diff --git a/.circleci/check-for-additional-platforms.sh b/.circleci/check-for-additional-platforms.sh new file mode 100755 index 0000000000000..9a0fcd6a304e6 --- /dev/null +++ b/.circleci/check-for-additional-platforms.sh @@ -0,0 +1,46 @@ +#!/bin/bash + +# Check to see if any changed recipes have specified the key +# extra:additional-platforms, and if so, if they match the platform of the +# currently-running machine. + +# arguments +git_range=$1 +job_name=$2 + +# Download ARM version of yq +yq_platform=$(uname) +yq_arch=$(uname -m) +[[ $yq_arch = "aarch64" ]] && yq_arch="arm64" +mkdir -p ${HOME}/bin +wget https://github.com/mikefarah/yq/releases/latest/download/yq_${yq_platform}_${yq_arch} -O ${HOME}/bin/yq +chmod +x ${HOME}/bin/yq + +# Find recipes changed from this merge +files=`git diff --name-only --diff-filter AMR ${git_range} | grep -E 'meta.yaml$' ` +build=0 + +for file in $files; do + echo $file + # To create a properly-formatted yaml that yq can parse, comment out jinja2 + # variable setting with {% %} and remove variable use with {{ }}. + additional_platforms=$(cat $file \ + | sed -E 's/(.*)\{%(.*)%\}(.*)/# \1\2\3/g' \ + | tr -d '{{' | tr -d '}}' \ + | ${HOME}/bin/yq '.extra.additional-platforms[]') + # Check if any additional platforms match this job + for additional_platform in $additional_platforms; do + if [ "${CIRCLE_JOB}" = "${job_name}-${additional_platform}" ] + then + build=1 + break + fi + done +done + +# If no changed recipes apply to this platform, skip remaining steps +if [[ build -lt 1 ]] +then + echo "No recipes using this platform, skipping rest of job." + circleci-agent step halt +fi diff --git a/.circleci/config.yml b/.circleci/config.yml new file mode 100644 index 0000000000000..7020f97145379 --- /dev/null +++ b/.circleci/config.yml @@ -0,0 +1,260 @@ +# .circleci/config.yml +version: 2.1 + +executors: + # osx-arm64: + # macos: + # xcode: 14.2.0 # indicate your selected version of Xcode + # resource_class: macos.m1.large.gen1 + linux-aarch64: + machine: + image: ubuntu-2204:current + resource_class: arm.medium + +jobs: # a basic unit of work in a run + build_and_test: + parameters: + os: + type: executor + executor: << parameters.os >> + steps: + - checkout + + - run: + name: Check for Additional Platforms + command: ./.circleci/check-for-additional-platforms.sh "origin/master...HEAD" "build_and_test" + + - run: + name: Fetch bioconda install script + command: wget https://raw.githubusercontent.com/bioconda/bioconda-common/master/{common,install-and-set-up-conda,configure-conda}.sh + + - run: + name: Install bioconda-utils + command: | + sudo mkdir -p /opt/ + sudo chmod o+rwx /opt + bash install-and-set-up-conda.sh + + - run: + name: Setup PATH + command: + echo 'export PATH=/opt/mambaforge/bin:"$PATH"' >> "$BASH_ENV" + + # We reconfigure conda to use the right channel setup. + # This has to be done after the cache is restored, because + # the channel setup is not cached as it resides in the home directory. + # We could use a system-wide (and therefore cached) channel setup, + # but mamba does not support that at the time of implementation + # (it ignores settings made by --system). + - run: + name: Configure conda + command: bash configure-conda.sh + + - run: + name: Build and test + command: | + source /opt/mambaforge/etc/profile.d/conda.sh + source /opt/mambaforge/etc/profile.d/mamba.sh + mamba activate bioconda + bioconda-utils build recipes config.yml \ + --lint --docker --mulled-test \ + --docker-base-image quay.io/bioconda/bioconda-utils-build-env-cos7-$(arch) \ + --git-range origin/master HEAD + + - run: + name: Prepare artifacts + command: | + ( + mkdir -p /tmp/artifacts/packages + cd /opt/mambaforge/envs/bioconda/conda-bld || exit 0 + find -name .cache | xargs rm -rf || true + for n in index.html channeldata.json linux-aarch64 linux-64 osx-64 noarch; do + cp -rv $n /tmp/artifacts/packages || true + done + if command -V docker >/dev/null; then + mkdir -p /tmp/artifacts/images + cd /tmp/artifacts/images + docker image ls --format='{{.Repository}}:{{.Tag}}' | \ + { grep biocontainers || true ; } | \ + xargs -n1 -P4 bash -c ' + test -n "${1+x}" || exit 0 + echo "Start compressing docker image ${1} ..." + docker save "${1}" | gzip -c > "${1##*/}.tar.gz" + echo "Finished compressing docker image ${1} ." + ' -- + fi + ) || true + + - store_artifacts: + path: /tmp/artifacts + + build_and_upload: + parameters: + os: + type: executor + executor: << parameters.os >> + steps: + - checkout + + - run: + name: Check for Additional Platforms + command: ./.circleci/check-for-additional-platforms.sh "${CIRCLE_SHA1}~1 ${CIRCLE_SHA1}" "build_and_upload" + + - run: + name: Fetch bioconda install script + command: wget https://raw.githubusercontent.com/bioconda/bioconda-common/master/{common,install-and-set-up-conda,configure-conda}.sh + + - run: + name: Install bioconda-utils + command: | + sudo mkdir -p /opt + sudo chmod o+rwx /opt + bash install-and-set-up-conda.sh + + - run: + name: Setup PATH + command: + echo 'export PATH=/opt/mambaforge/bin:"$PATH"' >> "$BASH_ENV" + + # We reconfigure conda to use the right channel setup. + # This has to be done after the cache is restored, because + # the channel setup is not cached as it resides in the home directory. + # We could use a system-wide (and therefore cached) channel setup, + # but mamba does not support that at the time of implementation + # (it ignores settings made by --system). + - run: + name: Configure conda + command: bash configure-conda.sh + + - run: + name: Build and push + command: | + source /opt/mambaforge/etc/profile.d/conda.sh + source /opt/mambaforge/etc/profile.d/mamba.sh + mamba activate bioconda + bioconda-utils handle-merged-pr recipes config.yml \ + --repo bioconda/bioconda-recipes \ + --git-range ${CIRCLE_SHA1}~1 ${CIRCLE_SHA1} \ + --fallback build \ + --artifact-source circleci + + bulk_build: + parameters: + os: + type: executor + runner: + type: integer + executor: << parameters.os >> + steps: + - add_ssh_keys: + fingerprints: + - 1e:85:74:42:35:5f:c5:a2:35:c2:ec:b7:80:c0:7c:40 + + - checkout + + - run: + name: Check for [ci run] + command: | + commit_message="$(git log --format=oneline -n 1 $CIRCLE_SHA1)" + if [[ $commit_message =~ "[ci run]" ]]; then + echo "[ci run] found, continuing." + else + echo "[ci run] not found, exiting." + circleci-agent step halt + fi + + - run: + name: set git user + command: | + git config user.name BiocondaBot + git config user.email biocondabot@users.noreply.github.com + git branch --set-upstream-to=origin/$CIRCLE_BRANCH $CIRCLE_BRANCH + + - run: + name: Fetch bioconda install script + command: wget https://raw.githubusercontent.com/bioconda/bioconda-common/bulk/{common,install-and-set-up-conda,configure-conda}.sh + + - run: + name: Install bioconda-utils + command: | + sudo mkdir -p /opt/ + sudo chmod o+rwx /opt + bash install-and-set-up-conda.sh + + - run: + name: Setup PATH + command: + echo 'export PATH=/opt/mambaforge/bin:"$PATH"' >> "$BASH_ENV" + + # We reconfigure conda to use the right channel setup. + # This has to be done after the cache is restored, because + # the channel setup is not cached as it resides in the home directory. + # We could use a system-wide (and therefore cached) channel setup, + # but mamba does not support that at the time of implementation + # (it ignores settings made by --system). + - run: + name: Configure conda + command: bash configure-conda.sh + + # For now, do not upload ARM images to biocontainers: --mulled-upload-target biocontainers + - run: + name: Build and upload + command: | + set -e + source /opt/mambaforge/etc/profile.d/conda.sh + source /opt/mambaforge/etc/profile.d/mamba.sh + mamba activate bioconda + echo '============' + conda info --all + conda config --show-sources + python -c 'import bioconda_utils.utils as u ; import pathlib as p ; print(*(f"{f}:\n{p.Path(f).read_text()}" for f in u.load_conda_build_config().exclusive_config_files), sep="\n")' + echo '============' + bioconda-utils build recipes config.yml \ + --worker-offset << parameters.runner >> --n-workers 6 \ + --docker --mulled-test --docker-base-image quay.io/bioconda/bioconda-utils-build-env-cos7-$(arch) \ + --anaconda-upload \ + --mulled-upload-target biocontainers \ + --record-build-failures \ + --skiplist-leafs + conda clean -y --all + + +workflows: + build and test (ARM): + jobs: + - build_and_test: + filters: + branches: + ignore: + - master + - bulk + matrix: + parameters: + os: + #- osx-arm64 + - linux-aarch64 + + build and upload (ARM): + jobs: + - build_and_upload: + filters: + branches: + only: master + matrix: + parameters: + os: + #- osx-arm64 + - linux-aarch64 + + Bulk branch (ARM): + jobs: + - bulk_build: + filters: + branches: + only: bulk + matrix: + parameters: + os: + #- osx-arm64 + - linux-aarch64 + runner: [0, 1, 2, 3, 4, 5] diff --git a/.github/workflows/Bulk.yml b/.github/workflows/Bulk.yml index e8eeb8712145d..8a3ec217f3ebb 100644 --- a/.github/workflows/Bulk.yml +++ b/.github/workflows/Bulk.yml @@ -77,7 +77,7 @@ jobs: build-osx: name: Bulk OSX Builds if: "contains(github.event.head_commit.message, '[ci run]')" - runs-on: macOS-latest + runs-on: macos-13 strategy: fail-fast: false max-parallel: 4 diff --git a/.github/workflows/PR.yml b/.github/workflows/PR.yml index f7bbb0178d3fd..272739ef7b06a 100644 --- a/.github/workflows/PR.yml +++ b/.github/workflows/PR.yml @@ -165,7 +165,7 @@ jobs: build-osx: name: OSX Tests - runs-on: macOS-latest + runs-on: macos-13 strategy: fail-fast: true max-parallel: 4 diff --git a/.github/workflows/master.yml b/.github/workflows/master.yml index 4a3fd95875aab..e698443590e50 100644 --- a/.github/workflows/master.yml +++ b/.github/workflows/master.yml @@ -71,7 +71,7 @@ jobs: build-osx: name: OSX Upload if: github.repository == 'bioconda/bioconda-recipes' - runs-on: macOS-latest + runs-on: macos-13 strategy: fail-fast: false max-parallel: 4 diff --git a/.github/workflows/nightly.yml b/.github/workflows/nightly.yml index f2954e626d069..11d48c1154598 100644 --- a/.github/workflows/nightly.yml +++ b/.github/workflows/nightly.yml @@ -65,7 +65,7 @@ jobs: build-osx: name: OSX Tests if: github.repository == 'bioconda/bioconda-recipes' - runs-on: macOS-latest + runs-on: macos-13 strategy: fail-fast: false max-parallel: 4 diff --git a/azure-pipeline-master.yml b/azure-pipeline-master.yml index 30030ff694fed..8cf42d62dcb1f 100644 --- a/azure-pipeline-master.yml +++ b/azure-pipeline-master.yml @@ -118,7 +118,6 @@ jobs: conda activate bioconda export OSTYPE="darwin" export CI="true" - export HOME=`pwd` bioconda-utils handle-merged-pr recipes config.yml \ --repo bioconda/bioconda-recipes \ diff --git a/azure-pipeline-nightly.yml b/azure-pipeline-nightly.yml index fd7f1f5e7da97..eac4139cd5875 100644 --- a/azure-pipeline-nightly.yml +++ b/azure-pipeline-nightly.yml @@ -76,7 +76,7 @@ jobs: # build and push all leftover packages bioconda-utils build recipes config.yml \ --docker --mulled-test --anaconda-upload --mulled-upload-target biocontainers \ - --prelint + --prelint --exclude bioconda-repodata-patches docker rmi quay.io/dpryan79/mulled_container:latest env: QUAY_OAUTH_TOKEN: $(QUAY_OAUTH_TOKEN) @@ -133,7 +133,6 @@ jobs: conda activate bioconda export OSTYPE="darwin" export CI="true" - export HOME=`pwd` bioconda-utils build recipes config.yml \ --anaconda-upload \ --prelint diff --git a/build-fail-blacklist b/build-fail-blacklist index 31d92e56cbae9..b2af9f3218d26 100644 --- a/build-fail-blacklist +++ b/build-fail-blacklist @@ -24,7 +24,6 @@ recipes/lordec recipes/octopus recipes/bttcmp recipes/bttoxin_scanner -recipes/cgat-apps recipes/hail recipes/monocle3-cli recipes/phenix @@ -175,7 +174,6 @@ recipes/bwa/0.6.2 # fails compilation in bulk on Linux recipes/paragraph recipes/selectsequencesfrommsa -recipes/centrifuge recipes/nasp recipes/mmvc recipes/gemma @@ -233,7 +231,6 @@ recipes/bmtool recipes/sibelia recipes/var-agg recipes/wham -recipes/percolator # Segfaults in bulk on Linux 24.3.2021 recipes/dbgraph @@ -249,7 +246,6 @@ recipes/ngsep recipes/rnabridge-denovo recipes/eval recipes/minorseq -recipes/prosampler recipes/methylextract recipes/blasr recipes/asn2gb @@ -324,7 +320,6 @@ recipes/bam-readcount recipes/mqc recipes/roprofile recipes/chanjo -recipes/xxmotif recipes/phylip recipes/gqt recipes/diamond_add_taxonomy @@ -423,9 +418,6 @@ recipes/intervalstats recipes/oligotyping recipes/oligotyping/2.0 -# missing file -recipes/shiver - # missing binary recipes/semeta @@ -699,7 +691,6 @@ recipes/sc3-scripts recipes/riboseqc # Some UnsatisfiableError -recipes/maaslin2 recipes/music-deconvolution # Bulk times out while solving environment @@ -771,7 +762,6 @@ recipes/cesm recipes/minnow recipes/quip recipes/conterminator -recipes/groot recipes/mantis recipes/apoc recipes/quorum @@ -803,7 +793,6 @@ recipes/ucsc-axtsort recipes/ucsc-axtswap recipes/ucsc-axttomaf recipes/ucsc-bamtopsl -recipes/ucsc-bedclip recipes/ucsc-bedcommonregions recipes/ucsc-bedcoverage recipes/ucsc-bedextendranges @@ -1045,7 +1034,6 @@ recipes/sweepfinder2 # syntax error in configure script recipes/kat -recipes/kmer-jellyfish # unicode error when packaging license file recipes/mapseq @@ -1059,11 +1047,11 @@ recipes/fmlrc2 # tries to download zlib itself, which fails recipes/d4binding -# maturin build fails -recipes/taxonomy - # no matching package named `quickersort` found recipes/mudskipper # md5 mismatch when downloading source recipes/komb + +# duplicate recipe +recipes/treeqmc diff --git a/recipes/3seq/meta.yaml b/recipes/3seq/meta.yaml index fc3d68b5e7018..00113808e3473 100644 --- a/recipes/3seq/meta.yaml +++ b/recipes/3seq/meta.yaml @@ -7,7 +7,9 @@ package: version: {{ version }} build: - number: 3 + number: 4 + run_exports: + - {{ pin_subpackage("3seq", max_pin="x") }} source: url: https://gitlab.com/lamhm/{{ name|lower }}/-/archive/v{{ version }}/3seq-v{{ version }}.tar.gz @@ -28,6 +30,10 @@ test: about: home: https://mol.ax/software/3seq/ - license: CC BY-NC-SA 4.0 + license: CC-BY-NC-SA-4.0 license_file: LICENSE.md summary: '3SEQ tests all sequence triplets in an alignment for a mosaic recombination signal.' + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/aacon/aacon.sh b/recipes/aacon/aacon.sh new file mode 100644 index 0000000000000..e69d47183a5e0 --- /dev/null +++ b/recipes/aacon/aacon.sh @@ -0,0 +1,11 @@ +#!/bin/bash +set -e + +JAR_NAME="compbio-conservation.jar" + +if [ -x "$JAVA_HOME/bin/java" ]; then + JAVA=$JAVA_HOME/bin/java +else + JAVA=$(which java) +fi +$JAVA -jar "$(dirname $(readlink -f "$0"))/$JAR_NAME" "$@" diff --git a/recipes/aacon/build.sh b/recipes/aacon/build.sh new file mode 100644 index 0000000000000..df55624091e03 --- /dev/null +++ b/recipes/aacon/build.sh @@ -0,0 +1,11 @@ +#!/bin/bash +set -eu + +OUTDIR=$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM +mkdir -p $OUTDIR +mkdir -p $PREFIX/bin + +cp $SRC_DIR/compbio-conservation-$PKG_VERSION.jar $OUTDIR/compbio-conservation.jar +cp $RECIPE_DIR/aacon.sh $OUTDIR/aacon +ln -s $OUTDIR/aacon $PREFIX/bin/aacon +chmod +x $PREFIX/bin/aacon diff --git a/recipes/aacon/meta.yaml b/recipes/aacon/meta.yaml new file mode 100644 index 0000000000000..ab2a510cd4664 --- /dev/null +++ b/recipes/aacon/meta.yaml @@ -0,0 +1,49 @@ +{% set version = "1.1" %} +{% set sha256sum = "8dd97c70d46d0f8cf6ca79f0cc7641e629db2ab3fec30bd6dbbf9de8c0607145" %} + +package: + name: aacon + version: {{ version }} + +build: + number: 0 + noarch: generic + run_exports: + - {{ pin_subpackage('aacon', max_pin="x") }} + +source: + url: https://github.com/bartongroup/aacon/releases/download/v{{ version }}/compbio-conservation-{{ version }}.jar + sha256: {{ sha256sum }} + +requirements: + run: + - openjdk >=8 + +test: + commands: + - aacon --help + +about: + home: https://www.compbio.dundee.ac.uk/aacon/ + dev_url: https://github.com/bartongroup/aacon + license: Apache-2.0 + summary: "AACon: A Fast Amino Acid Conservation Calculation Service" + description: + AACon is a set of tools implementing 17 different conservation scores + reviewed by Valdar as well as the more complex SMERFS algorithm for + predicting protein functional sites. AACon has been written with efficiency + in mind and takes less than a second to calculate conservation by all 18 + methods for an alignment of 500 sequences 350 residues long on a single CPU. + AACon exploits parallelism for the more demanding methods and to allow + multiple methods to run simultaneously. The parallel code gives close to + linear speedup with the number of processors, thus making it suitable for + server applications or other demanding environments. + +extra: + notes: + AACon is a Java program that comes with a custom wrapper shell script. + The shell wrapper is called "aacon" and is present on $PATH by default. + The Java program is executed with java specified by the $JAVA_HOME + variable. Otherwise, a "java" program from the current environment is used. + identifiers: + - biotools:aacon diff --git a/recipes/abacas/meta.yaml b/recipes/abacas/meta.yaml index 9ce4d033664dd..2373004ce8222 100644 --- a/recipes/abacas/meta.yaml +++ b/recipes/abacas/meta.yaml @@ -13,7 +13,9 @@ source: - patches/path.patch build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage("abacas", max_pin="x") }} noarch: generic requirements: diff --git a/recipes/abawaca/meta.yaml b/recipes/abawaca/meta.yaml index 8e93f86df7f49..22c0eb47290e3 100644 --- a/recipes/abawaca/meta.yaml +++ b/recipes/abawaca/meta.yaml @@ -11,7 +11,9 @@ source: - 0001-Use-CXX-and-flags.patch build: - number: 6 + number: 7 + run_exports: + - {{ pin_subpackage("abawaca", max_pin="x") }} requirements: build: @@ -34,3 +36,5 @@ extra: - keuv-grvl identifiers: - doi:10.1038/nature14486 + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/abpoa/meta.yaml b/recipes/abpoa/meta.yaml index a4fdf9234fc98..e0cbaba96a5cd 100644 --- a/recipes/abpoa/meta.yaml +++ b/recipes/abpoa/meta.yaml @@ -1,19 +1,18 @@ {% set version = "1.5.1" %} -{% set program = "abpoa" %} -{% set PROGRAM = "abPOA" %} +{% set name = "abPOA" %} package: - name: abpoa + name: {{ name | lower }} version: {{ version }} source: - url: https://github.com/yangao07/{{ PROGRAM }}/releases/download/v{{ version }}/{{ PROGRAM }}-v{{ version }}.tar.gz + url: https://github.com/yangao07/{{ name }}/releases/download/v{{ version }}/{{ name }}-v{{ version }}.tar.gz sha256: f0e1b41b1c9e18ecd2096df9b60ad053260ec773d70eecb307b02cca0efab89d build: - number: 0 + number: 1 run_exports: - - {{ pin_subpackage(program, max_pin="x.x") }} + - {{ pin_subpackage(name | lower, max_pin="x") }} requirements: build: @@ -24,10 +23,15 @@ requirements: test: commands: - - {{ program }} --version | grep {{ version }} + - {{ name | lower }} --version | grep {{ version }} about: - home: https://github.com/yangao07/{{ PROGRAM }} - license: GPL + home: https://github.com/yangao07/{{ name }} + license: MIT + license_family: MIT license_file: LICENSE summary: 'abPOA: fast SIMD-based partial order alignment using adaptive band' + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/abra2/meta.yaml b/recipes/abra2/meta.yaml index 1d5adf33ab6ae..342af9bad048e 100644 --- a/recipes/abra2/meta.yaml +++ b/recipes/abra2/meta.yaml @@ -10,21 +10,30 @@ source: sha256: edb35fb6ff318239353a573d1abad148073b8ac0bb2cd44a18e561abe08aef32 build: - number: 2 + number: 3 skip: true # [osx] + run_exports: + - pin_subpackage(name, max_pin="x") requirements: build: - maven - make - {{ compiler('cxx') }} + host: + - zlib run: - openjdk >=8,<10 - coreutils + - zlib test: commands: - - 'abra2 2>&1 | grep "Abra version"' + - 'abra2 2>&1 | grep "Abra version" || (abra2 && exit 1)' + +extra: + additional-platforms: + - linux-aarch64 about: home: https://github.com/mozack/abra2 diff --git a/recipes/abritamr/meta.yaml b/recipes/abritamr/meta.yaml index 6fbc267b65ae6..26d85eddc87b6 100644 --- a/recipes/abritamr/meta.yaml +++ b/recipes/abritamr/meta.yaml @@ -1,6 +1,6 @@ {% set name = "abritamr" %} -{% set version = "1.0.14" %} -{% set sha256 = "22600b8cf37c1c4cf5dc5b81f4774907e58ba874a5de968f169101d6829fe6e3" %} +{% set version = "1.0.17" %} +{% set sha256 = "091ddb77afb2a37b4955312887d2ff32669ddc0512b38ab51896139d3c897970" %} package: name: "{{ name|lower }}" @@ -15,20 +15,26 @@ build: noarch: python entry_points: - abritamr=abritamr.abritamr:main - script: "{{ PYTHON }} -m pip install . --ignore-installed --no-deps -vv" + script: "{{ PYTHON }} -m pip install . --no-build-isolation --no-deps -vvv" + run_exports: + - {{ pin_subpackage('abritamr', max_pin="x") }} requirements: host: - pip - - python =>3.9 - run: - - pandas =>1.4 - - xlsxwriter - - ncbi-amrfinderplus =3.10.42 - - blast - - hmmer + - python >=3.9 - libcurl - parallel + run: + - python >=3.9 + - pandas + - xlsxwriter + # Please review ncbi-amrfinderplus pinning every release + # The version should be pinned to the database version used by abritamr + # Please see the "changes.txt" file in https://github.com/MDU-PHL/abritamr/blob/master/abritamr/db/amrfinderplus/data//changes.txt + - ncbi-amrfinderplus =3.12.8 + - blast + - hmmer test: imports: @@ -44,9 +50,11 @@ about: license: GPL-3.0-only license_family: GPL3 summary: "Running AMRFinderPlus for MDU" - dev_url: https://github.com/MDU-PHL/abritamr + dev_url: https://github.com/MDU-PHL/abritamr extra: recipe-maintainers: - kristyhoran - andergs + identifiers: + - biotools:abritamr diff --git a/recipes/abromics_galaxy_json_extractor/meta.yaml b/recipes/abromics_galaxy_json_extractor/meta.yaml index 9b20f38f812b2..ffb7d367e33e6 100644 --- a/recipes/abromics_galaxy_json_extractor/meta.yaml +++ b/recipes/abromics_galaxy_json_extractor/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.8.3" %} +{% set version = "0.8.3.6" %} context: {} @@ -8,7 +8,7 @@ package: source: url: https://gitlab.com/ifb-elixirfr/abromics/abromics-galaxy-json-extractor/-/archive/{{ version }}/abromics-galaxy-json-extractor-{{ version }}.tar.gz - sha256: '81fc614902567dfe83d57fc978bf98cc22e26a58f0e25e359c9d647df6f05bb9' + sha256: '364997088a29c30cdc45d2c66af40a3d6b8e3398efe1d7eb242d31b0e68abd77' build: noarch: python diff --git a/recipes/abundancebin/meta.yaml b/recipes/abundancebin/meta.yaml index d01609dd35e02..1fc298ebc42e5 100644 --- a/recipes/abundancebin/meta.yaml +++ b/recipes/abundancebin/meta.yaml @@ -14,7 +14,9 @@ source: - 0001-Use-CXX-and-flags.patch build: - number: 6 + number: 7 + run_exports: + - {{ pin_subpackage("abundancebin", max_pin="x.x.x") }} skip: True # [osx] requirements: @@ -45,3 +47,5 @@ extra: - keuv-grvl identifiers: - doi:10.1007/978-3-642-12683-3_35 + additional-platforms: + - linux-aarch64 diff --git a/recipes/ac/meta.yaml b/recipes/ac/meta.yaml index 3b66857bde87b..17b4fbc7a327c 100644 --- a/recipes/ac/meta.yaml +++ b/recipes/ac/meta.yaml @@ -7,7 +7,9 @@ package: build: # Passes some invalid flags for clang skip: True # [osx] - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage("ac", max_pin="x.x") }} source: url: https://github.com/cobilab/ac/archive/v{{ version }}.tar.gz @@ -30,3 +32,7 @@ about: license_file: LICENSE license_family: GPL summary: A lossless compression tool for Amino Acid sequences + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/adapterremoval/meta.yaml b/recipes/adapterremoval/meta.yaml index b6c2fb86ec426..e916bf3a3bd45 100644 --- a/recipes/adapterremoval/meta.yaml +++ b/recipes/adapterremoval/meta.yaml @@ -10,7 +10,9 @@ source: sha256: {{ sha256 }} build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage("adapterremoval", max_pin="x") }} requirements: build: @@ -34,3 +36,7 @@ about: license: GPL3 license_file: LICENSE summary: The AdapterRemoval v2 tool for merging and clipping reads. + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/addrg/meta.yaml b/recipes/addrg/meta.yaml index 9a92b45beccbd..6b55770d98737 100644 --- a/recipes/addrg/meta.yaml +++ b/recipes/addrg/meta.yaml @@ -6,7 +6,9 @@ package: version: {{ version }} build: - number: 11 + number: 12 + run_exports: + - {{ pin_subpackage("addrg", max_pin="x.x") }} source: url: https://github.com/holtgrewe/addrg/archive/v{{ version }}.tar.gz @@ -17,6 +19,7 @@ requirements: - {{ compiler('c') }} host: - htslib + - zlib run: - htslib @@ -28,3 +31,7 @@ about: home: https://github.com/holtgrewe/addrg license: MIT summary: Add read group to BAM files + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/agat/meta.yaml b/recipes/agat/meta.yaml index 99c23db5c7482..a91fde31f4758 100755 --- a/recipes/agat/meta.yaml +++ b/recipes/agat/meta.yaml @@ -1,6 +1,6 @@ {% set name = "AGAT" %} -{% set version = "1.2.0" %} -{% set sha256 = "c812e4b4ca1d27b5b8804025fa5a33f56e9b542948b44885662b2cbb98d06055" %} +{% set version = "1.4.0" %} +{% set sha256 = "d5e30db44b5d05ed51c606a823894c01c85c1ed85580148ad5473cb2f2b2ac77" %} package: name: "{{ name|lower }}" @@ -13,6 +13,8 @@ source: build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage("agat", max_pin="x") }} requirements: host: diff --git a/recipes/agc/meta.yaml b/recipes/agc/meta.yaml index ad87d0fd1beb9..ea93af4029d36 100644 --- a/recipes/agc/meta.yaml +++ b/recipes/agc/meta.yaml @@ -1,20 +1,26 @@ -{% set version = "3.0" %} -{% set system = "linux"%} # [linux] -{% set system = "mac"%} # [osx] -{% set sha256 = "3ee3245e556221d246f9afe5d9ad86888f4eb5aea6b10f621241c3170ef8835e" %} # [linux] -{% set sha256 = "3d68b6b76948b6d9a36c4e848e37969eda6ae0ec1abace4ca61a7cc585dcdabf" %} # [osx] +{% set version = "3.1" %} + package: name: agc version: {{ version }} + build: number: 0 script: "mkdir -p ${PREFIX}/bin; cp agc ${PREFIX}/bin" + run_exports: + - {{ pin_subpackage('agc', max_pin="x") }} source: - url: https://github.com/refresh-bio/agc/releases/download/v{{ version }}/agc-{{ version }}_x64-{{ system }}.tar.gz - sha256: {{ sha256 }} + - url: https://github.com/refresh-bio/agc/releases/download/v{{ version }}/agc-{{ version }}_arm_linux.tar.gz # [aarch64] + sha256: 5fee3ccbb2691d82a877987e204c5946dbdbe40b9603af5d2421cb8506577534 # [aarch64] + - url: https://github.com/refresh-bio/agc/releases/download/v{{ version }}/agc-{{ version }}_x64_linux.tar.gz # [linux64] + sha256: 4868dd45c1ed31a7f36bcbc536174249de27b87ec83858d22b128cbec8deef53 # [linux64] + - url: https://github.com/refresh-bio/agc/releases/download/v{{ version }}/agc-{{ version }}_x64_mac.tar.gz # [osx and x86_64] + sha256: 0ef911e6bb8df791593ee6e89b5bddbf82b5823684955d249d6a67a39e6d0d4e # [osx and x86_64] + - url: https://github.com/refresh-bio/agc/releases/download/v{{ version }}/agc-{{ version }}_m1_mac.tar.gz # [osx and arm64] + sha256: ff8cc5dd4c5825a41e042567a93e9e01ef43fc91624c983640a29fd3c7ac03e4 # [osx and arm64] requirements: build: - run: + run: about: home: https://github.com/refresh-bio/agc summary: "Assembled Genomes Compressor (AGC) is a tool designed to compress collections of de-novo assembled genomes. It can be used for various types of datasets: short genomes (viruses) as well as long (humans)." @@ -23,6 +29,8 @@ test: commands: - agc extra: + additional-platforms: + - linux-aarch64 skip-lints: - should_be_noarch_generic - should_not_be_noarch_source diff --git a/recipes/age-metasv/meta.yaml b/recipes/age-metasv/meta.yaml index 2eefecbaee314..212bb76c1a0d5 100644 --- a/recipes/age-metasv/meta.yaml +++ b/recipes/age-metasv/meta.yaml @@ -10,7 +10,9 @@ source: build: skip: True # [osx] - number: 7 + number: 8 + run_exports: + - {{ pin_subpackage("age-metasv", max_pin="x.x.x") }} requirements: build: @@ -18,6 +20,7 @@ requirements: - {{ compiler('cxx') }} - llvm-openmp # [osx] - libgomp # [linux] + - libstdcxx-ng >=12 host: run: @@ -29,3 +32,7 @@ about: home: https://github.com/marghoob/AGE/tree/simple-parseable-output license: CCPL (Creative Commons Public License) summary: optimal alignment of sequences with structural variants (SVs), modifiied for MetaSV integration + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/akt/build.sh b/recipes/akt/build.sh index 54a4de419bbc8..4eca9aec4baa4 100644 --- a/recipes/akt/build.sh +++ b/recipes/akt/build.sh @@ -1,4 +1,8 @@ #!/bin/bash +if [ `uname -m` == "aarch64" ]; then +sed -i 's/\-mpopcnt//g' Makefile +fi + make \ CC="${CC} ${CFLAGS} ${CPPFLAGS} ${LDFLAGS}" \ CXX="${CXX} ${CXXFLAGS} ${CPPFLAGS} ${LDFLAGS}" diff --git a/recipes/akt/meta.yaml b/recipes/akt/meta.yaml index 166419b343c28..fe1cfb1e46ba5 100644 --- a/recipes/akt/meta.yaml +++ b/recipes/akt/meta.yaml @@ -10,7 +10,9 @@ source: sha256: {{ sha256 }} build: - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage("akt", max_pin="x.x.x") }} requirements: build: @@ -38,3 +40,5 @@ about: extra: identifiers: - doi:10.1093/bioinformatics/btw576 + additional-platforms: + - linux-aarch64 diff --git a/recipes/alcor/meta.yaml b/recipes/alcor/meta.yaml index 538f6076de517..29a3cfed328af 100644 --- a/recipes/alcor/meta.yaml +++ b/recipes/alcor/meta.yaml @@ -10,7 +10,9 @@ package: build: # Passes some invalid flags for clang skip: True # [osx] - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage("alcor", max_pin="x.x") }} source: url: https://github.com/cobilab/alcor/archive/v{{ version }}.tar.gz @@ -37,3 +39,7 @@ about: license_file: LICENSE license_family: GPL summary: Software for alignment-free simulation, mapping, and visualization of low-complexity regions in FASTA data. + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/aletsch/meta.yaml b/recipes/aletsch/meta.yaml index d456e3db645dd..1abc848d3520a 100644 --- a/recipes/aletsch/meta.yaml +++ b/recipes/aletsch/meta.yaml @@ -1,5 +1,5 @@ {% set name = "aletsch" %} -{% set version = "1.0.3" %} +{% set version = "1.1.1" %} package: name: "{{ name }}" @@ -7,10 +7,12 @@ package: source: url: "https://github.com/Shao-Group/aletsch/releases/download/v{{ version }}/aletsch-{{ version }}.tar.gz" - sha256: "1eae28ae32f40097320ef14c8dd65e30319cae5f1cb11533905b4330b5b76478" + sha256: "3537e90213baa7ea132b1648f4687780537999f3796711cf7398f9168d72f027" build: - number: 6 + number: 0 + run_exports: + - {{ pin_subpackage('aletsch', max_pin="x") }} requirements: build: @@ -32,7 +34,7 @@ about: home: "https://github.com/Shao-Group/aletsch" license: BSD-3-Clause license_file: LICENSE - summary: "Aletsch is a scalable, accurate, and versatile assembler for multiple RNA-seq samples." + summary: "Aletsch is an accurate, versatile assembler for multiple RNA-seq samples." extra: recipe-maintainers: diff --git a/recipes/alevin-fry/meta.yaml b/recipes/alevin-fry/meta.yaml index 2b773c2e1497a..446695091e5e6 100644 --- a/recipes/alevin-fry/meta.yaml +++ b/recipes/alevin-fry/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.8.2" %} +{% set version = "0.9.0" %} package: name: alevin-fry @@ -6,14 +6,16 @@ package: build: number: 0 - + run_exports: + - {{ pin_subpackage("alevin-fry", max_pin="x.x") }} + source: url: https://github.com/COMBINE-lab/alevin-fry/archive/v{{ version }}.tar.gz - sha256: 7feaa5b59c6537eee9d1a2a07797f151ba6a50955a969fa1807dcb7aeb357ab1 + sha256: 80fa964ba998c21dfd1190629015924e53d633be64cb8c8ee105bd7e3a33ac21 requirements: build: - - rust >=1.60 + - {{ compiler('rust') }} - cmake - autoconf - make diff --git a/recipes/alfred/build.sh b/recipes/alfred/build.sh index dc2400afabae2..89d206cac27f5 100644 --- a/recipes/alfred/build.sh +++ b/recipes/alfred/build.sh @@ -1,3 +1,3 @@ #!/bin/sh -CXXFLAGS="${CXXFLAGS} -D__STDC_FORMAT_MACROS" make CXX="${CXX}" prefix="${PREFIX}" install +CXXFLAGS="${CXXFLAGS} -D__STDC_FORMAT_MACROS" make -j${CPU_COUNT} CXX="${CXX}" prefix="${PREFIX}" install diff --git a/recipes/alfred/meta.yaml b/recipes/alfred/meta.yaml index a1d0b9d8a4038..8316353573dbf 100644 --- a/recipes/alfred/meta.yaml +++ b/recipes/alfred/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.2.8" %} -{% set sha256 = "5d2583249728184aedd0165e936496a02833221c44eec2243f20ea315fa525e9" %} +{% set version = "0.3.1" %} +{% set sha256 = "6a84eef8cb737e856915c88b340304a22e5cc5013f89d3756026f93720f3c8cb" %} package: name: alfred @@ -10,7 +10,7 @@ source: sha256: '{{ sha256 }}' build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('alfred', max_pin="x.x") }} @@ -41,3 +41,7 @@ about: license_family: BSD license_file: LICENSE summary: BAM alignment statistics, feature counting and feature annotation + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/alignoth/meta.yaml b/recipes/alignoth/meta.yaml index 20b848d111860..452eea4bb43a6 100644 --- a/recipes/alignoth/meta.yaml +++ b/recipes/alignoth/meta.yaml @@ -1,11 +1,11 @@ -{% set version = "0.11.0" %} +{% set version = "0.12.0" %} package: name: alignoth version: {{ version }} build: - number: 0 + number: 1 # TODO fails to build on osx with # Undefined symbols for architecture x86_64: "_SSLCopyALPNProtocols", referenced from: _sectransp_connect_step2 in libcurl_sys-1f07db570920ba9f.rlib(sectransp.o) skip: true #[osx] @@ -13,8 +13,8 @@ build: - {{ pin_subpackage('alignoth', max_pin="x") }} source: - url: https://github.com/koesterlab/alignoth/archive/v{{ version }}.tar.gz - sha256: b7df1ee950b274c8f1fdfe75b806f47b23a0a9bd8bf2db7b6b762f84a6295f91 + url: https://github.com/alignoth/alignoth/archive/v{{ version }}.tar.gz + sha256: e430a257f5ab440846756f53a0c618ebec86bd5d6f3627eab1fed11dd68f3b5c requirements: build: @@ -30,12 +30,13 @@ requirements: - libcurl - openssl + test: commands: - alignoth --help about: - home: https://github.com/koesterlab/alignoth + home: https://alignoth.github.io license: MIT summary: A tool for creating alignment plots from bam files @@ -43,3 +44,5 @@ extra: recipe-maintainers: - fxwiegand - johanneskoester + additional-platforms: #add aarch64 + - linux-aarch64 diff --git a/recipes/alignstats/meta.yaml b/recipes/alignstats/meta.yaml index 009b1ec52d685..645cec41b08ca 100644 --- a/recipes/alignstats/meta.yaml +++ b/recipes/alignstats/meta.yaml @@ -10,7 +10,9 @@ source: sha256: {{ sha256 }} build: - number: 1 + number: 2 + run_exports: + - {{ pin_subpackage("alignstats", max_pin="x.x.x") }} requirements: build: @@ -33,3 +35,7 @@ about: home: https://github.com/jfarek/alignstats license: BSD-3-Clause summary: Comprehensive alignment, whole-genome coverage, and capture coverage statistics. + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/allegro/build.sh b/recipes/allegro/build.sh index f8dc625177f65..193897e45693d 100644 --- a/recipes/allegro/build.sh +++ b/recipes/allegro/build.sh @@ -1,4 +1,8 @@ #!/bin/bash +rm -rf src/config.guess +rm -rf src/config.sub +wget "http://git.savannah.gnu.org/gitweb/?p=config.git;a=blob_plain;f=config.guess;hb=HEAD" -O src/config.guess +wget "http://git.savannah.gnu.org/gitweb/?p=config.git;a=blob_plain;f=config.sub;hb=HEAD" -O src/config.sub ./configure make CXXFLAGS="${CXXFLAGS} -std=c++03" diff --git a/recipes/allegro/meta.yaml b/recipes/allegro/meta.yaml index 72183ae9d3512..8a98f890cce1a 100644 --- a/recipes/allegro/meta.yaml +++ b/recipes/allegro/meta.yaml @@ -18,7 +18,9 @@ source: build: skip: True # [osx] - number: 7 + number: 8 + run_exports: + - {{ pin_subpackage("allegro", max_pin="x.x.x") }} requirements: build: @@ -27,6 +29,7 @@ requirements: host: - zlib - patch + - wget run: - zlib @@ -43,3 +46,5 @@ about: extra: skip-lints: - should_not_be_noarch_source + additional-platforms: + - linux-aarch64 diff --git a/recipes/altair-mf/meta.yaml b/recipes/altair-mf/meta.yaml index 353e78b5929a8..0deed9c024b96 100644 --- a/recipes/altair-mf/meta.yaml +++ b/recipes/altair-mf/meta.yaml @@ -10,7 +10,9 @@ package: build: # Passes some invalid flags for clang skip: True # [osx] - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage("altair-mf", max_pin="x.x.x") }} source: url: https://github.com/cobilab/altair/archive/v{{ version }}.tar.gz @@ -37,3 +39,7 @@ about: license_file: LICENSE license_family: GPL summary: Software for alignment-free and spatial-temporal analysis of multi-FASTA data + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/amdirt/meta.yaml b/recipes/amdirt/meta.yaml index 897c231a4e148..a28aeb665778a 100644 --- a/recipes/amdirt/meta.yaml +++ b/recipes/amdirt/meta.yaml @@ -1,5 +1,5 @@ {% set name = "amdirt" %} -{% set version = "1.4.6" %} +{% set version = "1.6.0" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/AMDirT-{{ version }}.tar.gz - sha256: dc099a28c68996ea7e8ca087856598e693fa5f780eec166ee9fcac8780b1f930 + sha256: 15feb7872d98e73225886a81a6b7b1af0e6a962e9a398d6e0343c31adeb9640c build: entry_points: @@ -15,6 +15,8 @@ build: noarch: python script: {{ PYTHON }} -m pip install . -vv number: 0 + run_exports: + - {{ pin_subpackage("amdirt", max_pin="x.x") }} requirements: host: @@ -24,6 +26,7 @@ requirements: - click - colorlog - jsonschema + - defusedxml - numpy - pandas - python >=3.9 diff --git a/recipes/ampcombi/meta.yaml b/recipes/ampcombi/meta.yaml index 463325c2d636f..1bb7752d2c957 100644 --- a/recipes/ampcombi/meta.yaml +++ b/recipes/ampcombi/meta.yaml @@ -1,5 +1,5 @@ {% set name = "AMPcombi" %} -{% set version = "0.1.7" %} +{% set version = "0.2.2" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: a73ab40cc80670f403aa629d1c1d7318ce21cc952618fdc1eba0ef667fae3578 + sha256: da9a179851a8f2041d05ccd10dd45b58099e84059e2e66a9ee405d1913471b58 build: noarch: python @@ -15,24 +15,27 @@ build: entry_points: - ampcombi = ampcombi:main script: "{{ PYTHON }} -m pip install . -vv" + run_exports: + - {{ pin_subpackage("ampcombi", max_pin="x.x") }} requirements: host: - pandas - pip - - python >=3.9 + - python ==3.11 run: - - pandas + - pandas ==1.5.2 - requests - parsedatetime - subprocess32 - - biopython + - biopython ==1.80 - backports.tempfile - contextlib2 - - diamond - openpyxl - jsonschema - - python >=3.9 + - python ==3.11 + - diamond ==2.0.15 + - mmseqs2 ==15.6f452 test: imports: diff --git a/recipes/amplicon_coverage_plot/meta.yaml b/recipes/amplicon_coverage_plot/meta.yaml index a0868b494288c..e870eaaf49531 100644 --- a/recipes/amplicon_coverage_plot/meta.yaml +++ b/recipes/amplicon_coverage_plot/meta.yaml @@ -11,8 +11,10 @@ source: build: noarch: python - number: 0 + number: 1 script: "{{ PYTHON }} -m pip install . --no-deps -vv" + run_exports: + - {{ pin_subpackage("amplicon_coverage_plot", max_pin="x.x") }} requirements: host: diff --git a/recipes/ampliconsuite/meta.yaml b/recipes/ampliconsuite/meta.yaml index 24da7d68a4da9..12d8bf1f0fda7 100644 --- a/recipes/ampliconsuite/meta.yaml +++ b/recipes/ampliconsuite/meta.yaml @@ -1,7 +1,7 @@ {% set name="ampliconsuite" %} -{% set AS_version="1.2.1" %} -{% set AA_version="1.3.r7" %} -{% set AC_version="1.1.1" %} +{% set AS_version="1.3.1" %} +{% set AA_version="1.4.r1" %} +{% set AC_version="1.1.3" %} package: name: {{ name }} @@ -11,12 +11,12 @@ source: # the sha256 sum is generated by doing # $ wget -O- [URL] | shasum -a 256 - url: https://github.com/AmpliconSuite/AmpliconSuite-pipeline/archive/v{{ AS_version }}.tar.gz - sha256: 79515b2c1a57a8ea22905737f3c02047a4319d7ab91554dff1a058ead653c720 + sha256: b74c8201b9e53493a8f1604f6035fa9e42c0ce7d1a258f9095b037afe2d5f2d8 - url: https://github.com/AmpliconSuite/AmpliconArchitect/archive/v{{ AA_version }}.tar.gz - sha256: be65a0293da9ced3f6f744657db475c16dd4dcaf9f037e17ee1a19f4ceaa7430 + sha256: d62e30999c69b994691c8a61b09255a0b223906fd76709febc0ae8387164f208 folder: ampliconarchitectlib - url: https://github.com/AmpliconSuite/AmpliconClassifier/archive/v{{ AC_version }}.tar.gz - sha256: 040400d2eb0b4c847245666a481de927eb0c9a368088c1e97f117e7a228c8c5d + sha256: 105f3d0dfd99c52bb8cd988f3fd71afb064b01167a36b72d8fe789f5dfe8c9f5 build: noarch: python @@ -41,12 +41,14 @@ requirements: - pysam - samtools - scipy + - bedtools host: - python >=3 test: commands: - AmpliconSuite-pipeline.py -v + - GroupedAnalysisAmpSuite.py -v - amplicon_classifier.py -v - feature_similarity.py -h - make_results_table.py -h diff --git a/recipes/amplify/build.sh b/recipes/amplify/build.sh index 94a9322f414cc..3795944d08f32 100644 --- a/recipes/amplify/build.sh +++ b/recipes/amplify/build.sh @@ -4,8 +4,8 @@ mkdir -p ${PREFIX}/bin/ mkdir -p ${PREFIX}/share/amplify/ mkdir -p ${PREFIX}/share/amplify/src/ mkdir -p ${PREFIX}/share/amplify/models/ -cp -r src/. ${PREFIX}/share/amplify/src -cp -r models/. ${PREFIX}/share/amplify/models +cp -r src/. ${PREFIX}/share/amplify/src/ +cp -r models/. ${PREFIX}/share/amplify/models/ echo "#!/bin/bash" > ${PREFIX}/bin/AMPlify echo "${PREFIX}/share/amplify/src/AMPlify.py \$@" >> ${PREFIX}/bin/AMPlify diff --git a/recipes/amplify/meta.yaml b/recipes/amplify/meta.yaml index 28e7d52ba1728..6df2912c42852 100644 --- a/recipes/amplify/meta.yaml +++ b/recipes/amplify/meta.yaml @@ -1,5 +1,5 @@ {% set name = "amplify" %} -{% set version = "1.1.0" %} +{% set version = "2.0.0" %} package: name: '{{ name|lower }}' @@ -7,22 +7,27 @@ package: source: url: https://github.com/bcgsc/AMPlify/archive/v{{ version }}.tar.gz - sha256: 8ce9cc10fbb73048b8d8906a387130d9a1ac24928c4762cd190861d44ebb4466 + sha256: 94418a9e2f09b1cfc63eff047fab6d15cce5a7afae5283e50ab809dac2de8752 build: - number: 0 + number: 1 noarch: generic + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} requirements: + host: + - python =3.6 run: - python =3.6 - keras =2.2.4 - - tensorflow =1.12 + - tensorflow >=1.10, <1.13 - numpy <1.17 - biopython - pandas - scikit-learn - h5py <3 + - absl-py <2 test: commands: diff --git a/recipes/ampligone/meta.yaml b/recipes/ampligone/meta.yaml index 7abf6fa3729ca..9189a1164ae51 100644 --- a/recipes/ampligone/meta.yaml +++ b/recipes/ampligone/meta.yaml @@ -1,5 +1,5 @@ {% set name = "AmpliGone" %} -{% set version = "1.3.0" %} +{% set version = "1.3.1" %} package: name: "{{ name|lower }}" @@ -7,11 +7,13 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: d2fb6b0b526e784a6ddaac19e92ab074266a25905de539f227a5131297c41aa0 + sha256: f53520874f5f3301b6099142e1d79264a96820add09affb0130744eb39ae4139 build: noarch: python number: 0 + run_exports: + - {{ pin_subpackage("ampligone", max_pin="x") }} entry_points: - ampligone = AmpliGone.AmpliGone:main - AmpliGone = AmpliGone.AmpliGone:main @@ -51,4 +53,4 @@ extra: recipe-maintainers: - florianzwagemaker - KHajji - - ids-bioinformatics + - ids-bioinformatics \ No newline at end of file diff --git a/recipes/anansescanpy/meta.yaml b/recipes/anansescanpy/meta.yaml index e53033971199d..7939a37e114b6 100644 --- a/recipes/anansescanpy/meta.yaml +++ b/recipes/anansescanpy/meta.yaml @@ -11,7 +11,9 @@ source: sha256: 9efd6ca2c1e5a9fc1ab70030f74f4a063f7e7ac065e6c7942d8b8cd08626accf build: - number: 0 + number: 1 + run_exports: + - {{ pin_subpackage("anansescanpy", max_pin="x.") }} noarch: python script: {{ PYTHON }} -m pip install . -vv diff --git a/recipes/ancestry_hmm-s/meta.yaml b/recipes/ancestry_hmm-s/meta.yaml index 1080842dc5b44..27e8fb91c3ef8 100644 --- a/recipes/ancestry_hmm-s/meta.yaml +++ b/recipes/ancestry_hmm-s/meta.yaml @@ -10,7 +10,9 @@ source: sha256: 3bbee77945f7c90b6aeddb27ca388411d91bc61c4b770dd1750492beeee9583f build: - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage(name, max_pin="x.x.x") }} requirements: build: @@ -39,3 +41,5 @@ about: extra: identifiers: - doi:10.1101/2020.08.02.232934 # bioRxiv preprint + additional-platforms: + - linux-aarch64 diff --git a/recipes/ancestry_hmm/meta.yaml b/recipes/ancestry_hmm/meta.yaml index ade1fb5b597eb..c1dc3d738c45c 100644 --- a/recipes/ancestry_hmm/meta.yaml +++ b/recipes/ancestry_hmm/meta.yaml @@ -11,7 +11,9 @@ source: sha256: {{sha256}} build: - number: 1 + number: 2 + run_exports: + - {{ pin_subpackage("ancestry_hmm", max_pin="x.x.x") }} requirements: build: @@ -39,3 +41,5 @@ about: extra: identifiers: - doi:10.1371/journal.pgen.1006529 + additional-platforms: + - linux-aarch64 diff --git a/recipes/anchorwave/meta.yaml b/recipes/anchorwave/meta.yaml index 2480797be239b..d4e34368db76c 100644 --- a/recipes/anchorwave/meta.yaml +++ b/recipes/anchorwave/meta.yaml @@ -1,7 +1,7 @@ {% set name = "anchorwave" %} -{% set version = "1.2.2" %} -{% set tag = "v1.2.2" %} -{% set sha256 = "db951e2fc8e493ce29e8c6e4f0226a68dc2fdc62631c1fe65077988647e98d01" %} +{% set version = "1.2.3" %} +{% set tag = "v1.2.3" %} +{% set sha256 = "1f689c06f9bbc8e1ed64c0addf4aaf5d172a2fea1e55660b8d3f6dfdffe3f157" %} package: name: {{ name }} diff --git a/recipes/anglerfish/meta.yaml b/recipes/anglerfish/meta.yaml index ee4d25f033fc1..d15537aa287a2 100644 --- a/recipes/anglerfish/meta.yaml +++ b/recipes/anglerfish/meta.yaml @@ -1,5 +1,5 @@ {% set name = "anglerfish" %} -{% set version = "0.6.0" %} +{% set version = "0.6.1" %} package: name: "{{ name|lower }}" @@ -7,12 +7,12 @@ package: source: url: "https://pypi.io/packages/source/b/bio-{{ name }}/bio-{{ name }}-{{ version }}.tar.gz" - sha256: b67a0c77680f85ebdf88622382bb271655e807c60dc3bdcd01997d336e6574fa + sha256: 91a62cbbc388009bd503df0d3f64441c0e86ab377da46f721f5fcf82b9cce331 build: number: 0 noarch: python - script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + script: "cp ${RECIPE_DIR}/requirements.txt ${SRC_DIR} && {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" entry_points: - anglerfish=anglerfish.anglerfish:anglerfish run_exports: @@ -24,11 +24,13 @@ requirements: - python >=3.7 run: - biopython + - click + - minimap2 - numpy + - pandas - python >=3.7 - python-levenshtein - pyyaml - - minimap2 test: imports: diff --git a/recipes/anglerfish/requirements.txt b/recipes/anglerfish/requirements.txt new file mode 100644 index 0000000000000..db39464867253 --- /dev/null +++ b/recipes/anglerfish/requirements.txt @@ -0,0 +1,6 @@ +biopython==1.83 +click==8.1.7 +levenshtein==0.23.0 +numpy==1.26.3 +pandas==2.1.4 +pyyaml==6.0.1 \ No newline at end of file diff --git a/recipes/angsd/meta.yaml b/recipes/angsd/meta.yaml index 4b2e5be264ddf..ada38cb647493 100644 --- a/recipes/angsd/meta.yaml +++ b/recipes/angsd/meta.yaml @@ -12,7 +12,9 @@ source: build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage("angsd", max_pin="x.x") }} skip: True # [osx] requirements: @@ -45,3 +47,5 @@ extra: identifiers: - biotools:angsd - doi:10.1186/s12859-014-0356-4 + additional-platforms: + - linux-aarch64 diff --git a/recipes/anise_basil/meta.yaml b/recipes/anise_basil/meta.yaml index 6eb293b43fae4..39ee6a2a7275f 100644 --- a/recipes/anise_basil/meta.yaml +++ b/recipes/anise_basil/meta.yaml @@ -18,7 +18,9 @@ source: build: skip: True # [py27] - number: 6 + number: 7 + run_exports: + - {{ pin_subpackage("anise_basil", max_pin="x.x.x") }} requirements: build: @@ -29,6 +31,7 @@ requirements: host: - boost-cpp - python + - zlib run: - python @@ -51,3 +54,5 @@ about: extra: identifiers: - doi:10.1093/bioinformatics/btv051 + additional-platforms: + - linux-aarch64 diff --git a/recipes/anndata2ri/meta.yaml b/recipes/anndata2ri/meta.yaml index ef5463b85c2d8..b9c15422687c7 100644 --- a/recipes/anndata2ri/meta.yaml +++ b/recipes/anndata2ri/meta.yaml @@ -6,9 +6,11 @@ package: version: {{ version }} build: - number: 0 + number: 1 noarch: python script: "{{ PYTHON }} -m pip install . --no-deps -vvv" + run_exports: + - {{ pin_subpackage('anndata2ri', max_pin="x") }} source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz @@ -20,14 +22,14 @@ requirements: - flit - pip - get_version - - rpy2 >=3.4.3 + - rpy2 >=3.5.2 - hatchling - hatch-vcs run: - python >=3.6 - anndata - get_version - - rpy2 >=3.4.3 + - rpy2 >=3.5.2 - tzlocal test: diff --git a/recipes/annembed/meta.yaml b/recipes/annembed/meta.yaml index 5a2b606fcd0b3..8b87e6aa37968 100644 --- a/recipes/annembed/meta.yaml +++ b/recipes/annembed/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.1.2" %} +{% set version = "0.1.4" %} package: name: annembed @@ -11,7 +11,7 @@ build: skip: True # [osx] source: url: https://github.com/jianshu93/annembed/archive/v{{ version }}.tar.gz - sha256: 68d08b42f06d873a3b301cb609530cb1072cd97cd8ccefa8d0331d857f692352 + sha256: 0f923798db3843aac0352eba5d2b169673ee087fce2cc37981bd19a1ecb878d0 requirements: build: @@ -26,7 +26,7 @@ test: - annembed -h about: - home: https://github.com/jean-pierreBoth/gsearch + home: https://github.com/jianshu93/annembed license: MIT summary: annembed is an ultra-fast and scalable non-linear dimension reduction algorithm (similar to UMAP or t-SNE) for large-scale biological data diff --git a/recipes/annonars/meta.yaml b/recipes/annonars/meta.yaml index d7d44551f9f50..c07360cdd3eb2 100644 --- a/recipes/annonars/meta.yaml +++ b/recipes/annonars/meta.yaml @@ -1,18 +1,18 @@ -{% set version = "0.33.0" %} +{% set version = "0.36.1" %} package: name: annonars version: {{ version }} build: - number: 0 + number: 1 skip: True # [osx] run_exports: - {{ pin_subpackage("annonars", max_pin="x.x") }} source: - url: https://github.com/bihealth/annonars/archive/refs/tags/v{{ version }}.tar.gz - sha256: 258cfc2aee680718fc1acc8bccddb571416e425198ca258ee295cdc42cc19f71 + url: https://github.com/varfish-org/annonars/archive/refs/tags/v{{ version }}.tar.gz + sha256: 7aee8b87780956171a922b8fead5201c1506d5ec9cadc7ea33c009ce2f0b3816 requirements: build: @@ -37,7 +37,7 @@ test: - annonars --help about: - home: https://github.com/bihealth/annonars + home: https://github.com/varfish-org/annonars license: Apache-2.0 license_file: LICENSE.txt summary: 'Genome annotation based on Rust and RocksDB.' @@ -45,3 +45,5 @@ about: extra: recipe-maintainers: - holtgrewe + additional-platforms: + - linux-aarch64 diff --git a/recipes/annosine2/meta.yaml b/recipes/annosine2/meta.yaml index 8e3f769b95e18..e3e0c6c3e22fc 100644 --- a/recipes/annosine2/meta.yaml +++ b/recipes/annosine2/meta.yaml @@ -1,5 +1,5 @@ {% set name = "annosine2" %} -{% set version = "1.0.5" %} +{% set version = "2.0.7" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 4b51d569f064657d31ad70893723ce1809e0be22d9be0fa23bb4c9924645a423 + sha256: 94387b895e2b011125211039598b8c426124aa43be6915697243497eefb7fff8 build: number: 0 diff --git a/recipes/annotsv/meta.yaml b/recipes/annotsv/meta.yaml index c729ada9c6038..573fe8dc6f9be 100644 --- a/recipes/annotsv/meta.yaml +++ b/recipes/annotsv/meta.yaml @@ -1,13 +1,13 @@ {% set name = "annotsv" %} -{% set version = "3.3.9" %} -{% set sha256 = "698db38f70aaf7e839fbe090fc647b5dd7584c71a9b6397e38bf5af83a4e4c44" %} +{% set version = "3.4" %} +{% set sha256 = "98dcdbaf93525380e6c9c9dd0d501bf1af21b68155f635e4422a955970ca8f83" %} package: name: {{ name }} version: {{ version }} build: - number: 0 + number: 1 noarch: generic run_exports: - {{ pin_subpackage('annotsv', max_pin="x") }} diff --git a/recipes/annotwg/meta.yaml b/recipes/annotwg/meta.yaml index fd06dc96d44b1..d2e294561f1b9 100644 --- a/recipes/annotwg/meta.yaml +++ b/recipes/annotwg/meta.yaml @@ -7,7 +7,9 @@ package: version: {{ version }} build: - number: 0 + number: 1 + run_exports: + - {{ pin_subpackage("annotwg", max_pin="x") }} noarch: generic source: diff --git a/recipes/antismash/build.sh b/recipes/antismash/build.sh index e60c5bc782d58..336e0d884c8bf 100644 --- a/recipes/antismash/build.sh +++ b/recipes/antismash/build.sh @@ -1,5 +1,5 @@ #!