamedVCFs was changed to modifiedVcfs.
  • Add the dockerImages to the output section.
  • Add bwa-mem2 capability.

version 4.0.0

  • Updated default versions for several tools to the newest version. Pin the volatile python container to a specific hash digest.
  • Changes in Cromwell 48 made it impossible to use the wide array of inputs in our documentation (such as Germline.sampleWorkflow.QC.Cutadapt.minimumLength). Fixes have been made upstream and in the pipeline. From Cromwell 52 onwards these options are available again.
  • WDL files and import zip packages are now offered with every release to make downloading and running much easier.
  • The output directory was restructured to contain less nested folders.
  • Performance has improved as a result of extensive benchmarking and profiling. Details can be found here.
  • Added a bwaThreads option to the input. This sets the number of threads used by the BWA aligner, and is a major influencer of wall clock time.
  • Use scatter-regions from the chunked-scatter python package as scattering tool. The old biopet-scatterregions package did not support scattersizes larger than 2 billion, making it impossible to have the whole human genome in one scatter.
  • Use sambamba markdup for marking duplicates with 2 threads which reduces wall clock time.
  • Updated default BWA containers. Both bwa and bwakit now contain 0.7.17 and include samtools 1.10 for fast sorting.
  • Added bcftools stats to the pipeline for variant statistics. These stats are reported in the MultiQC report.
  • Tasks were updated to contain the time_minutes runtime attribute and associated timeMinutes input, describing the maximum time the task will take to run.
  • Document the use of cromwell's final_workflow_outputs_dir feature which makes the germline and somatic pipelines usable on all of Cromwell's supported backends. Users are encouraged to use this feature. outputDir references are removed from the documentation.
  • Make the MultiQC task suitable for use with a final_workflow_outputs_dir so it can be used on all of Cromwell's supported backends.
  • Restructure the pipeline so variant calling jobs are scheduled more efficiently.

version 3.0.0

  • Add options to disable joint genotyping and allow per sample variant calling.
  • Make sure all important options are in the input section. No more nested inputs should be required for running this workflow.
  • Add scatterSize option to centrally control the scatter size
  • Add Structural-variantcalling workflow
  • Add proper copyright headers to WDL files. So the free software license is clear to end users who wish to adapt and modify.
  • Restructured inputs to not use unnecessary structs.
  • Added option for somatic CNV calling.
  • Added option for gender-aware variantcalling of X and Y non-PAR regions are provided.
  • Added wdl-aid to linting.
  • Added miniwdl to linting.

version 2.0.0

  • The bam-to-gvcf and jointgenotyping subworkflows were combined in a single gatk-variantcalling pipeline. This allowed for eliminating some inefficiencies that were caused by communication between these pipelines.
  • Simplify the pipelines so they use less subworkflows. This reduces the complexity for cromwell and reduces inefficiencies that are caused by waiting for the subworkflows to finish. It also makes configuring memory or cpu requirements for tasks in the workflow a lot easier, as these are not as deeply nested anymore.
  • Separated somatic and germline variant calling into their own workflows.

version 1.1.0

  • Allow using csv table format samplesheet as input format.
  • Update tasks so they pass the correct memory requirements to the execution engine. Memory requirements are set on a per-task (not per-core) basis.
  • Added option to use bwakit as aligner.
  • Region input is no longer passed to gatk-preprocess.
  • Added option to skip germline variant calling.

version 1.0.0

  • Explicitly list all images in dockerimages.yml.
  • Removed fastqsplitter step as it increased complexity with no gains. Documented the use of more cores for cutadapt as an alternative.
  • Updated documentation.
  • Fastqsplitter: Fixed error and updated to a newer build with an updated xopen dependency.
  • Fastqsplitter: use version 1.1.
  • Picard: Use version 2.20.5 of the biocontainer as this includes the R dependency.
  • General: Update GATK version to 4.1.2.0 and Picard to 2.19.0.
  • Update cutadapt version to 2.4.