/bin/bash echo "include antismash/detection/genefinding/data/train_crypto" >> MANIFEST.in -df -h -$PYTHON -m pip install . --ignore-installed --no-deps -vv +df -h +${PYTHON} -m pip install . --no-build-isolation --no-deps --no-cache-dir -vvv diff --git a/recipes/antismash/meta.yaml b/recipes/antismash/meta.yaml index 6d4818140a158..c6ae23bcad79e 100644 --- a/recipes/antismash/meta.yaml +++ b/recipes/antismash/meta.yaml @@ -1,6 +1,6 @@ {% set name = "antiSMASH" %} -{% set version = "6.1.1" %} -{% set sha256 = "38c9fa8d34dea2552d3b21e3cb2ca293864f2f53d381764de9dd3d5f0b40139e" %} +{% set version = "7.1.0" %} +{% set sha256 = "5c01cce48ef5cc2bc60bfd2e185a5937e731e86a711c4c822a336640984e9b48" %} package: name: {{ name|lower }} @@ -9,6 +9,11 @@ package: build: number: 0 noarch: python + entry_points: + - download-antismash-databases=antismash.download_databases:_main + - antismash=antismash.__main__:entrypoint + run_exports: + - {{ pin_subpackage('antismash', max_pin="x") }} source: url: https://dl.secondarymetabolites.org/releases/{{ version }}/antismash-{{ version }}.tar.gz @@ -16,31 +21,33 @@ source: requirements: host: - - python >=3.7 + - python >=3.9 - pip + - pytest run: - - python >=3.7 + - python >=3.9 + - brawn >=1.0.1 - numpy - - biopython 1.78 - - helperlibs >=0.2.0 + - biopython 1.78.* + - helperlibs >=0.2.1 - jinja2 - joblib - jsonschema - markupsafe >=2.0 + - nrpys >=0.1.1 - pysvg-py3 - bcbio-gff - - pyscss + - libsass - matplotlib-base - scipy - - openjdk - - scikit-learn >=0.19 - - diamond 0.9.* + - scikit-learn >=1.3.2 + - moods >=1.9.4.2 + - diamond - fasttree 2.1.* - glimmerhmm ==3.0.* - hmmer2 - - hmmer ==3.1b2 - - meme <=4.11.2 - - muscle 3.8.* + - hmmer >=3.1b2 + - meme 4.11.2 - blast - prodigal @@ -53,7 +60,7 @@ test: about: home: https://docs.antismash.secondarymetabolites.org/intro/ - license: AGPL-3.0 + license: AGPL-3.0-or-later license_family: AGPL license_file: LICENSE.txt summary: antiSMASH - the antibiotics and Secondary Metabolite Analysis SHell @@ -72,4 +79,5 @@ extra: - doi:10.1093/nar/gkx319 - doi:10.1093/nar/gkz310 - doi:10.1093/nar/gkab335 + - doi:10.1093/nar/gkad344 - usegalaxy-eu:antismash diff --git a/recipes/antismash/post-link.sh b/recipes/antismash/post-link.sh index 26fdad9e1d1cd..0df651f1df344 100644 --- a/recipes/antismash/post-link.sh +++ b/recipes/antismash/post-link.sh @@ -1,4 +1,11 @@ #!/bin/bash -# download the databases required by several options +cat <> ${PREFIX}/.messages.txt + + +antiSMASH databases are no longer included in the antismash conda package due to a "no space left on device" error. +Before using antiSMASH, please download the databases required by several options: download-antismash-databases + + +EOF diff --git a/recipes/anvio-minimal/meta.yaml b/recipes/anvio-minimal/meta.yaml index 4c1d381c9b90f..8cd80ff415df2 100644 --- a/recipes/anvio-minimal/meta.yaml +++ b/recipes/anvio-minimal/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "7.1" %} -{% set sha256 = "5ff729ba392a530b200378cd55e0dd85032152da44dce0260daef2ddc3122c99" %} +{% set version = "8" %} +{% set sha256 = "4ced91773648d9ca27a20b725ab64bc213d80b33726940f5f818240033912c04" %} package: name: anvio-minimal @@ -12,7 +12,9 @@ source: build: number: 0 noarch: python - script: python -m pip install --no-deps --ignore-installed -vv . + script: {{ PYTHON }} -m pip install --no-deps --no-build-isolation --no-cache-dir -vvv . + run_exports: + - {{ pin_subpackage('anvio-minimal', max_pin="x.x") }} requirements: host: @@ -20,18 +22,18 @@ requirements: - pip run: - python >=3 - - numpy + - numpy <=1.24 - bottle - pysam - ete3 - scipy - - scikit-learn <0.21 + - scikit-learn ==1.2.2 - django - requests - - psutil ==5.4.3 + - psutil - mistune - six - - pandas ==0.25.1 + - pandas ==1.4.4 - matplotlib-base - statsmodels - colored @@ -40,24 +42,33 @@ requirements: - numba - sqlite >=3.31.1 - paste + - multiprocess + - rich-argparse + - plotext + - networkx # these three are critical versions. any changes must be # tested with extra attention: - pyani ==0.2.10 - snakemake-minimal ==5.10.0 + test: commands: - anvi-pan-genome --help - anvi-script-reformat-fasta --help about: - home: http://merenlab.org/software/anvio/ + home: https://merenlab.org/software/anvio/ license: GPL-3.0-or-later license_family: GPL3 license_file: LICENSE.txt summary: "An interactive analysis and visualization platform for omics data" - dev_url: https://github.com/merenlab/anvio - + dev_url: https://github.com/merenlab/anvio + doc_url: https://anvio.org/learn/ + extra: container: # extended-base generates en_US.UTF-8 locale and sets LC_ALL, LANG properly extended-base: True + identifiers: + - biotools:anvio + - doi:10.1038/s41564-020-00834-3 diff --git a/recipes/apscale/meta.yaml b/recipes/apscale/meta.yaml index 495fa59ecdf6a..35804d0fc32bf 100644 --- a/recipes/apscale/meta.yaml +++ b/recipes/apscale/meta.yaml @@ -1,5 +1,5 @@ {% set name = "apscale" %} -{% set version = "1.6.3" %} +{% set version = "1.7.1" %} package: name: {{ name|lower }} @@ -7,14 +7,16 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/apscale-{{ version }}.tar.gz - sha256: cb9c08810cb2c55377ea4dde936f4321fd0a753ef853bb0fad621d4bb39d28da + sha256: 99ea723823313e33ee69373fbb9b12d7a62765fe6d74c9f69d61a2d4dc2ea69f build: entry_points: - apscale = apscale.__main__:main noarch: python - script: {{ PYTHON }} -m pip install . -vv + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv number: 0 + run_exports: + - {{ pin_subpackage('apscale', max_pin="x") }} requirements: host: @@ -38,16 +40,15 @@ test: imports: - apscale commands: - - pip check - apscale --help - requires: - - pip about: home: https://github.com/DominikBuchner/apscale summary: Advanced Pipeline for Simple yet Comprehensive AnaLysEs of DNA metabarcoding data license: MIT + license_family: MIT license_file: LICENSE + dev_url: https://github.com/DominikBuchner/apscale extra: recipe-maintainers: diff --git a/recipes/aragorn/meta.yaml b/recipes/aragorn/meta.yaml index b2936b72349f6..8292bad9d714a 100644 --- a/recipes/aragorn/meta.yaml +++ b/recipes/aragorn/meta.yaml @@ -7,7 +7,9 @@ source: url: http://www.ansikte.se/ARAGORN/Downloads/aragorn1.2.41.c build: - number: 1 + number: 2 + run_exports: + - {{ pin_subpackage("aragorn", max_pin="x.x.x") }} requirements: build: @@ -21,3 +23,7 @@ about: home: http://www.ansikte.se/ARAGORN/ license: GPLv3 summary: 'ARAGORN, tRNA (and tmRNA) detection' + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/arborator/meta.yaml b/recipes/arborator/meta.yaml new file mode 100644 index 0000000000000..23fe634945fa5 --- /dev/null +++ b/recipes/arborator/meta.yaml @@ -0,0 +1,51 @@ +{% set name = "arborator" %} +{% set version = "1.0.0" %} +{% set sha256 = "682f022481203da36368e46942213767068ecdb4fae4d0ab7580d8556d961d0e" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/arborator-{{ version }}.tar.gz + sha256: {{ sha256 }} + + +build: + number: 1 + noarch: python + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} + script: {{ PYTHON }} -m pip install . --use-pep517 --no-deps -vvv + entry_points: + - arborator=arborator.main:main + +requirements: + host: + - python >=3.8,<3.10 + - pip + run: + - python >=3.8,<3.10 + - {{ pin_compatible('numpy', max_pin="x") }} + - pyarrow ==12.0.0 + - pandas ==2.0.2 + - scipy >=1.0.0 + - numba ==0.57.1 + - pytables + - psutil + - six + - profile_dists + - genomic_address_service + + +test: + commands: + - arborator -h + +about: + home: 'https://pypi.org/project/arborator/' + summary: 'Arborator: Simplifying operationalized pathogen surveillance and outbreak detection' + license: Apache-2.0 + license_file: LICENSE + dev_url: 'https://github.com/phac-nml/arborator' + diff --git a/recipes/arcas-hla/meta.yaml b/recipes/arcas-hla/meta.yaml index fa98f4d095d42..c1508a625042b 100644 --- a/recipes/arcas-hla/meta.yaml +++ b/recipes/arcas-hla/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.5.0" %} +{% set version = "0.6.0" %} package: name: arcas-hla @@ -6,26 +6,31 @@ package: source: url: https://github.com/RabadanLab/arcasHLA/archive/v{{ version }}.tar.gz - sha256: fb17b3ba74facf4edb3329099b158910bdc7c4e73074efab9880d4136a0d4e93 + sha256: 75bef1a5596a9dfabccb901420f5d852d6d8a15d9c676e4c94787b8d25dd708b build: - number: 3 + number: 1 noarch: generic + run_exports: + - {{ pin_subpackage("arcas-hla", max_pin="x.x") }} requirements: run: + - bedtools + - biopython - coreutils - - bedtools >=2.27.1 - - biopython <=1.77 - git - git-lfs - - kallisto ==0.44.0 + - kallisto ==0.50.1 - numpy - pandas - pigz - - python >=3.6.1 - - samtools >=1.9 - - scipy ==1.1.0 + - pip + - pyarrow + - pytest + - python + - samtools + - scipy test: commands: @@ -33,10 +38,11 @@ test: about: home: https://github.com/RabadanLab/arcasHLA - license: GPL-3.0 - summary: high resolution HLA typing from RNA seq + license: GPL-3.0-only + license_file: LICENSE + summary: high-resolution HLA typing from RNA seq description: | - arcasHLA performs high resolution genotyping for HLA class I and class II + arcasHLA performs high-resolution genotyping for HLA class I and class II genes from RNA sequencing, supporting both paired and single-end samples. extra: diff --git a/recipes/architeuthis/meta.yaml b/recipes/architeuthis/meta.yaml new file mode 100644 index 0000000000000..6ef0a4385567a --- /dev/null +++ b/recipes/architeuthis/meta.yaml @@ -0,0 +1,44 @@ +{% set name = "architeuthis" %} +{% set version = "0.2.1" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/cdiener/{{ name }}/archive/{{ version }}.tar.gz + sha256: af522d822ed2dcf3bc386c8cb5ea42772ade1826b998ca0f1cd1d825f1a114ab + +build: + number: 0 + script: + - go build -v -ldflags "-w -s -X 'main.version={{ version }}'" -o $PREFIX/bin/architeuthis + run_exports: + - {{ pin_subpackage('architeuthis', max_pin="x.x") }} + +requirements: + build: + - {{ compiler('go') }} + run: + - taxonkit >=0.16.0 + +test: + commands: + - architeuthis -v + +about: + home: https://github.com/cdiener/{{ name }} + license: Apache-2.0 + license_file: LICENSE + summary: Tool to analyze and summarize data for Kraken. + description: | + architeuthis is a fast standalone command to supplement the Kraken suite of software + tools such like Kraken2, KrakenUniq, and Bracken. I saw myself repeatedly rewriting + the same code in my pipelines when dealing with Kraken output, like merging files or + maninpulating lineage annotations. It also adds some functionality to dive deeper + into the individual k-mer classifications for reads. + dev_url: https://github.com/cdiener/architeuthis.git + +extra: + recipe-maintainers: + - cdiener \ No newline at end of file diff --git a/recipes/arcs/meta.yaml b/recipes/arcs/meta.yaml index e32cd8699d69f..761927d7f9309 100644 --- a/recipes/arcs/meta.yaml +++ b/recipes/arcs/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.2.6" %} +{% set version = "1.2.7" %} package: name: arcs @@ -11,7 +11,7 @@ build: source: url: https://github.com/bcgsc/arcs/releases/download/v{{ version }}/arcs-{{ version }}.tar.gz - sha256: 6efc120d55212bfb0483a262731827318ec0a5f037d4984da8445cc3788ba297 + sha256: 3162cff3286a033b494ace8050abc96d4083f846cafe921bb0122170f705eca8 requirements: build: diff --git a/recipes/argnorm/meta.yaml b/recipes/argnorm/meta.yaml new file mode 100644 index 0000000000000..3266c5db32433 --- /dev/null +++ b/recipes/argnorm/meta.yaml @@ -0,0 +1,52 @@ +{% set name = "argnorm" %} +{% set version = "0.2.0" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" + sha256: 8210aaa121272f2bd815498332bd076b9a5322b064c851dfb32d01486921a88c + +build: + noarch: python + number: 1 + entry_points: + - argnorm=argnorm.cli:main + script: "{{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation" + run_exports: + - {{ pin_subpackage('argnorm', max_pin='x') }} +requirements: + host: + - pandas + - pip + - pronto >=2.5.6 + - pytest + - python >=3.7 + - setuptools + run: + - pandas + - pronto >=2.5.6 + - pytest + - python >=3.7 + - setuptools + +test: + imports: + - argnorm + - argnorm.data + commands: + - argnorm --help + +about: + home: "https://github.com/BigDataBiology/argNorm" + license: MIT + license_family: MIT + license_file: LICENSE + summary: "Normalize antibiotic resistance genes (ARGs) abundance tables (e.g., from metagenomics) by using the ARO ontology (developed by CARD)." + doc_url: https://argnorm.readthedocs.io/en/latest/ + +extra: + recipe-maintainers: + - Vedanth-Ramji diff --git a/recipes/arvados-python-client/meta.yaml b/recipes/arvados-python-client/meta.yaml index 8c8e710950c0a..0760ed2994b37 100644 --- a/recipes/arvados-python-client/meta.yaml +++ b/recipes/arvados-python-client/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.7.1" %} +{% set version = "2.7.2" %} package: name: arvados-python-client @@ -6,7 +6,7 @@ package: source: url: https://pypi.io/packages/source/a/arvados-python-client/arvados-python-client-{{ version }}.tar.gz - sha256: c973be949dbb35959d5eeda1d2bad31813484756e8367573e7b2f0149190039e + sha256: 97b064ee9e1fa1340c1742758c9ca7e787585118f8ccf94704033bd9ba5c05ed build: noarch: python diff --git a/recipes/ashlar/meta.yaml b/recipes/ashlar/meta.yaml index 56f3226e440d9..0f70c9431a7f1 100644 --- a/recipes/ashlar/meta.yaml +++ b/recipes/ashlar/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ashlar" %} -{% set version = "1.17.0" %} +{% set version = "1.18.0" %} package: name: "{{ name|lower }}" @@ -7,31 +7,34 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 3c4fb3a2d1ffee986f86c633d12f753544904ddccbd8499851badbdeec3142be + sha256: 2c0e8997a49daf64fc56b3afabc2e58a0eb2f6f9985d0c3c22be957bf8b03760 build: number: 0 entry_points: - ashlar=ashlar.scripts.ashlar:main - script: "{{ PYTHON }} -m pip install . -vv" + - preview_slide=ashlar.scripts.preview_slide:main + - make_alignment_movie=ashlar.scripts.make_alignment_movie:main + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" noarch: python + run_exports: + - {{ pin_subpackage('ashlar', max_pin="x") }} requirements: host: - pip - - python + - python <3.12 run: - blessed >=1.17 - matplotlib-base >=3.1.2 - networkx >=2.4 - numpy >=1.18.1 - - pip - pyjnius >=1.2.1 - - python + - python <3.12 - scikit-image ==0.19 - scikit-learn >=0.21.1 - scipy >=1.4.1 - - tifffile>=2022.4.8 + - tifffile >=2022.4.8 - zarr test: @@ -44,6 +47,8 @@ test: about: home: "https://github.com/sorgerlab/ashlar" license: MIT + license_family: MIT + license_file: LICENSE summary: "Alignment by Simultaneous Harmonization of Layer/Adjacency Registration" doc_url: https://labsyspharm.github.io/ashlar/ diff --git a/recipes/assembly-stats/meta.yaml b/recipes/assembly-stats/meta.yaml index 482798649fd68..9513521d7e277 100644 --- a/recipes/assembly-stats/meta.yaml +++ b/recipes/assembly-stats/meta.yaml @@ -12,8 +12,10 @@ source: - 0001-Fix-macOS-compilation.patch build: - number: 7 - + number: 8 + run_exports: + - {{ pin_subpackage("assembly-stats", max_pin="x") }} + requirements: build: - make @@ -30,3 +32,6 @@ about: home: https://github.com/sanger-pathogens/assembly-stats license: GPL-3.0 summary: 'Get assembly statistics from FASTA and FASTQ files' +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/assembly_finder/meta.yaml b/recipes/assembly_finder/meta.yaml index 0da7d56f0b95d..24c1e9923c775 100644 --- a/recipes/assembly_finder/meta.yaml +++ b/recipes/assembly_finder/meta.yaml @@ -1,44 +1,50 @@ {% set name = "assembly_finder" %} -{% set version = "0.4.1" %} +{% set version = "0.7.2" %} package: name: "{{ name|lower }}" version: "{{ version }}" source: - - url: https://github.com/metagenlab/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz - sha256: be7b470ad55c5ca304816b7414bf6d8f50db351b92ed9c6be6842ec0ed8cee8b + url: https://github.com/metagenlab/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: 83476551d22f2336ae40a3412f7b38011341006933d87fc3bb7e6b763a1b89bd + build: number: 0 - entry_points: - - assembly_finder = assembly_finder.assembly_finder:cli noarch: python - script: {{ PYTHON }} -m pip install --no-deps --ignore-installed . -vv + entry_points: + - assembly_finder=assembly_finder.__main__:main + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation run_exports: - {{ pin_subpackage('assembly_finder', max_pin="x.x") }} requirements: host: - - python >=3.9,<3.12 + - python >=3.10 - pip - run: - - python >=3.9,<3.12 - - snakemake-minimal >=7.32.4 - - click >=7 - - biopython >=1.78 - - pandas >=2.0.3 - - ete3 >=3.1.3 - - aspera-cli >=4.14.0 + - python >=3.10 + - snakemake-minimal >=7.32.4 + - pulp <2.8 + - snaketool-utils >=0.0.4 + - attrmap >=0.0.7 + - pyyaml >=6.0 + - pandas >=2.2.1 + - rich-click >=1.7.4 + test: commands: - assembly_finder -h - assembly_finder -v + about: home: https://github.com/metagenlab/assembly_finder - license: GPL-3.0-or-later + license: MIT + license_family: MIT license_file: LICENSE - summary: Snakemake pipeline to download assemblies from NCBI. + summary: "Snakemake-powered cli pipeline to download genomes with NCBI datasets" + dev_url: https://github.com/metagenlab/assembly_finder + doc_url: https://metagenlab.github.io/assembly_finder extra: container: diff --git a/recipes/assemblycomparator2/meta.yaml b/recipes/assemblycomparator2/meta.yaml index f0d50c8973c9b..cc2844dfddf15 100644 --- a/recipes/assemblycomparator2/meta.yaml +++ b/recipes/assemblycomparator2/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.5.15" %} +{% set version = "2.6.2" %} package: name: assemblycomparator2 @@ -6,7 +6,7 @@ package: source: url: https://github.com/cmkobel/assemblycomparator2/archive/refs/tags/v{{ version }}.tar.gz - sha256: 9605f4021710e975365090fba1c13c2005c46978cec48c6cabe678167c86d33e + sha256: 52d1465c0da1955ee58848043309db81e551a87428e8b10fc55c02437addf6b8 build: diff --git a/recipes/aster/activate.sh b/recipes/aster/activate.sh new file mode 100644 index 0000000000000..8b7e185b7e5ce --- /dev/null +++ b/recipes/aster/activate.sh @@ -0,0 +1,3 @@ +export OLD_LD_LIBRARY_PATH=${LD_LIBRARY_PATH} +export LD_LIBRARY_PATH=${CONDA_PREFIX}/lib/:${LD_LIBRARY_PATH} +export SINGULARITYENV_LD_LIBRARY_PATH=${LD_LIBRARY_PATH} \ No newline at end of file diff --git a/recipes/aster/build.sh b/recipes/aster/build.sh index 786e3a99cae85..0dbd5f0bcda22 100644 --- a/recipes/aster/build.sh +++ b/recipes/aster/build.sh @@ -1,6 +1,13 @@ #!/bin/bash -sed -i.bak1 's/-march=native/-march=x86-64 -mtune=generic/g' makefile +for CHANGE in "activate" "deactivate" +do + mkdir -p "${PREFIX}/etc/conda/${CHANGE}.d" + cp "${RECIPE_DIR}/${CHANGE}.sh" "${PREFIX}/etc/conda/${CHANGE}.d/${PKG_NAME}_${CHANGE}.sh" +done +if [ `uname -m` != "aarch64" ]; then + sed -i.bak1 's/-march=native/-march=x86-64 -mtune=generic/g' makefile +fi if [ "$(uname)" == "Darwin" ]; then sed -i.bak2 's/g++/${CXX}/g' makefile diff --git a/recipes/aster/deactivate.sh b/recipes/aster/deactivate.sh new file mode 100644 index 0000000000000..3b8e36f330814 --- /dev/null +++ b/recipes/aster/deactivate.sh @@ -0,0 +1,3 @@ +export LD_LIBRARY_PATH=${OLD_LD_LIBRARY_PATH} +unset OLD_LD_LIBRARY_PATH +unset SINGULARITYENV_LD_LIBRARY_PATH \ No newline at end of file diff --git a/recipes/aster/meta.yaml b/recipes/aster/meta.yaml index 74e9391b7ffa2..19c285b795681 100644 --- a/recipes/aster/meta.yaml +++ b/recipes/aster/meta.yaml @@ -1,6 +1,6 @@ -{% set version = "1.15" %} +{% set version = "1.16" %} {% set name = "ASTER" %} -{% set sha256 = "71618824a0f39135977709f21f3b6374815407411fb44474442a1a9c88a6c919" %} +{% set sha256 = "c6e80de483a0a59fc0d3a74465b1f793e773b9d79cbd20756c6766136ffbb1a7" %} package: name: "{{ name|lower }}" @@ -8,6 +8,8 @@ package: build: number: 2 + run_exports: + - {{ pin_subpackage('aster', max_pin="x") }} source: url: "https://github.com/chaoszhang/ASTER/archive/refs/tags/v{{ version }}.tar.gz" @@ -20,16 +22,21 @@ requirements: test: commands: - - master-site -h &> /dev/null # [linux] - - master-pair -h &> /dev/null # [linux] + - caster-site -h &> /dev/null # [linux] + - caster-pair -h &> /dev/null # [linux] + - waster-site -h &> /dev/null # [linux] - astral -h &> /dev/null - astral-pro -h &> /dev/null - astral-hybrid -h &> /dev/null about: home: https://github.com/chaoszhang/ASTER - license: AGPL-3.0 + license: AGPL-3.0-or-later + license_family: AGPL license_file: LICENSE summary: | Accurate Species Tree EstimatoR series; a family of optimation algorithms for species tree inference implemented in C++ +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/astral-tree/astral.py b/recipes/astral-tree/astral.py index f1b2e7421c1e6..2feff928efad7 100755 --- a/recipes/astral-tree/astral.py +++ b/recipes/astral-tree/astral.py @@ -76,24 +76,6 @@ def jvm_opts(argv): return (mem_opts, prop_opts, pass_args, exec_dir) -def def_temp_log_opts(args): - """ - Establish default temporary and log folders. - """ - TEMP = os.getenv("TEMP") - - if TEMP is not None: - if '-log' not in args: - args.append('-log') - args.append(TEMP+'/logs') - - if '-temp_folder' not in args : - args.append('-temp_folder') - args.append(TEMP) - - return args - - def main(): java = java_executable() """ @@ -104,7 +86,6 @@ def main(): we copy the jar file, lib, and resources to the exec_dir directory. """ (mem_opts, prop_opts, pass_args, exec_dir) = jvm_opts(sys.argv[1:]) - pass_args = def_temp_log_opts(pass_args) jar_dir = exec_dir if exec_dir else real_dirname(sys.argv[0]) if pass_args != [] and pass_args[0].startswith('eu'): diff --git a/recipes/astral-tree/meta.yaml b/recipes/astral-tree/meta.yaml index b3d9ae6d5b750..1def11046b60e 100644 --- a/recipes/astral-tree/meta.yaml +++ b/recipes/astral-tree/meta.yaml @@ -1,15 +1,17 @@ # Do not forget to update the version string in the astral_wrapper.py file {% set name = "Astral" %} {% set version = "5.7.8" %} -{% set sha256 = "7284f3f86d4824fb8b80a999f7495245961f2c62943c96c8ad9d626759f65b4e" %} +{% set sha256 = "7b3d89ca4fee42b00e547ed2485e60bebfdf7f0179cfc503f0c522d682483dea" %} package: name: {{ name|lower }}-tree version: {{ version }} build: - number: 0 + number: 1 noarch: generic + run_exports: + - {{ pin_subpackage('astral-tree', max_pin="x") }} source: url: https://github.com/smirarab/ASTRAL/raw/master/{{ name }}.{{ version }}.zip diff --git a/recipes/atac/build.sh b/recipes/atac/build.sh index b4a949f10528c..bcc44e6a711ac 100644 --- a/recipes/atac/build.sh +++ b/recipes/atac/build.sh @@ -3,8 +3,11 @@ make \ CC="${CC} ${CFLAGS} ${CPPFLAGS}" \ CXX="${CXX} ${CXXFLAGS} ${CPPFLAGS} -std=c++03" \ CLDFLAGS="${LDFLAGS}" \ - CXXLDFLAGS="${LDFLAGS}" \ - install + CXXLDFLAGS="${LDFLAGS}" +if [ `uname -m` == "aarch64" ]; then + sed -i "s/Linux-i686/Linux-aarch64/" ${SRC_DIR}/Make.compilers +fi +make install mkdir -p $PREFIX @@ -12,6 +15,10 @@ if [ `uname` == Darwin ]; then cp Darwin-amd64/bin/* $PREFIX/bin/ cp Darwin-amd64/include/* $PREFIX/include/ cp Darwin-amd64/lib/* $PREFIX/lib/ +elif [ `uname -m` == "aarch64" ]; then + cp Linux-aarch64/bin/* $PREFIX/bin/ + cp Linux-aarch64/include/* $PREFIX/include/ + cp Linux-aarch64/lib/* $PREFIX/lib/ else cp Linux-amd64/bin/* $PREFIX/bin/ cp Linux-amd64/include/* $PREFIX/include/ diff --git a/recipes/atac/meta.yaml b/recipes/atac/meta.yaml index b2610cc218ce7..f0650d89f2dc5 100644 --- a/recipes/atac/meta.yaml +++ b/recipes/atac/meta.yaml @@ -9,9 +9,10 @@ source: md5: e23ef1d41836b29332b70271b7c9eb74 build: - number: 4 - skip: True # [py>=30] - + number: 5 + run_exports: + - {{ pin_subpackage("atac", max_pin=None) }} + requirements: build: - make @@ -37,3 +38,5 @@ about: extra: identifiers: - biotools:atac + additional-platforms: + - linux-aarch64 diff --git a/recipes/atlas-gene-annotation-manipulation/meta.yaml b/recipes/atlas-gene-annotation-manipulation/meta.yaml index 78ccb7f53235b..b950a1054c28a 100644 --- a/recipes/atlas-gene-annotation-manipulation/meta.yaml +++ b/recipes/atlas-gene-annotation-manipulation/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.1.0" %} +{% set version = "1.1.1" %} package: name: atlas-gene-annotation-manipulation @@ -6,11 +6,13 @@ package: source: url: https://github.com/ebi-gene-expression-group/atlas-gene-annotation-manipulation/archive/v{{ version }}.tar.gz - sha256: 402b8a93a0bcab374c51d24048149b80e3fd7d1d78e6c8c93ca22804d06c59df + sha256: 25df8b43bbdacd7b05534ccae818cc290c1c5159c4d67cc0dafe52050c681480 build: number: 0 noarch: generic + run_exports: + - {{ pin_subpackage("atlas-gene-annotation-manipulation", max_pin="x") }} requirements: build: diff --git a/recipes/atropos/meta.yaml b/recipes/atropos/meta.yaml index 88e84a06fad27..8fd6958fa8d1b 100644 --- a/recipes/atropos/meta.yaml +++ b/recipes/atropos/meta.yaml @@ -11,7 +11,7 @@ source: sha256: {{ sha256 }} build: - number: 0 + number: 1 # Ensure Cython is rerun by removing *.c output files and PKG-INFO (checked for by setup.py) script: find . "(" -name "*.c" -o -name PKG-INFO ")" -exec rm {} ";" && {{ PYTHON }} -m pip install --no-deps --no-build-isolation . -vvv run_exports: @@ -39,3 +39,7 @@ about: license: CC0 and partly MIT summary: 'trim adapters from high-throughput sequencing reads' doc_url: https://atropos.readthedocs.io + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/attotree/meta.yaml b/recipes/attotree/meta.yaml index 3cd8f4c661f08..9b66f40105c9d 100644 --- a/recipes/attotree/meta.yaml +++ b/recipes/attotree/meta.yaml @@ -1,5 +1,5 @@ {% set name = "attotree" %} -{% set version = "0.1.1" %} +{% set version = "0.1.6" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: ada454ac2a9392667476816c466c005935d5ffe73f87b2b7bc7960a0ec0753a4 + sha256: 9794d2051c007e2e2f38cae53492c2c17b74e6cde2ee5859a8b051dbd65f3a78 build: number: 0 diff --git a/recipes/augur/meta.yaml b/recipes/augur/meta.yaml index 21d5c1cf2ebbe..9e8fbdf584bdd 100644 --- a/recipes/augur/meta.yaml +++ b/recipes/augur/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "23.1.1" %} +{% set version = "24.3.0" %} package: name: augur @@ -6,10 +6,10 @@ package: source: url: https://pypi.io/packages/source/n/nextstrain-augur/nextstrain-augur-{{ version }}.tar.gz - sha256: 1b6f8fb1f20c147d24806764761f8e977c8e100a58e04e06d3110bb72268518f + sha256: 39c648ec2c226e90f3f3b242ee0deda3760760efb567687b5430f76d0b2b5180 build: - number: 1 + number: 0 noarch: python entry_points: - augur = augur.__main__:main @@ -23,19 +23,19 @@ requirements: - pip run: - python >=3.8 - - bcbio-gff >=0.7.0,<0.8 - - biopython >=1.73,!=1.77,!=1.78 + - bcbio-gff >=0.7.1,<0.8 + - biopython >=1.80,<2 - cvxopt >=1.1.9,<2 - importlib_resources >=5.3.0 # [py<311] - isodate >=0.6.0,<0.7 - jsonschema >=3.0.0,<4 - - networkx >=2.5, <3 + - networkx >=2.5,<3 - numpy >=1.0.0,<2 - packaging >=19.2 - pandas >=1.0.0,<2 - pyfastx >=1.0.0,<3 - scipy >=1.0.0,<2 - - treetime >=0.10.0,<0.12 + - treetime >=0.11.2,<0.12 - xopen[zstd] >=1.7.0,<2 - fasttree diff --git a/recipes/auspice/meta.yaml b/recipes/auspice/meta.yaml index 32592ef4fcbe1..2be485192dd3a 100644 --- a/recipes/auspice/meta.yaml +++ b/recipes/auspice/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.50.0" %} +{% set version = "2.52.0" %} package: name: auspice @@ -6,7 +6,7 @@ package: source: url: https://registry.npmjs.org/auspice/-/auspice-{{ version }}.tgz - sha256: 60642de3c9cbbce388a81668f1d116ca8c28520abe5770298dd51aebd94660b0 + sha256: c23a411c10066d173ed2c4b687e3f60429b3ef4cf16cc6e13d79766bafba28df build: number: 0 diff --git a/recipes/aviary/meta.yaml b/recipes/aviary/meta.yaml index eba258abc566c..72560874ce8f3 100644 --- a/recipes/aviary/meta.yaml +++ b/recipes/aviary/meta.yaml @@ -1,29 +1,31 @@ -{% set version = "0.8.3" %} +{% set version = "0.9.0" %} {% set name = "aviary" %} -{% set sha256 = "c484f2bef8ac783e2fbb93270b8a8e034e1139eef2bf641ccfa3a4f17e78abcb" %} +{% set sha256 = "60a13bc4b5053dda041a2f2f677eb518c454b88225b53431dc65ae6ff0f2baa9" %} package: name: aviary version: {{ version }} +source: + url: https://github.com/rhysnewell/{{ name }}/releases/download/v{{ version }}/aviary-genome-{{ version }}.tar.gz + sha256: {{ sha256 }} + build: number: 0 noarch: python - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + entry_points: + - aviary = aviary.aviary:main run_exports: - - {{ pin_subpackage('aviary', max_pin="x") }} - -source: - url: https://github.com/rhysnewell/{{ name }}/releases/download/v{{ version }}/aviary-genome-{{ version }}.tar.gz - sha256: {{ sha256 }} + - {{ pin_subpackage('aviary', max_pin="x.x") }} requirements: host: - - python >=3.8 + - python >=3.8,<3.12 - pip run: - - python >=3.8,<=3.11 - - snakemake >=7.0.0,<=7.32.3 + - python >=3.8,<3.12 + - snakemake-minimal >=7.0.0,<=7.32.3 - ruamel.yaml >=0.15.99 - numpy - pandas @@ -41,11 +43,12 @@ test: about: home: https://github.com/rhysnewell/aviary/ doc_url: https://rhysnewell.github.io/aviary/ - license: GPL3 + dev_url: https://github.com/rhysnewell/aviary/ + license: GPL-3.0-or-later + license_family: GPL3 license_file: LICENSE summary: End-to-end metagenomics hybrid assembly and binning pipeline. description: | Aviary is an easy to use hybrid assembler and metagenomic pipeline For more details see documentation: https://rhysnewell.github.io/aviary/. - diff --git a/recipes/bactopia-assembler/meta.yaml b/recipes/bactopia-assembler/meta.yaml index d44aba6c79699..12a861b1cf8f4 100644 --- a/recipes/bactopia-assembler/meta.yaml +++ b/recipes/bactopia-assembler/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.0.3" %} +{% set version = "1.0.4" %} package: name: bactopia-assembler @@ -12,12 +12,12 @@ build: source: url: https://github.com/bactopia/bactopia-assembler/archive/v{{version}}.tar.gz - sha256: d4f318b7ba97a5c54823f7405bb79f03e0244bc7ccc52313acb4dcffbc1b7347 + sha256: fb332391d7c53db233716bfdc2adc1be25577a268bdb2b3a3fadcea168bcc816 requirements: run: - coreutils - - dragonflye >=1.1.2 + - dragonflye >=1.2.0 - importlib-metadata <5 - sed - shovill-se diff --git a/recipes/bactopia-py/meta.yaml b/recipes/bactopia-py/meta.yaml index 15bfa479cdcff..df10918af0a20 100644 --- a/recipes/bactopia-py/meta.yaml +++ b/recipes/bactopia-py/meta.yaml @@ -1,5 +1,5 @@ {% set name = "bactopia-py" %} -{% set version = "1.0.8" %} +{% set version = "1.1.0" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/bactopia/bactopia-{{ version }}.tar.gz - sha256: ce7277f229045af00b687f7121535f9423b4c346b9f27eb7eef6d83b8e6947c1 + sha256: f251c35b1cc69371e7ef93802243570e0942ee2ba066918667380fedb2ee5631 build: noarch: python diff --git a/recipes/bactopia-variants/meta.yaml b/recipes/bactopia-variants/meta.yaml index fa794e76b8c6d..cb6e67163305d 100644 --- a/recipes/bactopia-variants/meta.yaml +++ b/recipes/bactopia-variants/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.0.1" %} +{% set version = "1.0.2" %} package: name: bactopia-variants @@ -7,10 +7,12 @@ package: build: number: 0 noarch: generic + run_exports: + - {{ pin_subpackage("bactopia-variants", max_pin="x") }} source: url: https://github.com/bactopia/bactopia-variants/archive/v{{version}}.tar.gz - sha256: 4a18e88b7b01790620911762cf8e7d38d1c74ad94044b5ebdd23b9a246a96562 + sha256: 0adcc2cbdbcdd851f604243e88a9bb687baf00c533152899399da1f4ef759ae9 requirements: run: @@ -25,6 +27,7 @@ requirements: - sed - vcf-annotator >=0.7 - vcflib >=1.0.0_rc3,<=1.0.2 # Snippy crashes with v1.0.3 and later + - tabixpp 1.1.0 # vcflib requires libtabixpp.so.0, no longer available as of 1.1.2 test: commands: diff --git a/recipes/bactopia/meta.yaml b/recipes/bactopia/meta.yaml index 8c4f438484b0b..55a6a219c4b5d 100644 --- a/recipes/bactopia/meta.yaml +++ b/recipes/bactopia/meta.yaml @@ -1,23 +1,23 @@ {% set name = "bactopia" %} -{% set version = "3.0.0" %} +{% set version = "3.0.1" %} package: name: {{ name }} version: {{ version }} build: - number: 0 + number: 1 noarch: generic run_exports: - {{ pin_subpackage(name, max_pin='x.x') }} source: url: https://github.com/bactopia/bactopia/archive/v{{version}}.tar.gz - sha256: 24a934c02cde5ab33997590e8db748d045aaec993328b2675123f531e6c6aaf6 + sha256: f3f152294555c05ec37c20041385034b02a79a709d7801b07d2115f50115fa4a requirements: run: - - bactopia-py >=1.0.8 + - bactopia-py 1.0.9 - conda >=22.11.0 - coreutils - mamba >=1.1.0 @@ -25,7 +25,6 @@ requirements: - python >=3.9 - sed - wget - test: commands: diff --git a/recipes/badread/meta.yaml b/recipes/badread/meta.yaml index 00bef0af70ac4..f787041f5d582 100644 --- a/recipes/badread/meta.yaml +++ b/recipes/badread/meta.yaml @@ -1,5 +1,5 @@ -{% set version='0.4.0' %} -{% set sha256='1920f1efc1eae7b17f1fd9c6878795b5ba8d7fd910c933999aad349672a994b0' %} +{% set version='0.4.1' %} +{% set sha256='236dee5ac99b8d0c1997c482df5b805908b0c34f75277ef706e897af71db1f9a' %} package: name: badread @@ -10,9 +10,11 @@ source: sha256: {{ sha256 }} build: - number: 1 + number: 0 noarch: python script: {{ PYTHON }} -m pip install . --no-deps -vv + run_exports: + - {{ pin_subpackage('badread', max_pin='x.x') }} requirements: host: diff --git a/recipes/bakta/meta.yaml b/recipes/bakta/meta.yaml index 98a9068bd9875..2f9fe0bceefe4 100644 --- a/recipes/bakta/meta.yaml +++ b/recipes/bakta/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.9.1" %} +{% set version = "1.9.3" %} package: name: bakta @@ -6,7 +6,7 @@ package: source: url: https://github.com/oschwengers/bakta/archive/v{{ version }}.tar.gz - sha256: 'd8eb7ea1321ad6884002cfac670c33031b8dfa219a62b90c556f7cf402a64fe4' + sha256: '774a60b4fa2032ac4804a37eafdb4c2c67f2573d7f93e785b58963a47d535e70' build: noarch: python @@ -37,7 +37,7 @@ requirements: - infernal >=1.1.4 - piler-cr - pyhmmer >=0.10.4 - - diamond >=2.1.8 + - diamond ==2.1.8 - blast >=2.14.0 - ncbi-amrfinderplus >=3.11.26 - circos >=0.69.8 diff --git a/recipes/balrog/meta.yaml b/recipes/balrog/meta.yaml index 0811762f8e566..b9157d536a298 100644 --- a/recipes/balrog/meta.yaml +++ b/recipes/balrog/meta.yaml @@ -6,7 +6,9 @@ package: version: {{ version }} build: - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage("balrog", max_pin="x.x") }} source: url: https://github.com/salzberg-lab/BalrogCPP/archive/v{{ version }}.tar.gz @@ -35,3 +37,7 @@ about: license: MIT license_file: LICENSE summary: "Balrog: A universal protein model for prokaryotic gene prediction" + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/bamcmp/meta.yaml b/recipes/bamcmp/meta.yaml index e9798a1a41ca0..6972f19620ab3 100644 --- a/recipes/bamcmp/meta.yaml +++ b/recipes/bamcmp/meta.yaml @@ -7,7 +7,9 @@ source: md5: 05e583af007f86b275bcf95eceea7ba7 build: - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage("bamcmp", max_pin="x") }} script_env: - HTSLIBDIR=$PREFIX @@ -28,3 +30,7 @@ about: home: https://github.com/CRUKMI-ComputationalBiology/bamcmp license: GPL-3 summary: Tools for deconvolving host and graft reads using full-length alignments and their scores. + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/bamdash/meta.yaml b/recipes/bamdash/meta.yaml index 549a5ab5d04bd..2a77d75331151 100644 --- a/recipes/bamdash/meta.yaml +++ b/recipes/bamdash/meta.yaml @@ -1,5 +1,5 @@ {% set name = "bamdash" %} -{% set version = "0.2.3" %} +{% set version = "0.2.4" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/bamdash-{{ version }}.tar.gz - sha256: da43cd3539ba86b4d2800aded8a3361ba34f325f803b5acd2991c69473c0f398 + sha256: 9e9d81cb5cefbb2f356d1a1e05ffc84bcaee0cfbfd16b5e92d905817337ea4e8 build: entry_points: diff --git a/recipes/bamtools/meta.yaml b/recipes/bamtools/meta.yaml index 4b1e918f5bfae..803497b6c9a4b 100644 --- a/recipes/bamtools/meta.yaml +++ b/recipes/bamtools/meta.yaml @@ -1,7 +1,8 @@ +{% set name = "bamtools" %} {% set version = "2.5.2" %} package: - name: bamtools + name: {{ name }} version: {{ version }} source: @@ -11,7 +12,9 @@ source: # - 0001-Const-qualify-all-functors-operator-member-functions.patch build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} requirements: build: @@ -32,5 +35,7 @@ about: summary: C++ API & command-line toolkit for working with BAM data extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:bamtools diff --git a/recipes/baredsc/meta.yaml b/recipes/baredsc/meta.yaml index d9b7c9290d414..48c80ba130384 100644 --- a/recipes/baredsc/meta.yaml +++ b/recipes/baredsc/meta.yaml @@ -1,5 +1,5 @@ {% set name = "baredSC" %} -{% set version = "1.1.2" %} +{% set version = "1.1.3" %} package: name: {{ name | lower }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/lldelisle/baredSC/archive/v{{ version }}.tar.gz - sha256: 9c1ac38cebdb6e9183ee208f86021e3c80bbd98a3bff8a078327c4c8420f4fba + sha256: 96b4eee8d959ab4d30350ae7ac91d89501bb7175ab4c3bd3e3e9ff6b0c1dcfcf build: number: 0 @@ -49,3 +49,5 @@ about: extra: recipe-maintainers: - lldelisle + + \ No newline at end of file diff --git a/recipes/bbmap/build.sh b/recipes/bbmap/build.sh index e1f2e8a16fe49..3cad42d6b4a27 100755 --- a/recipes/bbmap/build.sh +++ b/recipes/bbmap/build.sh @@ -4,12 +4,16 @@ set -x -e -o pipefail BINARY_HOME=$PREFIX/bin BBMAP_HOME=$PREFIX/opt/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM +DATA_HOME=$PREFIX/share/$PKG_NAME mkdir -p $BINARY_HOME mkdir -p $BBMAP_HOME +mkdir -p $DATA_HOME chmod a+x *.sh cp -R * $BBMAP_HOME/ find *.sh -type f -exec ln -s $BBMAP_HOME/{} $BINARY_HOME/{} \; + +cp -R $BBMAP_HOME/resources $DATA_HOME diff --git a/recipes/bbmap/meta.yaml b/recipes/bbmap/meta.yaml index 68499749c3bf0..0ddc96a75784f 100644 --- a/recipes/bbmap/meta.yaml +++ b/recipes/bbmap/meta.yaml @@ -1,9 +1,6 @@ {% set name = "BBMap" %} -{% set version = "39.01" %} -{% set sha256 = "98608da50130c47f3abd095b889cc87f60beeb8b96169b664bc9d849abe093e6" %} - -build: - number: 1 +{% set version = "39.06" %} +{% set sha256 = "61d45bd59a543b90a143c5c7dbfec0ff6163dce54194b8c4b648fb6aac67d42e" %} package: name: {{ name|lower }} @@ -13,6 +10,11 @@ source: url: http://downloads.sourceforge.net/project/{{ name|lower }}/{{ name }}_{{ version }}.tar.gz sha256: {{ sha256 }} +build: + number: 0 + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x") }} + requirements: build: - {{ compiler('c') }} diff --git a/recipes/bcalm/meta.yaml b/recipes/bcalm/meta.yaml index 7dcb72552226d..225521b463c93 100644 --- a/recipes/bcalm/meta.yaml +++ b/recipes/bcalm/meta.yaml @@ -11,7 +11,9 @@ source: sha256: '{{sha256}}' build: - number: 5 + number: 6 + run_exports: + - {{ pin_subpackage("bcalm", max_pin="x.x.x") }} requirements: build: @@ -33,3 +35,7 @@ about: home: https://github.com/GATB/bcalm license: MIT License summary: BCALM 2 is a bioinformatics tool for constructing the compacted de Bruijn graph from sequencing data. + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/bcbio-gff/meta.yaml b/recipes/bcbio-gff/meta.yaml index ff55d1753cf3b..cceb7684f852b 100644 --- a/recipes/bcbio-gff/meta.yaml +++ b/recipes/bcbio-gff/meta.yaml @@ -1,5 +1,5 @@ {% set name = "bcbio-gff" %} -{% set version = "0.7.0" %} +{% set version = "0.7.1" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/b/{{ name|lower }}/{{ name }}-{{ version }}.tar.gz - sha256: f7b3922ee274106f8716703f41f05a1795aa9d73e903f4e481995ed8f5f65d2d + sha256: d1dc3294147b95baced6033f6386a0fed45c43767ef02d1223df5ef497e9cca6 build: number: 1 @@ -23,8 +23,7 @@ requirements: run: - python - six - # see: https://github.com/chapmanb/bcbb/issues/138 - - biopython <=1.81 + - biopython - bx-python test: diff --git a/recipes/bcftools-gtc2vcf-plugin/meta.yaml b/recipes/bcftools-gtc2vcf-plugin/meta.yaml index cc1e37047ad6f..414d0485f8c57 100644 --- a/recipes/bcftools-gtc2vcf-plugin/meta.yaml +++ b/recipes/bcftools-gtc2vcf-plugin/meta.yaml @@ -16,7 +16,7 @@ source: sha256: "782b5f1bc690415192231e82213b3493b047f45e630dc8ef6f154d6126ab3e68" build: - number: 0 + number: 1 skip: true # [osx] run_exports: - {{ pin_subpackage("bcftools-gtc2vcf-plugin", max_pin="x") }} @@ -45,3 +45,7 @@ about: home: https://github.com/freeseek/gtc2vcf license: MIT summary: Tools to convert Illumina and Affymetrix array intensity data files into VCF files. + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/bcftools/meta.yaml b/recipes/bcftools/meta.yaml index cbe333349ad2f..6641ea2aeb54d 100644 --- a/recipes/bcftools/meta.yaml +++ b/recipes/bcftools/meta.yaml @@ -1,4 +1,4 @@ -{% set version="1.19" %} +{% set version="1.20" %} package: name: bcftools @@ -11,7 +11,7 @@ build: source: url: https://github.com/samtools/bcftools/releases/download/{{ version }}/bcftools-{{ version }}.tar.bz2 - sha256: 782b5f1bc690415192231e82213b3493b047f45e630dc8ef6f154d6126ab3e68 + sha256: 312b8329de5130dd3a37678c712951e61e5771557c7129a70a327a300fda8620 requirements: build: @@ -48,6 +48,8 @@ about: VCF and BCF and streams will work in most, but not all situations. extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:bcftools - usegalaxy-eu:bcftools_merge diff --git a/recipes/bcov/meta.yaml b/recipes/bcov/meta.yaml index ed9b0afbe2fd2..a4d012b14a847 100644 --- a/recipes/bcov/meta.yaml +++ b/recipes/bcov/meta.yaml @@ -6,7 +6,9 @@ package: version: {{ version }} build: - number: 7 + number: 8 + run_exports: + - {{ pin_subpackage("bcov", max_pin="x.x.x") }} source: url: http://biocomp.unibo.it/savojard/bcov/bcov-1.0.tar.gz @@ -40,3 +42,5 @@ extra: identifiers: - biotools:bcov - doi:10.1093/bioinformatics/btt555 + additional-platforms: + - linux-aarch64 diff --git a/recipes/sdeper/LICENSE b/recipes/beacon2-import/LICENSE old mode 100755 new mode 100644 similarity index 95% rename from recipes/sdeper/LICENSE rename to recipes/beacon2-import/LICENSE index 5a026b2d7d3bb..08da4102474eb --- a/recipes/sdeper/LICENSE +++ b/recipes/beacon2-import/LICENSE @@ -1,21 +1,21 @@ -MIT License - -Copyright (c) 2023 az7jh2 - -Permission is hereby granted, free of charge, to any person obtaining a copy -of this software and associated documentation files (the "Software"), to deal -in the Software without restriction, including without limitation the rights -to use, copy, modify, merge, publish, distribute, sublicense, and/or sell -copies of the Software, and to permit persons to whom the Software is -furnished to do so, subject to the following conditions: - -The above copyright notice and this permission notice shall be included in all -copies or substantial portions of the Software. - -THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR -IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, -FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE -AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER -LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, -OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE -SOFTWARE. +MIT License + +Copyright (c) 2023 European Galaxy Project + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. diff --git a/recipes/beacon2-import/meta.yaml b/recipes/beacon2-import/meta.yaml new file mode 100644 index 0000000000000..6764c6cd2219d --- /dev/null +++ b/recipes/beacon2-import/meta.yaml @@ -0,0 +1,56 @@ +{% set name = "beacon2-import" %} +{% set version = "1.0.6" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/beacon2-import-{{ version }}.tar.gz + sha256: 5707364c9d5fdeb13e78709a727f93d00c6359f4673ceed42a29f52ae0a7d93f + +build: + entry_points: + - beacon2-import = beacon2_import.beacon2_import:beacon2_import + - beacon2-search = beacon2_search.beacon2_search:beacon_query + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage('beacon2-import', max_pin="x") }} + +requirements: + host: + - python >=3.10 + - pip + run: + - python =3.6.15 + - jsonschema + - dataclasses + - bioblend =0.10.0 + - cyvcf2 + - pymongo + +test: + imports: + - beacon2_import + - beacon2_search + - utils + commands: + - pip check + - beacon2-import --help + - beacon2-search --help + requires: + - python >=3.6 + - pip + +about: + home: https://pypi.org/project/beacon2-import/ + summary: Seamlessly import and query genomic variant data from a beacon + description: "Effortlessly import genetic variants from targeted Galaxy histories or local repositories into your beacon instance with our utility. Simplify querying and analysis of genetic data, enabling comprehensive genetic inquiries with ease" + license: CC-BY-NC-4.0 + license_file: LICENSE + +extra: + recipe-maintainers: + - khaled196 \ No newline at end of file diff --git a/recipes/beav/meta.yaml b/recipes/beav/meta.yaml index 51c26396cf4a7..61b78a68727b4 100644 --- a/recipes/beav/meta.yaml +++ b/recipes/beav/meta.yaml @@ -1,6 +1,6 @@ {% set name = "beav" %} -{% set version = "1.0.0" %} -{% set sha256 = "b0e65b26c2e5760bfa31587d153d3df902ee34606bc0f4059622dbcb8269ffc4" %} +{% set version = "1.1.0" %} +{% set sha256 = "f9a65ac152b33c8649b51e152cc7137036140f5e2d7460f162ebd180aac3f868" %} {% set dbscan_git = "condabeav0.5" %} {% set dbscan_sha256 = "2fe08873026fe63a9992bfb997e59fecce7facb903778983dc6917c962573463" %} {% set gapmind_git = "Beav0.5.1conda" %} diff --git a/recipes/bed2gff/build.sh b/recipes/bed2gff/build.sh new file mode 100644 index 0000000000000..8e10cdc3e3237 --- /dev/null +++ b/recipes/bed2gff/build.sh @@ -0,0 +1,9 @@ +#!/bin/bash + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" + +# build statically linked binary with Rust +RUST_BACKTRACE=1 +cargo install --verbose --path . --root ${PREFIX} diff --git a/recipes/bed2gff/meta.yaml b/recipes/bed2gff/meta.yaml new file mode 100644 index 0000000000000..43a1e954c68bf --- /dev/null +++ b/recipes/bed2gff/meta.yaml @@ -0,0 +1,37 @@ +{% set name = "bed2gff" %} +{% set version = "0.1.5" %} + +package: + name: bed2gff + version: {{ version }} + +source: + url: https://github.com/alejandrogzi/{{ name }}/archive/refs/tags/v.{{ version }}.tar.gz + sha256: 250333a3388a90d0a2f5a927eef220def95f7556e0c7d2344f0f7a37b3efa327 + +build: + number: 0 + run_exports: + - {{ pin_subpackage('bed2gff', max_pin="x.x") }} + +requirements: + build: + - {{ compiler("cxx") }} + - rust >=1.39 + - pkg-config + +test: + commands: + - bed2gff --help + - bed2gff --version + +about: + home: https://github.com/alejandrogzi/bed2gff + license: MIT + license_family: MIT + license_file: LICENSE + summary: "BED-to-GFF3 converter that runs in parallel" + +extra: + recipe-maintainers: + - alejandrogzi diff --git a/recipes/bed2gtf/build.sh b/recipes/bed2gtf/build.sh new file mode 100644 index 0000000000000..8e10cdc3e3237 --- /dev/null +++ b/recipes/bed2gtf/build.sh @@ -0,0 +1,9 @@ +#!/bin/bash + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" + +# build statically linked binary with Rust +RUST_BACKTRACE=1 +cargo install --verbose --path . --root ${PREFIX} diff --git a/recipes/bed2gtf/meta.yaml b/recipes/bed2gtf/meta.yaml new file mode 100644 index 0000000000000..8647a4c928c8c --- /dev/null +++ b/recipes/bed2gtf/meta.yaml @@ -0,0 +1,37 @@ +{% set name = "bed2gtf" %} +{% set version = "1.9.2" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/alejandrogzi/{{ name }}/archive/refs/tags/v.{{ version }}.tar.gz + sha256: 38bd7528a5a643a4ade316838af36085809bf6476d1b8f37f126d7678fb7e15f + +build: + number: 0 + run_exports: + - {{ pin_subpackage('bed2gtf', max_pin="x.x") }} + +requirements: + build: + - {{ compiler("cxx") }} + - rust >=1.39 + - pkg-config + +test: + commands: + - bed2gtf --help + - bed2gtf --version + +about: + home: https://github.com/alejandrogzi/bed2gtf + license: MIT + license_family: MIT + license_file: LICENSE + summary: "A high-performance BED-to-GTF converter written in Rust" + +extra: + recipe-maintainers: + - alejandrogzi diff --git a/recipes/bedgovcf/meta.yaml b/recipes/bedgovcf/meta.yaml index 8fd41cd2aadef..8be27b7e3ba9a 100644 --- a/recipes/bedgovcf/meta.yaml +++ b/recipes/bedgovcf/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '0.1.0' %} +{% set version = '0.1.1' %} {% set name = 'bedgovcf' %} package: @@ -7,9 +7,9 @@ package: source: - url: https://github.com/nvnieuwk/bedgovcf/releases/download/{{ version }}/bedgovcf-{{ version }}-darwin-amd64.tar.gz # [osx-amd64] - md5: 9e57370c3b7eced5da92cd11dc1984e5 # [osx] + md5: 978e24745b517395eb6d50cd0f8cdb1d # [osx] - url: https://github.com/nvnieuwk/bedgovcf/releases/download/{{ version }}/bedgovcf-{{ version }}-linux-amd64.tar.gz # [linux] - md5: bbe8e249c655a276657c6602524f7e39 # [linux] + md5: ca7b377c7c751b45daaf533bedbcc3d4 # [linux] build: number: 0 diff --git a/recipes/bedops/meta.yaml b/recipes/bedops/meta.yaml index d6e6046f96376..8224cdd389f9a 100644 --- a/recipes/bedops/meta.yaml +++ b/recipes/bedops/meta.yaml @@ -5,7 +5,9 @@ package: version: {{ version }} build: - number: 1 + number: 2 + run_exports: + - {{ pin_subpackage("bedops", max_pin="x.x.x") }} source: url: https://github.com/bedops/bedops/archive/v{{ version }}.tar.gz @@ -33,3 +35,5 @@ extra: identifiers: - biotools:Bedops - doi:10.1093/bioinformatics/bts277 + additional-platforms: + - linux-aarch64 diff --git a/recipes/bedtk/meta.yaml b/recipes/bedtk/meta.yaml index cb51dc445d8c3..13e1ffd1868b4 100644 --- a/recipes/bedtk/meta.yaml +++ b/recipes/bedtk/meta.yaml @@ -14,7 +14,9 @@ source: sha256: {{ sha256 }} build: - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage("bedtk", max_pin="x.x.x") }} requirements: build: @@ -48,3 +50,5 @@ about: extra: identifiers: - biotools:bedtk + additional-platforms: + - linux-aarch64 diff --git a/recipes/bedtools/meta.yaml b/recipes/bedtools/meta.yaml index 2c96f9e40ecca..d7c60edc863cc 100644 --- a/recipes/bedtools/meta.yaml +++ b/recipes/bedtools/meta.yaml @@ -10,7 +10,7 @@ source: sha256: fc7e660c2279b1e008b80aca0165a4a157daf4994d08a533ee925d73ce732b97 build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('bedtools', max_pin="x") }} @@ -35,6 +35,8 @@ about: summary: A powerful toolset for genome arithmetic extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:bedtools - usegalaxy-eu:bedtools_intersectbed diff --git a/recipes/bfc/meta.yaml b/recipes/bfc/meta.yaml index 36d92acead4e4..48efced8289a0 100644 --- a/recipes/bfc/meta.yaml +++ b/recipes/bfc/meta.yaml @@ -3,7 +3,9 @@ package: version: "r181" build: - number: 9 + number: 10 + run_exports: + - {{ pin_subpackage("bfc", max_pin="x.x.x") }} source: url: https://github.com/lh3/bfc/archive/a73dad248dc56d9d4d22eacbbbc51ac276045168.tar.gz @@ -29,3 +31,7 @@ about: license: MIT license_file: LICENSE.txt summary: BFC is a standalone high-performance tool for correcting sequencing errors from Illumina sequencing data. + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/bgreat/meta.yaml b/recipes/bgreat/meta.yaml index 8962130ba8d8f..586688e1e95e1 100644 --- a/recipes/bgreat/meta.yaml +++ b/recipes/bgreat/meta.yaml @@ -10,7 +10,9 @@ source: sha256: bc60e755a3205b725834f37d7509062879415f03730b424cbac06b776eb977cc build: - number: 6 + number: 7 + run_exports: + - {{ pin_subpackage("bgreat", max_pin="x.x.x") }} skip: true # [osx] requirements: @@ -29,3 +31,7 @@ about: home: https://github.com/Malfoy/BGREAT2 license: AGPL-3.0 summary: BGREAT2 is a read mapping tool for NGS sequencing data that align reads on a de Bruijn graph. Preliminary version described at https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1103-9 and used in Bcool a short read corrector (https://arxiv.org/abs/1711.03336) + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/bifrost/meta.yaml b/recipes/bifrost/meta.yaml index 5ca33f7b6ee0d..8ee624077f1c1 100644 --- a/recipes/bifrost/meta.yaml +++ b/recipes/bifrost/meta.yaml @@ -1,5 +1,5 @@ {% set name = "bifrost" %} -{% set version = "1.3.1" %} +{% set version = "1.3.5" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/pmelsted/{{ name|lower }}/archive/v{{ version }}.tar.gz - sha256: d6a9baacddba8e9508336c5adff15a8a482774c724fc0710392fed7bb9ad1e8b + sha256: e1b2491328b0cc1a32e433a8a9780f05547fa4b8d674b58abdda9ac8809f5341 build: number: 0 @@ -42,3 +42,4 @@ about: extra: identifiers: - doi:10.1101/695338 + - biotools:bifrost diff --git a/recipes/bigscape/meta.yaml b/recipes/bigscape/meta.yaml index 78c95f18aa48d..0809408af242a 100644 --- a/recipes/bigscape/meta.yaml +++ b/recipes/bigscape/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.1.6" %} -{% set sha256 = "c38f633d4f1c5b9034c9ee2c96a14b7994884e2fc005fbead219068a618580a4" %} +{% set version = "1.1.9" %} +{% set sha256 = "ef0ddb5b433e0b1467ae5f96037fd6d23ebcba6bc08201d1421eba35d072e534" %} package: name: bigscape diff --git a/recipes/bigtools/build.sh b/recipes/bigtools/build.sh new file mode 100644 index 0000000000000..cd115956df52e --- /dev/null +++ b/recipes/bigtools/build.sh @@ -0,0 +1,10 @@ +#!/bin/bash +set -ex + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" +export RUST_BACKTRACE=full + +cargo install --verbose --path ./bigtools --root $PREFIX --locked + diff --git a/recipes/bigtools/meta.yaml b/recipes/bigtools/meta.yaml new file mode 100644 index 0000000000000..ff77a44e62f1c --- /dev/null +++ b/recipes/bigtools/meta.yaml @@ -0,0 +1,35 @@ +{% set version = "0.4.2" %} + +package: + name: bigtools + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage('bigtools', max_pin="x.x") }} + +source: + url: https://github.com/jackh726/bigtools/archive/refs/tags/v{{ version }}.tar.gz + sha256: "bd26a59e89cd00b1c7c82e038f03528ebf853182ae26213aeae2c936f203633e" + +requirements: + build: + - {{ compiler('c') }} + - rust >=1.70 + +test: + commands: + - bigtools --help | grep Usage + +about: + home: https://github.com/jackh726/bigtools/ + license: MIT + doc_url: https://docs.rs/bigtools/latest/bigtools/ + summary: 'Bigtools provides a high-level, performant API for reading and writing bigWig and bigBed files.' + license_family: MIT + license_file: LICENSE + +extra: + identifiers: + - doi:10.5281/zenodo.10606493 diff --git a/recipes/binchicken/meta.yaml b/recipes/binchicken/meta.yaml index ec1cc96708dbd..08e18db208ba6 100644 --- a/recipes/binchicken/meta.yaml +++ b/recipes/binchicken/meta.yaml @@ -1,6 +1,6 @@ -{% set version = "0.10.3" %} +{% set version = "0.10.4" %} {% set name = "binchicken" %} -{% set sha256 = "da3a5a7e88c29e5470111e6011eb4395e7597c1ed50927b0cef16997d6484545" %} +{% set sha256 = "0a48da6e24e8c0b0d6746914d80991b1662180fcd58b987ae0925326d0007382" %} package: name: binchicken diff --git a/recipes/bindash/build.sh b/recipes/bindash/build.sh index 82b50c2465b8b..83f5dedf13ec7 100644 --- a/recipes/bindash/build.sh +++ b/recipes/bindash/build.sh @@ -1,8 +1,7 @@ #!/bin/bash mkdir release && pushd release cmake -DCMAKE_BUILD_TYPE=Release .. -make VERBOSE=1 +make VERBOSE=1 -j ${CPU_COUNT} install -d $PREFIX/bin install bindash $PREFIX/bin popd - diff --git a/recipes/bindash/build_failure.linux-64.yaml b/recipes/bindash/build_failure.linux-64.yaml deleted file mode 100644 index 5c45b9976d04e..0000000000000 --- a/recipes/bindash/build_failure.linux-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: bf400c5d79ff20f338f3a29d4eb02d4a42e02d5f4200e3a4c8fa6d6a9ebb8710 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |- - Diff algorithm options - --minimal produce the smallest possible diff - -w, --ignore-all-space - ignore whitespace when comparing lines - -b, --ignore-space-change - ignore changes in amount of whitespace - --ignore-space-at-eol - ignore changes in whitespace at EOL - --ignore-cr-at-eol ignore carrier-return at the end of line - --ignore-blank-lines ignore changes whose lines are all blank - -I, --ignore-matching-lines - ignore changes whose all lines match - --indent-heuristic heuristic to shift diff hunk boundaries for easy reading - --patience generate diff using the "patience diff" algorithm - --histogram generate diff using the "histogram diff" algorithm - --diff-algorithm - choose a diff algorithm - --anchored generate diff using the "anchored diff" algorithm - --word-diff[=] show word diff, using to delimit changed words - --word-diff-regex - use to decide what a word is - --color-words[=] - equivalent to --word-diff=color --word-diff-regex= - --color-moved[=] - moved lines of code are colored differently - --color-moved-ws - how white spaces are ignored in --color-moved - - Other diff options - --relative[=] - when run from subdir, exclude changes outside and show relative paths - -a, --text treat all files as text - -R swap two inputs, reverse the diff - --exit-code exit with 1 if there were differences, 0 otherwise - --quiet disable all output of the program - --ext-diff allow an external diff helper to be executed - --textconv run external text conversion filters when comparing binary files - --ignore-submodules[=] - ignore changes to submodules in the diff generation - --submodule[=] - specify how differences in submodules are shown - --ita-invisible-in-index - hide 'git add -N' entries from the index - --ita-visible-in-index - treat 'git add -N' entries as real in the index - -S look for differences that change the number of occurrences of the specified string - -G look for differences that change the number of occurrences of the specified regex - --pickaxe-all show all changes in the changeset with -S or -G - --pickaxe-regex treat in -S as extended POSIX regular expression - -O control the order in which files appear in the output - --rotate-to show the change in the specified path first - --skip-to skip the output to the specified path - --find-object - look for differences that change the number of occurrences of the specified object - --diff-filter [(A|C|D|M|R|T|U|X|B)...[*]] - select files by diff type - --output output to a specific file - - -- Configuring done (0.5s) - -- Generating done (0.0s) - -- Build files have been written to: $SRC_DIR/release - $BUILD_PREFIX/bin/cmake -S$SRC_DIR -B$SRC_DIR/release --check-build-system CMakeFiles/Makefile.cmake 0 - $BUILD_PREFIX/bin/cmake -E cmake_progress_start $SRC_DIR/release/CMakeFiles $SRC_DIR/release//CMakeFiles/progress.marks - make -f CMakeFiles/Makefile2 all - make[1]: Entering directory '$SRC_DIR/release' - make -f CMakeFiles/bindash.dir/build.make CMakeFiles/bindash.dir/depend - make[2]: Entering directory '$SRC_DIR/release' - cd $SRC_DIR/release && $BUILD_PREFIX/bin/cmake -E cmake_depends "Unix Makefiles" $SRC_DIR $SRC_DIR $SRC_DIR/release $SRC_DIR/release $SRC_DIR/release/CMakeFiles/bindash.dir/DependInfo.cmake --color= - make[2]: Leaving directory '$SRC_DIR/release' - make -f CMakeFiles/bindash.dir/build.make CMakeFiles/bindash.dir/build - make[2]: Entering directory '$SRC_DIR/release' - [ 50%] Building CXX object CMakeFiles/bindash.dir/src/bindash.cpp.o - $BUILD_PREFIX/bin/x86_64-conda-linux-gnu-c -DGIT_COMMIT_HASH="" -DGIT_DIFF_SHORTSTAT="" -fvisibility-inlines-hidden -fmessage-length=0 -march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/bindash-1.0 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix -std=c11 -Wall -O3 -DNDEBUG -Ofast -fopenmp -MD -MT CMakeFiles/bindash.dir/src/bindash.cpp.o -MF CMakeFiles/bindash.dir/src/bindash.cpp.o.d -o CMakeFiles/bindash.dir/src/bindash.cpp.o -c $SRC_DIR/src/bindash.cpp - /opt/conda/conda-bld/bindash_1685382869725/work/src/bindash.cpp: In function 'void cmddist(bool, bool, const std::vector&, const std::vector&, const Sketchargs&, const Distargs&)': - /opt/conda/conda-bld/bindash_1685382869725/work/src/bindash.cpp:361:63: error: aggregate 'std::array >, 2048> tophits_arr' has incomplete type and cannot be defined - 361 | std::array, ISIZE> tophits_arr; - | ^~~~~~~~~~~ - make[2]: *** [CMakeFiles/bindash.dir/build.make:76: CMakeFiles/bindash.dir/src/bindash.cpp.o] Error 1 - make[2]: Leaving directory '$SRC_DIR/release' - make[1]: *** [CMakeFiles/Makefile2:83: CMakeFiles/bindash.dir/all] Error 2 - make: *** [Makefile:91: all] Error 2 - make[1]: Leaving directory '$SRC_DIR/release' - Traceback (most recent call last): - File "/opt/conda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/conda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 2198, in build - utils.check_call_env(cmd, env=env, rewrite_stdout_env=rewrite_env, - File "/opt/conda/lib/python3.8/site-packages/conda_build/utils.py", line 451, in check_call_env - return _func_defaulting_env_to_os_environ("call", *popenargs, **kwargs) - File "/opt/conda/lib/python3.8/site-packages/conda_build/utils.py", line 427, in _func_defaulting_env_to_os_environ - raise subprocess.CalledProcessError(proc.returncode, _args) - subprocess.CalledProcessError: Command '['/bin/bash', '-o', 'errexit', '/opt/conda/conda-bld/bindash_1685382869725/work/conda_build.sh']' returned non-zero exit status 2. -# Last 100 lines of the build log. diff --git a/recipes/bindash/meta.yaml b/recipes/bindash/meta.yaml index a7667087921b2..1b5105f60619d 100644 --- a/recipes/bindash/meta.yaml +++ b/recipes/bindash/meta.yaml @@ -1,31 +1,32 @@ -{% set version = "2.0" %} +{% set name = "bindash" %} +{% set version = "2.3" %} package: - name: bindash + name: {{ name }} version: {{ version }} source: url: https://github.com/jianshu93/bindash/archive/v{{ version }}.tar.gz - sha256: 300fd4709df1d000470feb5af1a7d1ecd95c15f9c35f7535ae9c40dce4a540a8 + sha256: 6e4bf36fd04195ed0738ea8bf835eca1e400b5ce6eef3902bdf0673955d15166 build: skip: True # [osx] - number: 0 + number: 2 run_exports: - - {{ pin_subpackage('bindash', max_pin="x.x") }} + - {{ pin_subpackage('bindash', max_pin="x") }} requirements: build: - make - - {{ compiler('c') }} - {{ compiler('cxx') }} - cmake - - llvm-openmp # [osx] host: - zlib + - libgomp # [linux] - llvm-openmp # [osx] run: - zlib + - libgomp # [linux] - llvm-openmp # [osx] test: @@ -33,12 +34,19 @@ test: - bindash --help 2>&1 | grep sketch about: - home: https://github.com/zhaoxiaofei/bindash - license: Apache-2.0 - license_family: APACHE - license_file: LICENSE - summary: Fast and precise comparison of genomes and metagenomes (in the order of terabytes) on a typical personal laptop + home: https://github.com/zhaoxiaofei/bindash + license: Apache-2.0 + license_family: APACHE + license_file: LICENSE + summary: "Fast and precise comparison of genomes and metagenomes (in the order of terabytes) on a typical personal laptop." + dev_url: https://github.com/zhaoxiaofei/bindash extra: - identifiers: - - doi:10.1371/journal.pgen.1007758 + additional-platforms: + - linux-aarch64 + identifiers: + - doi:10.1093/bioinformatics/bty651 + - doi:10.1101/2024.03.13.584875 + recipe-maintainers: + - jianshu93 + - zhaoxiaofei diff --git a/recipes/binette/meta.yaml b/recipes/binette/meta.yaml index dbeca042db483..f666ea8f6e0f9 100644 --- a/recipes/binette/meta.yaml +++ b/recipes/binette/meta.yaml @@ -1,16 +1,20 @@ {% set name = "Binette" %} -{% set version = "0.1.6" %} +{% set version = "1.0.0" %} package: name: {{ name|lower }} version: {{ version }} source: url: https://github.com/genotoul-bioinfo/{{ name|lower }}/archive/refs/tags/v{{ version }}.tar.gz - sha256: 97f2bb4f9d8e0c06fadb4b1bc4097cc3bfeb80fe84d3c63424ae080b8ac4086d + sha256: 121cff275fac2bbec2062863fa074c7f4f2a16eb52cada89bc46c87b7429d63d + build: noarch: python number: 0 script: {{ PYTHON }} -m pip install --no-deps --ignore-installed -vv . + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x") }} + requirements: host: @@ -23,14 +27,13 @@ requirements: - numpy =1.19.2 - diamond =2.0.4 - pandas =1.4.0 - - prodigal =2.6.3 - checkm2 - requests - packaging - tqdm - - networkx + - networkx >=3 - pyfastx - - pyrodigal + - pyrodigal >=2 test: imports: @@ -40,7 +43,8 @@ test: about: home: https://github.com/genotoul-bioinfo/{{ name|lower }} + doc_url: https://binette.readthedocs.io license: MIT license_family: MIT license_file: LICENSE - summary: A fast and accurate binning refinement tool to constructs high quality MAGs from the output of multiple binning tools. + summary: "A fast and accurate binning refinement tool to constructs high quality MAGs from the output of multiple binning tools." diff --git a/recipes/bioawk/meta.yaml b/recipes/bioawk/meta.yaml index 12bf54695780a..c5dd0a636caf2 100644 --- a/recipes/bioawk/meta.yaml +++ b/recipes/bioawk/meta.yaml @@ -7,7 +7,9 @@ source: sha256: 5cbef3f39b085daba45510ff450afcf943cfdfdd483a546c8a509d3075ff51b5 build: - number: 9 + number: 10 + run_exports: + - {{ pin_subpackage("bioawk", max_pin="x.x.x") }} requirements: build: @@ -28,3 +30,7 @@ about: home: https://github.com/lh3/bioawk license: Free software license (https://github.com/lh3/bioawk/blob/master/README.awk#L1) summary: BWK awk modified for biological data + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/biobambam/meta.yaml b/recipes/biobambam/meta.yaml index c7d758af69ab6..482c9c1b272d1 100644 --- a/recipes/biobambam/meta.yaml +++ b/recipes/biobambam/meta.yaml @@ -12,8 +12,10 @@ source: sha256: {{ sha256hash }} build: - number: 3 + number: 4 skip: True # [osx] + run_exports: + - {{ pin_subpackage(name, max_pin='x') }} requirements: build: @@ -31,3 +33,7 @@ about: license: GPLv3 license_file: GPLv3 summary: Tools for early stage alignment file processing + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/biobb_cmip/meta.yaml b/recipes/biobb_cmip/meta.yaml index a8a334ea71e12..14d69afc54704 100644 --- a/recipes/biobb_cmip/meta.yaml +++ b/recipes/biobb_cmip/meta.yaml @@ -1,5 +1,5 @@ {% set name = "biobb_cmip" %} -{% set version = "4.1.0" %} +{% set version = "4.1.1" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: b25c9376e3091740e326911e3cb5006dfe03a092b98dae2ff525087fb2e77bed + sha256: 4d6fc4d8f4410c84e09cde21de645d40fd003bdff493b6bf9bb2bfaaa2b380a2 build: number: 0 diff --git a/recipes/biobb_pdb_tools/meta.yaml b/recipes/biobb_pdb_tools/meta.yaml index 2de77d46048e3..44c5d7c9dec38 100644 --- a/recipes/biobb_pdb_tools/meta.yaml +++ b/recipes/biobb_pdb_tools/meta.yaml @@ -1,5 +1,5 @@ {% set name = "biobb_pdb_tools" %} -{% set version = "4.1.0" %} +{% set version = "4.1.1" %} package: name: '{{ name|lower }}' @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: a956ceb461219df25154a59c8b319c79802f0f7975095837aef40d6b057c0744 + sha256: 7510052e89c534f935f1b70b575943fe391dc0bc837c4c0982c7cb3d944adb29 build: number: 0 diff --git a/recipes/biobb_pytorch/meta.yaml b/recipes/biobb_pytorch/meta.yaml new file mode 100644 index 0000000000000..eb1dde4c40c19 --- /dev/null +++ b/recipes/biobb_pytorch/meta.yaml @@ -0,0 +1,53 @@ +{% set name = "biobb_pytorch" %} +{% set version = "4.1.0" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" + sha256: 4e55252f16c25f0600ad353ab8e1db96dc4064e5087ea6ca6734fdf5ccb1dbae + +build: + number: 0 + noarch: python + script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed --no-cache-dir -vvv" + run_exports: + - {{ pin_subpackage(name, max_pin='x') }} + +requirements: + host: + - python >=3.8 + - setuptools + - biobb_common ==4.1.0 + - pytorch + run: + - python >=3.8 + - biobb_common ==4.1.0 + - pytorch + +test: + imports: + - biobb_pytorch + - biobb_pytorch.mdae + +about: + home: https://github.com/bioexcel/biobb_pytorch + license: Apache Software License + license_family: APACHE + license_file: '' + summary: biobb_pytorch is the Biobb module collection to create and train ML & DL models. + description: "# biobb_pytorch\n\n### Introduction\nBiobb_Pytorch is the Biobb module collection to create and train ML & DL models using the popular [PyTorch](https://pytorch.org/) Python library. + Biobb (BioExcel building blocks) packages are Python building blocks that create new layer of compatibility and interoperability over popular bioinformatics tools. The latest documentation of this package can be found in our readthedocs site: [latest API documentation](http://biobb-pytorch.readthedocs.io/en/latest/).\n\ + \n\n### Copyright & Licensing\nThis software has been developed in the [MMB group](http://mmb.irbbarcelona.org) at the [BSC](http://www.bsc.es/) & [IRB](https://www.irbbarcelona.org/) for the [European BioExcel](http://bioexcel.eu/), funded by the European Commission (EU H2020 [823830](http://cordis.europa.eu/projects/823830), EU H2020 [675728](http://cordis.europa.eu/projects/675728)).\ + \n\n* (c) 2015-2024 [Barcelona Supercomputing Center](https://www.bsc.es/)\n* (c) 2015-2024 [Institute for Research in Biomedicine](https://www.irbbarcelona.org/)\n\ + Licensed under the\n\ + [Apache License 2.0](https://www.apache.org/licenses/LICENSE-2.0), see the file LICENSE for details.\n\ + \n\ + ![](https://bioexcel.eu/wp-content/uploads/2019/04/Bioexcell_logo_1080px_transp.png \"Bioexcel\")\n\n\n" + doc_url: http://biobb_pytorch.readthedocs.io/en/latest/ + dev_url: https://github.com/bioexcel/biobb_pytorch + +extra: + recipe-maintainers: PauAndrio diff --git a/recipes/biocamlib/build.sh b/recipes/biocamlib/build.sh new file mode 100644 index 0000000000000..1851efa249a27 --- /dev/null +++ b/recipes/biocamlib/build.sh @@ -0,0 +1,17 @@ +#!/bin/bash +if [ "$(uname)" == "Darwin" ]; then + echo "Installing BiOCamLib for OSX." +else + echo "Installing BiOCamLib for Linux" +fi + +mkdir -p $PREFIX/bin +cp $SRC_DIR/FASTools $PREFIX/bin +cp $SRC_DIR/Parallel $PREFIX/bin +cp $SRC_DIR/Octopus $PREFIX/bin +cp $SRC_DIR/RC $PREFIX/bin + +chmod +x $PREFIX/bin/FASTools +chmod +x $PREFIX/bin/Parallel +chmod +x $PREFIX/bin/Octopus +chmod +x $PREFIX/bin/RC \ No newline at end of file diff --git a/recipes/biocamlib/meta.yaml b/recipes/biocamlib/meta.yaml new file mode 100644 index 0000000000000..5c9bd52dd6bc1 --- /dev/null +++ b/recipes/biocamlib/meta.yaml @@ -0,0 +1,47 @@ +{% set name = "biocamlib" %} +{% set version = "1.0.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + - url: https://github.com/PaoloRibeca/BiOCamLib/releases/download/v{{ version }}/BiOCamLib-{{ version }}-Linux_x86-64.tar.xz # [linux] + sha256: bd08b1fe1949cb2faa98b46b40a99c84f0f5581515e337bab50111b11d9c7f12 # [linux] + - url: https://github.com/PaoloRibeca/BiOCamLib/releases/download/v{{ version }}/BiOCamLib-{{ version }}-MacOS_x86-64.tar.xz # [osx] + sha256: e55766df1e0af12f825ab1fe244841b70b8ccce9c764b60acc56d4386d3ce9bb # [osx] + +build: + run_exports: + {{ pin_subpackage(name, max_pin="x") }} + number: 0 + skip: true # [win] + +test: + commands: + - Parallel -V + - FASTools -V + - Octopus -V + - RC -V + +about: + home: https://github.com/PaoloRibeca/BiOCamLib + license: GPL-3.0-only + license_file: LICENSE + summary: 'An OCaml foundation upon which a number of the bioinformatics tools are built.' + description: | + BiOCamLib is an OCaml foundation upon which a number of the bioinformatics tools are built, + including KPop . It consists of four tools: + 1. RC, which can efficiently compute the reverse complement of sequences. + 2. Octopus, which is a high-throughput program to compute the transitive closure of strings. + 3. Parallel, which allows the splits and processes an input file chunk-wise using a reader/workers/writer model. + 4. FASTools, which is a Swiss-knife tool for the manipulation of FASTA/FASTQ files. + + dev_url: https://github.com/PaoloRibeca/BiOCamLib + +extra: + recipe-maintainers: + - PaoloRibeca + - ryanmorrison22 + skip-lints: + - should_be_noarch_generic diff --git a/recipes/biocode/biocode.patch b/recipes/biocode/biocode.patch deleted file mode 100644 index 2b3d9f2ded9f8..0000000000000 --- a/recipes/biocode/biocode.patch +++ /dev/null @@ -1,23 +0,0 @@ -From 028ea8130db125bcb546bbc90dbdf44c5b5b0d5b Mon Sep 17 00:00:00 2001 -From: Gerry Tonkin-Hill -Date: Mon, 15 Aug 2022 12:26:17 +0100 -Subject: [PATCH] remove old script - ---- - setup.py | 2 +- - 1 file changed, 1 insertion(+), 1 deletion(-) - -diff --git a/setup.py b/setup.py -index 5a96f71..ec9f63d 100644 ---- a/setup.py -+++ b/setup.py -@@ -22,7 +22,7 @@ setup(name='biocode', - license='MIT', - long_description=read('README.rst'), - packages=['biocode'], -- scripts=['bin/append_to_column_9_value.py', 'bin/prepend_to_fasta_header.py', 'bin/download_assemblies_from_genbank.py', 'bin/convert_augustus_to_gff3.py', 'bin/convert_gff3_to_ncbi_tbl.py', 'bin/mark_partial_genes.py', 'bin/filter_fasta_by_abundance.py', 'bin/validate_feature_boundaries_on_molecules.py', 'bin/add_polypeptide_to_gff3_gene_models.py', 'bin/select_training_and_evaluation_transcripts.py', 'bin/filter_fasta_by_type.py', 'bin/filter_uniref_by_taxonomy.py', 'bin/remove_orphaned_features.py', 'bin/convert_blast_btab_to_bed.py', 'bin/replace_gff_type_column_value.py', 'bin/convert_blast_btab_to_gff3.py', 'bin/interleave_fastq.py', 'bin/split_isoforms_into_individual_genes.py', 'bin/make_cufflinks_ids_unique.py', 'bin/convert_gff3_to_gbk.py', 'bin/make_go_slim_index.py', 'bin/eggnog_to_sqlite3.py', 'bin/convert_metagenemark_gff_to_gff3.py', 'bin/append_to_fasta_header.py', 'bin/merge_bam_files.py', 'bin/remove_masked_gene_models.py', 'bin/filter_fastq_by_N_content.py', 'bin/uniref_to_sqlite3.py', 'bin/uniprot_sprot_to_sqlite3.py', 'bin/reverse_misordered_cds_coords.py', 'bin/update_selected_column9_values.py', 'bin/convert_gff3_to_gene_association_format.py', 'bin/interleave_fasta.py', 'bin/make_go_slim.py', 'bin/join_columnar_files.py', 'bin/split_interleaved_sequence_file.py', 'bin/merge_masked_fasta_files.py', 'bin/hmmlib_to_sqlite3.py', 'bin/fasta_size_distribution_plot.py', 'bin/report_gff3_statistics.py', 'bin/reformat_fasta_residue_lengths.py', 'bin/convert_cufflinks_gtf_to_gff3.py', 'bin/list_biocode.py', 'bin/fasta_simple_stats.py', 'bin/fastq_simple_stats.py', 'bin/convert_prodigal_to_gff3.py', 'bin/convert_scipio_gff_to_gff3.py', 'bin/filter_gff3_by_id_list.py', 'bin/reorient_sequences_by_id.py', 'bin/convert_fastq_to_fasta.py', 'bin/create_rsem_html_table.py', 'bin/convert_glimmerHMM_gff_to_gff3.py', 'bin/convert_genbank_to_gff3.py', 'bin/replace_homopolymeric_repeats_with_Ns.py', 'bin/split_fasta_into_even_files.py', 'bin/get_mpilup_from_id_list.py', 'bin/convert_gff_to_ncbi_gff3.py', 'bin/create_taxonomic_profile_from_blast.py', 'bin/convert_fasta_contigs_to_gff3.py', 'bin/merge_fasta_files_and_uniquify_ids.py', 'bin/merge_predicted_gff3.py', 'bin/filter_fasta_by_header_regex.py', 'bin/convert_pasa_gff_to_models.py', 'bin/extract_fasta_regions.py', 'bin/set_source_column.py', 'bin/tigrfam_info_to_sqlite3.py', 'bin/add_gff3_locus_tags.py', 'bin/fasta_base_content.py', 'bin/subsample_fasta.py', 'bin/convert_gff3_to_bed.py', 'bin/compare_gene_structures.py', 'bin/validate_fasta.py', 'bin/randomly_subsample_fastq.py', 'bin/append_to_fastq_read_header.py', 'bin/convert_aat_btab_to_gff3.py', 'bin/check_for_embedded_fasta_headers.py', 'bin/convert_htab_to_bed.py', 'bin/correct_gff3_CDS_phase_column.py', 'bin/report_coverage_gaps.py', 'bin/detect_inverted_repeats.py', 'bin/convert_cegma_gff_to_gff3.py', 'bin/remove_duplicate_features.py', 'bin/remove_duplicate_sequences.py', 'bin/create_taxonomy_db.py', 'bin/calculate_query_coverage_by_blast.py', 'bin/report_or_replace_nonstandard_residues.py', 'bin/write_fasta_from_gff.py', 'bin/filter_uniref_by_repid.py', 'bin/check_gff_for_internal_stops.py', 'bin/report_basic_gff_model_agreement.py', 'bin/calculate_gene_coverage_from_assembly.py', 'bin/report_gff_intron_and_intergenic_stats.py', 'bin/extend_genes_to_stops.py', 'bin/report_go_slim_counts.py', 'bin/make_go_index.py', 'bin/split_molecules_on_gaps.py'], -+ scripts=['bin/append_to_column_9_value.py', 'bin/prepend_to_fasta_header.py', 'bin/download_assemblies_from_genbank.py', 'bin/convert_augustus_to_gff3.py', 'bin/convert_gff3_to_ncbi_tbl.py', 'bin/mark_partial_genes.py', 'bin/filter_fasta_by_abundance.py', 'bin/validate_feature_boundaries_on_molecules.py', 'bin/add_polypeptide_to_gff3_gene_models.py', 'bin/select_training_and_evaluation_transcripts.py', 'bin/filter_fasta_by_type.py', 'bin/filter_uniref_by_taxonomy.py', 'bin/remove_orphaned_features.py', 'bin/convert_blast_btab_to_bed.py', 'bin/replace_gff_type_column_value.py', 'bin/convert_blast_btab_to_gff3.py', 'bin/interleave_fastq.py', 'bin/split_isoforms_into_individual_genes.py', 'bin/make_cufflinks_ids_unique.py', 'bin/convert_gff3_to_gbk.py', 'bin/make_go_slim_index.py', 'bin/eggnog_to_sqlite3.py', 'bin/convert_metagenemark_gff_to_gff3.py', 'bin/append_to_fasta_header.py', 'bin/merge_bam_files.py', 'bin/remove_masked_gene_models.py', 'bin/filter_fastq_by_N_content.py', 'bin/uniref_to_sqlite3.py', 'bin/uniprot_sprot_to_sqlite3.py', 'bin/reverse_misordered_cds_coords.py', 'bin/update_selected_column9_values.py', 'bin/convert_gff3_to_gene_association_format.py', 'bin/make_go_slim.py', 'bin/join_columnar_files.py', 'bin/split_interleaved_sequence_file.py', 'bin/merge_masked_fasta_files.py', 'bin/hmmlib_to_sqlite3.py', 'bin/fasta_size_distribution_plot.py', 'bin/report_gff3_statistics.py', 'bin/reformat_fasta_residue_lengths.py', 'bin/convert_cufflinks_gtf_to_gff3.py', 'bin/list_biocode.py', 'bin/fasta_simple_stats.py', 'bin/fastq_simple_stats.py', 'bin/convert_prodigal_to_gff3.py', 'bin/convert_scipio_gff_to_gff3.py', 'bin/filter_gff3_by_id_list.py', 'bin/reorient_sequences_by_id.py', 'bin/convert_fastq_to_fasta.py', 'bin/create_rsem_html_table.py', 'bin/convert_glimmerHMM_gff_to_gff3.py', 'bin/convert_genbank_to_gff3.py', 'bin/replace_homopolymeric_repeats_with_Ns.py', 'bin/split_fasta_into_even_files.py', 'bin/get_mpilup_from_id_list.py', 'bin/convert_gff_to_ncbi_gff3.py', 'bin/create_taxonomic_profile_from_blast.py', 'bin/convert_fasta_contigs_to_gff3.py', 'bin/merge_fasta_files_and_uniquify_ids.py', 'bin/merge_predicted_gff3.py', 'bin/filter_fasta_by_header_regex.py', 'bin/convert_pasa_gff_to_models.py', 'bin/extract_fasta_regions.py', 'bin/set_source_column.py', 'bin/tigrfam_info_to_sqlite3.py', 'bin/add_gff3_locus_tags.py', 'bin/fasta_base_content.py', 'bin/subsample_fasta.py', 'bin/convert_gff3_to_bed.py', 'bin/compare_gene_structures.py', 'bin/validate_fasta.py', 'bin/randomly_subsample_fastq.py', 'bin/append_to_fastq_read_header.py', 'bin/convert_aat_btab_to_gff3.py', 'bin/check_for_embedded_fasta_headers.py', 'bin/convert_htab_to_bed.py', 'bin/correct_gff3_CDS_phase_column.py', 'bin/report_coverage_gaps.py', 'bin/detect_inverted_repeats.py', 'bin/convert_cegma_gff_to_gff3.py', 'bin/remove_duplicate_features.py', 'bin/remove_duplicate_sequences.py', 'bin/create_taxonomy_db.py', 'bin/calculate_query_coverage_by_blast.py', 'bin/report_or_replace_nonstandard_residues.py', 'bin/write_fasta_from_gff.py', 'bin/filter_uniref_by_repid.py', 'bin/check_gff_for_internal_stops.py', 'bin/report_basic_gff_model_agreement.py', 'bin/calculate_gene_coverage_from_assembly.py', 'bin/report_gff_intron_and_intergenic_stats.py', 'bin/extend_genes_to_stops.py', 'bin/report_go_slim_counts.py', 'bin/make_go_index.py', 'bin/split_molecules_on_gaps.py'], - url='http://github.com/jorvis/biocode', - version='0.10.0', - zip_safe=False) --- diff --git a/recipes/biocode/meta.yaml b/recipes/biocode/meta.yaml index 2d3c8dc8fe5d8..42ff93ce5a92a 100644 --- a/recipes/biocode/meta.yaml +++ b/recipes/biocode/meta.yaml @@ -1,5 +1,5 @@ {% set name = "biocode" %} -{% set version = "0.10.0" %} +{% set version = "0.11.0" %} package: name: "{{ name|lower }}" @@ -7,14 +7,14 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: ab48e0ea92f52c7fe48c6c947d4d5aa43437f16cd42a804546c71ef0e5ba2265 - patches: biocode.patch + sha256: 5c0df506d07e6b073b56da360bba4dad8e0b90e4ceb6f62009ae51c56a83b162 build: noarch: python number: 0 script: "{{ PYTHON }} -m pip install . --no-deps -vv" - + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} requirements: host: - pip diff --git a/recipes/biocommons.seqrepo/meta.yaml b/recipes/biocommons.seqrepo/meta.yaml index f70cee72ac83a..0009a20f469c5 100644 --- a/recipes/biocommons.seqrepo/meta.yaml +++ b/recipes/biocommons.seqrepo/meta.yaml @@ -1,5 +1,5 @@ {% set name = "biocommons.seqrepo" %} -{% set version = "0.6.6" %} +{% set version = "0.6.9" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/biocommons.seqrepo-{{ version }}.tar.gz - sha256: 655eb8a2b6e3d4564ef2cbfaa2db6415ccb066f9fd786bd4b3303bbba00e752a + sha256: b08d616c6ab5c4bc8e1ef5e09e94c5c274c6da41f75a435323eddc716c9b5575 build: number: 0 diff --git a/recipes/bioconda-repodata-patches/gen_patch_json.py b/recipes/bioconda-repodata-patches/gen_patch_json.py index 7c729627c9df0..21de6d0ce0aa4 100755 --- a/recipes/bioconda-repodata-patches/gen_patch_json.py +++ b/recipes/bioconda-repodata-patches/gen_patch_json.py @@ -169,13 +169,13 @@ def _gen_new_index(repodata, subdir): if has_dep(record, 'htslib'): # skip deps prior to 1.10, which was the first with soversion 3 # TODO adjust replacement (exclusive) upper bound with each new compatible HTSlib - _pin_looser(fn, record, 'htslib', min_lower_bound='1.10', upper_bound='1.20') + _pin_looser(fn, record, 'htslib', min_lower_bound='1.10', upper_bound='1.21') # future libdeflate versions are compatible until they bump their soversion; relax dependencies accordingly if record_name in ['htslib', 'staden_io_lib', 'fastp'] and has_dep(record, 'libdeflate'): # skip deps that allow anything <1.3, which contained an incompatible library filename # TODO adjust the replacement (exclusive) upper bound each time a compatible new libdeflate is released - _pin_looser(fn, record, 'libdeflate', min_lower_bound='1.3', upper_bound='1.20') + _pin_looser(fn, record, 'libdeflate', min_lower_bound='1.3', upper_bound='1.21') # nanosim <=3.1.0 requires scikit-learn<=0.22.1 if record_name.startswith('nanosim') and has_dep(record, "scikit-learn") and version <= "3.1.0": diff --git a/recipes/bioconda-repodata-patches/meta.yaml b/recipes/bioconda-repodata-patches/meta.yaml index 71e65ad66f5eb..311f06f50de80 100644 --- a/recipes/bioconda-repodata-patches/meta.yaml +++ b/recipes/bioconda-repodata-patches/meta.yaml @@ -1,6 +1,6 @@ package: name: bioconda-repodata-patches - version: 20240112 # ensure that this is the "current" date, and always higher than the latest version in master + version: 20240416 # ensure that this is the "current" date, and always higher than the latest version in master source: path: . diff --git a/recipes/bioconda-utils/meta.yaml b/recipes/bioconda-utils/meta.yaml index 223a443b5d610..7181cbcc84667 100644 --- a/recipes/bioconda-utils/meta.yaml +++ b/recipes/bioconda-utils/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.11.1" %} -{% set sha256 = "7ed52d449b19beecf9461a998aeb8194b5930538ec6468996448bf28f1bab2f5" %} +{% set version = "2.14.0" %} +{% set sha256 = "0ae05ba291a1ad7ae956a42bc7e3123a9789ffcd10bf23f2de4499091b8a9e36" %} package: name: bioconda-utils @@ -41,7 +41,7 @@ requirements: - jsonschema 3.2.* - pyopenssl >=22.1 - conda-forge-pinning 2023.05.06.13.08.41 - - anaconda-client 1.6.* + - anaconda-client 1.12.* - involucro 1.1.* - skopeo 1.11.* - git 2.* @@ -52,12 +52,12 @@ requirements: - aiohttp-security - aiofiles 0.8.* - aioftp 0.12.* - - backoff 1.6.* + - backoff 2.2.* - cachetools 3.0.* - gitpython >=3.0.8,3.0.* - gidgethub 3.0.* - pyjwt >=2.4.0 - - beautifulsoup4 4.8.* + - beautifulsoup4 4.12.* - galaxy-lib >=18.9.1 - jinja2 >2.10.1,<3 - markupsafe <2.1 @@ -68,7 +68,7 @@ requirements: - docutils - markdown - graphviz - - requests 2.22.* + - requests 2.29.* - pygithub 1.* - diskcache 5.* - appdirs 1.* diff --git a/recipes/bioconductor-cellhashr/meta.yaml b/recipes/bioconductor-cellhashr/meta.yaml new file mode 100644 index 0000000000000..86c58266837e7 --- /dev/null +++ b/recipes/bioconductor-cellhashr/meta.yaml @@ -0,0 +1,82 @@ +{% set version = "1.04" %} +{% set sha256 = "a017cf985e78c39c899c5e2d43a7a1ff940f61c79145b6c4b1112e9bf8433de1" %} + +package: + name: bioconductor-cellhashr + version: {{version}} + +source: + url: https://github.com/BimberLab/cellhashR/archive/refs/tags/{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + noarch: generic + script: R CMD INSTALL --build . + run_exports: + - {{ pin_subpackage('bioconductor-cellhashr', max_pin="x") }} + rpaths: + - lib/R/lib/ + - lib/ + +requirements: + host: + - r-base + - r-essentials + - r-devtools + - r-rcpp + - r-rcpparmadillo + - r-rcppeigen + - r-rcppparallel + - r-rcppprogress + - bioconductor-preprocesscore + - r-pdftools + - bioconductor-demuxmix + - r-magick + - bioconductor-s4vectors + - bioconductor-dropletutils + - bioconductor-singlecellexperiment + - r-biocmanager + - r-seurat + - r-rmdformats + - r-ggforce + - r-reticulate + - r-ggextra + - r-ggthemes + - r-patchwork + - r-egg + - bioconductor-nempi + run: + - r-base + - r-essentials + - r-devtools + - r-rcpp + - r-rcpparmadillo + - r-rcppeigen + - r-rcppparallel + - r-rcppprogress + - bioconductor-preprocesscore + - bioconductor-dropletutils + - bioconductor-demuxmix + - r-seurat + - r-seuratobject + - r-rmdformats + - r-ggforce + - r-reticulate + - r-ggextra + - r-ggthemes + - r-patchwork + - r-egg + - bioconductor-nempi + +test: + commands: + - $R -e "library('cellhashR')" # [not win] + - "\"%R%\" -e \"library('cellhashR')\"" # [win] + +about: + home: https://github.com/BimberLab/cellhashR + license: MIT + license_family: MIT + summary: "An R package designed to demultiplex cell hashing data.\n More information in https://bimberlab.github.io/cellhashR/Lab B (2024). \n cellhashR: A Package for Demultiplexing Cell Hashing Data.\n" + dev_url: https://github.com/BimberLab/cellhashR diff --git a/recipes/bioconductor-cocoa/build_failure.linux-64.yaml b/recipes/bioconductor-cocoa/build_failure.linux-64.yaml deleted file mode 100644 index 65ed04bfcc672..0000000000000 --- a/recipes/bioconductor-cocoa/build_failure.linux-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: dd85fa037d453102ef61e3f47e51564c9d31f479966d88c0b89e752d33f8ea37 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |- - bioconda/noarch 100% - pkgs/main/linux-64 - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gbioconda/noarch - [] 1.5s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/linux-64 100% - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gpkgs/main/linux-64 - [] 1.6s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gpkgs/main/noarch - [] 1.7s - conda-forge/linux-64 - conda-forge/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 1.8s - conda-forge/linux-64 - conda-forge/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 1.9s - conda-forge/linux-64 - conda-forge/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 2.0s - conda-forge/linux-64 - conda-forge/noarch 100% - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 2.1s - conda-forge/linux-64 - conda-forge/noarch 100% - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gconda-forge/noarch - [] 2.2s - conda-forge/linux-64 - pkgs/r/linux-64 - pkgs/r/noarch 100%[2K[1A[2K[1A[2K[1A[2K[0Gpkgs/r/noarch - pkgs/r/linux-64 - [] 2.3s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.4s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.5s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.6s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.7s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.8s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.9s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.0s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.1s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.2s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.3s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.4s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.5s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.6s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.7s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.8s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.9s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.0s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.1s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.2s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.3s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.4s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.5s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.6s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.7s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.8s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.9s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.0s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.1s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.2s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.3s - [2K[1A[2K[0Gconda-forge/linux-64 - [?25h[34mReloading output folder: [0m[34m/opt/conda/[0m[34mconda-bld[0m - [?25l[2K[0G[] 0.0s - [2K[1A[2K[0Gopt/conda/conda-bld/linux-64 129.0 B @ 2.2MB/s 0.0s - opt/conda/conda-bld/noarch 1.1kB @ 22.3MB/s 0.0s - [?25hTraceback (most recent call last): - File "/opt/conda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/conda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 3089, in build_tree - test(pkg, config=metadata.config.copy(), stats=stats) - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 2879, in test - environ.create_env(metadata.config.test_prefix, actions, config=metadata.config, - File "/opt/conda/lib/python3.8/site-packages/conda_build/environ.py", line 1052, in create_env - display_actions(actions, index) - File "/opt/conda/lib/python3.8/site-packages/conda/exports.py", line 204, in display_actions - actions['LINK'] = [index[d] for d in actions['LINK']] - File "/opt/conda/lib/python3.8/site-packages/conda/exports.py", line 204, in - actions['LINK'] = [index[d] for d in actions['LINK']] - KeyError: Dist(channel='conda-forge', dist_name='python-3.12.1-hab00c5b_0_cpython', name='python', fmt='.conda', version='3.12.1', build_string='hab00c5b_0_cpython', build_number=0, base_url=None, platform=None) -# Last 100 lines of the build log. diff --git a/recipes/bioconductor-cocoa/meta.yaml b/recipes/bioconductor-cocoa/meta.yaml index 6a4528f450642..f61f932994f3b 100644 --- a/recipes/bioconductor-cocoa/meta.yaml +++ b/recipes/bioconductor-cocoa/meta.yaml @@ -58,4 +58,3 @@ about: summary: 'Coordinate Covariation Analysis' description: 'COCOA is a method for understanding epigenetic variation among samples. COCOA can be used with epigenetic data that includes genomic coordinates and an epigenetic signal, such as DNA methylation and chromatin accessibility data. To describe the method on a high level, COCOA quantifies inter-sample variation with either a supervised or unsupervised technique then uses a database of "region sets" to annotate the variation among samples. A region set is a set of genomic regions that share a biological annotation, for instance transcription factor (TF) binding regions, histone modification regions, or open chromatin regions. COCOA can identify region sets that are associated with epigenetic variation between samples and increase understanding of variation in your data.' license_file: '{{ environ["PREFIX"] }}/lib/R/share/licenses/GPL-3' - diff --git a/recipes/bioconductor-deseq2/meta.yaml b/recipes/bioconductor-deseq2/meta.yaml index fbad8ff890c69..b8c6af265423b 100644 --- a/recipes/bioconductor-deseq2/meta.yaml +++ b/recipes/bioconductor-deseq2/meta.yaml @@ -13,7 +13,7 @@ source: - 'https://depot.galaxyproject.org/software/bioconductor-{{ name|lower }}/bioconductor-{{ name|lower }}_{{ version }}_src_all.tar.gz' md5: 5eb89526ce9fd4da98b1a5e0b5ba0bf3 build: - number: 0 + number: 1 rpaths: - lib/R/lib/ - lib/ @@ -21,6 +21,7 @@ build: # Suggests: testthat, knitr, rmarkdown, vsn, pheatmap, RColorBrewer, apeglm, ashr, tximport, tximeta, tximportData, readr, pbapply, airway, pasilla (>= 0.2.10), glmGamPoi, BiocManager requirements: host: + - bioconductor-apeglm - 'bioconductor-biobase >=2.62.0,<2.63.0' - 'bioconductor-biocgenerics >=0.48.0,<0.49.0' - 'bioconductor-biocparallel >=1.36.0,<1.37.0' @@ -29,6 +30,7 @@ requirements: - 'bioconductor-matrixgenerics >=1.14.0,<1.15.0' - 'bioconductor-s4vectors >=0.40.0,<0.41.0' - 'bioconductor-summarizedexperiment >=1.32.0,<1.33.0' + - r-ashr - r-base - 'r-ggplot2 >=3.4.0' - r-locfit @@ -38,6 +40,7 @@ requirements: - libblas - liblapack run: + - bioconductor-apeglm - 'bioconductor-biobase >=2.62.0,<2.63.0' - 'bioconductor-biocgenerics >=0.48.0,<0.49.0' - 'bioconductor-biocparallel >=1.36.0,<1.37.0' @@ -46,6 +49,7 @@ requirements: - 'bioconductor-matrixgenerics >=1.14.0,<1.15.0' - 'bioconductor-s4vectors >=0.40.0,<0.41.0' - 'bioconductor-summarizedexperiment >=1.32.0,<1.33.0' + - r-ashr - r-base - 'r-ggplot2 >=3.4.0' - r-locfit diff --git a/recipes/bioconductor-dexseq/meta.yaml b/recipes/bioconductor-dexseq/meta.yaml index 29b4cbc81fbe4..c2dea7842a4e5 100644 --- a/recipes/bioconductor-dexseq/meta.yaml +++ b/recipes/bioconductor-dexseq/meta.yaml @@ -13,7 +13,7 @@ source: - 'https://depot.galaxyproject.org/software/bioconductor-{{ name|lower }}/bioconductor-{{ name|lower }}_{{ version }}_src_all.tar.gz' md5: 8e5876f927b0b0cdfc4a402bfb4fb3d6 build: - number: 1 + number: 2 rpaths: - lib/R/lib/ - lib/ @@ -54,6 +54,7 @@ requirements: - 'bioconductor-rsamtools >=2.18.0,<2.19.0' - 'bioconductor-s4vectors >=0.40.0,<0.41.0' - 'bioconductor-summarizedexperiment >=1.32.0,<1.33.0' + - 'htseq >=2.0.2,<2.1' - r-base - r-hwriter - r-rcolorbrewer @@ -62,6 +63,8 @@ requirements: test: commands: - '$R -e "library(''{{ name }}'')"' + - dexseq_prepare_annotation.py --help + - dexseq_count.py --help about: home: 'https://bioconductor.org/packages/{{ bioc }}/bioc/html/{{ name }}.html' license: 'GPL (>= 3)' diff --git a/recipes/bioconductor-enrichtf/build_failure.linux-64.yaml b/recipes/bioconductor-enrichtf/build_failure.linux-64.yaml deleted file mode 100644 index 0885f7bb52630..0000000000000 --- a/recipes/bioconductor-enrichtf/build_failure.linux-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: 1c991de1bbfe0824a102700e267a7f4665d9ce725d1b2ee87b87e8ec4ccbd588 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |- - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/linux-64 - pkgs/main/noarch - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 1.5s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/linux-64 100% - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 1.6s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/linux-64 100% - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gpkgs/main/linux-64 - [] 1.7s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 1.8s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gpkgs/main/noarch - pkgs/r/noarch - [] 1.9s - conda-forge/linux-64 - conda-forge/noarch - pkgs/r/linux-64 [2K[1A[2K[1A[2K[1A[2K[0G[] 2.0s - conda-forge/linux-64 - conda-forge/noarch 100% - pkgs/r/linux-64 [2K[1A[2K[1A[2K[1A[2K[0G[] 2.1s - conda-forge/linux-64 - pkgs/r/linux-64 [2K[1A[2K[1A[2K[0Gconda-forge/noarch - pkgs/r/linux-64 - [] 2.2s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.3s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.4s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.5s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.6s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.7s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.8s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.9s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.0s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.1s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.2s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.3s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.4s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.5s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.6s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.7s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.8s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.9s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.0s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.1s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.2s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.3s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.4s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.5s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.6s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.7s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.8s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.9s - conda-forge/linux-64 [2K[1A[2K[0G[] 5.0s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.1s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.2s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.3s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.4s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.5s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.6s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.7s - [2K[1A[2K[0Gconda-forge/linux-64 - [?25h[34mReloading output folder: [0m[34m/opt/conda/[0m[34mconda-bld[0m - [?25l[2K[0G[] 0.0s - [2K[1A[2K[0Gopt/conda/conda-bld/linux-64 129.0 B @ 2.1MB/s 0.0s - opt/conda/conda-bld/noarch 1.4kB @ 28.7MB/s 0.0s - [?25hTraceback (most recent call last): - File "/opt/conda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/conda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 3089, in build_tree - test(pkg, config=metadata.config.copy(), stats=stats) - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 2879, in test - environ.create_env(metadata.config.test_prefix, actions, config=metadata.config, - File "/opt/conda/lib/python3.8/site-packages/conda_build/environ.py", line 1052, in create_env - display_actions(actions, index) - File "/opt/conda/lib/python3.8/site-packages/conda/exports.py", line 204, in display_actions - actions['LINK'] = [index[d] for d in actions['LINK']] - File "/opt/conda/lib/python3.8/site-packages/conda/exports.py", line 204, in - actions['LINK'] = [index[d] for d in actions['LINK']] - KeyError: Dist(channel='conda-forge', dist_name='python-3.12.1-hab00c5b_0_cpython', name='python', fmt='.conda', version='3.12.1', build_string='hab00c5b_0_cpython', build_number=0, base_url=None, platform=None) -# Last 100 lines of the build log. diff --git a/recipes/bioconductor-enrichtf/meta.yaml b/recipes/bioconductor-enrichtf/meta.yaml index 942370c55322c..5637a45861a28 100644 --- a/recipes/bioconductor-enrichtf/meta.yaml +++ b/recipes/bioconductor-enrichtf/meta.yaml @@ -70,4 +70,3 @@ about: summary: 'Transcription Factors Enrichment Analysis' description: 'As transcription factors (TFs) play a crucial role in regulating the transcription process through binding on the genome alone or in a combinatorial manner, TF enrichment analysis is an efficient and important procedure to locate the candidate functional TFs from a set of experimentally defined regulatory regions. While it is commonly accepted that structurally related TFs may have similar binding preference to sequences (i.e. motifs) and one TF may have multiple motifs, TF enrichment analysis is much more challenging than motif enrichment analysis. Here we present a R package for TF enrichment analysis which combine motif enrichment with the PECA model.' license_file: '{{ environ["PREFIX"] }}/lib/R/share/licenses/GPL-3' - diff --git a/recipes/bioconductor-infercnv/meta.yaml b/recipes/bioconductor-infercnv/meta.yaml index 846a226731767..cca8ee52d9314 100644 --- a/recipes/bioconductor-infercnv/meta.yaml +++ b/recipes/bioconductor-infercnv/meta.yaml @@ -13,7 +13,7 @@ source: - 'https://depot.galaxyproject.org/software/bioconductor-{{ name }}/bioconductor-{{ name }}_{{ version }}_src_all.tar.gz' md5: d5bce5518c27e86b3fb26b6fedad5d7b build: - number: 0 + number: 1 rpaths: - lib/R/lib/ - lib/ @@ -27,6 +27,7 @@ requirements: - 'bioconductor-edger >=4.0.0,<4.1.0' - 'bioconductor-singlecellexperiment >=1.24.0,<1.25.0' - 'bioconductor-summarizedexperiment >=1.32.0,<1.33.0' + - 'r-htmltools >=0.5.7' - r-ape - r-argparse - r-base @@ -61,6 +62,7 @@ requirements: - 'bioconductor-edger >=4.0.0,<4.1.0' - 'bioconductor-singlecellexperiment >=1.24.0,<1.25.0' - 'bioconductor-summarizedexperiment >=1.32.0,<1.33.0' + - 'r-htmltools >=0.5.7' - r-ape - r-argparse - r-base diff --git a/recipes/bioconductor-otubase/build_failure.linux-64.yaml b/recipes/bioconductor-otubase/build_failure.linux-64.yaml deleted file mode 100644 index ffb92d761f8f5..0000000000000 --- a/recipes/bioconductor-otubase/build_failure.linux-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: 2466376a66b53bb6cdb3dff2c8ae7300a0ed3b25e36f88bb855a119a89b9d177 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |- - [] 1.2s - conda-forge/linux-64 - conda-forge/noarch - bioconda/linux-64 100% - pkgs/main/linux-64 - pkgs/main/noarch - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gbioconda/linux-64 - [] 1.3s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/linux-64 - pkgs/main/noarch - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 1.4s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/linux-64 100% - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gpkgs/main/linux-64 - [] 1.5s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 1.6s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gpkgs/main/noarch - [] 1.7s - conda-forge/linux-64 - conda-forge/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 1.8s - conda-forge/linux-64 - conda-forge/noarch 100% - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gconda-forge/noarch - [] 1.9s - conda-forge/linux-64 - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[0Gpkgs/r/noarch - pkgs/r/linux-64 - [] 2.0s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.1s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.2s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.3s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.4s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.5s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.6s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.7s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.8s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.9s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.0s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.1s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.2s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.3s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.4s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.5s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.6s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.7s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.8s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.9s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.0s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.1s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.2s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.3s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.4s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 4.5s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 4.6s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 4.7s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 4.8s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 4.9s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.0s - [2K[1A[2K[0Gconda-forge/linux-64 - [?25h[34mReloading output folder: [0m[34m/opt/conda/[0m[34mconda-bld[0m - [?25l[2K[0G[] 0.0s - [2K[1A[2K[0Gopt/conda/conda-bld/linux-64 129.0 B @ 2.6MB/s 0.0s - opt/conda/conda-bld/noarch 922.0 B @ 18.8MB/s 0.0s - [?25hTraceback (most recent call last): - File "/opt/conda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/conda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 3089, in build_tree - test(pkg, config=metadata.config.copy(), stats=stats) - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 2879, in test - environ.create_env(metadata.config.test_prefix, actions, config=metadata.config, - File "/opt/conda/lib/python3.8/site-packages/conda_build/environ.py", line 1052, in create_env - display_actions(actions, index) - File "/opt/conda/lib/python3.8/site-packages/conda/exports.py", line 204, in display_actions - actions['LINK'] = [index[d] for d in actions['LINK']] - File "/opt/conda/lib/python3.8/site-packages/conda/exports.py", line 204, in - actions['LINK'] = [index[d] for d in actions['LINK']] - KeyError: Dist(channel='conda-forge', dist_name='python-3.12.1-hab00c5b_0_cpython', name='python', fmt='.conda', version='3.12.1', build_string='hab00c5b_0_cpython', build_number=0, base_url=None, platform=None) -# Last 100 lines of the build log. diff --git a/recipes/bioconductor-otubase/meta.yaml b/recipes/bioconductor-otubase/meta.yaml index 51975ccd38e1e..b6a36eb811848 100644 --- a/recipes/bioconductor-otubase/meta.yaml +++ b/recipes/bioconductor-otubase/meta.yaml @@ -52,4 +52,3 @@ extra: name: bioconductor-otubase path: recipes/bioconductor-otubase version: 1.30.0 - diff --git a/recipes/bioconductor-promise/build_failure.linux-64.yaml b/recipes/bioconductor-promise/build_failure.linux-64.yaml deleted file mode 100644 index cf404d42c073a..0000000000000 --- a/recipes/bioconductor-promise/build_failure.linux-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: 5b781e0fa5e8b6eb7b4e980f15193540530dbd5b63b9a1fb5db07f32907673c6 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |- - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 1.2s - conda-forge/linux-64 - conda-forge/noarch - bioconda/linux-64 - pkgs/main/linux-64 - pkgs/main/noarch - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gbioconda/linux-64 - [] 1.3s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/linux-64 - pkgs/main/noarch - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 1.4s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/linux-64 100% - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gpkgs/main/linux-64 - [] 1.5s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 1.6s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch [2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0G[] 1.7s - conda-forge/linux-64 - conda-forge/noarch - pkgs/main/noarch - pkgs/r/linux-64 - pkgs/r/noarch 100%[2K[1A[2K[1A[2K[1A[2K[1A[2K[1A[2K[0Gpkgs/r/noarch - pkgs/main/noarch - [] 1.8s - conda-forge/linux-64 - conda-forge/noarch 100% - pkgs/r/linux-64 [2K[1A[2K[1A[2K[1A[2K[0G[] 1.9s - conda-forge/linux-64 - conda-forge/noarch 100% - pkgs/r/linux-64 [2K[1A[2K[1A[2K[1A[2K[0Gconda-forge/noarch - pkgs/r/linux-64 - [] 2.0s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.1s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.2s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.3s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.4s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.5s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.6s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.7s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.8s - conda-forge/linux-64 [2K[1A[2K[0G[] 2.9s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.0s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.1s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.2s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.3s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.4s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.5s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.6s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.7s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.8s - conda-forge/linux-64 [2K[1A[2K[0G[] 3.9s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.0s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.1s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.2s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.3s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.4s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.5s - conda-forge/linux-64 [2K[1A[2K[0G[] 4.6s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 4.7s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 4.8s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 4.9s - conda-forge/linux-64 100%[2K[1A[2K[0G[] 5.0s - conda-forge/linux-64 100%[2K[1A[2K[0Gconda-forge/linux-64 - [?25h[34mReloading output folder: [0m[34m/opt/conda/[0m[34mconda-bld[0m - [?25l[2K[0G[] 0.0s - [2K[1A[2K[0Gopt/conda/conda-bld/linux-64 129.0 B @ 2.2MB/s 0.0s - opt/conda/conda-bld/noarch 748.0 B @ 15.0MB/s 0.0s - [?25hTraceback (most recent call last): - File "/opt/conda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/conda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 3089, in build_tree - test(pkg, config=metadata.config.copy(), stats=stats) - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 2879, in test - environ.create_env(metadata.config.test_prefix, actions, config=metadata.config, - File "/opt/conda/lib/python3.8/site-packages/conda_build/environ.py", line 1052, in create_env - display_actions(actions, index) - File "/opt/conda/lib/python3.8/site-packages/conda/exports.py", line 204, in display_actions - actions['LINK'] = [index[d] for d in actions['LINK']] - File "/opt/conda/lib/python3.8/site-packages/conda/exports.py", line 204, in - actions['LINK'] = [index[d] for d in actions['LINK']] - KeyError: Dist(channel='conda-forge', dist_name='python-3.12.1-hab00c5b_0_cpython', name='python', fmt='.conda', version='3.12.1', build_string='hab00c5b_0_cpython', build_number=0, base_url=None, platform=None) -# Last 100 lines of the build log. diff --git a/recipes/bioconductor-tximeta/meta.yaml b/recipes/bioconductor-tximeta/meta.yaml index f258f1c4275af..1195350a6e9cc 100644 --- a/recipes/bioconductor-tximeta/meta.yaml +++ b/recipes/bioconductor-tximeta/meta.yaml @@ -13,7 +13,7 @@ source: - 'https://depot.galaxyproject.org/software/bioconductor-{{ name }}/bioconductor-{{ name }}_{{ version }}_src_all.tar.gz' md5: 20a7fe1f7efc9be9ab420325932b8c0b build: - number: 0 + number: 1 rpaths: - lib/R/lib/ - lib/ @@ -31,6 +31,7 @@ requirements: - 'bioconductor-genomicfeatures >=1.54.0,<1.55.0' - 'bioconductor-genomicranges >=1.54.0,<1.55.0' - 'bioconductor-iranges >=2.36.0,<2.37.0' + - 'bioconductor-rhdf5 >=2.0.0,<2.46.1' - 'bioconductor-s4vectors >=0.40.0,<0.41.0' - 'bioconductor-summarizedexperiment >=1.32.0,<1.33.0' - 'bioconductor-tximport >=1.30.0,<1.31.0' @@ -48,6 +49,7 @@ requirements: - 'bioconductor-genomicfeatures >=1.54.0,<1.55.0' - 'bioconductor-genomicranges >=1.54.0,<1.55.0' - 'bioconductor-iranges >=2.36.0,<2.37.0' + - 'bioconductor-rhdf5 >=2.0.0,<2.46.1' - 'bioconductor-s4vectors >=0.40.0,<0.41.0' - 'bioconductor-summarizedexperiment >=1.32.0,<1.33.0' - 'bioconductor-tximport >=1.30.0,<1.31.0' diff --git a/recipes/biodigest/meta.yaml b/recipes/biodigest/meta.yaml new file mode 100644 index 0000000000000..8bb365dda3fca --- /dev/null +++ b/recipes/biodigest/meta.yaml @@ -0,0 +1,49 @@ +{% set name = "biodigest" %} +{% set version = "0.2.16" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" + sha256: 7618cedf40fedd6dd60aa2fbf8635fb4af0a2c0ae16c01ef9741d30729b6e8bc + +build: + number: 2 + script: "{{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation" + noarch: python + run_exports: + - {{ pin_subpackage('biodigest', max_pin="x.x") }} + + +requirements: + host: + - pip + - python >=3.7 + run: + - biothings_client ==0.2.6 + - gseapy ==0.10.5 + - graph-tool >=2.58 + - numpy ==1.24.3 + - pandas ==1.5.2 + - psutil ==5.9.0 + - pycairo >=1.21.0 + - python >=3.7 + - requests >=2.28.2 + - scipy ==1.8.0 + - seaborn >=0.12.2 + +test: + imports: + - biodigest + - biodigest.evaluation + - biodigest.evaluation.d_utils + - biodigest.evaluation.mappers + +about: + home: "http://pypi.python.org/pypi/biodigest/" + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE + summary: "In silico Validation of Disease and Gene sets, Clusterings or Subnetworks (DIGEST)" diff --git a/recipes/biodigest/post-link.sh b/recipes/biodigest/post-link.sh new file mode 100644 index 0000000000000..75d67231bbb28 --- /dev/null +++ b/recipes/biodigest/post-link.sh @@ -0,0 +1,5 @@ +#!/bin/bash + +echo "Running setup script..." >> "$PREFIX/.messages.txt" +python -c "from biodigest import setup; setup.main(setup_type='api')" >> "$PREFIX/.messages.txt" +echo "Setup script finished." >> "$PREFIX/.messages.txt" \ No newline at end of file diff --git a/recipes/bioframe/meta.yaml b/recipes/bioframe/meta.yaml index 81590d40e0556..b25e8a10778bf 100644 --- a/recipes/bioframe/meta.yaml +++ b/recipes/bioframe/meta.yaml @@ -1,5 +1,5 @@ {% set name = "bioframe" %} -{% set version = "0.6.1" %} +{% set version = "0.6.4" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 63aec69ac37aebcdc8298ed41154a875ba99652cc7ef081dd1458bc90537f73b + sha256: 17c152fcb45c83ac0041435790e7fcd4344b74e1b09bd8c8d8b3d20c3ac468e9 build: noarch: python diff --git a/recipes/bionumpy/meta.yaml b/recipes/bionumpy/meta.yaml index 30519b96389e1..48b19940c064e 100644 --- a/recipes/bionumpy/meta.yaml +++ b/recipes/bionumpy/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.0.1" %} +{% set version = "1.0.8" %} package: name: bionumpy @@ -6,7 +6,7 @@ package: source: url: https://github.com/bionumpy/bionumpy/archive/refs/tags/v{{ version }}.tar.gz - sha256: 9e00254dc1c2ee2669048b7fd0bb6309e6caa218f8a330b00e3929f1dfeee58c + sha256: 25fcef9da2f95ee2b6152e51cfc0f802c23b2a7dbbba9aeb669f23226d419df7 build: noarch: python diff --git a/recipes/biscuit/build.sh b/recipes/biscuit/build.sh index b69c7a1e293f1..f19d32dd1e12f 100644 --- a/recipes/biscuit/build.sh +++ b/recipes/biscuit/build.sh @@ -1,9 +1,16 @@ #!/bin/bash -BIN=$PREFIX/bin -mkdir -p $BIN -make CC="$CC $LDFLAGS" CFLAGS="$CFLAGS" -cp biscuit $BIN -cp QC.sh $BIN -cp build_biscuit_QC_assets.pl $BIN -sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' $BIN/build_biscuit_QC_assets.pl +# Needed for building utils dependency +export INCLUDE_PATH="${PREFIX}/include" +export LIBRARY_PATH="${PREFIX}/lib" +export LDFLAGS="${LDFLAGS} -pthread -L${PREFIX}/lib" + +mkdir -p "${PREFIX}/bin" +mkdir -p build +cd build || exit 1 +cmake -DCMAKE_INSTALL_PREFIX:PATH="${PREFIX}" .. +make CC="${CC} ${LDFLAGS}" CFLAGS="${CFLAGS} -O3" +make install + +# Needed to run asset builder +sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' ${PREFIX}/bin/build_biscuit_QC_assets.pl diff --git a/recipes/biscuit/meta.yaml b/recipes/biscuit/meta.yaml index 380b874c46af9..39e7a090e8671 100644 --- a/recipes/biscuit/meta.yaml +++ b/recipes/biscuit/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.3.0.20231027" %} +{% set version = "1.4.0.20240108" %} package: name: biscuit @@ -11,36 +11,36 @@ build: source: - url: https://github.com/huishenlab/biscuit/releases/download/v{{ version }}/release-source.zip - sha256: 027d4343a49fde7c497f4a0292a2cb5bb475b4bcacedb17f251680dbf4f56995 - patches: - - patch - - url: https://github.com/huishenlab/biscuit/releases/download/v{{ version }}/QC.sh - sha256: f2b9237f1166681a5f4e2cb0b297b2c2a086ea4975948a292b4871e391244b13 - - url: https://github.com/huishenlab/biscuit/releases/download/v{{ version }}/build_biscuit_QC_assets.pl - sha256: 7967240b63c8f816e7da79c3c0eb890933ec47df1114f6893b9e9736c8e564a8 + sha256: 58625f286a4bda4a3884feb10be575e4cb205f09b9ddb1075d099ca2259c1c17 requirements: build: - make + - cmake - {{ compiler('c') }} host: - zlib - ncurses + - pthread-stubs - libcurl run: - zlib - ncurses + - pthread-stubs - libcurl - perl test: commands: - - biscuit 2>&1 || true - - QC.sh -h 2>&1 | grep Usage - - build_biscuit_QC_assets.pl -h 2>&1 | grep Usage + - biscuit 2>&1 | grep "Usage" + - QC.sh -h 2>&1 | grep "Usage" + - build_biscuit_QC_assets.pl -h 2>&1 | grep "Usage" about: home: https://github.com/huishenlab/biscuit license: MIT + license_family: MIT + license_file: LICENSE summary: A utility for analyzing sodium bisulfite conversion-based DNA methylation/modification data - + dev_url: https://github.com/huishenlab/biscuit + doc_url: https://huishenlab.github.io/biscuit/ diff --git a/recipes/biscuit/patch b/recipes/biscuit/patch deleted file mode 100644 index 2ef00a4400ab0..0000000000000 --- a/recipes/biscuit/patch +++ /dev/null @@ -1,64 +0,0 @@ -diff --git a/Makefile b/Makefile -index d54b6c2..8ee48a2 100644 ---- a/Makefile -+++ b/Makefile -@@ -1,5 +1,5 @@ --CC = gcc --CFLAGS = -W -Wall -finline-functions -fPIC -std=gnu99 -Wno-unused-result -O3 -+CC ?= gcc -+CFLAGS ?= -W -Wall -finline-functions -fPIC -std=gnu99 -Wno-unused-result -O3 - CLIB = -lncurses -lpthread -lz -lm - CF_OPTIMIZE = 1 - -diff --git a/lib/htslib/Makefile b/lib/htslib/Makefile -index 9c4ce60..c6722fd 100644 ---- a/lib/htslib/Makefile -+++ b/lib/htslib/Makefile -@@ -22,7 +22,7 @@ - # FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER - # DEALINGS IN THE SOFTWARE. - --CC = gcc -+CC ?= gcc - AR = ar - RANLIB = ranlib - -diff --git a/lib/klib/Makefile b/lib/klib/Makefile -index 15ad2fc..aebbf64 100644 ---- a/lib/klib/Makefile -+++ b/lib/klib/Makefile -@@ -1,4 +1,4 @@ --CC = gcc -+CC ?= gcc - AR = ar - CFLAGS = -g -Wall - -diff --git a/lib/sgsl/Makefile b/lib/sgsl/Makefile -index c939453..bc5fd6e 100644 ---- a/lib/sgsl/Makefile -+++ b/lib/sgsl/Makefile -@@ -1,4 +1,4 @@ --CC = gcc -+CC ?= gcc - AR = ar - CFLAGS = -g -Wall - # -std=gnu11 travis complains about this -@@ -25,7 +25,7 @@ libgsl.a: $(OBJECTS) - $(AR) -csr $@ $^ - - test: libgsl.a -- gcc -I. test/test.c libgsl.a -std=c99 -lm -o test-main -+ $(CC) -I. test/test.c libgsl.a -std=c99 -lm -o test-main - - clean: - rm -f $(OBJECTS) -diff --git a/lib/utils/Makefile b/lib/utils/Makefile -index 9c7f457..3b0cfef 100644 ---- a/lib/utils/Makefile -+++ b/lib/utils/Makefile -@@ -1,4 +1,4 @@ --CC = gcc -+CC ?= gcc - AR = ar - CFLAGS = -g -Wall - diff --git a/recipes/biscuit/script.sh b/recipes/biscuit/script.sh deleted file mode 100644 index 80e0ff397a83b..0000000000000 --- a/recipes/biscuit/script.sh +++ /dev/null @@ -1 +0,0 @@ -echo efrat diff --git a/recipes/blast/build_failure.osx-64.yaml b/recipes/blast/build_failure.osx-64.yaml deleted file mode 100644 index de9e3cf438772..0000000000000 --- a/recipes/blast/build_failure.osx-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: d58ac0e00618c06e1088a1a93035e4adcb36ef78f5f709b2dbb0e437fbc7ec1d # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |2- - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_islower' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_tolower' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_isupper' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_toupper' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_ishexnumber' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_isnumber' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_isalnum' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_isphonogram' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_isideogram' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_iscntrl' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_isspecial' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_isblank' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_isascii' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_toascii' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '___wcwidth' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_isgraph' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '___istype' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '___isctype' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_isrune' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_isspace' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '___sputc' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - duplicate symbol '_isalpha' in: - pcretest.o - /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/lib/libregexp.a(pcreposix.o) - ld: 567 duplicate symbols for architecture x86_64 - clang-14: error: linker command failed with exit code 1 (use -v to see invocation) - make[2]: *** [/opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/build/Makefile.app:159: test_pcre] Error 1 - /usr/bin/awk: can't open file make_test_pcre.log.new - source line number 4 - make[1]: *** [/opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/src/build-system/Makefile.meta_l:333: all.nonusr] Error 2 - make: *** [all_l.real] Error 2 - - ------------------------------------------------------ - Current dir: /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/build/util/regexp - - [create_flat_makefile.sh] FAILED (status 2): - make - grep: /opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/blast/c/ReleaseMT/build/Flat.configuration_log: No such file or directory - config.status: error: flat makefile generation failed. - Traceback (most recent call last): - File "/opt/mambaforge/envs/bioconda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 2198, in build - utils.check_call_env(cmd, env=env, rewrite_stdout_env=rewrite_env, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/utils.py", line 451, in check_call_env - return _func_defaulting_env_to_os_environ("call", *popenargs, **kwargs) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/utils.py", line 427, in _func_defaulting_env_to_os_environ - raise subprocess.CalledProcessError(proc.returncode, _args) - subprocess.CalledProcessError: Command '['/bin/bash', '-o', 'errexit', '/opt/mambaforge/envs/bioconda/conda-bld/blast_1685482928598/work/conda_build.sh']' returned non-zero exit status 1. -# Last 100 lines of the build log. diff --git a/recipes/blosum/meta.yaml b/recipes/blosum/meta.yaml index 88e1045f87f16..c20c944256cbd 100644 --- a/recipes/blosum/meta.yaml +++ b/recipes/blosum/meta.yaml @@ -1,5 +1,5 @@ {% set name = "blosum" %} -{% set version = "2.0.2" %} +{% set version = "2.0.3" %} package: name: {{ name }} @@ -7,12 +7,14 @@ package: source: url: https://github.com/not-a-feature/blosum/archive/refs/tags/v{{ version }}.tar.gz - sha256: a0e4a44471d6f70b19ec6b936cdf57cf9849bc5f21ef7d3a698b9e9c2e20a00f + sha256: 7e061dd6934333068b87d0d900eb437574f3c4acda26de7179c2422dcff74033 build: noarch: python number: 0 - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('blosum', max_pin="x") }} requirements: host: @@ -24,15 +26,11 @@ requirements: test: imports: - blosum - commands: - - pip check - requires: - - pip about: home: https://github.com/not-a-feature/blosum license: GPL-3.0-or-later - license_family: GPL + license_family: GPL3 license_file: LICENSE summary: 'A small module for easy access to BLOSUM matrices without dependencies.' description: | @@ -43,4 +41,3 @@ about: extra: recipe-maintainers: - not-a-feature - diff --git a/recipes/boms/meta.yaml b/recipes/boms/meta.yaml index 7097126eefac7..4368691e40f3d 100644 --- a/recipes/boms/meta.yaml +++ b/recipes/boms/meta.yaml @@ -1,5 +1,5 @@ {% set name = "boms" %} -{% set version = "1.0.5" %} +{% set version = "1.1.0" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 75187e1e78ac9eacda923dee3943936625676f2382859636448f14a64e57ea54 + sha256: c64a867233148dab9d32257e86b127793022f893321a43210ceaafa02870cd7c build: run_exports: diff --git a/recipes/bowtie/meta.yaml b/recipes/bowtie/meta.yaml index 0ac76f61b7f94..b515beadf19d5 100644 --- a/recipes/bowtie/meta.yaml +++ b/recipes/bowtie/meta.yaml @@ -13,7 +13,9 @@ source: build: skip: True # [py<30] - number: 6 + number: 7 + run_exports: + - {{ pin_subpackage("bowtie", max_pin="x.x") }} requirements: build: @@ -50,6 +52,8 @@ about: summary: An ultrafast memory-efficient short read aligner extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:bowtie - doi:10.1186/gb-2009-10-3-r25 diff --git a/recipes/bowtie2/build.sh b/recipes/bowtie2/build.sh index 90c802dd1d54d..0add48e56f0b0 100644 --- a/recipes/bowtie2/build.sh +++ b/recipes/bowtie2/build.sh @@ -1,5 +1,10 @@ #!/bin/bash +# Fetch third party dependencies +# (Git submodules - https://github.com/BenLangmead/bowtie2/blob/a43fa6f43f54989468a294967898f85b9fe4cefa/.gitmodules) +git clone --branch master https://github.com/simd-everywhere/simde-no-tests.git third_party/simde +git clone https://github.com/ch4rr0/libsais third_party/libsais + LDFLAGS="" make CXX=$CXX CPP=$CXX CC=$CC LDLIBS="-L$PREFIX/lib -lz -lzstd -ltbb -ltbbmalloc -lpthread" WITH_ZSTD=1 diff --git a/recipes/bowtie2/meta.yaml b/recipes/bowtie2/meta.yaml index 0d332684fac38..aca45e7cc57e5 100644 --- a/recipes/bowtie2/meta.yaml +++ b/recipes/bowtie2/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.5.2" %} +{% set version = "2.5.3" %} package: name: bowtie2 @@ -6,10 +6,10 @@ package: source: url: https://github.com/BenLangmead/bowtie2/archive/v{{ version }}.tar.gz - sha256: 2f86dbfbf3dcb8521d559f830594fe28ac6e4c40d81313a8c2bfb17c82a501e0 + sha256: 4ac3ece3db011322caab14678b9d80cfc7f75208cdaf0c58b24a6ea0f1a0a60e build: - number: 0 + number: 1 skip: True # [py2k] run_exports: - {{ pin_subpackage('bowtie2', max_pin="x") }} @@ -18,6 +18,7 @@ requirements: build: - {{ compiler('cxx') }} - make + - git host: - python - zlib @@ -54,6 +55,8 @@ about: summary: Fast and sensitive gapped read alignment extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:bowtie2 - doi:10.1038/nmeth.1923 diff --git a/recipes/braker3/meta.yaml b/recipes/braker3/meta.yaml index cbf46b0d20506..174a5deb011ec 100644 --- a/recipes/braker3/meta.yaml +++ b/recipes/braker3/meta.yaml @@ -1,6 +1,6 @@ {% set name = "BRAKER3" %} -{% set version = "3.0.7" %} -{% set sha256 = "578b51538e9d18c6f4d8892452d05d59b9126dcfbb6a32a1fe6f70c210370c96" %} +{% set version = "3.0.8" %} +{% set sha256 = "f2623290c3007a3e42719a0bb2713bec7226db222bfef742895a9d5d0b4ee526" %} package: name: "{{ name|lower }}" diff --git a/recipes/breseq/meta.yaml b/recipes/breseq/meta.yaml index 2b9c00862c815..8696fa41b547e 100644 --- a/recipes/breseq/meta.yaml +++ b/recipes/breseq/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.38.2" %} +{% set version = "0.38.3" %} package: name: breseq @@ -6,7 +6,7 @@ package: source: url: https://github.com/barricklab/breseq/releases/download/v{{ version }}/breseq-{{ version }}-Source.tar.gz - sha256: "d451670b9e7e3c87b76d3107efe7f1a9a94904011a32e5d407f4cce7ee3b2892" + sha256: "4d0c772fb87947e028094839f090ee130c87d0d5951adf5b845b79ac87449900" build: number: 0 diff --git a/recipes/btllib/build.sh b/recipes/btllib/build.sh index d87279c0cadac..aac83086b89e5 100644 --- a/recipes/btllib/build.sh +++ b/recipes/btllib/build.sh @@ -1,16 +1,15 @@ #!/bin/bash -export CXXFLAGS="${CXXFLAGS} -D_LIBCPP_DISABLE_AVAILABILITY" +export INCLUDES="-I{PREFIX}/include" +export LIBPATH="-L${PREFIX}/lib" +export LDFLAGS="${LDFLAGS} -L${PREFIX}/lib" +export CXXFLAGS="${CXXFLAGS} -O3 -I${PREFIX}/include -D_LIBCPP_DISABLE_AVAILABILITY" -./compile +CXX="${CXX}" CXXFLAGS="${CXXFLAGS}" meson setup --buildtype release --prefix "${PREFIX}" --strip build/ -Db_coverage=false -mkdir -p ${PREFIX}/bin/ -mkdir -p ${PREFIX}/include/ -mkdir -p ${PREFIX}/lib/ +cd build -cp -r install/bin/* ${PREFIX}/bin/ -cp -r install/include/* ${PREFIX}/include/ -cp -r install/lib/* ${PREFIX}/lib/ +ninja -v install # python wrappers: -$PYTHON -m pip install install/lib/btllib/python +$PYTHON -m pip install "${PREFIX}/lib/btllib/python" --no-deps --no-build-isolation -vvv diff --git a/recipes/btllib/build_failure.osx-64.yaml b/recipes/btllib/build_failure.osx-64.yaml deleted file mode 100644 index b1b23121063ba..0000000000000 --- a/recipes/btllib/build_failure.osx-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: b5330eaa8f450048b15b4e0a4ac3067bf62e46a1e378b96516730df6c583866d # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |- - [58/59] Installing files. - Installing libbtllib.a to $SRC_DIR/install/lib - Skipping RPATH fixing - Installing wrappers/python/_btllib.so to $SRC_DIR/install/lib/btllib/python/btllib - Skipping RPATH fixing - Installing recipes/indexlr to $SRC_DIR/install/bin - Skipping RPATH fixing - Installing recipes/randseq to $SRC_DIR/install/bin - Skipping RPATH fixing - Installing recipes/mi_bf_generate to $SRC_DIR/install/bin - Skipping RPATH fixing - Installing $SRC_DIR/include/btllib/seq_reader_multiline_fastq_module.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/process_pipeline.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/mi_bloom_filter.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/nthash_lowlevel.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/seq_reader_gfa2_module.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/data_stream.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/seq_reader_fastq_module.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/nthash_consts.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/order_queue.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/aahash.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/indexlr.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/status.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/counting_bloom_filter.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/aahash_consts.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/graph.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/bloom_filter.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/randseq.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/seq.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/seq_reader.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/seq_reader_fasta_module.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/nthash.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/seq_reader_multiline_fasta_module.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/util.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/cstring.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/seq_writer.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/include/btllib/seq_reader_sam_module.hpp to $SRC_DIR/install/include/btllib - Installing $SRC_DIR/wrappers/python/btllib.py to $SRC_DIR/install/lib/btllib/python/btllib - Installing /private/tmp/btllib-build-dzadL9GTQASFPuHRFG4M0A/wrappers/python/setup.py to $SRC_DIR/install/lib/btllib/python - Running custom install script '$SRC_DIR/scripts/install-cpptoml' - Running custom install script '$SRC_DIR/scripts/install-sdsl-lite' - - Build finished successfully! - btllib installation can be found at: $SRC_DIR/install - Processing ./install/lib/btllib/python - Preparing metadata (setup.py): started - Preparing metadata (setup.py): finished with status 'done' - Building wheels for collected packages: btllib - Building wheel for btllib (setup.py): started - Building wheel for btllib (setup.py): finished with status 'done' - Created wheel for btllib: filename=btllib-1.6.0-py3-none-any.whl size=673941 sha256=1df681e706445a63e978f5ae5d950166dacf8546ecbedfd7b3a11f89ee9d5142 - Stored in directory: /private/tmp/pip-ephem-wheel-cache-byvyhow3/wheels/fd/de/91/c0ac23923f09e9244ae72dd27c8d91edf6e02332772e8fb05f - Successfully built btllib - Installing collected packages: btllib - Successfully installed btllib-1.6.0 - - Resource usage statistics from building btllib: - Process count: 12 - CPU time: Sys=0:00:14.7, User=0:03:19.7 - Memory: 590.5M - Disk usage: 60.2K - Time elapsed: 0:02:40.9 - - - Packaging btllib - INFO:conda_build.build:Packaging btllib - Packaging btllib-1.6.0-py310hd3d38e4_1 - INFO:conda_build.build:Packaging btllib-1.6.0-py310hd3d38e4_1 - compiling .pyc files... - number of files: 157 - Traceback (most recent call last): - File "/opt/mambaforge/envs/bioconda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 2358, in build - newly_built_packages = bundlers[pkg_type](output_d, m, env, stats) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 1659, in bundle_conda - files = post_process_files(metadata, initial_files) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 1505, in post_process_files - post_build(m, new_files, build_python=python) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/post.py", line 1318, in post_build - post_process_shared_lib(m, f, prefix_files, host_prefix) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/post.py", line 1266, in post_process_shared_lib - mk_relative_osx(path, host_prefix, m, files=files, rpaths=rpaths) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/post.py", line 397, in mk_relative_osx - names = macho.otool(path, prefix) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/os_utils/macho.py", line 194, in otool - lines = check_output([otool, '-l', path], - File "/opt/mambaforge/envs/bioconda/lib/python3.8/subprocess.py", line 415, in check_output - return run(*popenargs, stdout=PIPE, timeout=timeout, check=True, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/subprocess.py", line 516, in run - raise CalledProcessError(retcode, process.args, - subprocess.CalledProcessError: Command '['/opt/mambaforge/envs/bioconda/conda-bld/btllib_1686051065758/_build_env/bin/llvm-otool', '-l', '/opt/mambaforge/envs/bioconda/conda-bld/btllib_1686051065758/_h_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placeho/lib/btllib/python/btllib/_btllib.so']' died with . -# Last 100 lines of the build log. diff --git a/recipes/btllib/meta.yaml b/recipes/btllib/meta.yaml index 6a7e631686d5b..e981478394a87 100644 --- a/recipes/btllib/meta.yaml +++ b/recipes/btllib/meta.yaml @@ -1,5 +1,5 @@ {% set name = "btllib" %} -{% set version = "1.7.0" %} +{% set version = "1.7.2" %} package: name: {{ name|lower }} @@ -7,39 +7,41 @@ package: source: url: https://github.com/bcgsc/btllib/releases/download/v{{ version }}/{{ name|lower }}-{{ version }}.tar.gz - sha256: a9a2b7d5c65865b20ee6467657c08ac05c9ea1f7c993bf44c3ffcf044b200def + sha256: 4c1bb29fdbd7d9a39f960360a5d4b224d22189862b948027a8e3ecd67c635926 build: - skip: true # [py < 38 or win] - number: 0 + skip: True # [py < 38 or win] + number: 1 run_exports: - {{ pin_subpackage('btllib', max_pin="x") }} requirements: build: - {{ compiler('cxx') }} + - cmake + - meson + - ninja host: - python - pip - - wheel - - meson - - ninja - - cmake - llvm-openmp # [osx] - libgomp # [linux] + - samtools + - swig + - doxygen run: - python - samtools + - llvm-openmp # [osx] + - libgomp # [linux] - pigz - - gzip # alternative to pigz + - gzip # alternative to pigz - tar - bzip2 - xz - lrzip - zip - wget - - llvm-openmp # [osx] - - libgomp # [linux] test: commands: @@ -54,6 +56,7 @@ about: license_file: LICENSE summary: 'Bioinformatics common code library in C++ with Python wrappers, from Bioinformatics Technology Lab' doc_url: https://bcgsc.github.io/btllib/ + dev_url: https://github.com/bcgsc/btllib extra: identifiers: diff --git a/recipes/busco/0001-Set-conda-distribution.patch b/recipes/busco/0001-Set-conda-distribution.patch new file mode 100644 index 0000000000000..68091d67a5b1f --- /dev/null +++ b/recipes/busco/0001-Set-conda-distribution.patch @@ -0,0 +1,11 @@ +--- a/src/busco/run_BUSCO.py ++++ b/src/busco/run_BUSCO.py +@@ -126,7 +126,7 @@ class BuscoMaster: + elif os.path.exists("/.singularity.d"): + self.run_data["distribution"] = "singularity" + else: +- self.run_data["distribution"] = "manual" ++ self.run_data["distribution"] = "conda" + + def get_download_url(self): + if self.config.getboolean("busco_run", "offline"): diff --git a/recipes/busco/meta.yaml b/recipes/busco/meta.yaml index 515c990c241e1..528eb257d49c9 100644 --- a/recipes/busco/meta.yaml +++ b/recipes/busco/meta.yaml @@ -1,6 +1,6 @@ {% set name = "busco" %} -{% set version = "5.6.1" %} -{% set sha256 = "1129d8dd1779455b77c47a926650e1974aaca58eeb9e6b3b6e4a706154ab2da8" %} +{% set version = "5.7.1" %} +{% set sha256 = "d57066b68d533f0b86518653430ba47b748ef14db56d2a992601d3e26096cad6" %} package: name: busco @@ -17,6 +17,7 @@ source: sha256: {{ sha256 }} patches: - 0001-Add-default-config-path-within-prefix-updated.patch + - 0001-Set-conda-distribution.patch requirements: host: @@ -26,7 +27,7 @@ requirements: - blast >=2.10.1 # There is a multithreading problem for all BLAST versions between 2.4 and 2.10.0 - hmmer >=3.1b2 # sepp needs this version - augustus >=3.3 - - biopython + - biopython >=1.79 - prodigal - sepp >=4.3.10 - dendropy <4.6.0 # necessary temporarily until SEPP updates their codebase or recipe @@ -41,7 +42,7 @@ requirements: - blast >=2.10.1 # There is a multithreading problem for all BLAST versions between 2.4 and 2.10.0 - hmmer >=3.1b2 # sepp needs this version - augustus >=3.3 - - biopython + - biopython >=1.79 - r-base - r-ggplot2 >=2.2.1 - prodigal diff --git a/recipes/bwa/Makefile.patch b/recipes/bwa/Makefile.patch deleted file mode 100644 index 5a26928815dc6..0000000000000 --- a/recipes/bwa/Makefile.patch +++ /dev/null @@ -1,16 +0,0 @@ -diff --git a/Makefile b/Makefile -index 7151435..2f0a4fe 100644 ---- a/Makefile -+++ b/Makefile -@@ -1,9 +1,9 @@ --CC= gcc -+#CC= gcc - #CC= clang --analyze - CFLAGS= -g -Wall -Wno-unused-function -O2 - WRAP_MALLOC=-DUSE_MALLOC_WRAPPERS - AR= ar --DFLAGS= -DHAVE_PTHREAD $(WRAP_MALLOC) -+DFLAGS= -DHAVE_PTHREAD $(WRAP_MALLOC) $(LDFLAGS) - LOBJS= utils.o kthread.o kstring.o ksw.o bwt.o bntseq.o bwa.o bwamem.o bwamem_pair.o bwamem_extra.o malloc_wrap.o \ - QSufSort.o bwt_gen.o rope.o rle.o is.o bwtindex.o - AOBJS= bwashm.o bwase.o bwaseqio.o bwtgap.o bwtaln.o bamlite.o \ diff --git a/recipes/bwa/build.sh b/recipes/bwa/build.sh index a8ff3c2d2b692..6bdafb538cade 100644 --- a/recipes/bwa/build.sh +++ b/recipes/bwa/build.sh @@ -1,9 +1,6 @@ #!/bin/bash -export C_INCLUDE_PATH=${PREFIX}/include -export LIBRARY_PATH=${PREFIX}/lib - -make CFLAGS="${CFLAGS} -fcommon" +make CC="$CC" CFLAGS="$CFLAGS" CPPFLAGS="$CPPFLAGS" LDFLAGS="$LDFLAGS" mkdir -p $PREFIX/bin mkdir -p $PREFIX/share/man/man1 cp bwa $PREFIX/bin diff --git a/recipes/bwa/meta.yaml b/recipes/bwa/meta.yaml index b781e21c89e93..c4b7f382317b3 100644 --- a/recipes/bwa/meta.yaml +++ b/recipes/bwa/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.7.17" %} -{% set sha256 = "980b9591b61c60042c4a39b9e31ccaad8d17ff179d44d347997825da3fdf47fd" %} +{% set version = "0.7.18" %} +{% set sha256 = "194788087f7b9a77c0114aa481b2ef21439f6abab72488c83917302e8d0e7870" %} package: name: bwa @@ -8,11 +8,11 @@ package: source: url: https://github.com/lh3/bwa/archive/v{{ version }}.tar.gz sha256: {{ sha256 }} - patches: - - Makefile.patch build: - number: 11 + number: 0 + run_exports: + - {{ pin_subpackage("bwa", max_pin="x.x") }} requirements: build: @@ -21,7 +21,6 @@ requirements: host: - zlib run: - - zlib - perl test: @@ -37,6 +36,8 @@ about: summary: The BWA read mapper. extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:bwa - usegalaxy-eu:bwa_mem diff --git a/recipes/bx-python/meta.yaml b/recipes/bx-python/meta.yaml index bbf510cd6ac66..61d42af5848fa 100644 --- a/recipes/bx-python/meta.yaml +++ b/recipes/bx-python/meta.yaml @@ -1,6 +1,6 @@ {% set name = "bx-python" %} -{% set version = "0.10.0" %} -{% set sha256 = "bfe9541d7b18a98e907b085e31f58d3989fbca4dc667c4ae48c33b753e0e2da8" %} +{% set version = "0.11.0" %} +{% set sha256 = "2cf8872572817e0d36145cc2711889df5729987ffed4e51280da1e3c2ccb9429" %} package: name: {{ name|lower }} @@ -11,9 +11,11 @@ source: sha256: {{ sha256 }} build: - number: 0 - skip: True # [py < 37] - script: {{ PYTHON }} -m pip install . --use-pep517 --no-deps -vvv + number: 1 + skip: True # [py < 38] + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation --no-cache-dir -vvv + run_exports: + - {{ pin_subpackage(name|lower, max_pin='x.x') }} requirements: build: @@ -22,9 +24,6 @@ requirements: - python - cython - pip - - setuptools - - wheel - - python-lzo - numpy - zlib run: @@ -60,8 +59,10 @@ about: license_family: MIT license_file: LICENSE doc_url: 'https://buildmedia.readthedocs.org/media/pdf/bx-python/latest/bx-python.pdf' - dev_url: 'https://pypi.org/project/bx-python/' + dev_url: 'https://github.com/bxlab/bx-python' extra: identifiers: - biotools:bx-python + additional-platforms: + - linux-aarch64 diff --git a/recipes/cadd-scripts/meta.yaml b/recipes/cadd-scripts/meta.yaml index 97cc5f5adcd16..57183b15af886 100644 --- a/recipes/cadd-scripts/meta.yaml +++ b/recipes/cadd-scripts/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.6.post1" %} -{% set sha256 = "0f83361c2e3b0f4bbd096d2e07a8cda4593a0d8b82f68ebff3153b161cad78a4" %} +{% set version = "1.7" %} +{% set sha256 = "46f06c31adc7bdde612c60120f892f2a622494b02812fc047e0d3cee6bd25a0f" %} package: name: cadd-scripts diff --git a/recipes/callingcardstools/meta.yaml b/recipes/callingcardstools/meta.yaml index dc887ec16da56..71fe9244deaa1 100644 --- a/recipes/callingcardstools/meta.yaml +++ b/recipes/callingcardstools/meta.yaml @@ -1,5 +1,5 @@ {% set name = "callingcardstools" %} -{% set version = "1.4.1" %} +{% set version = "1.5.2" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: b5e312e790fc5f88f979885ee080284a67e7142308350dcd7ca0566ec4ffc8d1 + sha256: 7ee834c5e7855d1613f6eb9759f7ea0496e70ffbf0b132ab9b76f03685cf652e build: noarch: python @@ -31,6 +31,7 @@ requirements: - pysam - python >=3.8 - scipy >=1.11.4 + - pyranges >=0.0.129 test: imports: diff --git a/recipes/camlhmp/meta.yaml b/recipes/camlhmp/meta.yaml new file mode 100644 index 0000000000000..81544753240b8 --- /dev/null +++ b/recipes/camlhmp/meta.yaml @@ -0,0 +1,49 @@ +{% set name = "camlhmp" %} +{% set version = "0.0.1" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/camlhmp/camlhmp-{{ version }}.tar.gz + sha256: 882013057ea4ff06c84919a71d50309e9db35efae507c1560c4380b0139e0d5e + +build: + noarch: python + script: {{ PYTHON }} -m pip install --no-deps --ignore-installed -vv . + number: 0 + run_exports: + - {{ pin_subpackage(name|lower, max_pin='x.x.x') }} + +requirements: + host: + - python >=3.8 + - poetry + - pip + run: + - blast + - executor + - pigz + - python >=3.8 + - pyyaml + - rich-click >=1.6.0 + +test: + imports: + - camlhmp + commands: + - pip check + - camlhmp --help + requires: + - pip + +about: + home: https://github.com/rpetit3/camlhmp + summary: Classification through yAML Heuristic Mapping Protocol + license: MIT + license_file: LICENSE + +extra: + recipe-maintainers: + - rpetit3 diff --git a/recipes/campygstyper/meta.yaml b/recipes/campygstyper/meta.yaml new file mode 100644 index 0000000000000..0d869745829a8 --- /dev/null +++ b/recipes/campygstyper/meta.yaml @@ -0,0 +1,35 @@ +{% set version = "0.1.1" %} +{% set name = "campygstyper" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/LanLab/{{ name }}/archive/v{{ version }}.tar.gz + sha256: 125787f7db92b8d787e47eeac710b66c6bc9e71a043dbc68de2427af09546e37 + +build: + noarch: python + number: 0 + script: {{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv + run_exports: + - {{ pin_subpackage('campygstyper', max_pin="x.x") }} + +requirements: + host: + - python >=3.8 + - pip + run: + - python >=3.8 + - fastani >=1.3 + +about: + home: https://github.com/LanLab/campygstyper + license: GPL-3.0-or-later + license_file: LICENSE + summary: Accurate assignment of ANI genomic species to Campylobacter genomes. + +test: + commands: + - campygstyper --help diff --git a/recipes/canopy/build.sh b/recipes/canopy/build.sh new file mode 100644 index 0000000000000..0754372e7255c --- /dev/null +++ b/recipes/canopy/build.sh @@ -0,0 +1,6 @@ +#!/bin/bash + +echo "Compiling Canopy" +mkdir -p ${PREFIX}/bin +make +mv cc.bin ${PREFIX}/bin/ diff --git a/recipes/canopy/meta.yaml b/recipes/canopy/meta.yaml new file mode 100644 index 0000000000000..8906c6773dc28 --- /dev/null +++ b/recipes/canopy/meta.yaml @@ -0,0 +1,36 @@ +{% set version="0.25" %} +{% set name="canopy" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/hildebra/canopy2/archive/refs/tags/v{{ version }}.tar.gz + sha256: 6ea391021dc81ff1981bb69b0ec27a56a17bd23e01c25a27b86808366d62061f + +build: + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} + +requirements: + build: + - {{ compiler('cxx') }} + - make + - llvm-openmp + host: + - zlib + run: + - zlib + - llvm-openmp + +test: + commands: + - cc.bin --version | grep {{ version }} + +about: + home: https://github.com/hildebra/canopy2/ + license: GPL-2.0-or-later + license_file: LICENSE + summary: 'Canopy - Metagenomics Canopy Clustering Implementation' diff --git a/recipes/capcruncher/meta.yaml b/recipes/capcruncher/meta.yaml index 39a98b445fdb9..f65c123600dbe 100644 --- a/recipes/capcruncher/meta.yaml +++ b/recipes/capcruncher/meta.yaml @@ -1,5 +1,5 @@ {% set name = "capcruncher" %} -{% set version = "0.3.11" %} +{% set version = "0.3.12" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/capcruncher-{{ version }}.tar.gz - sha256: 1baee46dc9eaab97125796292bc7d6a24821c69538d43f205a344f550db14a7a + sha256: 43b1e634dac4eee5f801b69b2adafb07b61c72556cc32b1cd5e03518ed2e407b build: number: 0 diff --git a/recipes/captus/build.sh b/recipes/captus/build.sh new file mode 100644 index 0000000000000..374c3b8aca8dd --- /dev/null +++ b/recipes/captus/build.sh @@ -0,0 +1,8 @@ +#!/bin/bash + +if [ `uname -s` == "Linux" ]; +then + ln -s "${PREFIX}/lib/libbz2.so.1.0" "${PREFIX}/lib/libbz2.so.1" +fi + +$PYTHON -m pip install . --ignore-installed -vv diff --git a/recipes/captus/meta.yaml b/recipes/captus/meta.yaml index 44207123a1eea..8a22b833b4489 100644 --- a/recipes/captus/meta.yaml +++ b/recipes/captus/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.0.0" %} -{% set sha256 = "2ecdab60cc0ce9b422e66e325a4746a04f2700c8b477790458217f0c9d0b8adb" %} +{% set version = "1.0.1" %} +{% set sha256 = "a9331d4a3d8d967e4b679c14e5af6fd98539659de3b740da876b1fa5c8dd0ba3" %} package: name: captus @@ -10,9 +10,8 @@ source: sha256: {{ sha256 }} build: - number: 0 + number: 2 noarch: python - script: "{{ PYTHON }} -m pip install . --ignore-installed -vv" run_exports: - {{ pin_subpackage("captus", max_pin="x.x") }} @@ -22,7 +21,6 @@ requirements: - python >=3.6 - pip - setuptools - run: - python >=3.6 - pip @@ -35,7 +33,7 @@ requirements: - megahit =1.2.9=hfbae3c0_0 # [osx] - mmseqs2 - muscle >=5 - - pandas + - pandas >=2.1.0 - perl-bioperl-core - perl-yaml - pigz diff --git a/recipes/carveme/LICENSE.txt b/recipes/carveme/LICENSE.txt new file mode 100644 index 0000000000000..e9b0f54ede839 --- /dev/null +++ b/recipes/carveme/LICENSE.txt @@ -0,0 +1,16 @@ + +Apache Software License 2.0 + +Copyright (c) 2017, Daniel Machado + +Licensed under the Apache License, Version 2.0 (the "License"); +you may not use this file except in compliance with the License. +You may obtain a copy of the License at + +http://www.apache.org/licenses/LICENSE-2.0 + +Unless required by applicable law or agreed to in writing, software +distributed under the License is distributed on an "AS IS" BASIS, +WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +See the License for the specific language governing permissions and +limitations under the License. diff --git a/recipes/carveme/meta.yaml b/recipes/carveme/meta.yaml new file mode 100644 index 0000000000000..3a9692325ff17 --- /dev/null +++ b/recipes/carveme/meta.yaml @@ -0,0 +1,65 @@ +{% set name = "carveme" %} +{% set version = "1.6.1" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" + sha256: 3f58e2519af378b15b7e0d175aefa94566793503e32856d690720213a1a9d478 + +build: + number: 0 + entry_points: + - build_universe=carveme.cli.build_universe:main + - curate_universe=carveme.cli.curate_universe:main + - carve=carveme.cli.carve:main + - gapfill=carveme.cli.gapfill:main + - merge_community=carveme.cli.merge_community:main + - benchmark=carveme.cli.benchmark:main + script: "{{ PYTHON }} -m pip install --use-pep517 . -vv" + noarch: python + build: + run_exports: + - {{ pin_subpackage('carveme', max_pin="x.x.x") }} + +requirements: + host: + - python >=3.8 + - pip + run: + - pandas + - python >=3.8 + - reframed >=1.5.1 + - diamond + - pyscipopt + - scip + - numpy + - requests +test: + imports: + - carveme + - carveme.cli + - carveme.reconstruction + - carveme.universe + - tests + commands: + - build_universe --help + - curate_universe --help + - carve --help + - gapfill --help + - merge_community --help + - benchmark --help + +about: + home: "https://github.com/cdanielmachado/carveme" + license: Apache-2.0 + license_family: APACHE + license_file: LICENSE.txt + summary: "CarveMe: automated genome-scale metabolic model reconstruction" + +extra: + recipe-maintainers: + - lhtxa + - cdanielmachado diff --git a/recipes/cazy_webscraper/meta.yaml b/recipes/cazy_webscraper/meta.yaml index f5c23370c9ad7..e46ee87c652f9 100644 --- a/recipes/cazy_webscraper/meta.yaml +++ b/recipes/cazy_webscraper/meta.yaml @@ -1,6 +1,6 @@ {% set name = "cazy_webscraper" %} -{% set version = "2.3.0" %} -{% set sha256 = "08a12134f124622069d4259c55d0bafc618e4f1d4872992529cd495d782fd21e" %} +{% set version = "2.3.0.3" %} +{% set sha256 = "82af3a5c13c1f3254bcbc9967c85d38f085c88f18834fb5a84155d5f13e669d9" %} package: name: {{ name|lower }} @@ -13,7 +13,7 @@ source: build: number: 0 noarch: python - script: {{ PYTHON }} -m pip install . -vv + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv entry_points: - cazy_webscraper = cazy_webscraper.cazy_scraper:main - cw_get_genbank_seqs = cazy_webscraper.expand.genbank.sequences.get_genbank_sequences:main @@ -25,6 +25,8 @@ build: - cw_get_pdb_structures = cazy_webscraper.expand.pdb.get_pdb_structures:main - cw_query_database = cazy_webscraper.api.cw_query_database:main - cw_get_db_schema = cazy_webscraper.sql.get_schema:main + run_exports: + - {{ pin_subpackage('cazy_webscraper', max_pin="x") }} requirements: host: @@ -57,6 +59,7 @@ about: dev_url: "https://github.com/HobnobMancer/cazy_webscraper" summary: "A tool to automate retrieving data from CAZy, build a local CAZyme SQL database, and throughly interrogating the data. Also, automate retrieving protein data, sequences, EC numbers and structure files for specific datasets in the CAZyme database from UniProt, GenBank and PDB." license: MIT + license_family: MIT license_file: LICENSE extra: diff --git a/recipes/ccmetagen/meta.yaml b/recipes/ccmetagen/meta.yaml index 9adb565f54b77..2041475df1daa 100644 --- a/recipes/ccmetagen/meta.yaml +++ b/recipes/ccmetagen/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ccmetagen" %} -{% set version = "1.4.2" %} +{% set version = "1.5.0" %} package: name: "{{ name|lower }}" @@ -7,11 +7,11 @@ package: source: url: "https://github.com/vrmarcelino/CCMetagen/archive/v{{ version }}.tar.gz" - sha256: "9e01a3e123e6fb2d30ac0f17f452bc5262c938821def867cfaea705e4f327940" + sha256: "44a0591e6a5d0a5317cf2307c8da6851dde039679b32bd0cc743b210b4add81d" build: noarch: python - number: 1 + number: 0 script: "python -m pip install --no-deps --ignore-installed . " run_exports: - {{ pin_subpackage(name, max_pin="x.x") }} diff --git a/recipes/ccsmeth/meta.yaml b/recipes/ccsmeth/meta.yaml index 2d8d97c2f3349..b31d55381a2a0 100644 --- a/recipes/ccsmeth/meta.yaml +++ b/recipes/ccsmeth/meta.yaml @@ -1,6 +1,6 @@ {% set name = "ccsmeth" %} -{% set version = "0.4.1" %} -{% set hash = "783382fc3f3a108d7b1f4de8f60c06a45c049d8de797251d14cadb1ae69b6aa7" %} +{% set version = "0.5.0" %} +{% set hash = "9f6bd61ebf1e7e7a4b6d0690658ccf0a70936faf3229db7998ef3ad6ef3e3a54" %} package: name: "{{ name|lower }}" @@ -16,6 +16,8 @@ build: entry_points: - ccsmeth=ccsmeth.ccsmeth:main script: "{{ PYTHON }} -m pip install . -vv" + run_exports: + - {{ pin_subpackage("ccsmeth", max_pin="x.x") }} requirements: host: @@ -28,7 +30,7 @@ requirements: - numpy >=1.20.0 - scikit-learn >=1.0.2 - statsmodels >=0.13.2 - - pytorch >=1.2.0,<=1.12.1 + - pytorch >=1.2.0,<=2.1.0 - pysam >=0.19.0 - tqdm >=4.64.0 - bedtools =2.30.0 diff --git a/recipes/cd-hit/meta.yaml b/recipes/cd-hit/meta.yaml index 87534475d3ab5..8163e48de1d69 100644 --- a/recipes/cd-hit/meta.yaml +++ b/recipes/cd-hit/meta.yaml @@ -10,7 +10,9 @@ source: sha256: {{ sha256 }} build: - number: 9 + number: 10 + run_exports: + - {{ pin_subpackage('cd-hit', max_pin="x") }} requirements: build: @@ -32,3 +34,7 @@ about: home: https://github.com/weizhongli/cdhit license: GPLv2 summary: Clusters and compares protein or nucleotide sequences + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/cdbtools/build.sh b/recipes/cdbtools/build.sh index 3298b9ab314d0..facdc9734cb9e 100644 --- a/recipes/cdbtools/build.sh +++ b/recipes/cdbtools/build.sh @@ -1,4 +1,4 @@ mkdir -pv $PREFIX/bin -make CC="${CXX}" LINKER="${CXX}" +make CC="${CXX}" LINKER="${CXX}" -j ${CPU_COUNT} cp cdbfasta $PREFIX/bin cp cdbyank $PREFIX/bin diff --git a/recipes/cdbtools/meta.yaml b/recipes/cdbtools/meta.yaml index a95d6334963bb..fd3037deed543 100644 --- a/recipes/cdbtools/meta.yaml +++ b/recipes/cdbtools/meta.yaml @@ -10,7 +10,9 @@ source: - zlib.patch build: - number: 9 + number: 10 + run_exports: + - {{ pin_subpackage('cdbtools', max_pin='x.x') }} requirements: build: @@ -31,4 +33,8 @@ about: license: Public Domain summary: CDB (Constant DataBase) indexing and retrieval tools for FASTA files +extra: + additional-platforms: + - linux-aarch64 + # vim:set ts=8 sw=2 diff --git a/recipes/cellqc/meta.yaml b/recipes/cellqc/meta.yaml index 898e630900d0c..0582defd01a18 100644 --- a/recipes/cellqc/meta.yaml +++ b/recipes/cellqc/meta.yaml @@ -1,5 +1,5 @@ {% set name = "cellqc" %} -{% set version = "0.0.6" %} +{% set version = "0.0.7" %} package: name: "{{ name|lower }}" @@ -7,10 +7,10 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 3da8ed9e2c275626ab2eb2c779cdb8eacf1429fce212357c0dd29c9753e08764 + sha256: d637e51cf5bbe5dae7b3fd8dc85f32af1e8b9c379882351878673bdd3ff6bf6d build: - number: 1 + number: 0 entry_points: - cellqc=cellqc.cellqc:main run_exports: diff --git a/recipes/cellsnake/meta.yaml b/recipes/cellsnake/meta.yaml index ceafb17b3f864..012b4037e3037 100644 --- a/recipes/cellsnake/meta.yaml +++ b/recipes/cellsnake/meta.yaml @@ -1,5 +1,5 @@ {% set name = "cellsnake" %} -{% set version = "0.2.0.11" %} +{% set version = "0.2.0.12" %} package: @@ -8,21 +8,22 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/cellsnake-{{ version }}.tar.gz - sha256: ceb1779bf0401db27fcfe3b7479d0f8fcd0024d2121e826cc1ca84fa333cfe5f + sha256: d8b812c5063a34cf07da900881517b1946c66f2ad2a89092168edaff5693cb7d build: noarch: python - number: 2 + number: 0 entry_points: - cellsnake=cellsnake.command_line:main - script: python -m pip install . -vv + script: python -m pip install . --ignore-installed -vv run_exports: - - {{ pin_subpackage(name, max_pin="x.x") }} + - {{ pin_compatible(name, max_pin="x.x") }} requirements: host: - pip - python + - r-base ==4.3 run: - python @@ -35,19 +36,19 @@ requirements: - pysam >=0.16.0.1 - regex >=2021.4.4 - scipy - - snakemake >=7.22.0 + - snakemake-minimal ==7.22.0 - umap-learn - plotly - - python-kaleido - - r-base ==4.2.2 + - r-ggraph ==2.1.0 - r-seurat ==4.3.0 - r-seuratobject ==4.1.3 - r-matrix <=1.5_4.1 - - r-igraph ==1.3.4 + - r-igraph - r-ggraph ==2.1.0 - r-clustree ==0.5.0 - r-dbplyr <=2.3.2 - r-ggthemes + - r-gplots - r-viridis - r-librarian - r-patchwork @@ -69,22 +70,9 @@ requirements: - r-r.utils - r-spdep - r-hdf5r - - r-monocle3 - r-rsvd - r-cowplot - r-randomcolor - - bioconductor-rhdf5lib - - bioconductor-clusterprofiler ==4.6.0 - - bioconductor-scater ==1.26.0 - - bioconductor-limma - - bioconductor-complexheatmap - - bioconductor-topgo - - bioconductor-org.hs.eg.db - - bioconductor-miqc - - bioconductor-rhdf5lib - - bioconductor-singler - - bioconductor-celldex - - bioconductor-enhancedvolcano - geos ==3.11.1 - cmake - hdf5 @@ -92,11 +80,12 @@ requirements: - r-xml - bedtools - samtools - - pandoc - kraken2 - - scanpy >=1.9.1 + - scanpy ==1.9.1 - openblas ==0.3.21 + - fastp + test: imports: - cellsnake diff --git a/recipes/cenote-taker3/meta.yaml b/recipes/cenote-taker3/meta.yaml index 6717368a52f63..63206767586a6 100644 --- a/recipes/cenote-taker3/meta.yaml +++ b/recipes/cenote-taker3/meta.yaml @@ -1,5 +1,5 @@ {% set name = "cenote-taker3" %} -{% set version = "3.2.0" %} +{% set version = "3.3.1" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://github.com/mtisza1/{{ name }}/archive/v{{ version }}.tar.gz" - sha256: fe28c66009a4b1ee6755fbabcfbe5a8d0cba985977818155d6aefd0324ea9f95 + sha256: ce595208f3d925f7798e579b2d72b995b192eac802e24bb3d9d0a2ca856b5a99 build: number: 0 @@ -43,6 +43,8 @@ requirements: - sed - grep - samtools + - pandas + - pyarrow test: diff --git a/recipes/centrifuge-core/meta.yaml b/recipes/centrifuge-core/meta.yaml index dfb689b988214..5381ccdd5d741 100644 --- a/recipes/centrifuge-core/meta.yaml +++ b/recipes/centrifuge-core/meta.yaml @@ -1,16 +1,19 @@ {% set name = "centrifuge-core" %} -{% set version = "1.0.4" %} +{% set version = "1.0.4.1" %} package: name: {{ name|lower }} version: {{ version }} build: - number: 2 + number: 0 + skip: true # [osx] + run_exports: + - {{ pin_subpackage("centrifuge-core", max_pin="x.x") }} source: url: https://github.com/DaehwanKimLab/centrifuge/archive/refs/tags/v{{ version }}.tar.gz - sha256: 929daed0f84739f7636cc1ea2757527e83373f107107ffeb5937a403ba5201bc + sha256: 638cc6701688bfdf81173d65fa95332139e11b215b2d25c030f8ae873c34e5cc requirements: build: diff --git a/recipes/centrifuge/meta.yaml b/recipes/centrifuge/meta.yaml index 2156e793478fb..e3d21ca909841 100644 --- a/recipes/centrifuge/meta.yaml +++ b/recipes/centrifuge/meta.yaml @@ -1,16 +1,19 @@ {% set name = "centrifuge" %} -{% set version = "1.0.4" %} +{% set version = "1.0.4.1" %} package: name: {{ name|lower }} version: {{ version }} build: - number: 0 + number: 1 + skip: true # [osx] + run_exports: + - {{ pin_subpackage("centrifuge", max_pin="x.x") }} source: url: https://github.com/DaehwanKimLab/centrifuge/archive/refs/tags/v{{ version }}.tar.gz - sha256: 929daed0f84739f7636cc1ea2757527e83373f107107ffeb5937a403ba5201bc + sha256: 638cc6701688bfdf81173d65fa95332139e11b215b2d25c030f8ae873c34e5cc requirements: build: @@ -32,7 +35,8 @@ test: about: home: https://github.com/DaehwanKimLab/centrifuge license: GPL3 - summary: 'Classifier for metagenomic sequences.' + license_file: LICENSE + summary: 'Classifier for metagenomic sequences. Supports classifier scripts' extra: identifiers: diff --git a/recipes/centrifuge/patch b/recipes/centrifuge/patch new file mode 100644 index 0000000000000..5a968e69311d7 --- /dev/null +++ b/recipes/centrifuge/patch @@ -0,0 +1,13 @@ +diff --git a/processor_support.h b/processor_support.h +index f68ee65..135a768 100644 +--- a/processor_support.h ++++ b/processor_support.h +@@ -49,7 +49,7 @@ public: + #elif defined(USING_GCC_COMPILER) + __get_cpuid(0x1, ®s.EAX, ®s.EBX, ®s.ECX, ®s.EDX); + #else +- std::cerr << “ERROR: please define __cpuid() for this build.\n”; ++ std::cerr << "ERROR: please define __cpuid() for this build.\n"; + assert(0); + #endif + if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; \ No newline at end of file diff --git a/recipes/centrifuger/meta.yaml b/recipes/centrifuger/meta.yaml index a25ea6d2ebf32..c43cddff49074 100644 --- a/recipes/centrifuger/meta.yaml +++ b/recipes/centrifuger/meta.yaml @@ -1,5 +1,5 @@ {% set name = "centrifuger" %} -{% set version = "1.0.0" %} +{% set version = "1.0.2" %} package: name: {{ name|lower }} @@ -12,7 +12,7 @@ build: source: url: https://github.com/mourisl/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz - sha256: 88d8e9031caa9298a2ea0c3a7a4d4a8a2a569dcc32cf6f795a13cdf03612aa49 + sha256: b26e47c862fd5f2ac3a4e2cad13dcae0de5470c4875e16a2dc6f0948b53c9a9c requirements: build: diff --git a/recipes/cgat-apps/meta.yaml b/recipes/cgat-apps/meta.yaml index a31ea03d5e61f..fa2fc24eb1ff5 100644 --- a/recipes/cgat-apps/meta.yaml +++ b/recipes/cgat-apps/meta.yaml @@ -1,17 +1,19 @@ -{% set version = "0.6.5" %} +{% set name = "cgat-apps" %} +{% set version = "0.7.2" %} package: - name: cgat-apps + name: {{ name|lower }} version: {{ version }} source: url: https://pypi.io/packages/source/c/cgat/cgat-{{ version }}.tar.gz - sha256: c2350e2e1e6897839537b0ed17b4a03140141d0f0c15cb804e6e7aa12e2d2b70 + sha256: 746701d1a6677e8200092894c35c942383123fd8e22ab172f3ef6b2222b8eaef build: - skip: True # [py2k or py == 39 or py == 36] - number: 3 + number: 1 + run_exports: + - {{ pin_subpackage('cgat-apps', max_pin="x.x") }} entry_points: - cgat = cgat.cgat:main @@ -23,34 +25,29 @@ requirements: - python - cython - numpy - - pysam>=0.17.0 + - pysam - htslib - setuptools - - ucsc-wigtobigwig run: - python - - cgatcore>=0.6.5 + - cgatcore - alignlib-lite - biopython - - future - matplotlib-base - numpy - pandas - pybedtools - pybigwig - - pysam>=0.17.0 + - pysam - htslib - pyyaml - quicksect - scipy - - six - - jinja2 - scikit-learn - sortedcontainers # Misc dependencies - bedtools - ucsc-bedgraphtobigwig - - ucsc-bedtobigbed - ucsc-wigtobigwig - coreutils - grep diff --git a/recipes/cgatcore/meta.yaml b/recipes/cgatcore/meta.yaml index c654b1ae42507..2dfaeabb0c6ac 100644 --- a/recipes/cgatcore/meta.yaml +++ b/recipes/cgatcore/meta.yaml @@ -1,5 +1,5 @@ {% set name = "cgatcore" %} -{% set version = "0.6.15" %} +{% set version = "0.6.16" %} package: name: {{ name|lower }} @@ -7,11 +7,13 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: a8a4e5867ae327307cbd49118d52add5ec7429d9ac1ac70f5189eff997f40360 + sha256: ae32907ff806829fa2389c6e27e658097c0a8dab1e4bed4123d9f85f4ba04be0 build: number: 0 noarch: python + run_exports: + - {{ pin_subpackage('cgatcore', max_pin="x.x") }} script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed --no-cache-dir -vvv" requirements: diff --git a/recipes/cgelib/meta.yaml b/recipes/cgelib/meta.yaml new file mode 100644 index 0000000000000..ddbcd260e9cc1 --- /dev/null +++ b/recipes/cgelib/meta.yaml @@ -0,0 +1,39 @@ +{% set name = "cgelib" %} +{% set version = "0.7.4" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/cgelib-{{ version }}.tar.gz + sha256: 213181bba24856ec367bdfd1e4615eeefff88243f8d29ad9446150927a434aed + +build: + number: 0 + noarch: python + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + run_exports: + - {{ pin_subpackage('cgelib', max_pin="x.x") }} + +requirements: + host: + - python >=3.6 + - pip + - wheel + run: + - python >=3.6 + - python-dateutil + - gitpython + +test: + imports: + - cgelib + +about: + home: https://genomicepidemiology.org/ + summary: "This package will in time replace the cgecore package. The package contains classes and functions intended to be utilized across the CGE tools." + license: Apache-2.0 + license_family: APACHE + license_file: LICENSE.txt + dev_url: https://bitbucket.org/genomicepidemiology/cgelib diff --git a/recipes/cgt/meta.yaml b/recipes/cgt/meta.yaml new file mode 100644 index 0000000000000..9afec628b546a --- /dev/null +++ b/recipes/cgt/meta.yaml @@ -0,0 +1,31 @@ +{% set name = "cgt" %} +{% set version = "1.0.0" %} + +package: + name: {{ name|lower}} + version: {{ version }} + +source: + url: https://github.com/bacpop/{{ name }}/archive/v{{ version }}.tar.gz + sha256: d79750878e45853e46a3e991e8f7274a2de248bca58476b2be7e527caac3ab2b + +build: + number: 0 + script: "cargo install --no-track --locked --verbose --root \"${PREFIX}\" --path ." + run_exports: + - {{ pin_subpackage("cgt", max_pin="x") }} + +requirements: + build: + - {{ compiler('rust') }} + +test: + commands: + - cgt_bacpop -V + +about: + home: https://github.com/bacpop/cgt + license: Apache-2.0 + license_family: APACHE + license_file: LICENSE.txt + summary: Calculate a core genome threshold (cgt) from metagenome data diff --git a/recipes/checkatlas/meta.yaml b/recipes/checkatlas/meta.yaml index 200cb63dfda15..3baabf8a06abf 100644 --- a/recipes/checkatlas/meta.yaml +++ b/recipes/checkatlas/meta.yaml @@ -1,5 +1,5 @@ {% set name = "checkatlas" %} -{% set version = "0.4.2" %} +{% set version = "0.4.17" %} package: name: "{{ name|lower }}" @@ -7,34 +7,28 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 2bf72a64d383d260dfd33c17f7d823f303973947b339fd32ee39e2a8d54ec241 + sha256: 3b831f58142cfd3a51fbf0df6a88e588d04f3df40a2a33a69cab7e8d6785b179 build: number: 0 entry_points: - checkatlas = checkatlas.__main__:main - checkatlas-workflow = checkatlas.checkatlas_workflow:main - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" noarch: python + run_exports: + - {{ pin_subpackage('checkatlas', max_pin="x.x") }} requirements: host: - - llvmlite >=0.39.1,<0.40.0 - - numba >=0.56.4,<0.57.0 - - numpy >=1.23.5,<2.0.0 - pip - - poetry >=1.5.1,<2.0.0 + - poetry-core >=1.5.1,<2.0.0 - python >=3.10 - - rpy2 ==3.5.10 - - scanpy >=1.9.1,<2.0.0 - - scikit-learn >=1.2.1,<2.0.0 - - types-pyyaml >=6.0.12.6,<7.0.0.0 run: + - python >=3.10 - llvmlite >=0.39.1,<0.40.0 - numba >=0.56.4,<0.57.0 - numpy >=1.23.5,<2.0.0 - - poetry >=1.5.1,<2.0.0 - - python >=3.10 - rpy2 ==3.5.10 - scanpy >=1.9.1,<2.0.0 - scikit-learn >=1.2.1,<2.0.0 diff --git a/recipes/checkqc/meta.yaml b/recipes/checkqc/meta.yaml index 4192646a5e34c..1def5f9605dfb 100644 --- a/recipes/checkqc/meta.yaml +++ b/recipes/checkqc/meta.yaml @@ -1,5 +1,5 @@ {% set name = "checkQC" %} -{% set version = "3.8.2" %} +{% set version = "4.0.1" %} package: name: "{{ name|lower }}" @@ -7,10 +7,10 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 3aeb234d64aede3377f33b7573eb4719d7c665d68985e8713b16159a1be87988 + sha256: 03bc01d96d45c4c1a0e07d410a6f3ec74c0fab0f7125434ca3d983e70d4d568a build: - number: 1 + number: 0 noarch: python entry_points: - checkqc = checkQC.app:start @@ -24,12 +24,14 @@ requirements: - pip - python >=3.6,<3.11 run: + - python >=3.6,<3.11 - click >=8.1.1 - PyYAML >=6.0 - illumina-interop >=1.2.4 - xmltodict >=0.13.0 - tornado >=6.3.2 - sample-sheet >=0.13.0 + test: imports: - checkQC @@ -45,6 +47,8 @@ about: license_family: GPL3 license_file: LICENSE summary: "A simple program to parse Illumina NGS data and check it for quality criteria." + doc_url: "https://checkqc.readthedocs.io/en/latest/" + dev_url: "https://www.github.com/Molmed/checkQC" extra: recipe-maintainers: diff --git a/recipes/checkv/meta.yaml b/recipes/checkv/meta.yaml index 50aa0beb676aa..544e4afbcee9f 100644 --- a/recipes/checkv/meta.yaml +++ b/recipes/checkv/meta.yaml @@ -1,5 +1,5 @@ {% set name = "checkv" %} -{% set version = "1.0.1" %} +{% set version = "1.0.3" %} package: name: "{{ name|lower }}" @@ -7,27 +7,31 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: c32b93e67ba92cd64e9214754d96c527152bda4cd06cc8214afe68130c33ea6e + sha256: 2438516f270191267a9860dfe31bf596d64a4fbc16be922b46fb6a4fd98d762a build: number: 0 noarch: python + script: "{{ PYTHON }} -m pip install . -vv" entry_points: - checkv=checkv.cli:cli - script: "{{ PYTHON }} -m pip install . -vv" + run_exports: + - {{ pin_subpackage("checkv", max_pin="x") }} requirements: host: - python >=3.6 - pip + - flit-core >=3.2,<4 run: - python >=3.6 - biopython - importlib-metadata >=0.12 - numpy - psutil + - requests - kcounter - - diamond + - diamond <=2.1.8 - hmmer - prodigal-gv diff --git a/recipes/chewbbaca/meta.yaml b/recipes/chewbbaca/meta.yaml index fae78e05f24ed..8d41f613a5ce0 100644 --- a/recipes/chewbbaca/meta.yaml +++ b/recipes/chewbbaca/meta.yaml @@ -1,13 +1,15 @@ {% set name = 'chewBBACA' %} -{% set version = '3.3.2' %} +{% set version = '3.3.5' %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 4e282320ce8b6b3b6e71d2db8961911c523d970f8b06e16c7c42b2aff0ae5f03 + url: https://github.com/B-UMMI/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + # url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: 6cf063286b55f55e33f75789eb5beaa59a1b7ca454f1a8bd89bb84a67aef1cde + # sha256: b54c5f4fb2f3c943f9ec51e5b81f4fb9a312fcc87fdea6e0a9f3edbebdf62308 build: number: 0 @@ -27,8 +29,8 @@ requirements: - python >=3.7 - numpy >=1.24.3 - scipy >=1.10.1 - - biopython >=1.78 - - pandas >=1.5.1 + - biopython >=1.79 + - pandas >=1.5.1,<2.1 - plotly >=5.8.0 - requests >=2.27.1 - sparqlwrapper >=2.0.0 diff --git a/recipes/chopper/meta.yaml b/recipes/chopper/meta.yaml index d48214ed8d874..d3d1d006ac7f4 100644 --- a/recipes/chopper/meta.yaml +++ b/recipes/chopper/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.7.0" %} +{% set version = "0.8.0" %} package: name: chopper @@ -11,7 +11,7 @@ build: source: url: https://github.com/wdecoster/chopper/archive/v{{ version }}.tar.gz - sha256: ff7e718084d16d4fa8ec40ede655d87dad5097e3e0f2d10cb278bcced02b586c + sha256: d79c3a3af8daf9e81f4a209061629e823a3cb0275ff13f9f7e800b9f62c19bab requirements: build: diff --git a/recipes/chromap/meta.yaml b/recipes/chromap/meta.yaml index 1805040802a97..05010a6f787c2 100644 --- a/recipes/chromap/meta.yaml +++ b/recipes/chromap/meta.yaml @@ -1,15 +1,17 @@ -{% set version = "0.2.5" %} +{% set version = "0.2.6" %} package: name: chromap version: {{ version }} build: - number: 2 + number: 0 + run_exports: + - {{ pin_subpackage('chromap', max_pin="x.x") }} source: url: https://github.com/haowenz/chromap/archive/refs/tags/v{{ version }}.tar.gz - sha256: 9cc77d7412304d41a0a419ba1da11e6794c1dab73cee2e2d71957376b1ddbc7a + sha256: bea2fc76bd7d8931f69db0b63aef19e50070b24c0ab1415569b59d490fff42e8 requirements: build: @@ -28,6 +30,8 @@ test: about: home: https://github.com/haowenz/chromap - license: GPL-3.0 + license: MIT + license_family: MIT license_file: LICENSE summary: Fast alignment and preprocessing of chromatin profiles + doc_url: https://zhanghaowen.com/chromap/ diff --git a/recipes/chromograph/meta.yaml b/recipes/chromograph/meta.yaml index 17ef1fb5263cb..559bb6398e177 100644 --- a/recipes/chromograph/meta.yaml +++ b/recipes/chromograph/meta.yaml @@ -7,8 +7,10 @@ package: build: noarch: python - number: 1 + number: 2 script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed --no-cache-dir -vvv" + run_exports: + - {{ pin_subpackage('chromograph', max_pin="x.x") }} source: url: https://github.com/Clinical-Genomics/chromograph/archive/refs/tags/v{{version}}.tar.gz @@ -16,11 +18,11 @@ source: requirements: host: - - python >=3.7,<3.10 + - python ==3.9 - pip run: - - python >=3.7,<3.10 - - matplotlib-base + - python ==3.9 + - matplotlib-base ==3.5.3 - numpy >=1.15 - pyaml - pandas diff --git a/recipes/circulocov/meta.yaml b/recipes/circulocov/meta.yaml new file mode 100644 index 0000000000000..ac4cd3556ab77 --- /dev/null +++ b/recipes/circulocov/meta.yaml @@ -0,0 +1,51 @@ +{% set name = "circulocov" %} +{% set version = "0.1.20240104" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: 6c585c90e63ff5ce4028157cb7f943f4abb679234daadb0349778bfb8141cd87 + +build: + number: 0 + noarch: python + entry_points: + - circulocov=circulocov.circulocov:main + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('circulocov', max_pin='x') }} + +requirements: + host: + - python >=3.8,<4.0 + - pip + run: + - python >=3.8,<4.0 + - matplotlib-base >=3.8.2 + - biopython >=1.58 + - numpy >=1.26.2 + - pandas >=2.1.4 + - pysam >=0.22.0 + - pycirclize >=1.3.0 + - minimap2 >=2.25 + +test: + imports: + - circulocov + commands: + - circulocov --help + +about: + home: https://github.com/erinyoung/CirculoCov + license: GPL-3.0 + license_family: GPL + license_file: LICENSE + summary: CirculoCov is a Python tool designed for circular-aware coverage analysis of draft genomes + doc_url: https://github.com/erinyoung/CirculoCov/blob/main/README.md + +extra: + recipe-maintainers: + - erinyoung diff --git a/recipes/civicpy/meta.yaml b/recipes/civicpy/meta.yaml index e757499136520..d4efb9149751d 100644 --- a/recipes/civicpy/meta.yaml +++ b/recipes/civicpy/meta.yaml @@ -1,5 +1,5 @@ {% set name = "civicpy" %} -{% set version = "3.0.0" %} +{% set version = "3.1.0" %} package: name: "{{ name|lower }}" @@ -7,29 +7,23 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 6aa80d2e37718b6a646a2adee5d2432f1a8fa87d6d13fd6e3de11a6834a0ba77 + sha256: 1e9d5a36dff490c5a806cfc152c5f998ba13a54e409cb72eff392dc2ada14537 build: number: 0 - noarch: generic + noarch: python entry_points: - civicpy=civicpy.cli:cli - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('civicpy', max_pin="x") }} requirements: - host: - - backports-datetime-fromisoformat =2.0.0 - - click - - deprecation - - networkx - - obonet =0.2.3 - - pandas + host: - pip - - pysam - python >=3.5 - - requests - - vcfpy run: + - python >=3.5 - backports-datetime-fromisoformat =2.0.0 - click - deprecation @@ -37,7 +31,6 @@ requirements: - obonet =0.2.3 - pandas - pysam - - python >=3.5 - requests - vcfpy diff --git a/recipes/clair3-illumina/build.sh b/recipes/clair3-illumina/build.sh index 91ce406b0b6f3..63c71150a4330 100755 --- a/recipes/clair3-illumina/build.sh +++ b/recipes/clair3-illumina/build.sh @@ -5,7 +5,3 @@ cp -rv preprocess/realign $PREFIX/bin/preprocess cd $PREFIX/bin/preprocess/realign $CXX -std=c++14 -O1 -shared -fPIC -o realigner ssw_cpp.cpp ssw.c realigner.cpp $CXX -std=c++11 -shared -fPIC -o debruijn_graph -O3 debruijn_graph.cpp -I $PREFIX/include -L $PREFIX/lib - - - - diff --git a/recipes/clair3-illumina/meta.yaml b/recipes/clair3-illumina/meta.yaml index 0f7f70a0be418..08b0896dac355 100644 --- a/recipes/clair3-illumina/meta.yaml +++ b/recipes/clair3-illumina/meta.yaml @@ -1,5 +1,5 @@ {% set name = "clair3-illumina" %} -{% set version = "1.0.5" %} +{% set version = "1.0.7" %} package: name: {{ name }} @@ -7,13 +7,14 @@ package: source: url: https://github.com/HKU-BAL/Clair3/archive/refs/tags/v{{ version }}.zip - sha256: 515129dace446d48a58e7f156d40ce09eb8ef15484661e0b7ff53fe83e5ac40a + sha256: 4c48146a1a9c0af547444719f443f8f536f5ce51b2f0c426107ef4288b31a4f2 build: number: 0 skip: True # [osx] run_exports: - - {{ pin_subpackage(name, max_pin="x.x") }} + - {{ pin_subpackage(name, max_pin="x") }} + requirements: build: - {{ compiler('cxx') }} @@ -21,6 +22,7 @@ requirements: - boost-cpp run: - clair3 + test: imports: - tensorflow @@ -31,5 +33,11 @@ test: about: home: 'https://github.com/HKU-BAL/Clair3' license: BSD-3-Clause + license_family: BSD license_file: LICENSE.md summary: "Clair3 with libraries to support variant calling using Illumina short-reads. Version in sync with Clair3." + dev_url: 'https://github.com/HKU-BAL/Clair3' + +extra: + identifiers: + - doi:10.1038/s43588-022-00387-x diff --git a/recipes/clair3/meta.yaml b/recipes/clair3/meta.yaml index 057a47b092a51..604a052449a64 100644 --- a/recipes/clair3/meta.yaml +++ b/recipes/clair3/meta.yaml @@ -1,5 +1,5 @@ {% set name = "clair3" %} -{% set version = "1.0.5" %} +{% set version = "1.0.7" %} package: name: {{ name }} @@ -7,10 +7,10 @@ package: source: url: http://www.bio8.cs.hku.hk/clair3/bioconda/Clair3_v{{ version }}.zip - sha256: 05ba9b4de25753ef1f20f0199521672d6d5a4f986d1b2b5d7dc77e5c4bcd3b9a + sha256: b34bf1e722dc86a1c5362b4d8aa788a177d998f66c53b6d4ba709962f0926cc4 build: - number: 0 + number: 1 skip: True # [osx] run_exports: - {{ pin_subpackage(name, max_pin="x") }} diff --git a/recipes/clipkit/meta.yaml b/recipes/clipkit/meta.yaml index 561c6ffd1651e..f1259b6f9302f 100644 --- a/recipes/clipkit/meta.yaml +++ b/recipes/clipkit/meta.yaml @@ -1,5 +1,5 @@ {% set name = "clipkit" %} -{% set version = "2.1.1" %} +{% set version = "2.3.0" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 21120216b1211db5dfbd97e575af882072e90065872aefdf1b34d55544ea881c + sha256: 6e4f39f7b0e99b89de17aa57a26d1a7c6a1c064203b4fd436b413ad7d2e57ce5 build: number: 0 diff --git a/recipes/clippy/meta.yaml b/recipes/clippy/meta.yaml index d0948b1f86c5b..53f2af39d28f4 100644 --- a/recipes/clippy/meta.yaml +++ b/recipes/clippy/meta.yaml @@ -10,29 +10,33 @@ source: sha256: 1fc00fd3df22524cb28974b7aae2d5fc20c6c23c5b84312dbc09ea275cebcf86 build: - number: 0 + number: 1 entry_points: - clippy = clip:main script: "{{ PYTHON }} -m pip install . -vv --ignore-installed --no-deps" noarch: python + run_exports: + - {{ pin_subpackage("clippy", max_pin='x.x') }} requirements: host: - pip - - python>=3.8 + - python >=3.8 + - openssl run: - - python>=3.8 - - bedtools=2.26.0 - - numpy>=1.19.0,<1.20.3 - - numpy-base>=1.19.0,<1.20.3 + - python >=3.8 + - bedtools =2.26.0 + - samtools =1.9 + - openssl + - numpy >=1.19.0,<1.20.3 - numpydoc - pandas - pybedtools - scipy - matplotlib-base - - dash=1.20.0 - - dash-bootstrap-components=0.11.3 - - werkzeug=2.0.0 + - dash =1.20.0 + - dash-bootstrap-components =0.11.3 + - werkzeug =2.0.0 test: imports: diff --git a/recipes/clonalframeml/meta.yaml b/recipes/clonalframeml/meta.yaml index e90bef289093c..eb47de77ebb1c 100644 --- a/recipes/clonalframeml/meta.yaml +++ b/recipes/clonalframeml/meta.yaml @@ -1,13 +1,18 @@ +{% set name = "clonalframeml" %} +{% set version = "1.13" %} + package: - name: clonalframeml - version: "1.12" + name: {{ name }} + version: {{ version }} build: - number: 4 + number: 0 + run_exports: + - {{ pin_subpackage('clonalframeml', max_pin="x") }} source: - url: https://github.com/xavierdidelot/ClonalFrameML/archive/v1.12.tar.gz - sha256: ef76705c1a0f1343184f956cd0bdc96c2cfdbb998177330b09b6df84c74c2de6 + url: https://github.com/xavierdidelot/ClonalFrameML/archive/refs/tags/v{{ version }}.tar.gz + sha256: 6056109380c695020afa0c26f4ce49dcb9267f1a8f26dfb42629bfa63ac25e6e requirements: build: @@ -20,6 +25,8 @@ test: about: home: https://github.com/xavierdidelot/ClonalFrameML - license: GPLv3 + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE summary: Efficient inferencing of recombination in bacterial genomes - + doc_url: https://github.com/xavierdidelot/clonalframeml/wiki diff --git a/recipes/clustalw/build.sh b/recipes/clustalw/build.sh index d5c9f16d06afe..d7f3623f6c4d8 100644 --- a/recipes/clustalw/build.sh +++ b/recipes/clustalw/build.sh @@ -1,5 +1,8 @@ #!/bin/bash +# use newer config.guess and config.sub that support linux-aarch64 +cp ${RECIPE_DIR}/config.* . + mkdir -p ${PREFIX} ./configure --prefix=$PREFIX make install diff --git a/recipes/clustalw/config.guess b/recipes/clustalw/config.guess new file mode 100644 index 0000000000000..1972fda8eb05d --- /dev/null +++ b/recipes/clustalw/config.guess @@ -0,0 +1,1700 @@ +#! /bin/sh +# Attempt to guess a canonical system name. +# Copyright 1992-2021 Free Software Foundation, Inc. + +timestamp='2021-01-25' + +# This file is free software; you can redistribute it and/or modify it +# under the terms of the GNU General Public License as published by +# the Free Software Foundation; either version 3 of the License, or +# (at your option) any later version. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY; without even the implied warranty of +# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU +# General Public License for more details. +# +# You should have received a copy of the GNU General Public License +# along with this program; if not, see . +# +# As a special exception to the GNU General Public License, if you +# distribute this file as part of a program that contains a +# configuration script generated by Autoconf, you may include it under +# the same distribution terms that you use for the rest of that +# program. This Exception is an additional permission under section 7 +# of the GNU General Public License, version 3 ("GPLv3"). +# +# Originally written by Per Bothner; maintained since 2000 by Ben Elliston. +# +# You can get the latest version of this script from: +# https://git.savannah.gnu.org/cgit/config.git/plain/config.guess +# +# Please send patches to . + + +me=$(echo "$0" | sed -e 's,.*/,,') + +usage="\ +Usage: $0 [OPTION] + +Output the configuration name of the system \`$me' is run on. + +Options: + -h, --help print this help, then exit + -t, --time-stamp print date of last modification, then exit + -v, --version print version number, then exit + +Report bugs and patches to ." + +version="\ +GNU config.guess ($timestamp) + +Originally written by Per Bothner. +Copyright 1992-2021 Free Software Foundation, Inc. + +This is free software; see the source for copying conditions. There is NO +warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE." + +help=" +Try \`$me --help' for more information." + +# Parse command line +while test $# -gt 0 ; do + case $1 in + --time-stamp | --time* | -t ) + echo "$timestamp" ; exit ;; + --version | -v ) + echo "$version" ; exit ;; + --help | --h* | -h ) + echo "$usage"; exit ;; + -- ) # Stop option processing + shift; break ;; + - ) # Use stdin as input. + break ;; + -* ) + echo "$me: invalid option $1$help" >&2 + exit 1 ;; + * ) + break ;; + esac +done + +if test $# != 0; then + echo "$me: too many arguments$help" >&2 + exit 1 +fi + +# CC_FOR_BUILD -- compiler used by this script. Note that the use of a +# compiler to aid in system detection is discouraged as it requires +# temporary files to be created and, as you can see below, it is a +# headache to deal with in a portable fashion. + +# Historically, `CC_FOR_BUILD' used to be named `HOST_CC'. We still +# use `HOST_CC' if defined, but it is deprecated. + +# Portable tmp directory creation inspired by the Autoconf team. + +tmp= +# shellcheck disable=SC2172 +trap 'test -z "$tmp" || rm -fr "$tmp"' 0 1 2 13 15 + +set_cc_for_build() { + # prevent multiple calls if $tmp is already set + test "$tmp" && return 0 + : "${TMPDIR=/tmp}" + # shellcheck disable=SC2039 + { tmp=$( (umask 077 && mktemp -d "$TMPDIR/cgXXXXXX") 2>/dev/null) && test -n "$tmp" && test -d "$tmp" ; } || + { test -n "$RANDOM" && tmp=$TMPDIR/cg$$-$RANDOM && (umask 077 && mkdir "$tmp" 2>/dev/null) ; } || + { tmp=$TMPDIR/cg-$$ && (umask 077 && mkdir "$tmp" 2>/dev/null) && echo "Warning: creating insecure temp directory" >&2 ; } || + { echo "$me: cannot create a temporary directory in $TMPDIR" >&2 ; exit 1 ; } + dummy=$tmp/dummy + case ${CC_FOR_BUILD-},${HOST_CC-},${CC-} in + ,,) echo "int x;" > "$dummy.c" + for driver in cc gcc c89 c99 ; do + if ($driver -c -o "$dummy.o" "$dummy.c") >/dev/null 2>&1 ; then + CC_FOR_BUILD="$driver" + break + fi + done + if test x"$CC_FOR_BUILD" = x ; then + CC_FOR_BUILD=no_compiler_found + fi + ;; + ,,*) CC_FOR_BUILD=$CC ;; + ,*,*) CC_FOR_BUILD=$HOST_CC ;; + esac +} + +# This is needed to find uname on a Pyramid OSx when run in the BSD universe. +# (ghazi@noc.rutgers.edu 1994-08-24) +if test -f /.attbin/uname ; then + PATH=$PATH:/.attbin ; export PATH +fi + +UNAME_MACHINE=$( (uname -m) 2>/dev/null) || UNAME_MACHINE=unknown +UNAME_RELEASE=$( (uname -r) 2>/dev/null) || UNAME_RELEASE=unknown +UNAME_SYSTEM=$( (uname -s) 2>/dev/null) || UNAME_SYSTEM=unknown +UNAME_VERSION=$( (uname -v) 2>/dev/null) || UNAME_VERSION=unknown + +case "$UNAME_SYSTEM" in +Linux|GNU|GNU/*) + LIBC=unknown + + set_cc_for_build + cat <<-EOF > "$dummy.c" + #include + #if defined(__UCLIBC__) + LIBC=uclibc + #elif defined(__dietlibc__) + LIBC=dietlibc + #elif defined(__GLIBC__) + LIBC=gnu + #else + #include + /* First heuristic to detect musl libc. */ + #ifdef __DEFINED_va_list + LIBC=musl + #endif + #endif + EOF + eval "$($CC_FOR_BUILD -E "$dummy.c" 2>/dev/null | grep '^LIBC' | sed 's, ,,g')" + + # Second heuristic to detect musl libc. + if [ "$LIBC" = unknown ] && + command -v ldd >/dev/null && + ldd --version 2>&1 | grep -q ^musl; then + LIBC=musl + fi + + # If the system lacks a compiler, then just pick glibc. + # We could probably try harder. + if [ "$LIBC" = unknown ]; then + LIBC=gnu + fi + ;; +esac + +# Note: order is significant - the case branches are not exclusive. + +case "$UNAME_MACHINE:$UNAME_SYSTEM:$UNAME_RELEASE:$UNAME_VERSION" in + *:NetBSD:*:*) + # NetBSD (nbsd) targets should (where applicable) match one or + # more of the tuples: *-*-netbsdelf*, *-*-netbsdaout*, + # *-*-netbsdecoff* and *-*-netbsd*. For targets that recently + # switched to ELF, *-*-netbsd* would select the old + # object file format. This provides both forward + # compatibility and a consistent mechanism for selecting the + # object file format. + # + # Note: NetBSD doesn't particularly care about the vendor + # portion of the name. We always set it to "unknown". + UNAME_MACHINE_ARCH=$( (uname -p 2>/dev/null || \ + /sbin/sysctl -n hw.machine_arch 2>/dev/null || \ + /usr/sbin/sysctl -n hw.machine_arch 2>/dev/null || \ + echo unknown)) + case "$UNAME_MACHINE_ARCH" in + aarch64eb) machine=aarch64_be-unknown ;; + armeb) machine=armeb-unknown ;; + arm*) machine=arm-unknown ;; + sh3el) machine=shl-unknown ;; + sh3eb) machine=sh-unknown ;; + sh5el) machine=sh5le-unknown ;; + earmv*) + arch=$(echo "$UNAME_MACHINE_ARCH" | sed -e 's,^e\(armv[0-9]\).*$,\1,') + endian=$(echo "$UNAME_MACHINE_ARCH" | sed -ne 's,^.*\(eb\)$,\1,p') + machine="${arch}${endian}"-unknown + ;; + *) machine="$UNAME_MACHINE_ARCH"-unknown ;; + esac + # The Operating System including object format, if it has switched + # to ELF recently (or will in the future) and ABI. + case "$UNAME_MACHINE_ARCH" in + earm*) + os=netbsdelf + ;; + arm*|i386|m68k|ns32k|sh3*|sparc|vax) + set_cc_for_build + if echo __ELF__ | $CC_FOR_BUILD -E - 2>/dev/null \ + | grep -q __ELF__ + then + # Once all utilities can be ECOFF (netbsdecoff) or a.out (netbsdaout). + # Return netbsd for either. FIX? + os=netbsd + else + os=netbsdelf + fi + ;; + *) + os=netbsd + ;; + esac + # Determine ABI tags. + case "$UNAME_MACHINE_ARCH" in + earm*) + expr='s/^earmv[0-9]/-eabi/;s/eb$//' + abi=$(echo "$UNAME_MACHINE_ARCH" | sed -e "$expr") + ;; + esac + # The OS release + # Debian GNU/NetBSD machines have a different userland, and + # thus, need a distinct triplet. However, they do not need + # kernel version information, so it can be replaced with a + # suitable tag, in the style of linux-gnu. + case "$UNAME_VERSION" in + Debian*) + release='-gnu' + ;; + *) + release=$(echo "$UNAME_RELEASE" | sed -e 's/[-_].*//' | cut -d. -f1,2) + ;; + esac + # Since CPU_TYPE-MANUFACTURER-KERNEL-OPERATING_SYSTEM: + # contains redundant information, the shorter form: + # CPU_TYPE-MANUFACTURER-OPERATING_SYSTEM is used. + echo "$machine-${os}${release}${abi-}" + exit ;; + *:Bitrig:*:*) + UNAME_MACHINE_ARCH=$(arch | sed 's/Bitrig.//') + echo "$UNAME_MACHINE_ARCH"-unknown-bitrig"$UNAME_RELEASE" + exit ;; + *:OpenBSD:*:*) + UNAME_MACHINE_ARCH=$(arch | sed 's/OpenBSD.//') + echo "$UNAME_MACHINE_ARCH"-unknown-openbsd"$UNAME_RELEASE" + exit ;; + *:LibertyBSD:*:*) + UNAME_MACHINE_ARCH=$(arch | sed 's/^.*BSD\.//') + echo "$UNAME_MACHINE_ARCH"-unknown-libertybsd"$UNAME_RELEASE" + exit ;; + *:MidnightBSD:*:*) + echo "$UNAME_MACHINE"-unknown-midnightbsd"$UNAME_RELEASE" + exit ;; + *:ekkoBSD:*:*) + echo "$UNAME_MACHINE"-unknown-ekkobsd"$UNAME_RELEASE" + exit ;; + *:SolidBSD:*:*) + echo "$UNAME_MACHINE"-unknown-solidbsd"$UNAME_RELEASE" + exit ;; + *:OS108:*:*) + echo "$UNAME_MACHINE"-unknown-os108_"$UNAME_RELEASE" + exit ;; + macppc:MirBSD:*:*) + echo powerpc-unknown-mirbsd"$UNAME_RELEASE" + exit ;; + *:MirBSD:*:*) + echo "$UNAME_MACHINE"-unknown-mirbsd"$UNAME_RELEASE" + exit ;; + *:Sortix:*:*) + echo "$UNAME_MACHINE"-unknown-sortix + exit ;; + *:Twizzler:*:*) + echo "$UNAME_MACHINE"-unknown-twizzler + exit ;; + *:Redox:*:*) + echo "$UNAME_MACHINE"-unknown-redox + exit ;; + mips:OSF1:*.*) + echo mips-dec-osf1 + exit ;; + alpha:OSF1:*:*) + case $UNAME_RELEASE in + *4.0) + UNAME_RELEASE=$(/usr/sbin/sizer -v | awk '{print $3}') + ;; + *5.*) + UNAME_RELEASE=$(/usr/sbin/sizer -v | awk '{print $4}') + ;; + esac + # According to Compaq, /usr/sbin/psrinfo has been available on + # OSF/1 and Tru64 systems produced since 1995. I hope that + # covers most systems running today. This code pipes the CPU + # types through head -n 1, so we only detect the type of CPU 0. + ALPHA_CPU_TYPE=$(/usr/sbin/psrinfo -v | sed -n -e 's/^ The alpha \(.*\) processor.*$/\1/p' | head -n 1) + case "$ALPHA_CPU_TYPE" in + "EV4 (21064)") + UNAME_MACHINE=alpha ;; + "EV4.5 (21064)") + UNAME_MACHINE=alpha ;; + "LCA4 (21066/21068)") + UNAME_MACHINE=alpha ;; + "EV5 (21164)") + UNAME_MACHINE=alphaev5 ;; + "EV5.6 (21164A)") + UNAME_MACHINE=alphaev56 ;; + "EV5.6 (21164PC)") + UNAME_MACHINE=alphapca56 ;; + "EV5.7 (21164PC)") + UNAME_MACHINE=alphapca57 ;; + "EV6 (21264)") + UNAME_MACHINE=alphaev6 ;; + "EV6.7 (21264A)") + UNAME_MACHINE=alphaev67 ;; + "EV6.8CB (21264C)") + UNAME_MACHINE=alphaev68 ;; + "EV6.8AL (21264B)") + UNAME_MACHINE=alphaev68 ;; + "EV6.8CX (21264D)") + UNAME_MACHINE=alphaev68 ;; + "EV6.9A (21264/EV69A)") + UNAME_MACHINE=alphaev69 ;; + "EV7 (21364)") + UNAME_MACHINE=alphaev7 ;; + "EV7.9 (21364A)") + UNAME_MACHINE=alphaev79 ;; + esac + # A Pn.n version is a patched version. + # A Vn.n version is a released version. + # A Tn.n version is a released field test version. + # A Xn.n version is an unreleased experimental baselevel. + # 1.2 uses "1.2" for uname -r. + echo "$UNAME_MACHINE"-dec-osf"$(echo "$UNAME_RELEASE" | sed -e 's/^[PVTX]//' | tr ABCDEFGHIJKLMNOPQRSTUVWXYZ abcdefghijklmnopqrstuvwxyz)" + # Reset EXIT trap before exiting to avoid spurious non-zero exit code. + exitcode=$? + trap '' 0 + exit $exitcode ;; + Amiga*:UNIX_System_V:4.0:*) + echo m68k-unknown-sysv4 + exit ;; + *:[Aa]miga[Oo][Ss]:*:*) + echo "$UNAME_MACHINE"-unknown-amigaos + exit ;; + *:[Mm]orph[Oo][Ss]:*:*) + echo "$UNAME_MACHINE"-unknown-morphos + exit ;; + *:OS/390:*:*) + echo i370-ibm-openedition + exit ;; + *:z/VM:*:*) + echo s390-ibm-zvmoe + exit ;; + *:OS400:*:*) + echo powerpc-ibm-os400 + exit ;; + arm:RISC*:1.[012]*:*|arm:riscix:1.[012]*:*) + echo arm-acorn-riscix"$UNAME_RELEASE" + exit ;; + arm*:riscos:*:*|arm*:RISCOS:*:*) + echo arm-unknown-riscos + exit ;; + SR2?01:HI-UX/MPP:*:* | SR8000:HI-UX/MPP:*:*) + echo hppa1.1-hitachi-hiuxmpp + exit ;; + Pyramid*:OSx*:*:* | MIS*:OSx*:*:* | MIS*:SMP_DC-OSx*:*:*) + # akee@wpdis03.wpafb.af.mil (Earle F. Ake) contributed MIS and NILE. + if test "$( (/bin/universe) 2>/dev/null)" = att ; then + echo pyramid-pyramid-sysv3 + else + echo pyramid-pyramid-bsd + fi + exit ;; + NILE*:*:*:dcosx) + echo pyramid-pyramid-svr4 + exit ;; + DRS?6000:unix:4.0:6*) + echo sparc-icl-nx6 + exit ;; + DRS?6000:UNIX_SV:4.2*:7* | DRS?6000:isis:4.2*:7*) + case $(/usr/bin/uname -p) in + sparc) echo sparc-icl-nx7; exit ;; + esac ;; + s390x:SunOS:*:*) + echo "$UNAME_MACHINE"-ibm-solaris2"$(echo "$UNAME_RELEASE" | sed -e 's/[^.]*//')" + exit ;; + sun4H:SunOS:5.*:*) + echo sparc-hal-solaris2"$(echo "$UNAME_RELEASE"|sed -e 's/[^.]*//')" + exit ;; + sun4*:SunOS:5.*:* | tadpole*:SunOS:5.*:*) + echo sparc-sun-solaris2"$(echo "$UNAME_RELEASE" | sed -e 's/[^.]*//')" + exit ;; + i86pc:AuroraUX:5.*:* | i86xen:AuroraUX:5.*:*) + echo i386-pc-auroraux"$UNAME_RELEASE" + exit ;; + i86pc:SunOS:5.*:* | i86xen:SunOS:5.*:*) + set_cc_for_build + SUN_ARCH=i386 + # If there is a compiler, see if it is configured for 64-bit objects. + # Note that the Sun cc does not turn __LP64__ into 1 like gcc does. + # This test works for both compilers. + if test "$CC_FOR_BUILD" != no_compiler_found; then + if (echo '#ifdef __amd64'; echo IS_64BIT_ARCH; echo '#endif') | \ + (CCOPTS="" $CC_FOR_BUILD -E - 2>/dev/null) | \ + grep IS_64BIT_ARCH >/dev/null + then + SUN_ARCH=x86_64 + fi + fi + echo "$SUN_ARCH"-pc-solaris2"$(echo "$UNAME_RELEASE"|sed -e 's/[^.]*//')" + exit ;; + sun4*:SunOS:6*:*) + # According to config.sub, this is the proper way to canonicalize + # SunOS6. Hard to guess exactly what SunOS6 will be like, but + # it's likely to be more like Solaris than SunOS4. + echo sparc-sun-solaris3"$(echo "$UNAME_RELEASE"|sed -e 's/[^.]*//')" + exit ;; + sun4*:SunOS:*:*) + case "$(/usr/bin/arch -k)" in + Series*|S4*) + UNAME_RELEASE=$(uname -v) + ;; + esac + # Japanese Language versions have a version number like `4.1.3-JL'. + echo sparc-sun-sunos"$(echo "$UNAME_RELEASE"|sed -e 's/-/_/')" + exit ;; + sun3*:SunOS:*:*) + echo m68k-sun-sunos"$UNAME_RELEASE" + exit ;; + sun*:*:4.2BSD:*) + UNAME_RELEASE=$( (sed 1q /etc/motd | awk '{print substr($5,1,3)}') 2>/dev/null) + test "x$UNAME_RELEASE" = x && UNAME_RELEASE=3 + case "$(/bin/arch)" in + sun3) + echo m68k-sun-sunos"$UNAME_RELEASE" + ;; + sun4) + echo sparc-sun-sunos"$UNAME_RELEASE" + ;; + esac + exit ;; + aushp:SunOS:*:*) + echo sparc-auspex-sunos"$UNAME_RELEASE" + exit ;; + # The situation for MiNT is a little confusing. The machine name + # can be virtually everything (everything which is not + # "atarist" or "atariste" at least should have a processor + # > m68000). The system name ranges from "MiNT" over "FreeMiNT" + # to the lowercase version "mint" (or "freemint"). Finally + # the system name "TOS" denotes a system which is actually not + # MiNT. But MiNT is downward compatible to TOS, so this should + # be no problem. + atarist[e]:*MiNT:*:* | atarist[e]:*mint:*:* | atarist[e]:*TOS:*:*) + echo m68k-atari-mint"$UNAME_RELEASE" + exit ;; + atari*:*MiNT:*:* | atari*:*mint:*:* | atarist[e]:*TOS:*:*) + echo m68k-atari-mint"$UNAME_RELEASE" + exit ;; + *falcon*:*MiNT:*:* | *falcon*:*mint:*:* | *falcon*:*TOS:*:*) + echo m68k-atari-mint"$UNAME_RELEASE" + exit ;; + milan*:*MiNT:*:* | milan*:*mint:*:* | *milan*:*TOS:*:*) + echo m68k-milan-mint"$UNAME_RELEASE" + exit ;; + hades*:*MiNT:*:* | hades*:*mint:*:* | *hades*:*TOS:*:*) + echo m68k-hades-mint"$UNAME_RELEASE" + exit ;; + *:*MiNT:*:* | *:*mint:*:* | *:*TOS:*:*) + echo m68k-unknown-mint"$UNAME_RELEASE" + exit ;; + m68k:machten:*:*) + echo m68k-apple-machten"$UNAME_RELEASE" + exit ;; + powerpc:machten:*:*) + echo powerpc-apple-machten"$UNAME_RELEASE" + exit ;; + RISC*:Mach:*:*) + echo mips-dec-mach_bsd4.3 + exit ;; + RISC*:ULTRIX:*:*) + echo mips-dec-ultrix"$UNAME_RELEASE" + exit ;; + VAX*:ULTRIX*:*:*) + echo vax-dec-ultrix"$UNAME_RELEASE" + exit ;; + 2020:CLIX:*:* | 2430:CLIX:*:*) + echo clipper-intergraph-clix"$UNAME_RELEASE" + exit ;; + mips:*:*:UMIPS | mips:*:*:RISCos) + set_cc_for_build + sed 's/^ //' << EOF > "$dummy.c" +#ifdef __cplusplus +#include /* for printf() prototype */ + int main (int argc, char *argv[]) { +#else + int main (argc, argv) int argc; char *argv[]; { +#endif + #if defined (host_mips) && defined (MIPSEB) + #if defined (SYSTYPE_SYSV) + printf ("mips-mips-riscos%ssysv\\n", argv[1]); exit (0); + #endif + #if defined (SYSTYPE_SVR4) + printf ("mips-mips-riscos%ssvr4\\n", argv[1]); exit (0); + #endif + #if defined (SYSTYPE_BSD43) || defined(SYSTYPE_BSD) + printf ("mips-mips-riscos%sbsd\\n", argv[1]); exit (0); + #endif + #endif + exit (-1); + } +EOF + $CC_FOR_BUILD -o "$dummy" "$dummy.c" && + dummyarg=$(echo "$UNAME_RELEASE" | sed -n 's/\([0-9]*\).*/\1/p') && + SYSTEM_NAME=$("$dummy" "$dummyarg") && + { echo "$SYSTEM_NAME"; exit; } + echo mips-mips-riscos"$UNAME_RELEASE" + exit ;; + Motorola:PowerMAX_OS:*:*) + echo powerpc-motorola-powermax + exit ;; + Motorola:*:4.3:PL8-*) + echo powerpc-harris-powermax + exit ;; + Night_Hawk:*:*:PowerMAX_OS | Synergy:PowerMAX_OS:*:*) + echo powerpc-harris-powermax + exit ;; + Night_Hawk:Power_UNIX:*:*) + echo powerpc-harris-powerunix + exit ;; + m88k:CX/UX:7*:*) + echo m88k-harris-cxux7 + exit ;; + m88k:*:4*:R4*) + echo m88k-motorola-sysv4 + exit ;; + m88k:*:3*:R3*) + echo m88k-motorola-sysv3 + exit ;; + AViiON:dgux:*:*) + # DG/UX returns AViiON for all architectures + UNAME_PROCESSOR=$(/usr/bin/uname -p) + if test "$UNAME_PROCESSOR" = mc88100 || test "$UNAME_PROCESSOR" = mc88110 + then + if test "$TARGET_BINARY_INTERFACE"x = m88kdguxelfx || \ + test "$TARGET_BINARY_INTERFACE"x = x + then + echo m88k-dg-dgux"$UNAME_RELEASE" + else + echo m88k-dg-dguxbcs"$UNAME_RELEASE" + fi + else + echo i586-dg-dgux"$UNAME_RELEASE" + fi + exit ;; + M88*:DolphinOS:*:*) # DolphinOS (SVR3) + echo m88k-dolphin-sysv3 + exit ;; + M88*:*:R3*:*) + # Delta 88k system running SVR3 + echo m88k-motorola-sysv3 + exit ;; + XD88*:*:*:*) # Tektronix XD88 system running UTekV (SVR3) + echo m88k-tektronix-sysv3 + exit ;; + Tek43[0-9][0-9]:UTek:*:*) # Tektronix 4300 system running UTek (BSD) + echo m68k-tektronix-bsd + exit ;; + *:IRIX*:*:*) + echo mips-sgi-irix"$(echo "$UNAME_RELEASE"|sed -e 's/-/_/g')" + exit ;; + ????????:AIX?:[12].1:2) # AIX 2.2.1 or AIX 2.1.1 is RT/PC AIX. + echo romp-ibm-aix # uname -m gives an 8 hex-code CPU id + exit ;; # Note that: echo "'$(uname -s)'" gives 'AIX ' + i*86:AIX:*:*) + echo i386-ibm-aix + exit ;; + ia64:AIX:*:*) + if test -x /usr/bin/oslevel ; then + IBM_REV=$(/usr/bin/oslevel) + else + IBM_REV="$UNAME_VERSION.$UNAME_RELEASE" + fi + echo "$UNAME_MACHINE"-ibm-aix"$IBM_REV" + exit ;; + *:AIX:2:3) + if grep bos325 /usr/include/stdio.h >/dev/null 2>&1; then + set_cc_for_build + sed 's/^ //' << EOF > "$dummy.c" + #include + + main() + { + if (!__power_pc()) + exit(1); + puts("powerpc-ibm-aix3.2.5"); + exit(0); + } +EOF + if $CC_FOR_BUILD -o "$dummy" "$dummy.c" && SYSTEM_NAME=$("$dummy") + then + echo "$SYSTEM_NAME" + else + echo rs6000-ibm-aix3.2.5 + fi + elif grep bos324 /usr/include/stdio.h >/dev/null 2>&1; then + echo rs6000-ibm-aix3.2.4 + else + echo rs6000-ibm-aix3.2 + fi + exit ;; + *:AIX:*:[4567]) + IBM_CPU_ID=$(/usr/sbin/lsdev -C -c processor -S available | sed 1q | awk '{ print $1 }') + if /usr/sbin/lsattr -El "$IBM_CPU_ID" | grep ' POWER' >/dev/null 2>&1; then + IBM_ARCH=rs6000 + else + IBM_ARCH=powerpc + fi + if test -x /usr/bin/lslpp ; then + IBM_REV=$(/usr/bin/lslpp -Lqc bos.rte.libc | + awk -F: '{ print $3 }' | sed s/[0-9]*$/0/) + else + IBM_REV="$UNAME_VERSION.$UNAME_RELEASE" + fi + echo "$IBM_ARCH"-ibm-aix"$IBM_REV" + exit ;; + *:AIX:*:*) + echo rs6000-ibm-aix + exit ;; + ibmrt:4.4BSD:*|romp-ibm:4.4BSD:*) + echo romp-ibm-bsd4.4 + exit ;; + ibmrt:*BSD:*|romp-ibm:BSD:*) # covers RT/PC BSD and + echo romp-ibm-bsd"$UNAME_RELEASE" # 4.3 with uname added to + exit ;; # report: romp-ibm BSD 4.3 + *:BOSX:*:*) + echo rs6000-bull-bosx + exit ;; + DPX/2?00:B.O.S.:*:*) + echo m68k-bull-sysv3 + exit ;; + 9000/[34]??:4.3bsd:1.*:*) + echo m68k-hp-bsd + exit ;; + hp300:4.4BSD:*:* | 9000/[34]??:4.3bsd:2.*:*) + echo m68k-hp-bsd4.4 + exit ;; + 9000/[34678]??:HP-UX:*:*) + HPUX_REV=$(echo "$UNAME_RELEASE"|sed -e 's/[^.]*.[0B]*//') + case "$UNAME_MACHINE" in + 9000/31?) HP_ARCH=m68000 ;; + 9000/[34]??) HP_ARCH=m68k ;; + 9000/[678][0-9][0-9]) + if test -x /usr/bin/getconf; then + sc_cpu_version=$(/usr/bin/getconf SC_CPU_VERSION 2>/dev/null) + sc_kernel_bits=$(/usr/bin/getconf SC_KERNEL_BITS 2>/dev/null) + case "$sc_cpu_version" in + 523) HP_ARCH=hppa1.0 ;; # CPU_PA_RISC1_0 + 528) HP_ARCH=hppa1.1 ;; # CPU_PA_RISC1_1 + 532) # CPU_PA_RISC2_0 + case "$sc_kernel_bits" in + 32) HP_ARCH=hppa2.0n ;; + 64) HP_ARCH=hppa2.0w ;; + '') HP_ARCH=hppa2.0 ;; # HP-UX 10.20 + esac ;; + esac + fi + if test "$HP_ARCH" = ""; then + set_cc_for_build + sed 's/^ //' << EOF > "$dummy.c" + + #define _HPUX_SOURCE + #include + #include + + int main () + { + #if defined(_SC_KERNEL_BITS) + long bits = sysconf(_SC_KERNEL_BITS); + #endif + long cpu = sysconf (_SC_CPU_VERSION); + + switch (cpu) + { + case CPU_PA_RISC1_0: puts ("hppa1.0"); break; + case CPU_PA_RISC1_1: puts ("hppa1.1"); break; + case CPU_PA_RISC2_0: + #if defined(_SC_KERNEL_BITS) + switch (bits) + { + case 64: puts ("hppa2.0w"); break; + case 32: puts ("hppa2.0n"); break; + default: puts ("hppa2.0"); break; + } break; + #else /* !defined(_SC_KERNEL_BITS) */ + puts ("hppa2.0"); break; + #endif + default: puts ("hppa1.0"); break; + } + exit (0); + } +EOF + (CCOPTS="" $CC_FOR_BUILD -o "$dummy" "$dummy.c" 2>/dev/null) && HP_ARCH=$("$dummy") + test -z "$HP_ARCH" && HP_ARCH=hppa + fi ;; + esac + if test "$HP_ARCH" = hppa2.0w + then + set_cc_for_build + + # hppa2.0w-hp-hpux* has a 64-bit kernel and a compiler generating + # 32-bit code. hppa64-hp-hpux* has the same kernel and a compiler + # generating 64-bit code. GNU and HP use different nomenclature: + # + # $ CC_FOR_BUILD=cc ./config.guess + # => hppa2.0w-hp-hpux11.23 + # $ CC_FOR_BUILD="cc +DA2.0w" ./config.guess + # => hppa64-hp-hpux11.23 + + if echo __LP64__ | (CCOPTS="" $CC_FOR_BUILD -E - 2>/dev/null) | + grep -q __LP64__ + then + HP_ARCH=hppa2.0w + else + HP_ARCH=hppa64 + fi + fi + echo "$HP_ARCH"-hp-hpux"$HPUX_REV" + exit ;; + ia64:HP-UX:*:*) + HPUX_REV=$(echo "$UNAME_RELEASE"|sed -e 's/[^.]*.[0B]*//') + echo ia64-hp-hpux"$HPUX_REV" + exit ;; + 3050*:HI-UX:*:*) + set_cc_for_build + sed 's/^ //' << EOF > "$dummy.c" + #include + int + main () + { + long cpu = sysconf (_SC_CPU_VERSION); + /* The order matters, because CPU_IS_HP_MC68K erroneously returns + true for CPU_PA_RISC1_0. CPU_IS_PA_RISC returns correct + results, however. */ + if (CPU_IS_PA_RISC (cpu)) + { + switch (cpu) + { + case CPU_PA_RISC1_0: puts ("hppa1.0-hitachi-hiuxwe2"); break; + case CPU_PA_RISC1_1: puts ("hppa1.1-hitachi-hiuxwe2"); break; + case CPU_PA_RISC2_0: puts ("hppa2.0-hitachi-hiuxwe2"); break; + default: puts ("hppa-hitachi-hiuxwe2"); break; + } + } + else if (CPU_IS_HP_MC68K (cpu)) + puts ("m68k-hitachi-hiuxwe2"); + else puts ("unknown-hitachi-hiuxwe2"); + exit (0); + } +EOF + $CC_FOR_BUILD -o "$dummy" "$dummy.c" && SYSTEM_NAME=$("$dummy") && + { echo "$SYSTEM_NAME"; exit; } + echo unknown-hitachi-hiuxwe2 + exit ;; + 9000/7??:4.3bsd:*:* | 9000/8?[79]:4.3bsd:*:*) + echo hppa1.1-hp-bsd + exit ;; + 9000/8??:4.3bsd:*:*) + echo hppa1.0-hp-bsd + exit ;; + *9??*:MPE/iX:*:* | *3000*:MPE/iX:*:*) + echo hppa1.0-hp-mpeix + exit ;; + hp7??:OSF1:*:* | hp8?[79]:OSF1:*:*) + echo hppa1.1-hp-osf + exit ;; + hp8??:OSF1:*:*) + echo hppa1.0-hp-osf + exit ;; + i*86:OSF1:*:*) + if test -x /usr/sbin/sysversion ; then + echo "$UNAME_MACHINE"-unknown-osf1mk + else + echo "$UNAME_MACHINE"-unknown-osf1 + fi + exit ;; + parisc*:Lites*:*:*) + echo hppa1.1-hp-lites + exit ;; + C1*:ConvexOS:*:* | convex:ConvexOS:C1*:*) + echo c1-convex-bsd + exit ;; + C2*:ConvexOS:*:* | convex:ConvexOS:C2*:*) + if getsysinfo -f scalar_acc + then echo c32-convex-bsd + else echo c2-convex-bsd + fi + exit ;; + C34*:ConvexOS:*:* | convex:ConvexOS:C34*:*) + echo c34-convex-bsd + exit ;; + C38*:ConvexOS:*:* | convex:ConvexOS:C38*:*) + echo c38-convex-bsd + exit ;; + C4*:ConvexOS:*:* | convex:ConvexOS:C4*:*) + echo c4-convex-bsd + exit ;; + CRAY*Y-MP:*:*:*) + echo ymp-cray-unicos"$UNAME_RELEASE" | sed -e 's/\.[^.]*$/.X/' + exit ;; + CRAY*[A-Z]90:*:*:*) + echo "$UNAME_MACHINE"-cray-unicos"$UNAME_RELEASE" \ + | sed -e 's/CRAY.*\([A-Z]90\)/\1/' \ + -e y/ABCDEFGHIJKLMNOPQRSTUVWXYZ/abcdefghijklmnopqrstuvwxyz/ \ + -e 's/\.[^.]*$/.X/' + exit ;; + CRAY*TS:*:*:*) + echo t90-cray-unicos"$UNAME_RELEASE" | sed -e 's/\.[^.]*$/.X/' + exit ;; + CRAY*T3E:*:*:*) + echo alphaev5-cray-unicosmk"$UNAME_RELEASE" | sed -e 's/\.[^.]*$/.X/' + exit ;; + CRAY*SV1:*:*:*) + echo sv1-cray-unicos"$UNAME_RELEASE" | sed -e 's/\.[^.]*$/.X/' + exit ;; + *:UNICOS/mp:*:*) + echo craynv-cray-unicosmp"$UNAME_RELEASE" | sed -e 's/\.[^.]*$/.X/' + exit ;; + F30[01]:UNIX_System_V:*:* | F700:UNIX_System_V:*:*) + FUJITSU_PROC=$(uname -m | tr ABCDEFGHIJKLMNOPQRSTUVWXYZ abcdefghijklmnopqrstuvwxyz) + FUJITSU_SYS=$(uname -p | tr ABCDEFGHIJKLMNOPQRSTUVWXYZ abcdefghijklmnopqrstuvwxyz | sed -e 's/\///') + FUJITSU_REL=$(echo "$UNAME_RELEASE" | sed -e 's/ /_/') + echo "${FUJITSU_PROC}-fujitsu-${FUJITSU_SYS}${FUJITSU_REL}" + exit ;; + 5000:UNIX_System_V:4.*:*) + FUJITSU_SYS=$(uname -p | tr ABCDEFGHIJKLMNOPQRSTUVWXYZ abcdefghijklmnopqrstuvwxyz | sed -e 's/\///') + FUJITSU_REL=$(echo "$UNAME_RELEASE" | tr ABCDEFGHIJKLMNOPQRSTUVWXYZ abcdefghijklmnopqrstuvwxyz | sed -e 's/ /_/') + echo "sparc-fujitsu-${FUJITSU_SYS}${FUJITSU_REL}" + exit ;; + i*86:BSD/386:*:* | i*86:BSD/OS:*:* | *:Ascend\ Embedded/OS:*:*) + echo "$UNAME_MACHINE"-pc-bsdi"$UNAME_RELEASE" + exit ;; + sparc*:BSD/OS:*:*) + echo sparc-unknown-bsdi"$UNAME_RELEASE" + exit ;; + *:BSD/OS:*:*) + echo "$UNAME_MACHINE"-unknown-bsdi"$UNAME_RELEASE" + exit ;; + arm:FreeBSD:*:*) + UNAME_PROCESSOR=$(uname -p) + set_cc_for_build + if echo __ARM_PCS_VFP | $CC_FOR_BUILD -E - 2>/dev/null \ + | grep -q __ARM_PCS_VFP + then + echo "${UNAME_PROCESSOR}"-unknown-freebsd"$(echo ${UNAME_RELEASE}|sed -e 's/[-(].*//')"-gnueabi + else + echo "${UNAME_PROCESSOR}"-unknown-freebsd"$(echo ${UNAME_RELEASE}|sed -e 's/[-(].*//')"-gnueabihf + fi + exit ;; + *:FreeBSD:*:*) + UNAME_PROCESSOR=$(/usr/bin/uname -p) + case "$UNAME_PROCESSOR" in + amd64) + UNAME_PROCESSOR=x86_64 ;; + i386) + UNAME_PROCESSOR=i586 ;; + esac + echo "$UNAME_PROCESSOR"-unknown-freebsd"$(echo "$UNAME_RELEASE"|sed -e 's/[-(].*//')" + exit ;; + i*:CYGWIN*:*) + echo "$UNAME_MACHINE"-pc-cygwin + exit ;; + *:MINGW64*:*) + echo "$UNAME_MACHINE"-pc-mingw64 + exit ;; + *:MINGW*:*) + echo "$UNAME_MACHINE"-pc-mingw32 + exit ;; + *:MSYS*:*) + echo "$UNAME_MACHINE"-pc-msys + exit ;; + i*:PW*:*) + echo "$UNAME_MACHINE"-pc-pw32 + exit ;; + *:Interix*:*) + case "$UNAME_MACHINE" in + x86) + echo i586-pc-interix"$UNAME_RELEASE" + exit ;; + authenticamd | genuineintel | EM64T) + echo x86_64-unknown-interix"$UNAME_RELEASE" + exit ;; + IA64) + echo ia64-unknown-interix"$UNAME_RELEASE" + exit ;; + esac ;; + i*:UWIN*:*) + echo "$UNAME_MACHINE"-pc-uwin + exit ;; + amd64:CYGWIN*:*:* | x86_64:CYGWIN*:*:*) + echo x86_64-pc-cygwin + exit ;; + prep*:SunOS:5.*:*) + echo powerpcle-unknown-solaris2"$(echo "$UNAME_RELEASE"|sed -e 's/[^.]*//')" + exit ;; + *:GNU:*:*) + # the GNU system + echo "$(echo "$UNAME_MACHINE"|sed -e 's,[-/].*$,,')-unknown-$LIBC$(echo "$UNAME_RELEASE"|sed -e 's,/.*$,,')" + exit ;; + *:GNU/*:*:*) + # other systems with GNU libc and userland + echo "$UNAME_MACHINE-unknown-$(echo "$UNAME_SYSTEM" | sed 's,^[^/]*/,,' | tr "[:upper:]" "[:lower:]")$(echo "$UNAME_RELEASE"|sed -e 's/[-(].*//')-$LIBC" + exit ;; + *:Minix:*:*) + echo "$UNAME_MACHINE"-unknown-minix + exit ;; + aarch64:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + aarch64_be:Linux:*:*) + UNAME_MACHINE=aarch64_be + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + alpha:Linux:*:*) + case $(sed -n '/^cpu model/s/^.*: \(.*\)/\1/p' /proc/cpuinfo 2>/dev/null) in + EV5) UNAME_MACHINE=alphaev5 ;; + EV56) UNAME_MACHINE=alphaev56 ;; + PCA56) UNAME_MACHINE=alphapca56 ;; + PCA57) UNAME_MACHINE=alphapca56 ;; + EV6) UNAME_MACHINE=alphaev6 ;; + EV67) UNAME_MACHINE=alphaev67 ;; + EV68*) UNAME_MACHINE=alphaev68 ;; + esac + objdump --private-headers /bin/sh | grep -q ld.so.1 + if test "$?" = 0 ; then LIBC=gnulibc1 ; fi + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + arc:Linux:*:* | arceb:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + arm*:Linux:*:*) + set_cc_for_build + if echo __ARM_EABI__ | $CC_FOR_BUILD -E - 2>/dev/null \ + | grep -q __ARM_EABI__ + then + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + else + if echo __ARM_PCS_VFP | $CC_FOR_BUILD -E - 2>/dev/null \ + | grep -q __ARM_PCS_VFP + then + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC"eabi + else + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC"eabihf + fi + fi + exit ;; + avr32*:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + cris:Linux:*:*) + echo "$UNAME_MACHINE"-axis-linux-"$LIBC" + exit ;; + crisv32:Linux:*:*) + echo "$UNAME_MACHINE"-axis-linux-"$LIBC" + exit ;; + e2k:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + frv:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + hexagon:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + i*86:Linux:*:*) + echo "$UNAME_MACHINE"-pc-linux-"$LIBC" + exit ;; + ia64:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + k1om:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + loongarch32:Linux:*:* | loongarch64:Linux:*:* | loongarchx32:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + m32r*:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + m68*:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + mips:Linux:*:* | mips64:Linux:*:*) + set_cc_for_build + IS_GLIBC=0 + test x"${LIBC}" = xgnu && IS_GLIBC=1 + sed 's/^ //' << EOF > "$dummy.c" + #undef CPU + #undef mips + #undef mipsel + #undef mips64 + #undef mips64el + #if ${IS_GLIBC} && defined(_ABI64) + LIBCABI=gnuabi64 + #else + #if ${IS_GLIBC} && defined(_ABIN32) + LIBCABI=gnuabin32 + #else + LIBCABI=${LIBC} + #endif + #endif + + #if ${IS_GLIBC} && defined(__mips64) && defined(__mips_isa_rev) && __mips_isa_rev>=6 + CPU=mipsisa64r6 + #else + #if ${IS_GLIBC} && !defined(__mips64) && defined(__mips_isa_rev) && __mips_isa_rev>=6 + CPU=mipsisa32r6 + #else + #if defined(__mips64) + CPU=mips64 + #else + CPU=mips + #endif + #endif + #endif + + #if defined(__MIPSEL__) || defined(__MIPSEL) || defined(_MIPSEL) || defined(MIPSEL) + MIPS_ENDIAN=el + #else + #if defined(__MIPSEB__) || defined(__MIPSEB) || defined(_MIPSEB) || defined(MIPSEB) + MIPS_ENDIAN= + #else + MIPS_ENDIAN= + #endif + #endif +EOF + eval "$($CC_FOR_BUILD -E "$dummy.c" 2>/dev/null | grep '^CPU\|^MIPS_ENDIAN\|^LIBCABI')" + test "x$CPU" != x && { echo "$CPU${MIPS_ENDIAN}-unknown-linux-$LIBCABI"; exit; } + ;; + mips64el:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + openrisc*:Linux:*:*) + echo or1k-unknown-linux-"$LIBC" + exit ;; + or32:Linux:*:* | or1k*:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + padre:Linux:*:*) + echo sparc-unknown-linux-"$LIBC" + exit ;; + parisc64:Linux:*:* | hppa64:Linux:*:*) + echo hppa64-unknown-linux-"$LIBC" + exit ;; + parisc:Linux:*:* | hppa:Linux:*:*) + # Look for CPU level + case $(grep '^cpu[^a-z]*:' /proc/cpuinfo 2>/dev/null | cut -d' ' -f2) in + PA7*) echo hppa1.1-unknown-linux-"$LIBC" ;; + PA8*) echo hppa2.0-unknown-linux-"$LIBC" ;; + *) echo hppa-unknown-linux-"$LIBC" ;; + esac + exit ;; + ppc64:Linux:*:*) + echo powerpc64-unknown-linux-"$LIBC" + exit ;; + ppc:Linux:*:*) + echo powerpc-unknown-linux-"$LIBC" + exit ;; + ppc64le:Linux:*:*) + echo powerpc64le-unknown-linux-"$LIBC" + exit ;; + ppcle:Linux:*:*) + echo powerpcle-unknown-linux-"$LIBC" + exit ;; + riscv32:Linux:*:* | riscv32be:Linux:*:* | riscv64:Linux:*:* | riscv64be:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + s390:Linux:*:* | s390x:Linux:*:*) + echo "$UNAME_MACHINE"-ibm-linux-"$LIBC" + exit ;; + sh64*:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + sh*:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + sparc:Linux:*:* | sparc64:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + tile*:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + vax:Linux:*:*) + echo "$UNAME_MACHINE"-dec-linux-"$LIBC" + exit ;; + x86_64:Linux:*:*) + set_cc_for_build + LIBCABI=$LIBC + if test "$CC_FOR_BUILD" != no_compiler_found; then + if (echo '#ifdef __ILP32__'; echo IS_X32; echo '#endif') | \ + (CCOPTS="" $CC_FOR_BUILD -E - 2>/dev/null) | \ + grep IS_X32 >/dev/null + then + LIBCABI="$LIBC"x32 + fi + fi + echo "$UNAME_MACHINE"-pc-linux-"$LIBCABI" + exit ;; + xtensa*:Linux:*:*) + echo "$UNAME_MACHINE"-unknown-linux-"$LIBC" + exit ;; + i*86:DYNIX/ptx:4*:*) + # ptx 4.0 does uname -s correctly, with DYNIX/ptx in there. + # earlier versions are messed up and put the nodename in both + # sysname and nodename. + echo i386-sequent-sysv4 + exit ;; + i*86:UNIX_SV:4.2MP:2.*) + # Unixware is an offshoot of SVR4, but it has its own version + # number series starting with 2... + # I am not positive that other SVR4 systems won't match this, + # I just have to hope. -- rms. + # Use sysv4.2uw... so that sysv4* matches it. + echo "$UNAME_MACHINE"-pc-sysv4.2uw"$UNAME_VERSION" + exit ;; + i*86:OS/2:*:*) + # If we were able to find `uname', then EMX Unix compatibility + # is probably installed. + echo "$UNAME_MACHINE"-pc-os2-emx + exit ;; + i*86:XTS-300:*:STOP) + echo "$UNAME_MACHINE"-unknown-stop + exit ;; + i*86:atheos:*:*) + echo "$UNAME_MACHINE"-unknown-atheos + exit ;; + i*86:syllable:*:*) + echo "$UNAME_MACHINE"-pc-syllable + exit ;; + i*86:LynxOS:2.*:* | i*86:LynxOS:3.[01]*:* | i*86:LynxOS:4.[02]*:*) + echo i386-unknown-lynxos"$UNAME_RELEASE" + exit ;; + i*86:*DOS:*:*) + echo "$UNAME_MACHINE"-pc-msdosdjgpp + exit ;; + i*86:*:4.*:*) + UNAME_REL=$(echo "$UNAME_RELEASE" | sed 's/\/MP$//') + if grep Novell /usr/include/link.h >/dev/null 2>/dev/null; then + echo "$UNAME_MACHINE"-univel-sysv"$UNAME_REL" + else + echo "$UNAME_MACHINE"-pc-sysv"$UNAME_REL" + fi + exit ;; + i*86:*:5:[678]*) + # UnixWare 7.x, OpenUNIX and OpenServer 6. + case $(/bin/uname -X | grep "^Machine") in + *486*) UNAME_MACHINE=i486 ;; + *Pentium) UNAME_MACHINE=i586 ;; + *Pent*|*Celeron) UNAME_MACHINE=i686 ;; + esac + echo "$UNAME_MACHINE-unknown-sysv${UNAME_RELEASE}${UNAME_SYSTEM}${UNAME_VERSION}" + exit ;; + i*86:*:3.2:*) + if test -f /usr/options/cb.name; then + UNAME_REL=$(sed -n 's/.*Version //p' /dev/null >/dev/null ; then + UNAME_REL=$( (/bin/uname -X|grep Release|sed -e 's/.*= //')) + (/bin/uname -X|grep i80486 >/dev/null) && UNAME_MACHINE=i486 + (/bin/uname -X|grep '^Machine.*Pentium' >/dev/null) \ + && UNAME_MACHINE=i586 + (/bin/uname -X|grep '^Machine.*Pent *II' >/dev/null) \ + && UNAME_MACHINE=i686 + (/bin/uname -X|grep '^Machine.*Pentium Pro' >/dev/null) \ + && UNAME_MACHINE=i686 + echo "$UNAME_MACHINE"-pc-sco"$UNAME_REL" + else + echo "$UNAME_MACHINE"-pc-sysv32 + fi + exit ;; + pc:*:*:*) + # Left here for compatibility: + # uname -m prints for DJGPP always 'pc', but it prints nothing about + # the processor, so we play safe by assuming i586. + # Note: whatever this is, it MUST be the same as what config.sub + # prints for the "djgpp" host, or else GDB configure will decide that + # this is a cross-build. + echo i586-pc-msdosdjgpp + exit ;; + Intel:Mach:3*:*) + echo i386-pc-mach3 + exit ;; + paragon:*:*:*) + echo i860-intel-osf1 + exit ;; + i860:*:4.*:*) # i860-SVR4 + if grep Stardent /usr/include/sys/uadmin.h >/dev/null 2>&1 ; then + echo i860-stardent-sysv"$UNAME_RELEASE" # Stardent Vistra i860-SVR4 + else # Add other i860-SVR4 vendors below as they are discovered. + echo i860-unknown-sysv"$UNAME_RELEASE" # Unknown i860-SVR4 + fi + exit ;; + mini*:CTIX:SYS*5:*) + # "miniframe" + echo m68010-convergent-sysv + exit ;; + mc68k:UNIX:SYSTEM5:3.51m) + echo m68k-convergent-sysv + exit ;; + M680?0:D-NIX:5.3:*) + echo m68k-diab-dnix + exit ;; + M68*:*:R3V[5678]*:*) + test -r /sysV68 && { echo 'm68k-motorola-sysv'; exit; } ;; + 3[345]??:*:4.0:3.0 | 3[34]??A:*:4.0:3.0 | 3[34]??,*:*:4.0:3.0 | 3[34]??/*:*:4.0:3.0 | 4400:*:4.0:3.0 | 4850:*:4.0:3.0 | SKA40:*:4.0:3.0 | SDS2:*:4.0:3.0 | SHG2:*:4.0:3.0 | S7501*:*:4.0:3.0) + OS_REL='' + test -r /etc/.relid \ + && OS_REL=.$(sed -n 's/[^ ]* [^ ]* \([0-9][0-9]\).*/\1/p' < /etc/.relid) + /bin/uname -p 2>/dev/null | grep 86 >/dev/null \ + && { echo i486-ncr-sysv4.3"$OS_REL"; exit; } + /bin/uname -p 2>/dev/null | /bin/grep entium >/dev/null \ + && { echo i586-ncr-sysv4.3"$OS_REL"; exit; } ;; + 3[34]??:*:4.0:* | 3[34]??,*:*:4.0:*) + /bin/uname -p 2>/dev/null | grep 86 >/dev/null \ + && { echo i486-ncr-sysv4; exit; } ;; + NCR*:*:4.2:* | MPRAS*:*:4.2:*) + OS_REL='.3' + test -r /etc/.relid \ + && OS_REL=.$(sed -n 's/[^ ]* [^ ]* \([0-9][0-9]\).*/\1/p' < /etc/.relid) + /bin/uname -p 2>/dev/null | grep 86 >/dev/null \ + && { echo i486-ncr-sysv4.3"$OS_REL"; exit; } + /bin/uname -p 2>/dev/null | /bin/grep entium >/dev/null \ + && { echo i586-ncr-sysv4.3"$OS_REL"; exit; } + /bin/uname -p 2>/dev/null | /bin/grep pteron >/dev/null \ + && { echo i586-ncr-sysv4.3"$OS_REL"; exit; } ;; + m68*:LynxOS:2.*:* | m68*:LynxOS:3.0*:*) + echo m68k-unknown-lynxos"$UNAME_RELEASE" + exit ;; + mc68030:UNIX_System_V:4.*:*) + echo m68k-atari-sysv4 + exit ;; + TSUNAMI:LynxOS:2.*:*) + echo sparc-unknown-lynxos"$UNAME_RELEASE" + exit ;; + rs6000:LynxOS:2.*:*) + echo rs6000-unknown-lynxos"$UNAME_RELEASE" + exit ;; + PowerPC:LynxOS:2.*:* | PowerPC:LynxOS:3.[01]*:* | PowerPC:LynxOS:4.[02]*:*) + echo powerpc-unknown-lynxos"$UNAME_RELEASE" + exit ;; + SM[BE]S:UNIX_SV:*:*) + echo mips-dde-sysv"$UNAME_RELEASE" + exit ;; + RM*:ReliantUNIX-*:*:*) + echo mips-sni-sysv4 + exit ;; + RM*:SINIX-*:*:*) + echo mips-sni-sysv4 + exit ;; + *:SINIX-*:*:*) + if uname -p 2>/dev/null >/dev/null ; then + UNAME_MACHINE=$( (uname -p) 2>/dev/null) + echo "$UNAME_MACHINE"-sni-sysv4 + else + echo ns32k-sni-sysv + fi + exit ;; + PENTIUM:*:4.0*:*) # Unisys `ClearPath HMP IX 4000' SVR4/MP effort + # says + echo i586-unisys-sysv4 + exit ;; + *:UNIX_System_V:4*:FTX*) + # From Gerald Hewes . + # How about differentiating between stratus architectures? -djm + echo hppa1.1-stratus-sysv4 + exit ;; + *:*:*:FTX*) + # From seanf@swdc.stratus.com. + echo i860-stratus-sysv4 + exit ;; + i*86:VOS:*:*) + # From Paul.Green@stratus.com. + echo "$UNAME_MACHINE"-stratus-vos + exit ;; + *:VOS:*:*) + # From Paul.Green@stratus.com. + echo hppa1.1-stratus-vos + exit ;; + mc68*:A/UX:*:*) + echo m68k-apple-aux"$UNAME_RELEASE" + exit ;; + news*:NEWS-OS:6*:*) + echo mips-sony-newsos6 + exit ;; + R[34]000:*System_V*:*:* | R4000:UNIX_SYSV:*:* | R*000:UNIX_SV:*:*) + if test -d /usr/nec; then + echo mips-nec-sysv"$UNAME_RELEASE" + else + echo mips-unknown-sysv"$UNAME_RELEASE" + fi + exit ;; + BeBox:BeOS:*:*) # BeOS running on hardware made by Be, PPC only. + echo powerpc-be-beos + exit ;; + BeMac:BeOS:*:*) # BeOS running on Mac or Mac clone, PPC only. + echo powerpc-apple-beos + exit ;; + BePC:BeOS:*:*) # BeOS running on Intel PC compatible. + echo i586-pc-beos + exit ;; + BePC:Haiku:*:*) # Haiku running on Intel PC compatible. + echo i586-pc-haiku + exit ;; + x86_64:Haiku:*:*) + echo x86_64-unknown-haiku + exit ;; + SX-4:SUPER-UX:*:*) + echo sx4-nec-superux"$UNAME_RELEASE" + exit ;; + SX-5:SUPER-UX:*:*) + echo sx5-nec-superux"$UNAME_RELEASE" + exit ;; + SX-6:SUPER-UX:*:*) + echo sx6-nec-superux"$UNAME_RELEASE" + exit ;; + SX-7:SUPER-UX:*:*) + echo sx7-nec-superux"$UNAME_RELEASE" + exit ;; + SX-8:SUPER-UX:*:*) + echo sx8-nec-superux"$UNAME_RELEASE" + exit ;; + SX-8R:SUPER-UX:*:*) + echo sx8r-nec-superux"$UNAME_RELEASE" + exit ;; + SX-ACE:SUPER-UX:*:*) + echo sxace-nec-superux"$UNAME_RELEASE" + exit ;; + Power*:Rhapsody:*:*) + echo powerpc-apple-rhapsody"$UNAME_RELEASE" + exit ;; + *:Rhapsody:*:*) + echo "$UNAME_MACHINE"-apple-rhapsody"$UNAME_RELEASE" + exit ;; + arm64:Darwin:*:*) + echo aarch64-apple-darwin"$UNAME_RELEASE" + exit ;; + *:Darwin:*:*) + UNAME_PROCESSOR=$(uname -p) + case $UNAME_PROCESSOR in + unknown) UNAME_PROCESSOR=powerpc ;; + esac + if command -v xcode-select > /dev/null 2> /dev/null && \ + ! xcode-select --print-path > /dev/null 2> /dev/null ; then + # Avoid executing cc if there is no toolchain installed as + # cc will be a stub that puts up a graphical alert + # prompting the user to install developer tools. + CC_FOR_BUILD=no_compiler_found + else + set_cc_for_build + fi + if test "$CC_FOR_BUILD" != no_compiler_found; then + if (echo '#ifdef __LP64__'; echo IS_64BIT_ARCH; echo '#endif') | \ + (CCOPTS="" $CC_FOR_BUILD -E - 2>/dev/null) | \ + grep IS_64BIT_ARCH >/dev/null + then + case $UNAME_PROCESSOR in + i386) UNAME_PROCESSOR=x86_64 ;; + powerpc) UNAME_PROCESSOR=powerpc64 ;; + esac + fi + # On 10.4-10.6 one might compile for PowerPC via gcc -arch ppc + if (echo '#ifdef __POWERPC__'; echo IS_PPC; echo '#endif') | \ + (CCOPTS="" $CC_FOR_BUILD -E - 2>/dev/null) | \ + grep IS_PPC >/dev/null + then + UNAME_PROCESSOR=powerpc + fi + elif test "$UNAME_PROCESSOR" = i386 ; then + # uname -m returns i386 or x86_64 + UNAME_PROCESSOR=$UNAME_MACHINE + fi + echo "$UNAME_PROCESSOR"-apple-darwin"$UNAME_RELEASE" + exit ;; + *:procnto*:*:* | *:QNX:[0123456789]*:*) + UNAME_PROCESSOR=$(uname -p) + if test "$UNAME_PROCESSOR" = x86; then + UNAME_PROCESSOR=i386 + UNAME_MACHINE=pc + fi + echo "$UNAME_PROCESSOR"-"$UNAME_MACHINE"-nto-qnx"$UNAME_RELEASE" + exit ;; + *:QNX:*:4*) + echo i386-pc-qnx + exit ;; + NEO-*:NONSTOP_KERNEL:*:*) + echo neo-tandem-nsk"$UNAME_RELEASE" + exit ;; + NSE-*:NONSTOP_KERNEL:*:*) + echo nse-tandem-nsk"$UNAME_RELEASE" + exit ;; + NSR-*:NONSTOP_KERNEL:*:*) + echo nsr-tandem-nsk"$UNAME_RELEASE" + exit ;; + NSV-*:NONSTOP_KERNEL:*:*) + echo nsv-tandem-nsk"$UNAME_RELEASE" + exit ;; + NSX-*:NONSTOP_KERNEL:*:*) + echo nsx-tandem-nsk"$UNAME_RELEASE" + exit ;; + *:NonStop-UX:*:*) + echo mips-compaq-nonstopux + exit ;; + BS2000:POSIX*:*:*) + echo bs2000-siemens-sysv + exit ;; + DS/*:UNIX_System_V:*:*) + echo "$UNAME_MACHINE"-"$UNAME_SYSTEM"-"$UNAME_RELEASE" + exit ;; + *:Plan9:*:*) + # "uname -m" is not consistent, so use $cputype instead. 386 + # is converted to i386 for consistency with other x86 + # operating systems. + # shellcheck disable=SC2154 + if test "$cputype" = 386; then + UNAME_MACHINE=i386 + else + UNAME_MACHINE="$cputype" + fi + echo "$UNAME_MACHINE"-unknown-plan9 + exit ;; + *:TOPS-10:*:*) + echo pdp10-unknown-tops10 + exit ;; + *:TENEX:*:*) + echo pdp10-unknown-tenex + exit ;; + KS10:TOPS-20:*:* | KL10:TOPS-20:*:* | TYPE4:TOPS-20:*:*) + echo pdp10-dec-tops20 + exit ;; + XKL-1:TOPS-20:*:* | TYPE5:TOPS-20:*:*) + echo pdp10-xkl-tops20 + exit ;; + *:TOPS-20:*:*) + echo pdp10-unknown-tops20 + exit ;; + *:ITS:*:*) + echo pdp10-unknown-its + exit ;; + SEI:*:*:SEIUX) + echo mips-sei-seiux"$UNAME_RELEASE" + exit ;; + *:DragonFly:*:*) + echo "$UNAME_MACHINE"-unknown-dragonfly"$(echo "$UNAME_RELEASE"|sed -e 's/[-(].*//')" + exit ;; + *:*VMS:*:*) + UNAME_MACHINE=$( (uname -p) 2>/dev/null) + case "$UNAME_MACHINE" in + A*) echo alpha-dec-vms ; exit ;; + I*) echo ia64-dec-vms ; exit ;; + V*) echo vax-dec-vms ; exit ;; + esac ;; + *:XENIX:*:SysV) + echo i386-pc-xenix + exit ;; + i*86:skyos:*:*) + echo "$UNAME_MACHINE"-pc-skyos"$(echo "$UNAME_RELEASE" | sed -e 's/ .*$//')" + exit ;; + i*86:rdos:*:*) + echo "$UNAME_MACHINE"-pc-rdos + exit ;; + *:AROS:*:*) + echo "$UNAME_MACHINE"-unknown-aros + exit ;; + x86_64:VMkernel:*:*) + echo "$UNAME_MACHINE"-unknown-esx + exit ;; + amd64:Isilon\ OneFS:*:*) + echo x86_64-unknown-onefs + exit ;; + *:Unleashed:*:*) + echo "$UNAME_MACHINE"-unknown-unleashed"$UNAME_RELEASE" + exit ;; +esac + +# No uname command or uname output not recognized. +set_cc_for_build +cat > "$dummy.c" < +#include +#endif +#if defined(ultrix) || defined(_ultrix) || defined(__ultrix) || defined(__ultrix__) +#if defined (vax) || defined (__vax) || defined (__vax__) || defined(mips) || defined(__mips) || defined(__mips__) || defined(MIPS) || defined(__MIPS__) +#include +#if defined(_SIZE_T_) || defined(SIGLOST) +#include +#endif +#endif +#endif +main () +{ +#if defined (sony) +#if defined (MIPSEB) + /* BFD wants "bsd" instead of "newsos". Perhaps BFD should be changed, + I don't know.... */ + printf ("mips-sony-bsd\n"); exit (0); +#else +#include + printf ("m68k-sony-newsos%s\n", +#ifdef NEWSOS4 + "4" +#else + "" +#endif + ); exit (0); +#endif +#endif + +#if defined (NeXT) +#if !defined (__ARCHITECTURE__) +#define __ARCHITECTURE__ "m68k" +#endif + int version; + version=$( (hostinfo | sed -n 's/.*NeXT Mach \([0-9]*\).*/\1/p') 2>/dev/null); + if (version < 4) + printf ("%s-next-nextstep%d\n", __ARCHITECTURE__, version); + else + printf ("%s-next-openstep%d\n", __ARCHITECTURE__, version); + exit (0); +#endif + +#if defined (MULTIMAX) || defined (n16) +#if defined (UMAXV) + printf ("ns32k-encore-sysv\n"); exit (0); +#else +#if defined (CMU) + printf ("ns32k-encore-mach\n"); exit (0); +#else + printf ("ns32k-encore-bsd\n"); exit (0); +#endif +#endif +#endif + +#if defined (__386BSD__) + printf ("i386-pc-bsd\n"); exit (0); +#endif + +#if defined (sequent) +#if defined (i386) + printf ("i386-sequent-dynix\n"); exit (0); +#endif +#if defined (ns32000) + printf ("ns32k-sequent-dynix\n"); exit (0); +#endif +#endif + +#if defined (_SEQUENT_) + struct utsname un; + + uname(&un); + if (strncmp(un.version, "V2", 2) == 0) { + printf ("i386-sequent-ptx2\n"); exit (0); + } + if (strncmp(un.version, "V1", 2) == 0) { /* XXX is V1 correct? */ + printf ("i386-sequent-ptx1\n"); exit (0); + } + printf ("i386-sequent-ptx\n"); exit (0); +#endif + +#if defined (vax) +#if !defined (ultrix) +#include +#if defined (BSD) +#if BSD == 43 + printf ("vax-dec-bsd4.3\n"); exit (0); +#else +#if BSD == 199006 + printf ("vax-dec-bsd4.3reno\n"); exit (0); +#else + printf ("vax-dec-bsd\n"); exit (0); +#endif +#endif +#else + printf ("vax-dec-bsd\n"); exit (0); +#endif +#else +#if defined(_SIZE_T_) || defined(SIGLOST) + struct utsname un; + uname (&un); + printf ("vax-dec-ultrix%s\n", un.release); exit (0); +#else + printf ("vax-dec-ultrix\n"); exit (0); +#endif +#endif +#endif +#if defined(ultrix) || defined(_ultrix) || defined(__ultrix) || defined(__ultrix__) +#if defined(mips) || defined(__mips) || defined(__mips__) || defined(MIPS) || defined(__MIPS__) +#if defined(_SIZE_T_) || defined(SIGLOST) + struct utsname *un; + uname (&un); + printf ("mips-dec-ultrix%s\n", un.release); exit (0); +#else + printf ("mips-dec-ultrix\n"); exit (0); +#endif +#endif +#endif + +#if defined (alliant) && defined (i860) + printf ("i860-alliant-bsd\n"); exit (0); +#endif + + exit (1); +} +EOF + +$CC_FOR_BUILD -o "$dummy" "$dummy.c" 2>/dev/null && SYSTEM_NAME=$($dummy) && + { echo "$SYSTEM_NAME"; exit; } + +# Apollos put the system type in the environment. +test -d /usr/apollo && { echo "$ISP-apollo-$SYSTYPE"; exit; } + +echo "$0: unable to guess system type" >&2 + +case "$UNAME_MACHINE:$UNAME_SYSTEM" in + mips:Linux | mips64:Linux) + # If we got here on MIPS GNU/Linux, output extra information. + cat >&2 <&2 <&2 </dev/null || echo unknown) +uname -r = $( (uname -r) 2>/dev/null || echo unknown) +uname -s = $( (uname -s) 2>/dev/null || echo unknown) +uname -v = $( (uname -v) 2>/dev/null || echo unknown) + +/usr/bin/uname -p = $( (/usr/bin/uname -p) 2>/dev/null) +/bin/uname -X = $( (/bin/uname -X) 2>/dev/null) + +hostinfo = $( (hostinfo) 2>/dev/null) +/bin/universe = $( (/bin/universe) 2>/dev/null) +/usr/bin/arch -k = $( (/usr/bin/arch -k) 2>/dev/null) +/bin/arch = $( (/bin/arch) 2>/dev/null) +/usr/bin/oslevel = $( (/usr/bin/oslevel) 2>/dev/null) +/usr/convex/getsysinfo = $( (/usr/convex/getsysinfo) 2>/dev/null) + +UNAME_MACHINE = "$UNAME_MACHINE" +UNAME_RELEASE = "$UNAME_RELEASE" +UNAME_SYSTEM = "$UNAME_SYSTEM" +UNAME_VERSION = "$UNAME_VERSION" +EOF +fi + +exit 1 + +# Local variables: +# eval: (add-hook 'before-save-hook 'time-stamp) +# time-stamp-start: "timestamp='" +# time-stamp-format: "%:y-%02m-%02d" +# time-stamp-end: "'" +# End: diff --git a/recipes/clustalw/config.sub b/recipes/clustalw/config.sub new file mode 100644 index 0000000000000..38f3d037a785f --- /dev/null +++ b/recipes/clustalw/config.sub @@ -0,0 +1,1885 @@ +#! /bin/sh +# Configuration validation subroutine script. +# Copyright 1992-2021 Free Software Foundation, Inc. + +# shellcheck disable=SC2006,SC2268 # see below for rationale + +timestamp='2021-10-27' + +# This file is free software; you can redistribute it and/or modify it +# under the terms of the GNU General Public License as published by +# the Free Software Foundation; either version 3 of the License, or +# (at your option) any later version. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY; without even the implied warranty of +# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU +# General Public License for more details. +# +# You should have received a copy of the GNU General Public License +# along with this program; if not, see . +# +# As a special exception to the GNU General Public License, if you +# distribute this file as part of a program that contains a +# configuration script generated by Autoconf, you may include it under +# the same distribution terms that you use for the rest of that +# program. This Exception is an additional permission under section 7 +# of the GNU General Public License, version 3 ("GPLv3"). + + +# Please send patches to . +# +# Configuration subroutine to validate and canonicalize a configuration type. +# Supply the specified configuration type as an argument. +# If it is invalid, we print an error message on stderr and exit with code 1. +# Otherwise, we print the canonical config type on stdout and succeed. + +# You can get the latest version of this script from: +# https://git.savannah.gnu.org/cgit/config.git/plain/config.sub + +# This file is supposed to be the same for all GNU packages +# and recognize all the CPU types, system types and aliases +# that are meaningful with *any* GNU software. +# Each package is responsible for reporting which valid configurations +# it does not support. The user should be able to distinguish +# a failure to support a valid configuration from a meaningless +# configuration. + +# The goal of this file is to map all the various variations of a given +# machine specification into a single specification in the form: +# CPU_TYPE-MANUFACTURER-OPERATING_SYSTEM +# or in some cases, the newer four-part form: +# CPU_TYPE-MANUFACTURER-KERNEL-OPERATING_SYSTEM +# It is wrong to echo any other type of specification. + +# The "shellcheck disable" line above the timestamp inhibits complaints +# about features and limitations of the classic Bourne shell that were +# superseded or lifted in POSIX. However, this script identifies a wide +# variety of pre-POSIX systems that do not have POSIX shells at all, and +# even some reasonably current systems (Solaris 10 as case-in-point) still +# have a pre-POSIX /bin/sh. + +me=`echo "$0" | sed -e 's,.*/,,'` + +usage="\ +Usage: $0 [OPTION] CPU-MFR-OPSYS or ALIAS + +Canonicalize a configuration name. + +Options: + -h, --help print this help, then exit + -t, --time-stamp print date of last modification, then exit + -v, --version print version number, then exit + +Report bugs and patches to ." + +version="\ +GNU config.sub ($timestamp) + +Copyright 1992-2021 Free Software Foundation, Inc. + +This is free software; see the source for copying conditions. There is NO +warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE." + +help=" +Try \`$me --help' for more information." + +# Parse command line +while test $# -gt 0 ; do + case $1 in + --time-stamp | --time* | -t ) + echo "$timestamp" ; exit ;; + --version | -v ) + echo "$version" ; exit ;; + --help | --h* | -h ) + echo "$usage"; exit ;; + -- ) # Stop option processing + shift; break ;; + - ) # Use stdin as input. + break ;; + -* ) + echo "$me: invalid option $1$help" >&2 + exit 1 ;; + + *local*) + # First pass through any local machine types. + echo "$1" + exit ;; + + * ) + break ;; + esac +done + +case $# in + 0) echo "$me: missing argument$help" >&2 + exit 1;; + 1) ;; + *) echo "$me: too many arguments$help" >&2 + exit 1;; +esac + +# Split fields of configuration type +# shellcheck disable=SC2162 +saved_IFS=$IFS +IFS="-" read field1 field2 field3 field4 <&2 + exit 1 + ;; + *-*-*-*) + basic_machine=$field1-$field2 + basic_os=$field3-$field4 + ;; + *-*-*) + # Ambiguous whether COMPANY is present, or skipped and KERNEL-OS is two + # parts + maybe_os=$field2-$field3 + case $maybe_os in + nto-qnx* | linux-* | uclinux-uclibc* \ + | uclinux-gnu* | kfreebsd*-gnu* | knetbsd*-gnu* | netbsd*-gnu* \ + | netbsd*-eabi* | kopensolaris*-gnu* | cloudabi*-eabi* \ + | storm-chaos* | os2-emx* | rtmk-nova*) + basic_machine=$field1 + basic_os=$maybe_os + ;; + android-linux) + basic_machine=$field1-unknown + basic_os=linux-android + ;; + *) + basic_machine=$field1-$field2 + basic_os=$field3 + ;; + esac + ;; + *-*) + # A lone config we happen to match not fitting any pattern + case $field1-$field2 in + decstation-3100) + basic_machine=mips-dec + basic_os= + ;; + *-*) + # Second component is usually, but not always the OS + case $field2 in + # Prevent following clause from handling this valid os + sun*os*) + basic_machine=$field1 + basic_os=$field2 + ;; + zephyr*) + basic_machine=$field1-unknown + basic_os=$field2 + ;; + # Manufacturers + dec* | mips* | sequent* | encore* | pc533* | sgi* | sony* \ + | att* | 7300* | 3300* | delta* | motorola* | sun[234]* \ + | unicom* | ibm* | next | hp | isi* | apollo | altos* \ + | convergent* | ncr* | news | 32* | 3600* | 3100* \ + | hitachi* | c[123]* | convex* | sun | crds | omron* | dg \ + | ultra | tti* | harris | dolphin | highlevel | gould \ + | cbm | ns | masscomp | apple | axis | knuth | cray \ + | microblaze* | sim | cisco \ + | oki | wec | wrs | winbond) + basic_machine=$field1-$field2 + basic_os= + ;; + *) + basic_machine=$field1 + basic_os=$field2 + ;; + esac + ;; + esac + ;; + *) + # Convert single-component short-hands not valid as part of + # multi-component configurations. + case $field1 in + 386bsd) + basic_machine=i386-pc + basic_os=bsd + ;; + a29khif) + basic_machine=a29k-amd + basic_os=udi + ;; + adobe68k) + basic_machine=m68010-adobe + basic_os=scout + ;; + alliant) + basic_machine=fx80-alliant + basic_os= + ;; + altos | altos3068) + basic_machine=m68k-altos + basic_os= + ;; + am29k) + basic_machine=a29k-none + basic_os=bsd + ;; + amdahl) + basic_machine=580-amdahl + basic_os=sysv + ;; + amiga) + basic_machine=m68k-unknown + basic_os= + ;; + amigaos | amigados) + basic_machine=m68k-unknown + basic_os=amigaos + ;; + amigaunix | amix) + basic_machine=m68k-unknown + basic_os=sysv4 + ;; + apollo68) + basic_machine=m68k-apollo + basic_os=sysv + ;; + apollo68bsd) + basic_machine=m68k-apollo + basic_os=bsd + ;; + aros) + basic_machine=i386-pc + basic_os=aros + ;; + aux) + basic_machine=m68k-apple + basic_os=aux + ;; + balance) + basic_machine=ns32k-sequent + basic_os=dynix + ;; + blackfin) + basic_machine=bfin-unknown + basic_os=linux + ;; + cegcc) + basic_machine=arm-unknown + basic_os=cegcc + ;; + convex-c1) + basic_machine=c1-convex + basic_os=bsd + ;; + convex-c2) + basic_machine=c2-convex + basic_os=bsd + ;; + convex-c32) + basic_machine=c32-convex + basic_os=bsd + ;; + convex-c34) + basic_machine=c34-convex + basic_os=bsd + ;; + convex-c38) + basic_machine=c38-convex + basic_os=bsd + ;; + cray) + basic_machine=j90-cray + basic_os=unicos + ;; + crds | unos) + basic_machine=m68k-crds + basic_os= + ;; + da30) + basic_machine=m68k-da30 + basic_os= + ;; + decstation | pmax | pmin | dec3100 | decstatn) + basic_machine=mips-dec + basic_os= + ;; + delta88) + basic_machine=m88k-motorola + basic_os=sysv3 + ;; + dicos) + basic_machine=i686-pc + basic_os=dicos + ;; + djgpp) + basic_machine=i586-pc + basic_os=msdosdjgpp + ;; + ebmon29k) + basic_machine=a29k-amd + basic_os=ebmon + ;; + es1800 | OSE68k | ose68k | ose | OSE) + basic_machine=m68k-ericsson + basic_os=ose + ;; + gmicro) + basic_machine=tron-gmicro + basic_os=sysv + ;; + go32) + basic_machine=i386-pc + basic_os=go32 + ;; + h8300hms) + basic_machine=h8300-hitachi + basic_os=hms + ;; + h8300xray) + basic_machine=h8300-hitachi + basic_os=xray + ;; + h8500hms) + basic_machine=h8500-hitachi + basic_os=hms + ;; + harris) + basic_machine=m88k-harris + basic_os=sysv3 + ;; + hp300 | hp300hpux) + basic_machine=m68k-hp + basic_os=hpux + ;; + hp300bsd) + basic_machine=m68k-hp + basic_os=bsd + ;; + hppaosf) + basic_machine=hppa1.1-hp + basic_os=osf + ;; + hppro) + basic_machine=hppa1.1-hp + basic_os=proelf + ;; + i386mach) + basic_machine=i386-mach + basic_os=mach + ;; + isi68 | isi) + basic_machine=m68k-isi + basic_os=sysv + ;; + m68knommu) + basic_machine=m68k-unknown + basic_os=linux + ;; + magnum | m3230) + basic_machine=mips-mips + basic_os=sysv + ;; + merlin) + basic_machine=ns32k-utek + basic_os=sysv + ;; + mingw64) + basic_machine=x86_64-pc + basic_os=mingw64 + ;; + mingw32) + basic_machine=i686-pc + basic_os=mingw32 + ;; + mingw32ce) + basic_machine=arm-unknown + basic_os=mingw32ce + ;; + monitor) + basic_machine=m68k-rom68k + basic_os=coff + ;; + morphos) + basic_machine=powerpc-unknown + basic_os=morphos + ;; + moxiebox) + basic_machine=moxie-unknown + basic_os=moxiebox + ;; + msdos) + basic_machine=i386-pc + basic_os=msdos + ;; + msys) + basic_machine=i686-pc + basic_os=msys + ;; + mvs) + basic_machine=i370-ibm + basic_os=mvs + ;; + nacl) + basic_machine=le32-unknown + basic_os=nacl + ;; + ncr3000) + basic_machine=i486-ncr + basic_os=sysv4 + ;; + netbsd386) + basic_machine=i386-pc + basic_os=netbsd + ;; + netwinder) + basic_machine=armv4l-rebel + basic_os=linux + ;; + news | news700 | news800 | news900) + basic_machine=m68k-sony + basic_os=newsos + ;; + news1000) + basic_machine=m68030-sony + basic_os=newsos + ;; + necv70) + basic_machine=v70-nec + basic_os=sysv + ;; + nh3000) + basic_machine=m68k-harris + basic_os=cxux + ;; + nh[45]000) + basic_machine=m88k-harris + basic_os=cxux + ;; + nindy960) + basic_machine=i960-intel + basic_os=nindy + ;; + mon960) + basic_machine=i960-intel + basic_os=mon960 + ;; + nonstopux) + basic_machine=mips-compaq + basic_os=nonstopux + ;; + os400) + basic_machine=powerpc-ibm + basic_os=os400 + ;; + OSE68000 | ose68000) + basic_machine=m68000-ericsson + basic_os=ose + ;; + os68k) + basic_machine=m68k-none + basic_os=os68k + ;; + paragon) + basic_machine=i860-intel + basic_os=osf + ;; + parisc) + basic_machine=hppa-unknown + basic_os=linux + ;; + psp) + basic_machine=mipsallegrexel-sony + basic_os=psp + ;; + pw32) + basic_machine=i586-unknown + basic_os=pw32 + ;; + rdos | rdos64) + basic_machine=x86_64-pc + basic_os=rdos + ;; + rdos32) + basic_machine=i386-pc + basic_os=rdos + ;; + rom68k) + basic_machine=m68k-rom68k + basic_os=coff + ;; + sa29200) + basic_machine=a29k-amd + basic_os=udi + ;; + sei) + basic_machine=mips-sei + basic_os=seiux + ;; + sequent) + basic_machine=i386-sequent + basic_os= + ;; + sps7) + basic_machine=m68k-bull + basic_os=sysv2 + ;; + st2000) + basic_machine=m68k-tandem + basic_os= + ;; + stratus) + basic_machine=i860-stratus + basic_os=sysv4 + ;; + sun2) + basic_machine=m68000-sun + basic_os= + ;; + sun2os3) + basic_machine=m68000-sun + basic_os=sunos3 + ;; + sun2os4) + basic_machine=m68000-sun + basic_os=sunos4 + ;; + sun3) + basic_machine=m68k-sun + basic_os= + ;; + sun3os3) + basic_machine=m68k-sun + basic_os=sunos3 + ;; + sun3os4) + basic_machine=m68k-sun + basic_os=sunos4 + ;; + sun4) + basic_machine=sparc-sun + basic_os= + ;; + sun4os3) + basic_machine=sparc-sun + basic_os=sunos3 + ;; + sun4os4) + basic_machine=sparc-sun + basic_os=sunos4 + ;; + sun4sol2) + basic_machine=sparc-sun + basic_os=solaris2 + ;; + sun386 | sun386i | roadrunner) + basic_machine=i386-sun + basic_os= + ;; + sv1) + basic_machine=sv1-cray + basic_os=unicos + ;; + symmetry) + basic_machine=i386-sequent + basic_os=dynix + ;; + t3e) + basic_machine=alphaev5-cray + basic_os=unicos + ;; + t90) + basic_machine=t90-cray + basic_os=unicos + ;; + toad1) + basic_machine=pdp10-xkl + basic_os=tops20 + ;; + tpf) + basic_machine=s390x-ibm + basic_os=tpf + ;; + udi29k) + basic_machine=a29k-amd + basic_os=udi + ;; + ultra3) + basic_machine=a29k-nyu + basic_os=sym1 + ;; + v810 | necv810) + basic_machine=v810-nec + basic_os=none + ;; + vaxv) + basic_machine=vax-dec + basic_os=sysv + ;; + vms) + basic_machine=vax-dec + basic_os=vms + ;; + vsta) + basic_machine=i386-pc + basic_os=vsta + ;; + vxworks960) + basic_machine=i960-wrs + basic_os=vxworks + ;; + vxworks68) + basic_machine=m68k-wrs + basic_os=vxworks + ;; + vxworks29k) + basic_machine=a29k-wrs + basic_os=vxworks + ;; + xbox) + basic_machine=i686-pc + basic_os=mingw32 + ;; + ymp) + basic_machine=ymp-cray + basic_os=unicos + ;; + *) + basic_machine=$1 + basic_os= + ;; + esac + ;; +esac + +# Decode 1-component or ad-hoc basic machines +case $basic_machine in + # Here we handle the default manufacturer of certain CPU types. It is in + # some cases the only manufacturer, in others, it is the most popular. + w89k) + cpu=hppa1.1 + vendor=winbond + ;; + op50n) + cpu=hppa1.1 + vendor=oki + ;; + op60c) + cpu=hppa1.1 + vendor=oki + ;; + ibm*) + cpu=i370 + vendor=ibm + ;; + orion105) + cpu=clipper + vendor=highlevel + ;; + mac | mpw | mac-mpw) + cpu=m68k + vendor=apple + ;; + pmac | pmac-mpw) + cpu=powerpc + vendor=apple + ;; + + # Recognize the various machine names and aliases which stand + # for a CPU type and a company and sometimes even an OS. + 3b1 | 7300 | 7300-att | att-7300 | pc7300 | safari | unixpc) + cpu=m68000 + vendor=att + ;; + 3b*) + cpu=we32k + vendor=att + ;; + bluegene*) + cpu=powerpc + vendor=ibm + basic_os=cnk + ;; + decsystem10* | dec10*) + cpu=pdp10 + vendor=dec + basic_os=tops10 + ;; + decsystem20* | dec20*) + cpu=pdp10 + vendor=dec + basic_os=tops20 + ;; + delta | 3300 | motorola-3300 | motorola-delta \ + | 3300-motorola | delta-motorola) + cpu=m68k + vendor=motorola + ;; + dpx2*) + cpu=m68k + vendor=bull + basic_os=sysv3 + ;; + encore | umax | mmax) + cpu=ns32k + vendor=encore + ;; + elxsi) + cpu=elxsi + vendor=elxsi + basic_os=${basic_os:-bsd} + ;; + fx2800) + cpu=i860 + vendor=alliant + ;; + genix) + cpu=ns32k + vendor=ns + ;; + h3050r* | hiux*) + cpu=hppa1.1 + vendor=hitachi + basic_os=hiuxwe2 + ;; + hp3k9[0-9][0-9] | hp9[0-9][0-9]) + cpu=hppa1.0 + vendor=hp + ;; + hp9k2[0-9][0-9] | hp9k31[0-9]) + cpu=m68000 + vendor=hp + ;; + hp9k3[2-9][0-9]) + cpu=m68k + vendor=hp + ;; + hp9k6[0-9][0-9] | hp6[0-9][0-9]) + cpu=hppa1.0 + vendor=hp + ;; + hp9k7[0-79][0-9] | hp7[0-79][0-9]) + cpu=hppa1.1 + vendor=hp + ;; + hp9k78[0-9] | hp78[0-9]) + # FIXME: really hppa2.0-hp + cpu=hppa1.1 + vendor=hp + ;; + hp9k8[67]1 | hp8[67]1 | hp9k80[24] | hp80[24] | hp9k8[78]9 | hp8[78]9 | hp9k893 | hp893) + # FIXME: really hppa2.0-hp + cpu=hppa1.1 + vendor=hp + ;; + hp9k8[0-9][13679] | hp8[0-9][13679]) + cpu=hppa1.1 + vendor=hp + ;; + hp9k8[0-9][0-9] | hp8[0-9][0-9]) + cpu=hppa1.0 + vendor=hp + ;; + i*86v32) + cpu=`echo "$1" | sed -e 's/86.*/86/'` + vendor=pc + basic_os=sysv32 + ;; + i*86v4*) + cpu=`echo "$1" | sed -e 's/86.*/86/'` + vendor=pc + basic_os=sysv4 + ;; + i*86v) + cpu=`echo "$1" | sed -e 's/86.*/86/'` + vendor=pc + basic_os=sysv + ;; + i*86sol2) + cpu=`echo "$1" | sed -e 's/86.*/86/'` + vendor=pc + basic_os=solaris2 + ;; + j90 | j90-cray) + cpu=j90 + vendor=cray + basic_os=${basic_os:-unicos} + ;; + iris | iris4d) + cpu=mips + vendor=sgi + case $basic_os in + irix*) + ;; + *) + basic_os=irix4 + ;; + esac + ;; + miniframe) + cpu=m68000 + vendor=convergent + ;; + *mint | mint[0-9]* | *MiNT | *MiNT[0-9]*) + cpu=m68k + vendor=atari + basic_os=mint + ;; + news-3600 | risc-news) + cpu=mips + vendor=sony + basic_os=newsos + ;; + next | m*-next) + cpu=m68k + vendor=next + case $basic_os in + openstep*) + ;; + nextstep*) + ;; + ns2*) + basic_os=nextstep2 + ;; + *) + basic_os=nextstep3 + ;; + esac + ;; + np1) + cpu=np1 + vendor=gould + ;; + op50n-* | op60c-*) + cpu=hppa1.1 + vendor=oki + basic_os=proelf + ;; + pa-hitachi) + cpu=hppa1.1 + vendor=hitachi + basic_os=hiuxwe2 + ;; + pbd) + cpu=sparc + vendor=tti + ;; + pbb) + cpu=m68k + vendor=tti + ;; + pc532) + cpu=ns32k + vendor=pc532 + ;; + pn) + cpu=pn + vendor=gould + ;; + power) + cpu=power + vendor=ibm + ;; + ps2) + cpu=i386 + vendor=ibm + ;; + rm[46]00) + cpu=mips + vendor=siemens + ;; + rtpc | rtpc-*) + cpu=romp + vendor=ibm + ;; + sde) + cpu=mipsisa32 + vendor=sde + basic_os=${basic_os:-elf} + ;; + simso-wrs) + cpu=sparclite + vendor=wrs + basic_os=vxworks + ;; + tower | tower-32) + cpu=m68k + vendor=ncr + ;; + vpp*|vx|vx-*) + cpu=f301 + vendor=fujitsu + ;; + w65) + cpu=w65 + vendor=wdc + ;; + w89k-*) + cpu=hppa1.1 + vendor=winbond + basic_os=proelf + ;; + none) + cpu=none + vendor=none + ;; + leon|leon[3-9]) + cpu=sparc + vendor=$basic_machine + ;; + leon-*|leon[3-9]-*) + cpu=sparc + vendor=`echo "$basic_machine" | sed 's/-.*//'` + ;; + + *-*) + # shellcheck disable=SC2162 + saved_IFS=$IFS + IFS="-" read cpu vendor <&2 + exit 1 + ;; + esac + ;; +esac + +# Here we canonicalize certain aliases for manufacturers. +case $vendor in + digital*) + vendor=dec + ;; + commodore*) + vendor=cbm + ;; + *) + ;; +esac + +# Decode manufacturer-specific aliases for certain operating systems. + +if test x$basic_os != x +then + +# First recognize some ad-hoc cases, or perhaps split kernel-os, or else just +# set os. +case $basic_os in + gnu/linux*) + kernel=linux + os=`echo "$basic_os" | sed -e 's|gnu/linux|gnu|'` + ;; + os2-emx) + kernel=os2 + os=`echo "$basic_os" | sed -e 's|os2-emx|emx|'` + ;; + nto-qnx*) + kernel=nto + os=`echo "$basic_os" | sed -e 's|nto-qnx|qnx|'` + ;; + *-*) + # shellcheck disable=SC2162 + saved_IFS=$IFS + IFS="-" read kernel os <&2 + exit 1 + ;; +esac + +# As a final step for OS-related things, validate the OS-kernel combination +# (given a valid OS), if there is a kernel. +case $kernel-$os in + linux-gnu* | linux-dietlibc* | linux-android* | linux-newlib* \ + | linux-musl* | linux-relibc* | linux-uclibc* ) + ;; + uclinux-uclibc* ) + ;; + -dietlibc* | -newlib* | -musl* | -relibc* | -uclibc* ) + # These are just libc implementations, not actual OSes, and thus + # require a kernel. + echo "Invalid configuration \`$1': libc \`$os' needs explicit kernel." 1>&2 + exit 1 + ;; + kfreebsd*-gnu* | kopensolaris*-gnu*) + ;; + vxworks-simlinux | vxworks-simwindows | vxworks-spe) + ;; + nto-qnx*) + ;; + os2-emx) + ;; + *-eabi* | *-gnueabi*) + ;; + -*) + # Blank kernel with real OS is always fine. + ;; + *-*) + echo "Invalid configuration \`$1': Kernel \`$kernel' not known to work with OS \`$os'." 1>&2 + exit 1 + ;; +esac + +# Here we handle the case where we know the os, and the CPU type, but not the +# manufacturer. We pick the logical manufacturer. +case $vendor in + unknown) + case $cpu-$os in + *-riscix*) + vendor=acorn + ;; + *-sunos*) + vendor=sun + ;; + *-cnk* | *-aix*) + vendor=ibm + ;; + *-beos*) + vendor=be + ;; + *-hpux*) + vendor=hp + ;; + *-mpeix*) + vendor=hp + ;; + *-hiux*) + vendor=hitachi + ;; + *-unos*) + vendor=crds + ;; + *-dgux*) + vendor=dg + ;; + *-luna*) + vendor=omron + ;; + *-genix*) + vendor=ns + ;; + *-clix*) + vendor=intergraph + ;; + *-mvs* | *-opened*) + vendor=ibm + ;; + *-os400*) + vendor=ibm + ;; + s390-* | s390x-*) + vendor=ibm + ;; + *-ptx*) + vendor=sequent + ;; + *-tpf*) + vendor=ibm + ;; + *-vxsim* | *-vxworks* | *-windiss*) + vendor=wrs + ;; + *-aux*) + vendor=apple + ;; + *-hms*) + vendor=hitachi + ;; + *-mpw* | *-macos*) + vendor=apple + ;; + *-*mint | *-mint[0-9]* | *-*MiNT | *-MiNT[0-9]*) + vendor=atari + ;; + *-vos*) + vendor=stratus + ;; + esac + ;; +esac + +echo "$cpu-$vendor-${kernel:+$kernel-}$os" +exit + +# Local variables: +# eval: (add-hook 'before-save-hook 'time-stamp) +# time-stamp-start: "timestamp='" +# time-stamp-format: "%:y-%02m-%02d" +# time-stamp-end: "'" +# End: diff --git a/recipes/clustalw/meta.yaml b/recipes/clustalw/meta.yaml index a8ef603ac467b..0a24762959d42 100644 --- a/recipes/clustalw/meta.yaml +++ b/recipes/clustalw/meta.yaml @@ -9,7 +9,10 @@ source: - patch # [osx] build: - number: 9 + number: 10 + run_exports: + - {{ pin_subpackage('clustalw', max_pin="x.x") }} + requirements: build: @@ -27,6 +30,8 @@ about: summary: ClustalW2 is a general purpose multiple sequence alignment program for DNA or proteins. extra: + additional-platforms: + - linux-aarch64 skip-lints: - should_not_be_noarch_source identifiers: diff --git a/recipes/cmappy/meta.yaml b/recipes/cmappy/meta.yaml index 196a2880e7b0d..69d6ac37d40e1 100644 --- a/recipes/cmappy/meta.yaml +++ b/recipes/cmappy/meta.yaml @@ -15,9 +15,11 @@ build: - gct2gctx=cmapPy.pandasGEXpress.gct2gctx:main - concat=cmapPy.pandasGEXpress.concat:main - subset=cmapPy.pandasGEXpress.subset:main - number: 5 + number: 6 skip: True # [py<30] script: {{ PYTHON }} -m pip install . --no-deps -vv + run_exports: + - {{ pin_subpackage('cmappy', max_pin='x') }} requirements: build: @@ -50,3 +52,7 @@ about: license_family: BSD summary: Assorted tools for interacting with .gct, .gctx, .grp, and .gmt files as well as other Connectivity Map (Broad Institute) data/tools + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/cmat/meta.yaml b/recipes/cmat/meta.yaml index 69e11aa455e27..ecfe125c94af4 100644 --- a/recipes/cmat/meta.yaml +++ b/recipes/cmat/meta.yaml @@ -1,5 +1,5 @@ {% set name = "cmat" %} -{% set version = "3.1.0" %} +{% set version = "3.1.2" %} package: name: {{ name }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/EBIvariation/CMAT/archive/v{{version}}.tar.gz - sha256: 1e46a83d3d7e46a41f9f62ff4af0c151851fbbebc1c6b129255f987d75b64079 + sha256: bac2b83970c76bdb50b18f5555f689b0e8522ddd60fc73ab6a6f16b640c94a73 build: number: 0 @@ -61,4 +61,4 @@ about: extra: recipe-maintainers: - - apriltuesday \ No newline at end of file + - apriltuesday diff --git a/recipes/cnvkit/meta.yaml b/recipes/cnvkit/meta.yaml index b4fce96ae4f94..f39326c930829 100644 --- a/recipes/cnvkit/meta.yaml +++ b/recipes/cnvkit/meta.yaml @@ -1,37 +1,43 @@ -{% set version="0.9.10" %} +{% set name = "cnvkit" %} +{% set version = "0.9.11" %} + package: - name: cnvkit + name: {{ name }} version: {{ version }} source: url: https://github.com/etal/cnvkit/archive/v{{ version }}.tar.gz - sha256: 56739496f1f59511661107e662d81e5fd8af413571e853b0a1b34d882a19349a + sha256: 1763936427184270108fd51219ebc82f542e28339bdec587579b8745f61179a8 build: noarch: python number: 0 - script: {{ PYTHON }} -m pip install . --no-deps -vv + entry_points: + - cnvkit.py = cnvlib.cnvkit:main + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation --no-cache-dir -vvv + run_exports: + - {{ pin_subpackage('cnvkit', max_pin="x.x") }} requirements: host: - - python >=3.5 + - python >=3.8 - pip run: - - python >=3.5 + - python >=3.8 - bioconductor-dnacopy - - biopython >=1.62 - - joblib <1.0 - - matplotlib-base >=1.3.1 + - biopython >=1.80 + - matplotlib-base >=3.5.2 - networkx >=2.4 - - numpy >=1.9 - - pandas >=0.23.3 - - pomegranate >=0.9.0 - - pyfaidx >=0.4.7 - - pysam >=0.16.0 + - numpy >=1.24.2 + - pandas >=1.5.3 + - pomegranate >=0.14.8,<=0.14.9 + - pyfaidx >=0.7.1 + - pysam >=0.20.0 - r-base >=3.4.1 - r-cghflasso - - reportlab >=3.0 - - scipy >=0.15.0 + - reportlab >=3.6.12 + - scikit-learn >=1.1.0 + - scipy >=1.10.1 test: imports: @@ -45,9 +51,30 @@ test: about: home: https://github.com/etal/cnvkit license: Apache-2.0 + license_family: APACHE + license_file: LICENSE summary: Copy number variant detection from high-throughput sequencing + dev_url: https://github.com/etal/cnvkit + doc_url: https://cnvkit.readthedocs.io/en/stable/ extra: identifiers: - biotools:cnvkit - doi:10.1371/journal.pcbi.1004873 + - usegalaxy-eu:cnvkit_access + - usegalaxy-eu:cnvkit_antitarget + - usegalaxy-eu:cnvkit_autobin + - usegalaxy-eu:cnvkit_batch + - usegalaxy-eu:cnvkit_call + - usegalaxy-eu:cnvkit_coverage + - usegalaxy-eu:cnvkit_diagram + - usegalaxy-eu:cnvkit_fix + - usegalaxy-eu:cnvkit_heatmap + - usegalaxy-eu:cnvkit_reference + - usegalaxy-eu:cnvkit_scatter + - usegalaxy-eu:cnvkit_segment + - usegalaxy-eu:cnvkit_target + - usegalaxy-eu:cnvkit_breaks + - usegalaxy-eu:cnvkit_genemetrics + - usegalaxy-eu:cnvkit_segmetrics + - usegalaxy-eu:cnvkit_sex diff --git a/recipes/coatran/build.sh b/recipes/coatran/build.sh index b0e17ef5d4f51..3fb84cb72e5d8 100644 --- a/recipes/coatran/build.sh +++ b/recipes/coatran/build.sh @@ -2,4 +2,4 @@ mkdir -p ${PREFIX}/bin make CXX=${CXX} -cp {coatran_constant,coatran_expgrowth,coatran_transtree,coatran_inftime} ${PREFIX}/bin +cp coatran_* ${PREFIX}/bin diff --git a/recipes/coatran/meta.yaml b/recipes/coatran/meta.yaml index 92dea311f4897..73c066d76d605 100644 --- a/recipes/coatran/meta.yaml +++ b/recipes/coatran/meta.yaml @@ -1,43 +1,43 @@ -{% set name = "CoaTran" %} -{% set version = "0.0.1" %} -{% set commit = "e0d34b0" %} -{% set sha256 = "a20c263675ec34ecbfd08eecfaa639aa5b6fb7648b5d27fdf41cec9f8eb8cce0" %} +{% set name = "coatran" %} +{% set version = "0.0.4" %} package: - name: "{{ name|lower }}" - version: "{{ version }}" - -source: - url: "https://github.com/niemasd/CoaTran/archive/{{ commit }}.zip" - sha256: {{ sha256}} + name: {{ name }} + version: {{ version }} build: - number: 3 + number: 0 + run_exports: + - {{ pin_subpackage('coatran', max_pin="x.x.x") }} + +source: + url: https://github.com/niemasd/CoaTran/archive/refs/tags/{{ version }}.tar.gz + sha256: b0af9eff5c78a7126ce5f36386c3c514e811d3470392a7a18566195e40765456 requirements: build: - - make + - {{ compiler('c') }} - {{ compiler('cxx') }} - host: - run: - -test: - commands: - - coatran_constant --help 2>&1 | grep CoaTran - - coatran_expgrowth --help 2>&1 | grep CoaTran - - coatran_transtree --help 2>&1 | grep CoaTran - - coatran_inftime --help 2>&1 | grep CoaTran + - make about: - home: "https://github.com/niemasd/CoaTran" - license: GPLv3 - license_family: GPL + home: https://github.com/niemasd/CoaTran + license: GPL-3.0-or-later + license_family: GPL3 license_file: LICENSE - summary: "CoaTran: Coalescent tree simulation along a transmission network" - dev_url: "https://github.com/niemasd/CoaTran" + summary: Coalescent tree simulation along a transmission network + dev_url: https://github.com/niemasd/CoaTran + +test: + commands: + - coatran_constant -h 2>&1 | grep "CoaTran" + - coatran_inftime -h 2>&1 | grep "CoaTran" + - coatran_transtree -h 2>&1 | grep "CoaTran" extra: identifiers: - biotools:coatran + - doi:10.1101/2020.11.10.377499 recipe-maintainers: - acaprez + - niemasd diff --git a/recipes/cobra-meta/meta.yaml b/recipes/cobra-meta/meta.yaml index 509ff1273ccc4..75e252817b53c 100644 --- a/recipes/cobra-meta/meta.yaml +++ b/recipes/cobra-meta/meta.yaml @@ -1,5 +1,5 @@ {% set name = "cobra-meta" %} -{% set version = "1.2.2" %} +{% set version = "1.2.3" %} package: name: {{ name }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/linxingchen/cobra/archive/refs/tags/v{{ version }}.tar.gz - sha256: 26f3cab513f8bb78d0aeb5ccfa3aed57bafb62f42bee1ac814e74e43c330a390 + sha256: 877813cd705cb5a8b3611f3fca705bb6576ba82a8283552bed73c34bec880375 build: entry_points: diff --git a/recipes/cogent3/meta.yaml b/recipes/cogent3/meta.yaml index 8b5b4792d7e2f..a113597567360 100644 --- a/recipes/cogent3/meta.yaml +++ b/recipes/cogent3/meta.yaml @@ -1,5 +1,5 @@ {% set name = "cogent3" %} -{% set version = "2023.12.15a1" %} +{% set version = "2024.2.5a1" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 8cccfdb39aff746c9225b1e063a6506502c840276c843bcb93fea10bb2f31bfb + sha256: 4b0d59ba1c31b8257a56258d992fb201b53f265aa6f041da24ed9dc412a7782f build: noarch: python diff --git a/recipes/colabfold/meta.yaml b/recipes/colabfold/meta.yaml index c8c5024145ad6..c69bc9d8395a3 100644 --- a/recipes/colabfold/meta.yaml +++ b/recipes/colabfold/meta.yaml @@ -14,7 +14,7 @@ build: python -m pip install --no-deps --ignore-installed alphafold/ run_exports: - {{ pin_subpackage('colabfold', max_pin="x") }} - number: 0 + number: 2 source: - url: https://github.com/sokrypton/ColabFold/archive/refs/tags/v{{ cf_version }}.tar.gz @@ -43,11 +43,11 @@ requirements: - dm-tree - ml-collections - importlib-metadata - - dm-haiku ==0.0.10 + - dm-haiku >=0.0.12 - biopython <=1.82 - - jax >=0.4.14 - - jaxlib >=0.4.14 - - tensorflow >=2.12.1=cpu* + - jax >=0.4.23,<0.4.26 + - jaxlib >=0.4.23,<0.4.26 + - tensorflow-base >=2.12.1=cpu* - mmseqs2 >=15.6f452 - kalign2 >=2.04 - hhsuite >=3.3.0 diff --git a/recipes/comebin/meta.yaml b/recipes/comebin/meta.yaml index 655515c4b5f9f..3b95de96aefd5 100644 --- a/recipes/comebin/meta.yaml +++ b/recipes/comebin/meta.yaml @@ -1,10 +1,10 @@ package: name: comebin - version: "1.0.3" + version: "1.0.4" source: - url: https://github.com/ziyewang/COMEBin/archive/refs/tags/1.0.3.tar.gz - sha256: 27001cff1029ddf492da18ba8f4db18c055f48e062237bb9e17ad65ed7602930 + url: https://github.com/ziyewang/COMEBin/archive/refs/tags/1.0.4.tar.gz + sha256: 63726b4ae450c0ca366845d46f2065326a83454b2c7f87cec5b53adc9527be22 build: number: 0 diff --git a/recipes/comet-ms/build.sh b/recipes/comet-ms/build.sh index 4201a024dcc62..f7a9edbb36ae9 100644 --- a/recipes/comet-ms/build.sh +++ b/recipes/comet-ms/build.sh @@ -5,10 +5,13 @@ set -x export INCLUDE_PATH="${PREFIX}/MSToolkit/include" export CPPFLAGS="-I${PREFIX}/MSToolkit/include" +# To switch from static to dynamic linking on linux. The Makefile does not have this flag for macOS +# Dynamic linking does not work with mulled container tests +#sed -i.bak 's#-static##' Makefile sed -i.bak "s#gcc#${CC}#;s#g++#${CXX}#" MSToolkit/Makefile sed -i.bak "s#gcc#${CC}#;s#g++#${CXX}#" CometSearch/Makefile -make CXX=${CXX} +make CXX=${CXX} -j ${CPU_COUNT} mkdir -p "$PREFIX"/bin cp comet.exe ${PREFIX}/bin/comet diff --git a/recipes/comet-ms/meta.yaml b/recipes/comet-ms/meta.yaml index ca7c83e01a164..66057b41ec387 100644 --- a/recipes/comet-ms/meta.yaml +++ b/recipes/comet-ms/meta.yaml @@ -1,25 +1,29 @@ {% set name = "comet-ms" %} -{% set version = "2023010" %} -{% set md5 = "f1899e07eeeefddedf22b93133f9aea8" %} +{% set version = "2023012" %} +{% set md5 = "d60433652e5a5e682288ddbdfb014eb4" %} package: name: {{ name }} version: {{ version }} source: - url: https://github.com/UWPR/Comet/archive/refs/tags/v2023.01.0.zip + url: https://github.com/UWPR/Comet/archive/refs/tags/v2023.01.2.zip md5: {{ md5 }} build: + run_exports: + - {{ pin_subpackage('comet-ms', max_pin=None) }} skip: True # [osx] - number: 2 + number: 1 requirements: build: - make + - unzip - {{ compiler('c') }} - {{ compiler('cxx') }} - - unzip + # To have clock_gettime in glibc. Linking to librt did not work due to inflexible Makefiles + - sysroot_linux-64 2.17 # [linux64] test: commands: @@ -32,6 +36,8 @@ about: summary: 'Comet is a command line tool that does MS/MS database search.' extra: + additional-platforms: + - linux-aarch64 identifiers: - doi:10.1007/s13361-015-1179-x - doi:10.1002/pmic.201200439 diff --git a/recipes/compleasm/meta.yaml b/recipes/compleasm/meta.yaml index db6a28c2c338e..3a880d2db517b 100644 --- a/recipes/compleasm/meta.yaml +++ b/recipes/compleasm/meta.yaml @@ -1,6 +1,6 @@ {% set name = "compleasm" %} -{% set version = "0.2.5" %} -{% set hash = "d2da3f30cf6850daf8328f78986e6bfb6fac1baf2b4b207a14f2180a659a04c7" %} +{% set version = "0.2.6" %} +{% set hash = "298a50064b3ada90089912844e40c174de49c976a19ccb53d3645f312649ad25" %} package: name: "{{ name|lower }}" diff --git a/recipes/condiga/meta.yaml b/recipes/condiga/meta.yaml index 49725a4d226b7..bc43a45207ab8 100644 --- a/recipes/condiga/meta.yaml +++ b/recipes/condiga/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ConDiGA" %} -{% set version = "0.2.1" %} +{% set version = "0.2.2" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://github.com/metagentools/{{ name }}/archive/v{{ version }}.tar.gz" - sha256: adde1cc9808f3d1b174309affc385464880968a33434f2de411e099686c1aec2 + sha256: 492bcf86bfceff50af12c230e98284f9422330d6d2840280c0eb3fed3fd843ed build: number: 0 @@ -15,14 +15,16 @@ build: entry_points: - convert=condiga_utils.support.convert:main script: - - "{{ PYTHON }} -m pip install . -vv" + - "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('condiga', max_pin="x.x") }} requirements: host: - pip - - python + - python >=3.8 run: - - python + - python >=3.8 - click - biopython - xlsxwriter diff --git a/recipes/cooltools/meta.yaml b/recipes/cooltools/meta.yaml index 13642309de7a2..b85e63fb65783 100644 --- a/recipes/cooltools/meta.yaml +++ b/recipes/cooltools/meta.yaml @@ -1,5 +1,5 @@ {% set name = "cooltools" %} -{% set version = "0.6.1" %} +{% set version = "0.7.0" %} package: name: "{{ name|lower }}" @@ -7,14 +7,14 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 1082186215c1215b1f1192b1c5dd2d103e0db6df3dca3a9e49ec15676f5c0adb + sha256: 8b26d4857cc76b2dd3d1097b85f828cf6d5f1cf85b0cfd4b67a310e33e7ece1c build: number: 0 - skip: True # [py <= 37] + skip: True # [py < 37] entry_points: - cooltools = cooltools.cli:cli - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" run_exports: - {{ pin_subpackage('cooltools', max_pin="x.x") }} @@ -25,16 +25,17 @@ requirements: - cython - pip - python - - numpy <1.24 + - numpy run: - bioframe >=0.4.1 - click >=7 - cooler >=0.9.1 - joblib - matplotlib-base + - multiprocess - numba - - numpy <1.24 # remove constraint once https://github.com/numba/numba/issues/8615 has been resolved - - pandas >=1.5.1,<2 #Temporary upper ceiling + - {{ pin_compatible('numpy') }} + - pandas >=1.5.1 - python - scikit-learn >=1.1.2 - scipy diff --git a/recipes/cosg/meta.yaml b/recipes/cosg/meta.yaml new file mode 100644 index 0000000000000..71dc651904859 --- /dev/null +++ b/recipes/cosg/meta.yaml @@ -0,0 +1,48 @@ +{% set name = "cosg" %} +{% set version = "1.0.1" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/cosg-{{ version }}.tar.gz + sha256: 258ca73066ac6cbe5121cf78d5e047b48b9372c9b448ecaeb3fb67dc9f7e759c + +build: + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} + +requirements: + host: + - python + - pip + run: + - python + - anndata >=0.7.4 + - numpy >=1.17.0 + - pandas >=0.21 + - scanpy >=1.6.0 + - scikit-learn >=0.21.2 + - scipy >=1.4 + +test: + imports: + - cosg + commands: + - pip check + requires: + - pip + +about: + home: https://github.com/genecell/COSG + summary: Accurate and fast cell marker gene identification with COSG + license: BSD-3-Clause + license_file: LICENSE + +extra: + recipe-maintainers: + - heylf diff --git a/recipes/coverm/meta.yaml b/recipes/coverm/meta.yaml index 7e12b62eb8ef2..90634a04ae368 100644 --- a/recipes/coverm/meta.yaml +++ b/recipes/coverm/meta.yaml @@ -1,14 +1,16 @@ -{% set version = "0.6.1" %} +{% set version = "0.7.0" %} {% set name = "coverm" %} -{% set sha256 = "b6211e6f89ef986691b910d7d7b4c6d1e9eb9beb64e4f71902178ed60d27f4e6" %} +{% set sha256 = "539142529d2590166e98ed399db36913fbf8b256d8c74a1966acae849c18a828" %} package: name: {{ name }} version: {{ version }} build: - number: 6 + number: 0 skip: True # [osx] + run_exports: + - {{ pin_subpackage('coverm', max_pin="x.x") }} source: url: https://github.com/wwood/{{ name }}/archive/v{{ version }}.tar.gz @@ -21,6 +23,8 @@ requirements: - {{ compiler('cxx') }} - clangdev # one of the rust submodules explicitly requires clang. As it's statically compiled that will hopefully work - pkg-config + - make + - cmake host: - zlib - gsl @@ -43,4 +47,5 @@ test: about: home: https://github.com/wwood/CoverM license: GPL3 + license_family: GPL3 summary: CoverM aims to be a configurable, easy to use and fast DNA read coverage and relative abundance calculator focused on metagenomics applications diff --git a/recipes/cpat/build.sh b/recipes/cpat/build.sh new file mode 100644 index 0000000000000..ea41484c36517 --- /dev/null +++ b/recipes/cpat/build.sh @@ -0,0 +1,9 @@ +#!/bin/bash + +${PYTHON} -m pip install . --no-deps --ignore-installed -vv + +# Prefix '.py' has been removed from v3.0.5 +# symlinking for reverse compatibility, as suggested in release notes +ln -s ${PREFIX}/bin/cpat ${PREFIX}/bin/cpat.py +ln -s ${PREFIX}/bin/make_hexamer_tab ${PREFIX}/bin/make_hexamer_tab.py +ln -s ${PREFIX}/bin/make_logitModel ${PREFIX}/bin/make_logitModel.py diff --git a/recipes/cpat/meta.yaml b/recipes/cpat/meta.yaml index 7303729af7f68..749a4451c6ab6 100644 --- a/recipes/cpat/meta.yaml +++ b/recipes/cpat/meta.yaml @@ -1,18 +1,19 @@ {% set name = "CPAT" %} -{% set version = "3.0.4" %} +{% set version = "3.0.5" %} package: name: "{{ name|lower }}" version: "{{ version }}" build: - number: 2 - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv " + number: 0 skip: True # [py2k or py > 39] + run_exports: + - {{ pin_subpackage('cpat', max_pin="x") }} source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 6d832f20729f8fc814384a27a4fcebcf81b11c0e6d80a404b4c4860d17e7d935 + sha256: ea7c9216208221f68055f962073622939ff90bbe52ebe36c305ead9f91ed24bc requirements: build: @@ -40,6 +41,6 @@ test: about: home: https://cpat.readthedocs.io/en/latest/ - license: GNU General Public v2 or later (GPLv2+) + license: GPL-2.0-or-later license_file: LICENSE.txt summary: Coding Potential Assessment Tool diff --git a/recipes/cptac/meta.yaml b/recipes/cptac/meta.yaml index 8a64077d86dde..650ccc357ca33 100644 --- a/recipes/cptac/meta.yaml +++ b/recipes/cptac/meta.yaml @@ -1,5 +1,5 @@ {% set name = "cptac" %} -{% set version = "1.5.10" %} +{% set version = "1.5.13" %} package: @@ -8,7 +8,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 85176554062e73dd0226027baa876357056acd4c81e233082403817252e4fa1e + sha256: be96ee2ed931625aa80d9e876163a4343afed2e2f82e7851231176058cc393c5 build: number: 0 diff --git a/recipes/cramino/meta.yaml b/recipes/cramino/meta.yaml index 0d07842df6aad..ae53c0a7a5a9d 100644 --- a/recipes/cramino/meta.yaml +++ b/recipes/cramino/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.13.1" %} +{% set version = "0.14.5" %} package: name: cramino @@ -12,7 +12,7 @@ build: source: url: https://github.com/wdecoster/cramino/archive/v{{ version }}.tar.gz - sha256: 92e60915b2fccacb21f2c5b71253b667615e1a99f964f232569122458cf64c40 + sha256: d3b31ab76808ca76171e2539cfe30e66fe24cbd4af4ff9a941c282a0bc438032 requirements: build: diff --git a/recipes/crispector/meta.yaml b/recipes/crispector/meta.yaml index eead4a143981d..0032615c4b7e3 100644 --- a/recipes/crispector/meta.yaml +++ b/recipes/crispector/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.0.4" %} +{% set version = "1.0.7" %} package: name: crispector @@ -10,10 +10,12 @@ build: - crispector = crispector.cli:main noarch: python script: python -m pip install . --no-deps -vv + run_exports: + - {{ pin_subpackage('crispector', max_pin="x") }} source: - url: https://github.com/YakhiniGroup/crispector/archive/v{{ version }}.tar.gz - sha256: 66b4ecc6f73958221eed868200c00d3c39718e9a146c389da9fcbd16440f6f1f + url: https://github.com/YakhiniGroup/crispector/archive/refs/tags/V{{ version }}.tar.gz + sha256: f88a8807e9793c7fb9db341f5ba9f130e59f557ecac55b625eb0dcd61ad38b9c requirements: host: @@ -35,6 +37,7 @@ requirements: - pandas >=0.24.2 - statsmodels - jinja2 + - mpmath >=1.3.0 test: commands: diff --git a/recipes/crispector2/meta.yaml b/recipes/crispector2/meta.yaml index 8b47e82f104df..cf882e1b1ee03 100644 --- a/recipes/crispector2/meta.yaml +++ b/recipes/crispector2/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.0.7" %} +{% set version = "2.0.8" %} package: name: crispector2 @@ -15,15 +15,15 @@ build: source: url: https://github.com/theAguy/crispector2/archive/refs/tags/v{{ version }}.tar.gz - sha256: 3531fd5cad957c046a54355a18552453bf1dac7141b3e7b7c13b40ccf5599a86 + sha256: 9ca7823cbd4decdd3b1bbe3bd4bb7c77e87142ce4d1df21f06565ee9ee465177 requirements: host: - - python 3.7 + - python >=3.8 - pip run: - - python 3.7 - - biopython >=1.74 + - python >=3.8 + - biopython >=1.74, <=1.79 # Bio.SubsMat - fastp - python-edlib - click >=7.0 diff --git a/recipes/crispresso2/meta.yaml b/recipes/crispresso2/meta.yaml index 73a70bc89da04..106ea600a08eb 100644 --- a/recipes/crispresso2/meta.yaml +++ b/recipes/crispresso2/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.2.14" %} +{% set version = "2.3.0" %} package: name: crispresso2 @@ -6,11 +6,13 @@ package: build: skip: True # [py2k] - number: 0 + number: 1 + run_exports: + - {{ pin_subpackage('crispresso2', max_pin='x') }} source: url: https://github.com/pinellolab/CRISPResso2/archive/v{{ version }}.tar.gz - sha256: ec9c5ff4069a651601dd980ef20c60bf14467ec97324c92673f6dcd698b9f844 + sha256: ccbb1c8e27139a10562d154c510149d833841f92370755914020d71e49bcfa33 requirements: build: @@ -29,8 +31,8 @@ requirements: - plotly - matplotlib-base - jinja2 - - trimmomatic - - flash + - jinja_partials + - fastp - samtools - bowtie2 - seaborn-base @@ -46,3 +48,7 @@ about: license: Partners license_file: LICENSE.txt summary: "A software pipeline designed to enable rapid and intuitive interpretation of genome editing experiments" + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/crisprme/build.sh b/recipes/crisprme/build.sh index cd80a4ea7cf0d..48c4a11527c52 100644 --- a/recipes/crisprme/build.sh +++ b/recipes/crisprme/build.sh @@ -5,6 +5,6 @@ mkdir -p "${PREFIX}/opt/crisprme" chmod -R 700 . unzip PostProcess/pickle_data.zip mv CRISTA_predictors.pkl PostProcess/ -cp crisprme.py "${PREFIX}/bin/" +cp crisprme.py "${PREFIX}/bin/" && chmod +rx "${PREFIX}/bin/crisprme.py" cp crisprme_test_complete_package.sh "${PREFIX}/bin/" -cp -R * "${PREFIX}/opt/crisprme/" \ No newline at end of file +cp -R * "${PREFIX}/opt/crisprme/" diff --git a/recipes/crisprme/meta.yaml b/recipes/crisprme/meta.yaml index 42d75db4871bf..6997ee9a682b8 100644 --- a/recipes/crisprme/meta.yaml +++ b/recipes/crisprme/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.1.1" %} +{% set version = "2.1.4" %} package: name: crisprme @@ -6,12 +6,14 @@ package: source: url: https://github.com/pinellolab/CRISPRme/archive/refs/tags/v{{ version }}.tar.gz - sha256: d59a970c8210cbc5854d77101fe23b5f0ead899b53bcc4c9e6cfb3579c02db26 - + sha256: a2d8d374365ba90eeb81548b16b589f23bc9ee184cca447306efc12b3d1a97f8 + build: + run_exports: + - {{ pin_subpackage('crisprme', max_pin="x") }} number: 0 noarch: generic - + requirements: host: - unzip @@ -46,6 +48,12 @@ test: about: home: https://github.com/pinellolab/CRISPRme - license: AGPL-3.0 + license: AGPL-3.0-or-later + license_family: AGPL license_file: LICENSE - summary: CRISPRme, tool package for CRISPR experiments assessment and analysis. \ No newline at end of file + summary: CRISPRme, tool package for CRISPR experiments assessment and analysis. + dev_url: https://github.com/pinellolab/CRISPRme + +extra: + identifiers: + - doi:10.1038/s41588-022-01257-y diff --git a/recipes/csvtk/meta.yaml b/recipes/csvtk/meta.yaml index f81d3b38c5053..75a19c78e343c 100644 --- a/recipes/csvtk/meta.yaml +++ b/recipes/csvtk/meta.yaml @@ -1,19 +1,21 @@ -{% set version = "0.29.0" %} +{% set version = "0.30.0" %} package: name: csvtk version: {{ version }} build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('csvtk', max_pin='x.x') }} source: - url: https://github.com/shenwei356/csvtk/releases/download/v{{ version }}/csvtk_darwin_amd64.tar.gz # [osx] - md5: 055172fe0ce888cdbbe11c3c03846aa4 # [osx] - - url: https://github.com/shenwei356/csvtk/releases/download/v{{ version }}/csvtk_linux_amd64.tar.gz # [linux] - md5: ac796feaa66514b0b5eb9b21df81c22b # [linux] + md5: c415255e265ba0cd547806fdbda05652 # [osx] + - url: https://github.com/shenwei356/csvtk/releases/download/v{{ version }}/csvtk_linux_amd64.tar.gz # [linux and x86_64] + md5: 8f5877d4fbea89609d64bd2679956476 # [linux and x86_64] + - url: https://github.com/shenwei356/csvtk/releases/download/v{{ version }}/csvtk_linux_arm64.tar.gz # [linux and aarch64] + md5: 2a6dd840291d23971ff538eaf3de00ec # [linux and aarch64] test: commands: @@ -25,6 +27,8 @@ about: license: MIT extra: + additional-platforms: + - linux-aarch64 skip-lints: - should_be_noarch_generic - should_not_be_noarch_source diff --git a/recipes/curare/meta.yaml b/recipes/curare/meta.yaml index 961edaf9848d9..0458d942c20e0 100644 --- a/recipes/curare/meta.yaml +++ b/recipes/curare/meta.yaml @@ -1,5 +1,5 @@ {% set name = "curare" %} -{% set version = "0.5.1" %} +{% set version = "0.6.0" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/pblumenkamp/Curare/archive/refs/tags/{{ version }}.tar.gz - sha256: bf1d47c889b90bb33b5b5353b87d8486a23321394a928e863510c6ac2e8eb0c7 + sha256: e98935fce614bf0b8b3db4e9c65c9fbba999fab84e69e4158209b6319f59a0da build: number: 0 @@ -29,6 +29,8 @@ requirements: - python =3.10 - pyyaml =6.0 - docopt =0.6.2 + - progressbar2 =4.3.2 + - biopython =1.83 test: imports: diff --git a/recipes/cutadapt/meta.yaml b/recipes/cutadapt/meta.yaml index a6b4c6ec5aa58..5b7e6a9e62d14 100644 --- a/recipes/cutadapt/meta.yaml +++ b/recipes/cutadapt/meta.yaml @@ -1,17 +1,17 @@ -{% set version = "4.6" %} +{% set version = "4.8" %} package: name: cutadapt version: {{ version }} source: - url: https://files.pythonhosted.org/packages/35/b4/f1a7401c3503c17998fb9547b04353217a18323d5d85a3b957f1049ab800/cutadapt-4.6.tar.gz - sha256: 924116f34569248035b16f58e73458ed4c0004e44823b80b07f4ab419272f591 + url: https://files.pythonhosted.org/packages/c6/a7/7d5399e15747df9d203ecd12f510665db1a38b2bddac4e69eb715f2f90fe/cutadapt-4.8.tar.gz + sha256: ac852f6b5f2d1147d0d34bef2eaa5879776f81c69a35dd328a701aae39ec6034 build: - number: 1 - script: "{{ PYTHON }} -m pip install . --no-deps -vv" - skip: True # [py27 or py36] + number: 0 + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + skip: True # [py < 38] run_exports: - {{ pin_subpackage("cutadapt", max_pin="x") }} @@ -36,12 +36,18 @@ test: about: home: https://cutadapt.readthedocs.io/ + dev_url: https://github.com/marcelm/cutadapt license: MIT + license_family: MIT + license_file: LICENSE summary: Trim adapters from high-throughput sequencing reads extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - marcelm identifiers: - biotools:cutadapt - doi:10.14806/ej.17.1.200 + - usegalaxy-eu:cutadapt diff --git a/recipes/cutefc/meta.yaml b/recipes/cutefc/meta.yaml new file mode 100644 index 0000000000000..39c976a89d87d --- /dev/null +++ b/recipes/cutefc/meta.yaml @@ -0,0 +1,49 @@ +{% set version = "1.0.0" %} + +package: + name: cutefc + version: {{ version }} + +source: + url: https://pypi.io/packages/source/c/cuteFC/cuteFC-{{ version }}.tar.gz + sha256: c8cfc36d2b2195760d8feee2e3a8e79a885622c3e50f8ceb903d945d4e41e0ef + +build: + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + noarch: python + run_exports: + - {{ pin_subpackage("cutefc", max_pin="x.x") }} + +requirements: + host: + - python >=3 + - pip + run: + - python >=3 + - scipy + - pysam + - biopython + - cigar + - numpy + - pyvcf3 + - scikit-learn + +test: + imports: + - benchmarks + - cuteFC + commands: + - cuteFC -h + requires: + - pip + +about: + home: https://github.com/tjiangHIT/cuteFC + summary: Regenotyping structural variants through an accurate and efficient force-calling method + license: MIT + license_file: LICENSE + +extra: + recipe-maintainers: + - Meltpinkg diff --git a/recipes/cutesv/meta.yaml b/recipes/cutesv/meta.yaml index 957edae2caec5..7f9935d939f64 100644 --- a/recipes/cutesv/meta.yaml +++ b/recipes/cutesv/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.1.0" %} +{% set version = "2.1.1" %} package: name: cutesv @@ -6,7 +6,7 @@ package: source: url: https://github.com/tjiangHIT/cuteSV/archive/cuteSV-v{{ version }}.tar.gz - sha256: c2d072e8c3c1a2a8ec52abe63ffc796d0e023385e850c4ead6e3a18c14f173d3 + sha256: ebba8ffe0943626a9c1606adeed37bec3a4c0816c4fb7af8d6d219d7bee2acd2 build: number: 0 diff --git a/recipes/cytoscape/meta.yaml b/recipes/cytoscape/meta.yaml index 6fc7e23fbb204..068d4c8f5ba8c 100644 --- a/recipes/cytoscape/meta.yaml +++ b/recipes/cytoscape/meta.yaml @@ -1,6 +1,6 @@ {% set name = "cytoscape" %} -{% set version = "3.10.1" %} -{% set sha256 = "93373f75143822a2162c4db5b0b0b614fdf2e34c1a0300ab915cadfd1b148418" %} +{% set version = "3.10.2" %} +{% set sha256 = "561380f7429aa806941027897fd1ca902597c4dadf4bf1bbd3141a39f2bd3f3e" %} package: name: {{ name }} diff --git a/recipes/cyvcf2/meta.yaml b/recipes/cyvcf2/meta.yaml index b959105c2467d..71d64a2a0c42c 100644 --- a/recipes/cyvcf2/meta.yaml +++ b/recipes/cyvcf2/meta.yaml @@ -1,6 +1,6 @@ {% set name = "cyvcf2" %} -{% set version = "0.30.26" %} -{% set sha256 = "e8473957181ef7b037213d110217046d107cd6a0eb4671f13c47a7a24412db05" %} +{% set version = "0.30.28" %} +{% set sha256 = "dde7771570e210df9ca6d21c171a8aa376f191966826241fdcdf960befb9cc0f" %} package: name: {{ name }} @@ -14,9 +14,9 @@ source: - patches/setup.py.patch build: - number: 0 + number: 1 skip: True # [py < 37] - script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation --no-cache-dir -vvv entry_points: - cyvcf2 = cyvcf2.__main__:cli run_exports: @@ -32,8 +32,6 @@ requirements: - python - cython - pip - - setuptools - - wheel - curl - zlib - htslib >=1.10 @@ -64,3 +62,5 @@ extra: identifiers: - doi:10.1093/bioinformatics/btx057 - biotools:cyvcf2 + additional-platforms: + - linux-aarch64 diff --git a/recipes/dajin2/meta.yaml b/recipes/dajin2/meta.yaml index eca8b4b9afad9..263b0d54587fd 100644 --- a/recipes/dajin2/meta.yaml +++ b/recipes/dajin2/meta.yaml @@ -1,13 +1,13 @@ {% set name = "DAJIN2" %} -{% set version = "0.3.6" %} +{% set version = "0.4.5" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/DAJIN2-{{ version }}.zip - sha256: cf9e686f78041682589c8e90bcac8eb2ad6473987c96bd574faf36e0b461613c + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/dajin2-{{ version }}.zip + sha256: f20fa8d86a17aa3b13c74da959fae02ff57acd5bf7bdd1a852a3cebb6ee1efb3 build: entry_points: @@ -24,23 +24,22 @@ requirements: - pip run: - python - - numpy >=1.20.0 - - scipy >=1.6.0 + - numpy >=1.24.0 + - scipy >=1.10.0 - pandas >=1.0.0 - - openpyxl >=3.0.0 - - rapidfuzz >=3.0.0 - - statsmodels >=0.13.5 - - scikit-learn >=1.0.0 + - openpyxl >=3.1.0 + - rapidfuzz >=3.6.0 + - scikit-learn >=1.3.0 - mappy >=2.24 - - pysam >=0.19.0 + - pysam >=0.21.0 - flask >=2.2.0 - waitress >=2.1.0 - jinja2 >=3.1.0 - - plotly >=5.0.0 + - plotly >=5.19.0 - python-kaleido >=0.2.0 - cstag >=1.0.0 - - midsv >=0.10.1 - - wslpath >=0.3.0 + - midsv >=0.11.0 + - wslpath >=0.4.1 test: imports: diff --git a/recipes/dart/build.sh b/recipes/dart/build.sh index ab1901877606f..641bf8a605d82 100755 --- a/recipes/dart/build.sh +++ b/recipes/dart/build.sh @@ -1,6 +1,11 @@ #!/bin/bash mkdir -p ${PREFIX}/bin +ARCH_BUILD="-m64 -msse4.1" +case $(uname -m) in + arm64|aarch64) ARCH_BUILD="" ;; +esac + #index pushd src/BWT_Index make CC=$CC FLAGS="$CFLAGS" LIBS="$LDFLAGS -lm -lz" @@ -14,6 +19,6 @@ popd #dart pushd src -make CXX=$CXX FLAGS="$CXXFLAGS -Wall -D NDEBUG -O3 -m64 -msse4.1 -fPIC" LIB="$LDFLAGS -lz -lm -lbz2 -llzma -lpthread" +make CXX=$CXX FLAGS="$CXXFLAGS -Wall -D NDEBUG -O3 $ARCH_BUILD -fPIC" LIB="$LDFLAGS -lz -lm -lbz2 -llzma -lpthread" cp dart $PREFIX/bin diff --git a/recipes/dart/meta.yaml b/recipes/dart/meta.yaml index f444a029c9ea5..a6f2aa00531a7 100644 --- a/recipes/dart/meta.yaml +++ b/recipes/dart/meta.yaml @@ -9,7 +9,9 @@ source: sha256: '847d5e0a7e10162583fcf7168d31924d38290b5364e08c4a9cdd6653da73c64f' build: - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage("dart", max_pin='x.x') }} requirements: build: @@ -42,3 +44,6 @@ about: extra: identifiers: - doi:10.1093/bioinformatics/btx558 + + additional-platforms: + - linux-aarch64 diff --git a/recipes/dbcan/meta.yaml b/recipes/dbcan/meta.yaml index 7be1bbfbd0487..4c247128ceb5f 100644 --- a/recipes/dbcan/meta.yaml +++ b/recipes/dbcan/meta.yaml @@ -1,5 +1,5 @@ {% set name = "dbcan" %} -{% set version = "4.1.2" %} +{% set version = "4.1.4" %} package: name: "{{ name|lower }}" @@ -9,7 +9,8 @@ source: # the sha256 sum is generated by doing # wget -0- [URL] | shasum -a 256 url: https://github.com/linnabrown/run_dbcan/releases/download/{{ version }}/dbcan-{{ version }}.tar.gz - sha256: 3a675683379d1afc9f3444fc9894272f1485956df266a6ee4fc11a8f628e6d51 + sha256: 12dc906b56c3b1bfea667aa617d46d3f292857fc360730e4fe1d35f5b5557215 + build: number: 0 @@ -46,6 +47,7 @@ requirements: - openpyxl - matplotlib-base - session-info + - blast test: imports: diff --git a/recipes/ddocent/meta.yaml b/recipes/ddocent/meta.yaml index 643ad6a48b5f6..d295e0eb03724 100644 --- a/recipes/ddocent/meta.yaml +++ b/recipes/ddocent/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.9.4" %} -{% set sha256 = "4d44f72ad9c4bee3587f58ff7a18a972a5e31063396c3200705c72f02c4ee96b" %} +{% set version = "2.9.7" %} +{% set sha256 = "28ad3a597a2477cffc1b8a7dd4dcb204e0912f40664c128e8cfd783e56d46a04" %} package: name: ddocent @@ -8,14 +8,14 @@ package: source: url: https://github.com/jpuritz/dDocent/archive/v{{ version }}.tar.gz sha256: {{ sha256 }} - + build: - number: 1 + number: 2 noarch: generic + run_exports: + - {{ pin_subpackage('ddocent', max_pin="x") }} requirements: - build: - host: run: - fastp >=0.20.0 - seqtk >=1.3 @@ -30,7 +30,7 @@ requirements: - rainbow - cd-hit - bedtools >=2.26.0 - - vcflib >=0.1.11 + - vcflib >=0.1.11, <1.0.4 - gnuplot - parallel - pear @@ -42,10 +42,14 @@ test: commands: - "samtools --version" - "dDocent --help" + about: - home: "http://ddocent.com" - license: "The MIT License (MIT)" - summary: " dDocent is an interactive bash wrapper to QC, assemble, map, and call SNPs from all types of RAD data" + home: "https://ddocent.com" + license: MIT + license_family: MIT + summary: "dDocent is an interactive bash wrapper to QC, assemble, map, and call SNPs from all types of RAD data" + dev_url: https://github.com/jpuritz/dDocent + doc_url: https://www.ddocent.com/UserGuide/ extra: container: diff --git a/recipes/ddrage/meta.yaml b/recipes/ddrage/meta.yaml index 87d3345a7373c..a4046dab43b7f 100644 --- a/recipes/ddrage/meta.yaml +++ b/recipes/ddrage/meta.yaml @@ -1,17 +1,19 @@ -{% set version = "1.7.1" %} +{% set version = "1.8.1" %} package: name: ddrage version: {{ version }} source: - url: https://bitbucket.org/genomeinformatics/rage/get/{{ version }}.tar.gz - sha256: 4ae5a34428658087ca70ad29ae8d3c7a3b55170bfa419d3adcf727fe807d93f3 + url: https://files.pythonhosted.org/packages/f8/bf/a3156beda9476a3ed69d1fd049465f70cad5f3df1de0a0efeb55c401f0e3/ddrage-{{ version }}.tar.gz + sha256: a08962227144a8de0d47b8dbfb51aaf692660d5a7c519a11561b91c6217186ac build: noarch: python number: 0 + run_exports: + - {{ pin_subpackage("ddrage", max_pin="x") }} script: {{ PYTHON }} -m pip install . --ignore-installed --no-deps -vv entry_points: - rage = ddrage.__main__:main diff --git a/recipes/decoupler/meta.yaml b/recipes/decoupler/meta.yaml deleted file mode 100644 index d8c9c0a826d9f..0000000000000 --- a/recipes/decoupler/meta.yaml +++ /dev/null @@ -1,52 +0,0 @@ -{% set name = "decoupler" %} -{% set version = "1.5.0" %} - -package: - name: {{ name|lower }} - version: {{ version }} - -source: - url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/decoupler-{{ version }}.tar.gz - sha256: 1278b0912df0eb22618b720a7c862e6babd874472290e7c81c27dcf65c5bd48a - -build: - noarch: python - script: {{ PYTHON }} -m pip install . -vv - number: 0 - run_exports: - - {{ pin_subpackage(name, max_pin="x") }} - -requirements: - host: - - python >=3.6 - - pip - run: - - python >=3.6 - - numba - - tqdm - - anndata - - typing-extensions - - seaborn - - skranger - - scikit-learn - - omnipath - - adjusttext - - scanpy - -test: - imports: - - decoupler - commands: - - pip check - requires: - - pip - -about: - home: https://github.com/saezlab/decoupler-py - summary: Ensemble of methods to infer biological activities from omics data - license: GPL-3.0 - license_file: LICENSE - -extra: - recipe-maintainers: - - pcm32 diff --git a/recipes/deeplc/meta.yaml b/recipes/deeplc/meta.yaml index 51849c0d6507f..053b4fee421bc 100644 --- a/recipes/deeplc/meta.yaml +++ b/recipes/deeplc/meta.yaml @@ -1,6 +1,6 @@ {% set name = "DeepLC" %} -{% set version = "2.2.26" %} -{% set sha256 = "b4cbb3612a89fe82ddac6149a261f7440c721f4b87235ce534c4cbd95d424e1b" %} +{% set version = "2.2.27" %} +{% set sha256 = "611cd06f1a12a543289c4fa0bbb5364bc3dbeeca905464c7c2668f45fa2fa781" %} package: name: {{ name|lower }} diff --git a/recipes/deeplcretrainer/meta.yaml b/recipes/deeplcretrainer/meta.yaml index 5d602ecfa1aa3..635792b35745b 100644 --- a/recipes/deeplcretrainer/meta.yaml +++ b/recipes/deeplcretrainer/meta.yaml @@ -1,6 +1,6 @@ {% set name = "DeepLCRetrainer" %} -{% set version = "0.2.8" %} -{% set sha256 = "73a9052d186921df42cfefce6215ee50f2a0abb3c4b1cef4a67126a59dfa7c9b" %} +{% set version = "0.2.12" %} +{% set sha256 = "bd31124518f6b5d1f1ec2f0983c0885b44e235b93134cc61c5eab52e2519bdff" %} package: name: {{ name|lower }} diff --git a/recipes/deepmei/meta.yaml b/recipes/deepmei/meta.yaml index ab40e3175008d..5176e0a8ea618 100644 --- a/recipes/deepmei/meta.yaml +++ b/recipes/deepmei/meta.yaml @@ -1,16 +1,16 @@ package: name: deepmei - version: 1.0.0 + version: 1.6.24 source: - url: https://raw.githubusercontent.com/kanglu123/deepmei_v1.0.0/master/DeepMEI.without_models_and_files.tar.gz - sha256: 6af31abb690b3ba209d719a1e924baaab725760deb47a69319c171308d095269 + url: https://raw.githubusercontent.com/kanglu123/deepmei/deepmei-v1.6.24/deepmei_update_v1.6.24.2.tar.gz + sha256: 9a0fa0905776924969907cd71dfdf47e9e7afa8fc0ca277e30b2bf222efee3fd build: noarch: generic number: 0 run_exports: - {{ pin_subpackage('deepmei', max_pin="x.x") }} - + requirements: run: # List dependencies here. e.g.: @@ -26,10 +26,10 @@ requirements: test: commands: - - deepmeiv1 + - deepmei about: - home: https://github.com/Kanglu123/deepmei + home: https://github.com/Kanglu123/deepmei/tree/deepmei-v1.6.24 license: GPL-3.0 license_file: license.txt - summary: A pipeline to detect mobile elements insertion in human genome + summary: A tool to detect mobile elements insertion diff --git a/recipes/deeptools/meta.yaml b/recipes/deeptools/meta.yaml index 805ccb38e5137..a6e95ba34a6cb 100644 --- a/recipes/deeptools/meta.yaml +++ b/recipes/deeptools/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "3.5.4" %} +{% set version = "3.5.5" %} package: name: deeptools @@ -6,23 +6,47 @@ package: source: url: https://github.com/deeptools/deepTools/archive/refs/tags/{{ version }}.tar.gz - sha256: 4554a2e9cfa264b181e4847be93a070e7ffe4ad5cb3988bc2606da4d59b2f3ea + sha256: f6dda39f552624758a9830cd4589ef43e7047284759b103cf833271cfa564dd1 build: - number: 1 + number: 0 noarch: python run_exports: - {{ pin_subpackage("deeptools", max_pin="x") }} - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vvv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + entry_points: + - alignmentSieve = deeptools.alignmentSieve:main + - bamCompare = deeptools.bamCompare:main + - bamCoverage = deeptools.bamCoverage:main + - bamPEFragmentSize = deeptools.bamPEFragmentSize:main + - bigwigAverage = deeptools.bigwigAverage:main + - bigwigCompare = deeptools.bigwigCompare:main + - computeGCBias = deeptools.computeGCBias:main + - computeMatrix = deeptools.computeMatrix:main + - computeMatrixOperations = deeptools.computeMatrixOperations:main + - correctGCBias = deeptools.correctGCBias:main + - deeptools = deeptools.deeptools_list_tools:main + - estimateReadFiltering = deeptools.estimateReadFiltering:main + - estimateScaleFactor = deeptools.estimateScaleFactor:main + - multiBamSummary = deeptools.multiBamSummary:main + - multiBigwigSummary = deeptools.multiBigwigSummary:main + - plotCorrelation = deeptools.plotCorrelation:main + - plotCoverage = deeptools.plotCoverage:main + - plotEnrichment = deeptools.plotEnrichment:main + - plotFingerprint = deeptools.plotFingerprint:main + - plotHeatmap = deeptools.plotHeatmap:main + - plotPCA = deeptools.plotPCA:main + - plotProfile = deeptools.plotProfile:main requirements: host: - - python >=3.7 + - python >=3.8 - pip run: - - python >=3.7 + - python >=3.8 - pybigwig >=0.2.3 - numpy >=1.9.0 + - numpydoc >=0.5 - scipy >=0.17.0 - matplotlib-base >=3.5.0 - pysam >=0.14.0 @@ -34,18 +58,39 @@ requirements: test: imports: - deeptools - commands: - bamCompare --version about: home: https://github.com/deeptools/deepTools - license: GPL3 + license: MIT + license_family: MIT license_file: LICENSE.txt summary: A set of user-friendly tools for normalization and visualzation of deep-sequencing data + doc_url: https://deeptools.readthedocs.io/en/latest/ + dev_url: https://github.com/deeptools/deepTools extra: identifiers: - biotools:deeptools - doi:10.1093/nar/gkw257 - usegalaxy-eu:deeptools_plot_heatmap + - usegalaxy-eu:deeptools_plot_pca + - usegalaxy-eu:deeptools_plot_profile + - usegalaxy-eu:deeptools_plot_correlation + - usegalaxy-eu:deeptools_plot_coverage + - usegalaxy-eu:deeptools_plot_fingerprint + - usegalaxy-eu:deeptools_plot_enrichment + - usegalaxy-eu:deeptools_bam_compare + - usegalaxy-eu:deeptools_bam_pe_fragmentsize + - usegalaxy-eu:deeptools_bigwig_compare + - usegalaxy-eu:deeptools_correct_gc_bias + - usegalaxy-eu:deeptools_multi_bam_summary + - usegalaxy-eu:deeptools_compute_matrix + - usegalaxy-eu:deeptools_compute_gc_bias + - usegalaxy-eu:deeptools_multi_bigwig_summary + - usegalaxy-eu:deeptools_compute_matrix_operations + - usegalaxy-eu:deeptools_alignmentsieve + - usegalaxy-eu:deeptools_estimatereadfiltering + - usegalaxy-eu:hicup_deduplicator + - usegalaxy-eu:deeptools_bigwig_average diff --git a/recipes/deeptoolsintervals/meta.yaml b/recipes/deeptoolsintervals/meta.yaml index 592130b2c9fbe..6611f446819f6 100644 --- a/recipes/deeptoolsintervals/meta.yaml +++ b/recipes/deeptoolsintervals/meta.yaml @@ -10,7 +10,7 @@ source: sha256: 7d94c36fd2b6f10d8b99e536d2672e8228971f1fc810497d33527bba2c40d4f6 build: - number: 6 + number: 8 run_exports: - {{ pin_subpackage("deeptoolsintervals", max_pin="x.x") }} @@ -33,3 +33,7 @@ about: home: https://github.com/deeptools/deeptools_intervals license: MIT summary: A python module creating/accessing GTF-based interval trees with associated meta-data + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/defense-finder/meta.yaml b/recipes/defense-finder/meta.yaml index 91d9f8225e58c..80a8fee131a79 100644 --- a/recipes/defense-finder/meta.yaml +++ b/recipes/defense-finder/meta.yaml @@ -1,5 +1,5 @@ {% set name = "defense-finder" %} -{% set version = "1.2.0" %} +{% set version = "1.2.2" %} package: name: {{ name|lower }} @@ -7,11 +7,11 @@ package: source: url: https://github.com/mdmparis/defense-finder/archive/v{{ version }}.tar.gz - sha256: 79547704ebe5d758b7692c2a9bdd1c4ccd6084a35ee18201dabb2e494da3ec36 + sha256: e34e59cf1329e26c9cb6e42bb5cb6a7a051e09ca4bf981b9334f73a08d354625 # patches: 0001-fix-no-results.patch build: - number: 0 + number: 1 noarch: python script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv run_exports: @@ -24,7 +24,9 @@ requirements: run: - click >=8.0.3 - colorlog >=6.3.0a1 - - macsyfinder + # macsyfinder pinned based notes at https://github.com/mdmparis/defense-finder/releases/tag/v1.2.2 + # Please review macsyfinder version in future release + - macsyfinder 2.1.1 - python >=3.7 - pyhmmer - pyrodigal diff --git a/recipes/degenotate/meta.yaml b/recipes/degenotate/meta.yaml index f66a7025ab294..df8b230b1460e 100644 --- a/recipes/degenotate/meta.yaml +++ b/recipes/degenotate/meta.yaml @@ -1,6 +1,6 @@ {% set name = "degenotate" %} -{% set version = "1.2.4" %} -{% set sha256 = "46359a6d33e660b21c0a0384c641e1aac15f7546f1fbb7463f01d94ad27abf60" %} +{% set version = "1.3" %} +{% set sha256 = "1c12673fd743c24845fec1dd503bf01114faa6b7f4545429e62747e65d323a66" %} package: name: {{ name|lower }} diff --git a/recipes/delly/build.sh b/recipes/delly/build.sh index 3da9d173f7a55..e70b4a265f219 100644 --- a/recipes/delly/build.sh +++ b/recipes/delly/build.sh @@ -1,12 +1,5 @@ #!/bin/sh mkdir -p "${PREFIX}/bin" -if [[ ${target_platform} == osx-64 ]] ; then - make all CXX=$CXX CXXFLAGS="-I${PREFIX}/include -L${PREFIX}/lib" - cp src/delly "${PREFIX}/bin" -else - wget "https://github.com/dellytools/delly/releases/download/v${PKG_VERSION}/delly_v${PKG_VERSION}_linux_x86_64bit" - mv delly_v${PKG_VERSION}_linux_x86_64bit delly - chmod +x delly - cp delly "${PREFIX}/bin" -fi +make all CXX=$CXX CXXFLAGS="-I${PREFIX}/include -L${PREFIX}/lib" +cp src/delly "${PREFIX}/bin" diff --git a/recipes/delly/meta.yaml b/recipes/delly/meta.yaml index ee0d6f0ea4c2d..1be26ed167cf9 100644 --- a/recipes/delly/meta.yaml +++ b/recipes/delly/meta.yaml @@ -10,7 +10,7 @@ source: sha256: '{{ sha256 }}' build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage("delly", max_pin="x.x") }} @@ -42,6 +42,8 @@ about: summary: Structural variant discovery by integrated paired-end and split-read analysis extra: + additional-platforms: + - linux-aarch64 identifiers: - doi:10.1093/bioinformatics/bts378 - biotools:Delly2 diff --git a/recipes/demuxem/meta.yaml b/recipes/demuxem/meta.yaml index a2160ef5ce27c..59efd8c3de7d9 100644 --- a/recipes/demuxem/meta.yaml +++ b/recipes/demuxem/meta.yaml @@ -1,5 +1,5 @@ {% set name = "demuxEM" %} -{% set version = "0.1.7" %} +{% set version = "0.1.7.post1" %} package: name: "{{ name|lower }}" @@ -7,29 +7,32 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: "a6d9c7f51cad81328f88c5cc298a38ce7364dc5555876a44f375113225ee1eae" + sha256: "f6e6608c37875fb2db6cbd1abe48ce1149b41c7b2b26380cd4d581dca6cac260" build: - number: 1 + number: 0 noarch: python entry_points: - demuxEM = demuxEM.__main__:main - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation --use-pep517 -vvv" + run_exports: + - {{ pin_subpackage('demuxem', max_pin="x.x") }} requirements: host: - - python >=3.7 + - python >=3.8 - pip - setuptools_scm run: - - python >=3.7 + - python >=3.8 + - docopt - numpy - pandas - scipy - scikit-learn - seaborn - pegasusio >=0.2.12 - - importlib_metadata >=0.7 # [py<38] + - importlib_metadata >=0.7 # [py < 38] test: imports: @@ -41,7 +44,8 @@ test: about: home: "https://github.com/lilab-bcb/demuxEM" doc_url: "https://demuxEM.readthedocs.io" - license: BSD + license: BSD-3-Clause + license_family: BSD license_file: LICENSE summary: "DemuxEM is the demultiplexing module of Pegasus, which works on cell-hashing and nucleus-hashing genomics data." diff --git a/recipes/dfast/meta.yaml b/recipes/dfast/meta.yaml index bee44b4572a7a..b57da8b83f70f 100644 --- a/recipes/dfast/meta.yaml +++ b/recipes/dfast/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.2.20" %} +{% set version = "1.2.21" %} package: name: dfast @@ -6,11 +6,13 @@ package: source: url: https://github.com/nigyta/dfast_core/archive/{{ version }}.tar.gz - sha256: 57f24e8bc20f412b73612ba710e14a009f77381f415f3ee47d69b5c7411ef71d + sha256: 70283cbfc756f5033cc92d1c721b9f7b5d5ba521a6da6e36e2bed794267c8a7b build: number: 0 binary_relocation: False # [osx] + run_exports: + - {{ pin_subpackage("dfast", max_pin="x.x") }} requirements: build: diff --git a/recipes/diamond/meta.yaml b/recipes/diamond/meta.yaml index 0fe8f5553d59f..d35213fa65257 100644 --- a/recipes/diamond/meta.yaml +++ b/recipes/diamond/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.1.8" %} -{% set sha256 = "b6088259f2bc92d1f9dc4add44590cff68321bcbf91eefbc295a3525118b9415" %} +{% set version = "2.1.9" %} +{% set sha256 = "4cde9df78c63e8aef9df1e3265cd06a93ce1b047d6dba513a1437719b70e9d88" %} package: name: diamond @@ -11,6 +11,8 @@ source: build: number: 0 + run_exports: + - {{ pin_subpackage('diamond', max_pin="x") }} requirements: build: @@ -32,10 +34,11 @@ test: about: home: https://github.com/bbuchfink/diamond - license: GPL-3.0 - license_family: GPL + license: GPL-3.0-or-later + license_family: GPL3 license_file: LICENSE summary: Accelerated BLAST compatible local sequence aligner + doc_url: https://github.com/bbuchfink/diamond/wiki extra: identifiers: diff --git a/recipes/diffacto/meta.yaml b/recipes/diffacto/meta.yaml index ad0a23a0bd854..30a547e5fe097 100644 --- a/recipes/diffacto/meta.yaml +++ b/recipes/diffacto/meta.yaml @@ -1,5 +1,5 @@ {% set name = "diffacto" %} -{% set version = "1.0.6" %} +{% set version = "1.0.7" %} package: name: "{{ name|lower }}" @@ -7,14 +7,16 @@ package: source: url: https://github.com/statisticalbiotechnology/diffacto/archive/refs/tags/v{{ version }}.tar.gz - sha256: fde7d7f350abc28de0cce23e68d375028a1d3d0969c988a7d07268fe56085f85 + sha256: 372d46e43509b2d0cbc5499a651ef51f175f24e211219598127f5f3ba13755fe build: noarch: python number: 0 entry_points: - diffacto = diffacto.diffacto:main - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv " + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('diffacto', max_pin="x") }} requirements: host: @@ -37,7 +39,8 @@ test: about: home: "https://github.com/statisticalbiotechnology/diffacto" - license: "Apache Software" + license: "Apache-2.0" license_family: "APACHE" license_file: "LICENSE.txt" summary: "A protein summarization method for shotgun proteomics experiments" + dev_url: "https://github.com/statisticalbiotechnology/diffacto" diff --git a/recipes/dimet/meta.yaml b/recipes/dimet/meta.yaml index fcc2e26a6ff37..3dbed3022c530 100644 --- a/recipes/dimet/meta.yaml +++ b/recipes/dimet/meta.yaml @@ -1,5 +1,5 @@ {% set name = "dimet" %} -{% set version = "0.1.4" %} +{% set version = "0.2.4" %} package: name: {{ name|lower }} @@ -7,12 +7,12 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/dimet-{{ version }}.tar.gz - sha256: 372537f9c9aef2035868357df2c04e5f94bf3f6bef39f69988e25d114a8009ab + sha256: d394d9a9b1eab5c9cc89f9ac59ff0ee06226b3c6421a6eede001491220fb2642 build: noarch: python script: {{ PYTHON }} -m pip install . -vv - number: 0 + number: 1 run_exports: - {{ pin_subpackage(name, max_pin="x.x") }} @@ -28,15 +28,15 @@ requirements: - coverage - hydra-colorlog >=1.2.0,<1.3.0 - hydra-core >=1.3.2,<1.4.0 - - matplotlib-base >=3.7.1,<3.8.0 - - numpy >=1.23.1,<1.24.0 - - pandas >=1.5.3,<1.6.0 - - pydantic >=1.10.8,<2.0.0 + - matplotlib-base >=3.8.3 + - numpy >=1.26.4 + - pandas >=2.2.0 + - pydantic >=2.6.1 - python-dotenv >=1.0,<2.0 - pyyaml >=6.0,<7.0 - - scikit-learn >=1.1.1,<1.2.0 + - scikit-learn >=1.4.0 - scipy >=1.9.1,<1.10.0 - - seaborn >=0.11.2,<0.12.0 + - seaborn >=0.13.2 - statsmodels >=0.13.5,<0.14.0 test: @@ -44,7 +44,7 @@ test: - dimet about: home: https://github.com/cbib/DIMet.git - summary: A tool for Differential Isotope-labeled targeted Metabolomics + summary: A tool for Differential Isotope-labeled targeted Metabolomics data license: MIT license_file: LICENSE diff --git a/recipes/dinamo/meta.yaml b/recipes/dinamo/meta.yaml index 917619344a1c4..78a2ba7d3cfb2 100644 --- a/recipes/dinamo/meta.yaml +++ b/recipes/dinamo/meta.yaml @@ -14,7 +14,9 @@ source: build: skip: True # [osx] - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x") }} requirements: build: @@ -37,6 +39,8 @@ about: summary: An exact and efficient method for IUPAC motif discovery in DNA sequences extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - simonvh identifiers: diff --git a/recipes/dinopy/meta.yaml b/recipes/dinopy/meta.yaml index e3ff0b18c9196..53f879bd28e6b 100644 --- a/recipes/dinopy/meta.yaml +++ b/recipes/dinopy/meta.yaml @@ -1,14 +1,17 @@ +{% set version = "3.0.0" %} + package: name: dinopy - version: "2.2.1" + version: {{ version }} source: - url: https://files.pythonhosted.org/packages/2f/6c/eb26221f3b28e05ceede15e02a31c6fb3762940d46ac5cd3b1f56951b59a/dinopy-2.2.1.tar.gz - sha256: 092323edddf48c9d3082dfaf934f5c3e4011c7e1248503cd352105e6e50bfcf5 + url: https://files.pythonhosted.org/packages/e3/fd/06182a3e21bd400c172ef973512a070968c039a0f18f41c54c933fcafef9/dinopy-{{ version }}.tar.gz + sha256: 9b2238c20c946a7ea34b979fec4dd182f3474958e9a03075dfbbb464e9d84028 build: - skip: True # [py27 or py36] - number: 5 + number: 0 + run_exports: + - {{ pin_subpackage("dinopy", max_pin="x") }} requirements: build: @@ -16,7 +19,7 @@ requirements: host: - python - setuptools - - cython >=0.22 + - cython >=3.0.0 - numpy =1.21 run: - python diff --git a/recipes/dmtools/build.sh b/recipes/dmtools/build.sh new file mode 100644 index 0000000000000..d52244b3f4425 --- /dev/null +++ b/recipes/dmtools/build.sh @@ -0,0 +1,24 @@ +#!/bin/bash + +export C_INCLUDE_PATH=${PREFIX}/include +export CPLUS_INCLUDE_PATH=${PREFIX}/include +export LIBRARY_PATH=${PREFIX}/lib +export LD_LIBRARY_PATH=${PREFIX}/lib + +##echo make CXX=$CXX CPP=$CXX CC=$CC CFLAGS="-g -w -O3 -Wsign-compare -I$BUILD_PREFIX/include" +make CXX=$CXX CPP=$CXX CC=$CC +#CFLAGS="-g -w -O3 -Wsign-compare -I$PREFIX/include -L$PREFIX/lib" +##export CFLAGS="-I$BUILD_PREFIX/include" +##export LDFLAGS="-L$BUILD_PREFIX/lib" +##CFLAGS="${CFLAGS} -fcommon" +##LDFLAGS="" +##make CXX=$CXX CPP=$CXX CC=$CC LDLIBS="-L$PREFIX/lib -lz -lzstd -ltbb -ltbbmalloc -lpthread" WITH_ZSTD=1 + +mkdir -p $PREFIX/bin +cp dmtools $PREFIX/bin +cp genome2cg $PREFIX/bin +cp genomebinLen $PREFIX/bin +cp dmalign $PREFIX/bin +cp bam2dm $PREFIX/bin +cp dmDMR $PREFIX/bin +cp libBinaMeth.so $PREFIX/lib diff --git a/recipes/dmtools/conda_build_config.yaml b/recipes/dmtools/conda_build_config.yaml new file mode 100644 index 0000000000000..1271f9dfbd295 --- /dev/null +++ b/recipes/dmtools/conda_build_config.yaml @@ -0,0 +1,7 @@ +# current version does not build with newer compilers +cxx_compiler_version: + - 10 # [linux] + - 14 # [osx] +c_compiler_version: + - 10 # [linux] + - 14 # [osx] diff --git a/recipes/dmtools/meta.yaml b/recipes/dmtools/meta.yaml new file mode 100644 index 0000000000000..478f477f896f6 --- /dev/null +++ b/recipes/dmtools/meta.yaml @@ -0,0 +1,45 @@ +{% set name = "dmtools" %} +{% set version = "0.2.6" %} +{% set sha256 = "7492be776a73ed0aea639ec73d78726a37cfa45d6d31baa12dc7ecb7589d41e9" %} + +package: + name: "{{ name|lower }}" + version: {{ version }} + +source: + url: https://github.com/ZhouQiangwei/dmtools/archive/refs/tags/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage('dmtools', max_pin="x.x") }} + skip: True # [osx] + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('cxx') }} + - make + host: + - curl + - zlib + - libcurl + - htslib + - gsl + run: + - htslib + - zlib + - gsl + - libcurl + - perl + +test: + commands: + - dmtools + +about: + home: 'https://github.com/ZhouQiangwei/dmtools' + license: MIT + summary: 'BS-seq, WGBS, NOMe-Seq, RRBS data storage and analysis tool dmtools' + doc_url: 'https://dmtools-docs.readthedocs.io/en/latest/index.html' diff --git a/recipes/dnaapler/meta.yaml b/recipes/dnaapler/meta.yaml index 5737d45fcec6a..afdd8db8dc58a 100644 --- a/recipes/dnaapler/meta.yaml +++ b/recipes/dnaapler/meta.yaml @@ -1,5 +1,5 @@ {% set name = "dnaapler" %} -{% set version = "0.5.1" %} +{% set version = "0.7.0" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 9bc6289ebefaa2e9725709cae2dbfa2723ad0d4e7f073f781a23e9b799bac8a8 + sha256: 1ae921824055e8c4e9f7651ddd4d4011612f863f17cb95b496849de03560304f build: number: 0 diff --git a/recipes/dnaio/meta.yaml b/recipes/dnaio/meta.yaml index 6b39d3c44a898..dc4afde759949 100644 --- a/recipes/dnaio/meta.yaml +++ b/recipes/dnaio/meta.yaml @@ -9,7 +9,7 @@ source: sha256: d0528c23516fe4e947970bdef33c423f0a30ab3b083bd4f6f049fd66d8cef803 build: - number: 0 + number: 1 script: "{{ PYTHON }} -m pip install . --no-deps -vv" skip: True # [py27] run_exports: @@ -38,5 +38,7 @@ about: summary: 'Read and write FASTA and FASTQ files efficiently' extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - marcelm diff --git a/recipes/dnarrange/meta.yaml b/recipes/dnarrange/meta.yaml index 5bf8821eb06a2..71980172cffb7 100644 --- a/recipes/dnarrange/meta.yaml +++ b/recipes/dnarrange/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.6.1" %} +{% set version = "1.6.2" %} package: name: dnarrange @@ -6,7 +6,7 @@ package: source: url: https://github.com/mcfrith/dnarrange/archive/{{ version }}.tar.gz - sha256: e5046acb96e561b3dc12c4685eb0acf3170b812577a32655c08c21b8eb5a957d + sha256: 1f6b82b51160855455cc2c8ce198dffca7bdfe635806a3c0adc0e58669f8dbe3 build: number: 0 diff --git a/recipes/dnoise/meta.yaml b/recipes/dnoise/meta.yaml index b706edda05cf0..e8aa73687be78 100644 --- a/recipes/dnoise/meta.yaml +++ b/recipes/dnoise/meta.yaml @@ -1,6 +1,6 @@ {% set name = "DnoisE" %} -{% set version = "1.4.0" %} -{% set sha256 = "bee24dbe42fb884810788bb4ac874d6b664e24a3820e6706406fd8a90b6ac328" %} +{% set version = "1.4.1" %} +{% set sha256 = "39c728faea03732df906cb90bf541efdb8d7ebf4858c9bf2717fa8a75e9157b1" %} package: name: {{ name|lower }} diff --git a/recipes/dodge/meta.yaml b/recipes/dodge/meta.yaml index 5e1278b3e5998..c346fc0fe1669 100644 --- a/recipes/dodge/meta.yaml +++ b/recipes/dodge/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.1.0" %} +{% set version = "1.0.0" %} {% set name = "dodge" %} package: @@ -7,7 +7,7 @@ package: source: url: https://github.com/LanLab/{{ name }}/archive/v{{ version }}.tar.gz - sha256: 6897fa29651f3ea9f404f73da8a8d0e2981e2f4e3b9a44a1252fb74a2b908a7a + sha256: 5b95858a6e317f0ecc7f46b369e052bd14734bc316ec38e360f2de3ae2f62116 build: noarch: python diff --git a/recipes/dosage_score/LICENSE.txt b/recipes/dosage_score/LICENSE.txt new file mode 100644 index 0000000000000..e72bfddabc15b --- /dev/null +++ b/recipes/dosage_score/LICENSE.txt @@ -0,0 +1,674 @@ + GNU GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU General Public License is a free, copyleft license for +software and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. We, the Free Software Foundation, use the +GNU General Public License for most of our software; it applies also to +any other work released this way by its authors. You can apply it to +your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you have +certain responsibilities if you distribute copies of the software, or if +you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the manufacturer +can do so. This is fundamentally incompatible with the aim of +protecting users' freedom to change the software. The systematic +pattern of such abuse occurs in the area of products for individuals to +use, which is precisely where it is most unacceptable. Therefore, we +have designed this version of the GPL to prohibit the practice for those +products. If such problems arise substantially in other domains, we +stand ready to extend this provision to those domains in future versions +of the GPL, as needed to protect the freedom of users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU Affero General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the special requirements of the GNU Affero General Public License, +section 13, concerning interaction through a network will apply to the +combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU General Public License from time to time. Such new versions will +be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + + Copyright (C) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see . + +Also add information on how to contact you by electronic and paper mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + Copyright (C) + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + +The hypothetical commands `show w' and `show c' should show the appropriate +parts of the General Public License. Of course, your program's commands +might be different; for a GUI interface, you would use an "about box". + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU GPL, see +. + + The GNU General Public License does not permit incorporating your program +into proprietary programs. If your program is a subroutine library, you +may consider it more useful to permit linking proprietary applications with +the library. If this is what you want to do, use the GNU Lesser General +Public License instead of this License. But first, please read +. \ No newline at end of file diff --git a/recipes/dosage_score/meta.yaml b/recipes/dosage_score/meta.yaml new file mode 100644 index 0000000000000..99f5fbb7b1edc --- /dev/null +++ b/recipes/dosage_score/meta.yaml @@ -0,0 +1,46 @@ +{% set name = "dosage_score" %} +{% set version = "1.0.0" %} +{% set sha256 = "4d5761a1b0284bba5c0291359b24e7abf9a7e729b06917c324bf846d59b4306c" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/SegawaTenta/Dosage-score/releases/download/v{{ version }}/Dosage-score-main.zip + sha256: {{ sha256 }} + +build: + script: python -m pip install --no-deps --ignore-installed . + noarch: python + number: 0 + run_exports: + - {{ pin_subpackage('dosage_score', max_pin="x") }} + +requirements: + build: + - python >=3.7 + - setuptools + - pip + run: + - python >=3.7 + - pandas =1.5.0 + - samtools >=1.16 + - matplotlib-base + - numpy + +test: + commands: + - dosage_score -h + - dosage_score_plot -h + +about: + home: https://github.com/SegawaTenta/Dosage-score + summary: 'Dosage-score: pipline to estimate dosage of each genomic region' + license: 'GPL-3.0-or-later' + license_family: GPL + license_file: LICENSE.txt + +extra: + identifiers: + - biotools:dosage_score diff --git a/recipes/dragonflye/meta.yaml b/recipes/dragonflye/meta.yaml index e69873f01afb6..94fb87669134c 100644 --- a/recipes/dragonflye/meta.yaml +++ b/recipes/dragonflye/meta.yaml @@ -1,5 +1,5 @@ {% set name = "dragonflye" %} -{% set version = "1.1.2" %} +{% set version = "1.2.0" %} package: name: {{ name }} @@ -13,13 +13,14 @@ build: source: url: https://github.com/rpetit3/{{ name }}/archive/v{{ version }}.tar.gz - sha256: 0175f72233c2aa5b4f398fee8f1c17ae69ff04a17dd81ca5e105ec3b3fb4d0ab + sha256: e01f7c6ad237811fcf7719abc756c29e3751d019bac7a827ff2f5d202c150b23 requirements: run: - assembly-scan >=1.0.0 - any2fasta >=0.4.2 - bwa + - dnaapler - fastp - flye >=2.9.2 - kmc >=3.1 @@ -31,7 +32,7 @@ requirements: - perl-findbin - pigz >=2.6 - pilon - - polypolish + - polypolish >=0.6.0 - porechop - racon >=1.5.0 - rasusa >=0.7.1 diff --git a/recipes/dram/fix_setup.patch b/recipes/dram/fix_setup.patch new file mode 100644 index 0000000000000..f8fb0fcc6f255 --- /dev/null +++ b/recipes/dram/fix_setup.patch @@ -0,0 +1,14 @@ +--- scripts/DRAM-setup.py.old 2024-03-24 22:09:07.980198244 -0500 ++++ scripts/DRAM-setup.py 2024-03-24 22:10:39.107097364 -0500 +@@ -121,10 +121,10 @@ + help='vog annotations file') # add loc to vog_annotations to match the rest + + set_db_locs_parser.add_argument('--viral_loc', default=None, ++ help='mmseqs2 database file from ref seq viral gene collection') + set_db_locs_parser.add_argument('--camper_tar_gz_loc', default=None, + help='The source for the CAMPER database files, this is a tar.gz file downloaded' + ' from the release page https://github.com/WrightonLabCSU/CAMPER/releases') +- help='mmseqs2 database file from ref seq viral gene collection') + set_db_locs_parser.add_argument('--peptidase_loc', default=None, + help='mmseqs2 database file from MEROPS database') + set_db_locs_parser.add_argument('--description_db_loc', default=None, diff --git a/recipes/dram/meta.yaml b/recipes/dram/meta.yaml index 6c93600ad8052..71f440a076c1b 100644 --- a/recipes/dram/meta.yaml +++ b/recipes/dram/meta.yaml @@ -1,7 +1,7 @@ {% set name = "DRAM" %} {% set pypi_name = "DRAM-bio" %} -{% set version = "1.4.6" %} -{% set sha256 = "f014c55d7e75433bfc029dc20092df6eb9fb5a565dc60d6e7934d0261f36f945" %} +{% set version = "1.5.0" %} +{% set sha256 = "2d4a503fa806e33b580afb6d21879b2399178e48ba3b05ada882449fee571889" %} package: name: {{ name|lower }} @@ -10,15 +10,20 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ pypi_name }}/{{ pypi_name }}-{{ version }}.tar.gz sha256: {{ sha256 }} + patches: + # https://github.com/WrightonLabCSU/DRAM/issues/339 + - fix_setup.patch build: - number: 2 + number: 0 noarch: python script: "{{ PYTHON }} -m pip install . -vv" + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x") }} requirements: host: - - python >=3.6 + - python >=3.8 - pip run: - python >=3.8 diff --git a/recipes/drep/meta.yaml b/recipes/drep/meta.yaml index 8e0c4025e8f64..b85c516641122 100644 --- a/recipes/drep/meta.yaml +++ b/recipes/drep/meta.yaml @@ -1,5 +1,5 @@ {% set name = "drep" %} -{% set version = "3.4.5" %} +{% set version = "3.5.0" %} package: name: drep @@ -7,12 +7,12 @@ package: source: url: https://pypi.io/packages/source/d/drep/drep-{{ version }}.tar.gz - sha256: 147ddbb775c8f81e8cf4c4d79dc0378039628bd375ea135b8052b8a1d07180c3 + sha256: 4bd2fe9021fdcbcdf646ef5c558d4ea5d9440b290c0a42454037008997a9cfc6 build: number: 0 noarch: python - script: {{ PYTHON }} -m pip install --no-deps --ignore-installed --no-cache-dir -vvv . + script: {{ PYTHON }} -m pip install --no-deps --no-build-isolation --no-cache-dir -vvv . run_exports: - {{ pin_subpackage('drep', max_pin="x") }} @@ -22,16 +22,18 @@ requirements: - pip run: - python >3 + - tqdm - numpy - pandas - seaborn - matplotlib-base - - biopython - scikit-learn - mummer4 - mash - prodigal - fastani + - checkm-genome + - skani test: imports: diff --git a/recipes/dropkick/meta.yaml b/recipes/dropkick/meta.yaml new file mode 100644 index 0000000000000..8454489e5b6ba --- /dev/null +++ b/recipes/dropkick/meta.yaml @@ -0,0 +1,51 @@ +{% set name = "dropkick" %} +{% set version = "1.2.8" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/dropkick-{{ version }}.tar.gz + sha256: 4bfbd23984ac11669691818f29e1f0033e32dd7c2236b16d8a2f20fe60c923c6 + +build: + number: 0 + # "Failed to find libgfortran.3.dylib" build error on OSX + skip: True # [py < 36 or osx] + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + entry_points: + - dropkick = dropkick.__main__:main + run_exports: + - {{ pin_subpackage('dropkick', max_pin="x") }} + +requirements: + build: + - {{ compiler('fortran') }} + - {{ compiler('c') }} + host: + - python + - pip + - numpy + run: + - python + - scipy >=0.14.1 + - pandas + - scikit-learn >=0.18.0 + - scikit-image + - matplotlib-base >=3.0.3 + - scanpy + - {{ pin_compatible('numpy') }} + +test: + imports: + - dropkick + commands: + - dropkick --help + +about: + home: https://github.com/KenLauLab/dropkick + summary: Automated scRNA-seq filtering + license: MIT + license_family: MIT + license_file: LICENSE diff --git a/recipes/dudes/meta.yaml b/recipes/dudes/meta.yaml index af2174caed477..31bf5937c52ae 100644 --- a/recipes/dudes/meta.yaml +++ b/recipes/dudes/meta.yaml @@ -1,30 +1,47 @@ +{% set name = "dudes" %} +{% set version = "0.10.0" %} + package: - name: dudes - version: "0.08" + name: "{{ name|lower }}" + version: "{{ version }}" source: - url: https://github.com/pirovc/dudes/archive/dudes_v0.08.tar.gz - md5: b569094e73ad2d40dccac7a26554a839 + url: https://github.com/pirovc/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: cb53be14da0c9d40e4ac758a6de7fe98e494c5bff3847d5aa6568a1ea8781180 build: noarch: python - number: 2 - script: {{ PYTHON }} -m pip install . --ignore-installed --no-deps -vv + number: 0 + script: {{ PYTHON }} -m pip install --no-deps --ignore-installed --no-cache-dir -vvv . + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: host: - - python >=3 + - python >=3.10 - pip + - poetry run: - - python >=3 - - numpy - - pandas + - python >=3.10 + - matplotlib-base >=3.5.1 + - numpy >=1.21.0 + - pandas >=1.4.1 test: commands: - - DUDes.py -h 2>&1 | echo $? + - dudes -h + - dudesdb -h about: - home: https://github.com/pirovc/dudes/ - license: The MIT License (MIT) - summary: 'DUDes: a top-down taxonomic profiler for metagenomics' + home: https://github.com/pirovc/dudes + summary: "DUDes: a top-down taxonomic profiler for metagenomics and metaproteomics" + license: MIT License + license_family: MIT + license_file: LICENSE.md + +extra: + identifiers: + - doi:10.1093/bioinformatics/btw150 + recipe-maintainers: + - pirovc + - rababerladuseladim diff --git a/recipes/dupsifter/meta.yaml b/recipes/dupsifter/meta.yaml index 7a256ef424987..2d91cf55de8e3 100644 --- a/recipes/dupsifter/meta.yaml +++ b/recipes/dupsifter/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '1.2.0.20230926' %} +{% set version = '1.2.1.20240119' %} package: name: dupsifter @@ -11,7 +11,7 @@ build: source: url: https://github.com/huishenlab/dupsifter/releases/download/v{{ version }}/release-source.zip - sha256: 7a4dfe194d51ac09b30f85f6c77f9e8c31c62e636f56c09748688b32755d9521 + sha256: ca3db67e36f9a3d054acf9fbaf0dee1037781d468d7f094ea5d3852610448e7a patches: - patch diff --git a/recipes/dxpy/meta.yaml b/recipes/dxpy/meta.yaml index 2f93229ada451..422bee812a140 100644 --- a/recipes/dxpy/meta.yaml +++ b/recipes/dxpy/meta.yaml @@ -1,5 +1,5 @@ {% set name = "dxpy" %} -{% set version = "0.368.1" %} +{% set version = "0.374.0" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: e8fd366edfbe7c9ffd86be14e89d1a0086843442807bea3c404146ca7e96de62 + sha256: 2e1f049d28815ae7c3a67f4e2302bc9fe23bd235780c927b82122d52badf9fcb build: number: 0 diff --git a/recipes/earlgrey/meta.yaml b/recipes/earlgrey/meta.yaml index caa4eddb4e6a7..b2caab5f88b65 100644 --- a/recipes/earlgrey/meta.yaml +++ b/recipes/earlgrey/meta.yaml @@ -1,6 +1,6 @@ {% set name = "EarlGrey" %} -{% set version = "4.0.3" %} -{% set sha256 = "5715301151d7d6609aa703c9c174f00e1bde61c6d2f0493f5c01831d95152fb0" %} +{% set version = "4.1.1" %} +{% set sha256 = "499b39f0887f6b258a0fc7ac8eb4aa1abbc3fbe2e22d412be245c21e2c896381" %} package: name: {{ name|lower }} diff --git a/recipes/ebi-eva-common-pyutils/meta.yaml b/recipes/ebi-eva-common-pyutils/meta.yaml new file mode 100644 index 0000000000000..5e11341ad5529 --- /dev/null +++ b/recipes/ebi-eva-common-pyutils/meta.yaml @@ -0,0 +1,47 @@ +{% set name = "ebi-eva-common-pyutils" %} +{% set version = "0.6.6" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/ebi_eva_common_pyutils-{{ version }}.tar.gz + sha256: 9f55b4482b52fad605e7fbca061f200b82277bfac967fbf55688f5724dd76348 + +build: + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + noarch: python + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} + +requirements: + host: + - python + - pip + run: + - python + - requests + - lxml + - pyyaml + - cached-property + - retry + +test: + imports: + - ebi_eva_common_pyutils + commands: + - pip check + requires: + - pip + +about: + home: https://github.com/EBIVariation/eva-common-pyutils + summary: EBI EVA - Common Python Utilities + license: Apache-2.0 + license_file: LICENSE + +extra: + recipe-maintainers: + - apriltuesday diff --git a/recipes/edta/build.sh b/recipes/edta/build.sh index 729d94a5a9379..e47cfd13c7302 100644 --- a/recipes/edta/build.sh +++ b/recipes/edta/build.sh @@ -20,3 +20,12 @@ for name in ${EDTA_OTHER_PROGRAMS} ; do done ln -sf ${EDTA_DIR}/development/EDTA_processI.pl ${PREFIX}/bin/ + +LTR_FINDER_PARALLEL_DIR=${EDTA_DIR}/bin/LTR_FINDER_parallel + +cat <>${PREFIX}/bin/LTR_FINDER_parallel +#!/bin/bash +perl ${LTR_FINDER_PARALLEL_DIR}/LTR_FINDER_parallel \$@ +END + +chmod a+x ${PREFIX}/bin/LTR_FINDER_parallel \ No newline at end of file diff --git a/recipes/edta/meta.yaml b/recipes/edta/meta.yaml index 3e5f7651efd27..eb2e7f1763bc2 100644 --- a/recipes/edta/meta.yaml +++ b/recipes/edta/meta.yaml @@ -11,7 +11,7 @@ source: sha256: {{ sha256 }} build: - number: 0 + number: 1 noarch: generic run_exports: - {{ pin_subpackage('edta', max_pin='x') }} @@ -59,6 +59,7 @@ test: - EDTA_processI.pl -h 2>&1 | grep -i "Perform EDTA" - EDTA_raw.pl -h 2>&1 | grep -i "Obtain raw" - lib-test.pl -h 2>&1 | grep -i "To test" + - LTR_FINDER_parallel -check_dependencies > /dev/null about: home: https://github.com/oushujun/EDTA diff --git a/recipes/egglib/meta.yaml b/recipes/egglib/meta.yaml index 00a8af2197238..db7cc9d666615 100644 --- a/recipes/egglib/meta.yaml +++ b/recipes/egglib/meta.yaml @@ -1,5 +1,5 @@ {% set name = "egglib" %} -{% set version = "3.3.1" %} +{% set version = "3.3.2" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/EggLib-{{ version }}.zip - sha256: ef918149243b7a6c3007629b3bb8df59a49af53910300bc3a07c698ac84bec55 + sha256: 596838f6504c5a0f7ae9da9fbe41a595c3113e27d764e1a09a9e8795ef79d056 build: number: 0 diff --git a/recipes/emboss/meta.yaml b/recipes/emboss/meta.yaml index 6d391404b6993..f0dc4935fe501 100644 --- a/recipes/emboss/meta.yaml +++ b/recipes/emboss/meta.yaml @@ -3,8 +3,10 @@ package: version: "6.6.0" build: - number: 7 + number: 8 skip: True # [osx] + run_exports: + - {{ pin_subpackage("emboss", max_pin="x.x") }} source: url: ftp://emboss.open-bio.org/pub/EMBOSS/EMBOSS-6.6.0.tar.gz @@ -19,10 +21,12 @@ requirements: - zlib - libgd - libpng + - libharu run: - zlib - libgd - libpng + - libharu about: home: http://emboss.open-bio.org/ diff --git a/recipes/ena-upload-cli/meta.yaml b/recipes/ena-upload-cli/meta.yaml index 5e31554cbe1b8..cd0ab25f80af4 100644 --- a/recipes/ena-upload-cli/meta.yaml +++ b/recipes/ena-upload-cli/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ena-upload-cli" %} -{% set version = "0.7.0" %} +{% set version = "0.7.1" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: e82e086c84435f5c9d53373d1e3e124a87ce1ead0ba75b72050db534cd50eab9 + sha256: ee176f66a3ff7af7091eb45184fd2c1778581fc56d4a96410f14cd19312cce7e build: number: 0 diff --git a/recipes/ena-webin-cli/meta.yaml b/recipes/ena-webin-cli/meta.yaml index 98bc27a785056..3201e5a7de9c9 100644 --- a/recipes/ena-webin-cli/meta.yaml +++ b/recipes/ena-webin-cli/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "6.9.0" %} -{% set sha256 = "13218491e3d0dce8b28360606e23ffd54bd491452449c996e7f05944bf352217" %} +{% set version = "7.1.1" %} +{% set sha256 = "88e7744f12264c0ece54a6bb73833e43b877d5af6cca5bc415d1b55bb0aba782" %} package: name: ena-webin-cli diff --git a/recipes/entrez-direct/aarch64.patch b/recipes/entrez-direct/aarch64.patch new file mode 100644 index 0000000000000..897f38f6818d7 --- /dev/null +++ b/recipes/entrez-direct/aarch64.patch @@ -0,0 +1,115 @@ +diff -urN edirect.orig/cmd/build.sh edirect/cmd/build.sh +--- edirect.orig/cmd/build.sh 2022-11-12 07:25:55 ++++ edirect/cmd/build.sh 2024-03-08 22:13:47 +@@ -13,6 +13,7 @@ + Darwin-*arm* ) platform=Silicon ;; + CYGWIN_NT-* | MINGW*-* ) platform=CYGWIN_NT ;; + Linux-*arm* ) platform=ARM ;; ++ Linux-*aarch64* ) platform=ARM64 ;; + * ) platform=UNSUPPORTED ;; + esac + +@@ -94,7 +95,7 @@ + fi + + # erase any existing executables in current directory +-for plt in Darwin Silicon Linux CYGWIN_NT ARM ++for plt in Darwin Silicon Linux CYGWIN_NT ARM ARM64 + do + rm -f *.$plt + done +@@ -103,6 +104,7 @@ + mods="darwin amd64 Darwin \ + darwin arm64 Silicon \ + linux amd64 Linux \ ++ linux arm64 ARM64 \ + windows 386 CYGWIN_NT \ + linux arm ARM" + +@@ -126,13 +128,13 @@ + if [ "$cleanup" = true ] + then + # remove old executables from target +- for plt in Darwin Silicon Linux CYGWIN_NT ARM ++ for plt in Darwin Silicon Linux CYGWIN_NT ARM ARM64 + do + rm -f $target/*.$plt + done + fi + # copy new executables to target +- for plt in Darwin Silicon Linux CYGWIN_NT ARM ++ for plt in Darwin Silicon Linux CYGWIN_NT ARM ARM64 + do + for exc in xtract rchive transmute + do +@@ -145,7 +147,7 @@ + fi + + # erase any remaining executables after compiling +-for plt in Darwin Silicon Linux CYGWIN_NT ARM ++for plt in Darwin Silicon Linux CYGWIN_NT ARM ARM64 + do + rm -f *.$plt + done +diff -urN edirect.orig/extern/build.sh edirect/extern/build.sh +--- edirect.orig/extern/build.sh 2024-03-04 11:00:38 ++++ edirect/extern/build.sh 2024-03-08 22:14:43 +@@ -13,6 +13,7 @@ + Darwin-*arm* ) platform=Silicon ;; + CYGWIN_NT-* | MINGW*-* ) platform=CYGWIN_NT ;; + Linux-*arm* ) platform=ARM ;; ++ Linux-*aarch64* ) platform=ARM64 ;; + * ) platform=UNSUPPORTED ;; + esac + +@@ -51,7 +52,7 @@ + fi + + # erase any existing executables in current directory +-for plt in Darwin Silicon Linux CYGWIN_NT ARM ++for plt in Darwin Silicon Linux CYGWIN_NT ARM ARM64 + do + rm -f *.$plt + done +@@ -64,7 +65,7 @@ + done + + # will be using "go run", erase executables after test complication +-for plt in Darwin Silicon Linux CYGWIN_NT ARM ++for plt in Darwin Silicon Linux CYGWIN_NT ARM ARM64 + do + rm -f *.$plt + done +diff -urN edirect.orig/rchive edirect/rchive +--- edirect.orig/rchive 2022-01-29 07:25:44 ++++ edirect/rchive 2024-03-08 22:16:43 +@@ -62,6 +62,7 @@ + Darwin-*arm* ) platform=Silicon ;; + CYGWIN_NT-* | MINGW*-* ) platform=CYGWIN_NT ;; + Linux-*arm* ) platform=ARM ;; ++ Linux-*aarch64* ) platform=ARM64 ;; + * ) platform=UNSUPPORTED ;; + esac + compiled=$0."$platform" +diff -urN edirect.orig/transmute edirect/transmute +--- edirect.orig/transmute 2023-02-22 07:25:33 ++++ edirect/transmute 2024-03-08 22:16:43 +@@ -402,6 +402,7 @@ + Darwin-*arm* ) platform=Silicon ;; + CYGWIN_NT-* | MINGW*-* ) platform=CYGWIN_NT ;; + Linux-*arm* ) platform=ARM ;; ++ Linux-*aarch64* ) platform=ARM64 ;; + * ) platform=UNSUPPORTED ;; + esac + compiled=$0."$platform" +diff -urN edirect.orig/xtract edirect/xtract +--- edirect.orig/xtract 2024-02-28 09:25:34 ++++ edirect/xtract 2024-03-08 22:16:43 +@@ -110,6 +110,7 @@ + Darwin-*arm* ) platform=Silicon ;; + CYGWIN_NT-* | MINGW*-* ) platform=CYGWIN_NT ;; + Linux-*arm* ) platform=ARM ;; ++ Linux-*aarch64* ) platform=ARM64 ;; + * ) platform=UNSUPPORTED ;; + esac + compiled=$0."$platform" diff --git a/recipes/entrez-direct/build.sh b/recipes/entrez-direct/build.sh index 9771c20b4c018..99a82f92a55e0 100644 --- a/recipes/entrez-direct/build.sh +++ b/recipes/entrez-direct/build.sh @@ -3,18 +3,24 @@ # Keep track of the process set -uex +mkdir bin nobin +# Don't install these most bespoke scripts +mv custom-* idx-* pm-* xy-* nobin +# Move ordinary scripts into a subdirectory for convenience +mv $(find * -type d -prune -o -print | sed '/^[A-Z]/d;/[.]pdf$/d;/[.]pem$/d;/[.]py$/d;/conda/d;/build/d') bin + mkdir -p $PREFIX/bin -mv * $PREFIX/bin -mkdir -p "$PREFIX/home" -export HOME="$PREFIX/home" +(cd cmd && sh -ex ./build.sh $PREFIX/bin) +(cd extern && sh -ex ./build.sh $PREFIX/bin) -# Needs to run in the install folder -cd ${PREFIX}/bin +# Ensure conda-build can tidy up this compiler cache tree +test -d gopath && chmod -R u+wX gopath -sh install.sh +mkdir -p $PREFIX/bin/data $PREFIX/bin/help +install -m 644 data/* $PREFIX/bin/data +install -m 644 help/* $PREFIX/bin/help -# clean up -rm -rf eutils cmd -rm -rf *.log *.go *.yaml setup.sh install.sh *.gz *.pdf -rm -rf idx-* index-* pm-* custom* xy-* CA.pm cacert.pem +install -m 755 bin/* $PREFIX/bin +echo "Check for additional scripts to be installed to .../bin" +ls diff --git a/recipes/entrez-direct/meta.yaml b/recipes/entrez-direct/meta.yaml index 9c509fc7a21c3..f4f4fc137f9bd 100644 --- a/recipes/entrez-direct/meta.yaml +++ b/recipes/entrez-direct/meta.yaml @@ -1,21 +1,24 @@ -{% set version = "16.2" %} -{% set date = "20211103" %} -{% set sha256 = "42124ac5aa9aed2bb399b064ad4dfe418b9facb6f61eef95ac7e92e7cc410dd3" %} +{% set version = "21.6" %} +{% set date = "20240308" %} +{% set sha256 = "805e34f2705905a7aed49b8bcd1ed6a1a6c2acf1f7ea249349cbbce30cac30bd" %} package: name: entrez-direct version: {{ version }} build: - number: 1 + number: 0 + run_exports: + - {{ pin_subpackage("entrez-direct", max_pin="x") }} source: - url: https://raw.githubusercontent.com/biostars/conda-ready-entrez-direct/main/dist/edirect-16.2.20211103.tar.gz + url: https://ftp.ncbi.nlm.nih.gov/entrez/entrezdirect/versions/{{ version }}.{{ date }}/edirect.tar.gz sha256: {{ sha256 }} + patches: + - aarch64.patch requirements: build: - # The installer script downloads statically compiled binaries, so this is effectively just avoiding linter errors - {{ compiler('go') }} run: - wget @@ -29,13 +32,17 @@ test: - esearch --help - elink --help - esummary --help + - rchive -version + - transmute -version - xtract -version about: - home: ftp://ftp.ncbi.nlm.nih.gov/entrez/entrezdirect/versions/{{ version }}.{{ date }}/README + home: https://ftp.ncbi.nlm.nih.gov/entrez/entrezdirect/versions/{{ version }}.{{ date }}/README license: PUBLIC DOMAIN summary: Entrez Direct (EDirect) is an advanced method for accessing the NCBI's set of interconnected databases (publication, sequence, structure, gene, variation, expression, etc.) from a UNIX terminal window. Functions take search terms from command-line arguments. Individual operations are combined to build multi-step queries. Record retrieval and formatting normally complete the process. extra: + additional-platforms: + - linux-aarch64 container: extended-base: True diff --git a/recipes/entrez-direct/xtract.patch b/recipes/entrez-direct/xtract.patch deleted file mode 100644 index 5a9c413eb66a8..0000000000000 --- a/recipes/entrez-direct/xtract.patch +++ /dev/null @@ -1,30 +0,0 @@ ---- setup.sh 2019-10-18 19:50:47.000000000 +0200 -+++ setup.sh.new 2020-02-03 08:32:53.591369832 +0100 -@@ -62,7 +62,8 @@ - - if [ -f xtract."$platform" ] - then -- chmod +x xtract."$platform" -+ mv xtract."$osname" xtract -+ chmod +x xtract - else - echo "Unable to download xtract executable." - fi -@@ -113,17 +114,4 @@ - | tee $advice - fi - --if [ -z "$prfx" ] --then --echo "" --echo "or manually edit the PATH variable assignment in your .bash_profile file." --echo "" --echo "Would you like to do that automatically now? [y/N]" --read response --case "$response" in -- [Yy]* ) . $advice; echo "OK, done." ;; -- [Nn]* | '' ) echo "Holding off, then." ;; -- * ) echo "Conservatively taking that as a no." ;; --esac --fi - rm $advice diff --git a/recipes/ephemeris/meta.yaml b/recipes/ephemeris/meta.yaml index 23825c1b8f8f3..e6929208c86a9 100644 --- a/recipes/ephemeris/meta.yaml +++ b/recipes/ephemeris/meta.yaml @@ -1,42 +1,53 @@ +{% set name = "ephemeris" %} +{% set version = "0.10.10" %} + package: - name: ephemeris - version: "0.10.8" + name: {{ name }} + version: {{ version }} source: - url: https://files.pythonhosted.org/packages/92/56/0544ef43ecb994e543a81f68bbe65dd0ccaf1a21eaa3706a75190f4ba256/ephemeris-0.10.8.tar.gz - sha256: dd19c739ddb83ffbfa7d23b63e979f26602af2282c21a799cc52ea4342d62d37 + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/ephemeris-{{ version }}.tar.gz + sha256: 397599341949e359c5dc1cb6bf8b4be06b14cc3d2e8fb404a3421f37d17c2b44 build: number: 0 noarch: python - preserve_egg_dir: True entry_points: - - get-tool-list=ephemeris.get_tool_list_from_galaxy:main - - shed-tools=ephemeris.shed_tools:main - - workflow-install=ephemeris.workflow_install:main - - run-data-managers=ephemeris.run_data_managers:main - - workflow-to-tools=ephemeris.generate_tool_list_from_ga_workflow_files:main - - setup-data-libraries=ephemeris.setup_data_libraries:main - - galaxy-wait=ephemeris.sleep:main - script: python -m pip install --no-deps --ignore-installed . + - get-tool-list = ephemeris.get_tool_list_from_galaxy:main + - shed-tools = ephemeris.shed_tools:main + - workflow-install = ephemeris.workflow_install:main + - run-data-managers = ephemeris.run_data_managers:main + - workflow-to-tools = ephemeris.generate_tool_list_from_ga_workflow_files:main + - setup-data-libraries = ephemeris.setup_data_libraries:main + - galaxy-wait = ephemeris.sleep:main + - install_tool_deps = ephemeris.install_tool_deps:main + - install-tool-deps = ephemeris.install_tool_deps:main + - set-library-permissions = ephemeris.set_library_permissions:main + - _idc-lint = ephemeris._idc_lint:main + - _idc-split-data-manager-genomes = ephemeris._idc_split_data_manager_genomes:main + - _idc-data-managers-to-tools = ephemeris._idc_data_managers_to_tools:main + script: {{ PYTHON }} -m pip install --no-deps --no-build-isolation . -vvv + run_exports: + - {{ pin_subpackage('ephemeris', max_pin="x.x") }} requirements: host: - - python + - python >=3.7 - pip run: - - python + - python >=3.7 - pyyaml - six >=1.9.0 - bioblend >=0.10.0 - jinja2 - - galaxy-tool-util >=20.5.0 - - galaxy-util >=20.5.0 + - galaxy-tool-util >=20.9.1 + - galaxy-util >=20.9.0 + - pysam + - rich test: imports: - ephemeris - commands: - get-tool-list --help - shed-tools --help @@ -45,9 +56,13 @@ test: - workflow-to-tools --help - setup-data-libraries --help - galaxy-wait --help + - install_tool_deps --help + - install-tool-deps --help + - set-library-permissions --help about: home: https://github.com/galaxyproject/ephemeris license: Academic Free License (AFL) summary: 'Ephemeris is an opinionated library and set of scripts for managing the bootstrapping of Galaxy project plugins - tools, index data, and workflows.' license_family: OTHER + doc_url: https://ephemeris.readthedocs.io/en/latest/ diff --git a/recipes/epic2/meta.yaml b/recipes/epic2/meta.yaml index bf674d7045e4c..278c65055a381 100644 --- a/recipes/epic2/meta.yaml +++ b/recipes/epic2/meta.yaml @@ -11,9 +11,11 @@ source: sha256: '{{ hash_value }}' build: - number: 6 + number: 7 # Compilation errors on OSX skip: True # [osx or py27] + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} requirements: build: @@ -25,6 +27,7 @@ requirements: - setuptools - pysam - htslib + - zlib run: - python - scipy @@ -47,6 +50,8 @@ about: summary: 'Ultraperformant Chip-Seq broad domain finder based on SICER.' extra: + additional-platforms: + - linux-aarch64 identifiers: - doi:10.1093/bioinformatics/btz232 recipe-maintainers: diff --git a/recipes/epik/build.sh b/recipes/epik/build.sh new file mode 100644 index 0000000000000..7bdd89211df09 --- /dev/null +++ b/recipes/epik/build.sh @@ -0,0 +1,24 @@ +#!/bin/bash +set -ex + +export CPLUS_INCLUDE_PATH=${PREFIX}/include +export CPP_INCLUDE_PATH=${PREFIX}/include +export CXX_INCLUDE_PATH=${PREFIX}/include + +#to ensure zlib location +export CFLAGS="$CFLAGS -I$PREFIX/include" +export LDFLAGS="$LDFLAGS -L$PREFIX/lib" + +mkdir -p $PREFIX/bin +mkdir -p $PREFIX/lib + +cmake -B build -DBUILD_SHARED_LIBS=ON --install-prefix=$PREFIX +cmake --build build --target all +cmake --install build + +ls $PREFIX/bin +ls $PREFIX/lib + +chmod +x $PREFIX/bin/epik-aa +chmod +x $PREFIX/bin/epik-dna +chmod +x $PREFIX/bin/epik.py diff --git a/recipes/epik/meta.yaml b/recipes/epik/meta.yaml new file mode 100644 index 0000000000000..438e50ab8cc17 --- /dev/null +++ b/recipes/epik/meta.yaml @@ -0,0 +1,42 @@ +{% set name = "EPIK" %} +{% set version = "0.2.0" %} +{% set sha256 = "33db0a0fec8e89950110ea8c910947e00e224117dcba2a78d9347f61da4fe1cb" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/phylo42/{{ name|lower }}/releases/download/v{{ version }}/EPIK-v{{ version }}_src_for_bioconda.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage('epik', max_pin="x.x") }} + +requirements: + build: + - make + - {{ compiler('cxx') }} + - cmake + - llvm-openmp # [osx] + host: + - boost-cpp >=1.67 + - zlib + - rapidjson + run: + - boost-cpp >=1.67 + - llvm-openmp # [osx] + - python + - click + + +about: + home: https://github.com/phylo42/epik + license: MIT + license_family: MIT + license_file: LICENSE + summary: "EPIK is a tool for fast alignement-free phylogenetic placements." + description: "EPIK uses pre-computed phylo-k-mers indexes (see package IPK) to rapidly place large amounts of sequences on a fixed phylogenetic tree. Please cite: doi.org/10.1093/bioinformatics/btad692" + diff --git a/recipes/epik/run_test.sh b/recipes/epik/run_test.sh new file mode 100644 index 0000000000000..d35e1baf13fad --- /dev/null +++ b/recipes/epik/run_test.sh @@ -0,0 +1,36 @@ +#!/usr/bin/env bash + +PASS=true + +# A +echo "test A" +command -v epik-dna +if [ $? -ne 0 ]; then + echo "failed" + PASS=false +fi + +# B +echo "test B" +command -v epik-aa +if [ $? -ne 0 ]; then + echo "failed" + PASS=false +fi + +# C +echo "test C" +epik-dna 2>&1 | grep "Evolutionary Placement with Informative K-mers" +if [ $? -ne 0 ]; then + echo "failed" + PASS=false +fi + +#D +echo "test D" +epik.py place --help +if [ $? -ne 0 ]; then + echo "failed" + PASS=false +fi + diff --git a/recipes/eva-sub-cli/build.sh b/recipes/eva-sub-cli/build.sh new file mode 100644 index 0000000000000..aa7198453931d --- /dev/null +++ b/recipes/eva-sub-cli/build.sh @@ -0,0 +1,21 @@ +#!/bin/bash + +BIOVALIDATOR_VERSION=2.2.1 + +EVA_SUB_CLI="${PREFIX}/share/${PKG_NAME}-${PKG_VERSION}" +mkdir -p ${PREFIX}/bin ${EVA_SUB_CLI} + +# Install eva-sub-cli +$PYTHON -m pip install . +cp bin/* ${PREFIX}/bin +echo "Done with eva-sub-cli" + +cd ${EVA_SUB_CLI} + +# Install biovalidator from source +curl -Lo biovalidator.zip https://github.com/elixir-europe/biovalidator/archive/refs/tags/v${BIOVALIDATOR_VERSION}.zip \ + && unzip -q biovalidator.zip && rm biovalidator.zip \ + && cd biovalidator-${BIOVALIDATOR_VERSION} \ + && npm install && npm install -g \ + && cd .. +echo "Done with biovalidator" diff --git a/recipes/eva-sub-cli/meta.yaml b/recipes/eva-sub-cli/meta.yaml new file mode 100644 index 0000000000000..d60fc92c71c34 --- /dev/null +++ b/recipes/eva-sub-cli/meta.yaml @@ -0,0 +1,60 @@ +{% set name = "eva-sub-cli" %} +{% set version = "0.2" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/EBIvariation/eva-sub-cli/archive/v{{version}}.tar.gz + sha256: c997f72a93f13f03485274bf5f0468bfc9d5ed3082a9b81742eb21133aa35bff + +build: + number: 0 + noarch: generic + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} + +requirements: + host: + - nextflow >=21.10.0 + - python >=3.8 + - nodejs >=10.19.1 + - vcf-validator >=0.9.6 + - ebi-eva-common-pyutils >=0.6.1 + - pyyaml + - jinja2 + - openpyxl + - requests + - jsonschema + - unzip + run: + - nextflow >=21.10.0 + - python >=3.8 + - nodejs >=10.19.1 + - vcf-validator >=0.9.6 + - ebi-eva-common-pyutils >=0.6.1 + - pyyaml + - jinja2 + - openpyxl + - requests + - jsonschema + +test: + imports: + - eva_sub_cli + commands: + - biovalidator --help + - eva-sub-cli.py --help + +about: + home: https://github.com/EBIvariation/eva-sub-cli + summary: EVA Submission Command Line Interface + license: Apache-2.0 + license_file: LICENSE + +extra: + recipe-maintainers: + - apriltuesday + - tcezard + - ebi-variation \ No newline at end of file diff --git a/recipes/evofr/meta.yaml b/recipes/evofr/meta.yaml index a5eae9189357a..e874ecf75867f 100644 --- a/recipes/evofr/meta.yaml +++ b/recipes/evofr/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.1.21" %} +{% set version = "0.1.22" %} package: name: evofr @@ -6,7 +6,7 @@ package: source: url: https://pypi.io/packages/source/e/evofr/evofr-{{ version }}.tar.gz - sha256: 0ec5329a19087992e14e8c5a5b969b6069308f287595125b67574176c73532c0 + sha256: 8643b54c985dd01ce915c1cf4f475d4f29370166ad62cde7619f66c9f50890e6 build: number: 0 @@ -24,9 +24,9 @@ requirements: - python >=3.9,<4 - numpy >=1.22.4 - pandas >=1.4.2 - - jax >=0.4.1,<0.5.0 + - jax >=0.4.14,<0.5.0 - jaxlib >=0.4.1,<0.5.0 - - numpyro >=0.12.0,<0.13.0 + - numpyro >=0.13.2,<0.14.0 - blackjax >=0.9.6,<0.10.0 test: diff --git a/recipes/exomiser-rest-prioritiser/meta.yaml b/recipes/exomiser-rest-prioritiser/meta.yaml index 03395c15f4f0a..5f67ff79744ad 100644 --- a/recipes/exomiser-rest-prioritiser/meta.yaml +++ b/recipes/exomiser-rest-prioritiser/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "13.3.0" %} -{% set sha256 = "bff2399f63d26f11169e4b2de5e397bcd3c61f74022703a5d8eff20b2ac4926c" %} +{% set version = "14.0.0" %} +{% set sha256 = "6817537b1e602f533219089fc89d6c1d154e26e61efb05a5de382a56eeba4094" %} package: name: exomiser-rest-prioritiser @@ -17,7 +17,7 @@ build: requirements: run: - - openjdk >=8 + - openjdk >=17 - zlib test: @@ -27,4 +27,11 @@ test: about: home: https://github.com/exomiser/Exomiser summary: Exomiser prioritiser REST API - license: AGPL3 + license: AGPL-3.0-or-later + license_family: AGPL + doc_url: https://exomiser.readthedocs.io/en/latest/ + dev_url: https://github.com/exomiser/Exomiser + +extra: + identifiers: + - biotools:exomiser diff --git a/recipes/exonerate/build.sh b/recipes/exonerate/build.sh index 6b8ee4937a8a8..512cc3cc3a21f 100644 --- a/recipes/exonerate/build.sh +++ b/recipes/exonerate/build.sh @@ -1,4 +1,11 @@ #!/bin/sh + +set -xe + +# Download newer config.{sub,guess} files +wget "http://git.savannah.gnu.org/gitweb/?p=config.git;a=blob_plain;f=config.guess;hb=HEAD" -O config.guess +wget "http://git.savannah.gnu.org/gitweb/?p=config.git;a=blob_plain;f=config.sub;hb=HEAD" -O config.sub + mkdir -p ${PREFIX}/bin export CFLAGS="-I$PREFIX/include" diff --git a/recipes/exonerate/conda_build_config.yaml b/recipes/exonerate/conda_build_config.yaml new file mode 100644 index 0000000000000..8caf245450f76 --- /dev/null +++ b/recipes/exonerate/conda_build_config.yaml @@ -0,0 +1,5 @@ +c_compiler_version: + - 10 # [linux] + +cxx_compiler_version: + - 10 # [linux] diff --git a/recipes/exonerate/meta.yaml b/recipes/exonerate/meta.yaml index 3a6311a7d2c30..73b122af68549 100644 --- a/recipes/exonerate/meta.yaml +++ b/recipes/exonerate/meta.yaml @@ -9,7 +9,9 @@ source: sha256: f849261dc7c97ef1f15f222e955b0d3daf994ec13c9db7766f1ac7e77baa4042 build: - number: 7 + number: 8 + run_exports: + - {{ pin_subpackage('exonerate', max_pin='x') }} requirements: build: @@ -21,6 +23,7 @@ requirements: host: - glib - pcre + - wget run: - glib @@ -32,10 +35,13 @@ test: about: home: https://www.ebi.ac.uk/about/vertebrate-genomics/software/exonerate - license: GPL-3.0 + license: GPL-3.0-or-later + license_file: COPYING summary: Exonerate - A generic tool for pairwise sequence comparison / alignment extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:exonerate diff --git a/recipes/ezaai/build.sh b/recipes/ezaai/build.sh index 125996f06d360..1c8fd24997d5c 100644 --- a/recipes/ezaai/build.sh +++ b/recipes/ezaai/build.sh @@ -2,7 +2,8 @@ EZ_AAI_JAR_NAME="EzAAI.jar" EZ_AAI_LICENSE="LICENSE.md" -EZ_AAI_BIN="${PREFIX}/bin/EzAAI" +EZ_AAI_BIN="${PREFIX}/bin/ezaai" +EZ_AAI_BIN_ALT="${PREFIX}/bin/EzAAI" # Copy the JAR to the resource directory TARGET="${PREFIX}/share/${PKG_NAME}-${PKG_VERSION}-${PKG_BUILDNUM}" @@ -12,6 +13,9 @@ cp "${EZ_AAI_LICENSE}" "${TARGET}" # Alias the JAR in the bin directory mkdir -p "${PREFIX}/bin" -echo '#!/usr/bin/env bash' > "${EZ_AAI_BIN}" -echo "java -jar ${TARGET}/${EZ_AAI_JAR_NAME} \$@" >> "${EZ_AAI_BIN}" +cat << EOF > "${EZ_AAI_BIN}" +#!/bin/sh +exec java -jar "${TARGET}/${EZ_AAI_JAR_NAME}" "\${@}" +EOF chmod +x "${EZ_AAI_BIN}" +cp "${EZ_AAI_BIN}" "${EZ_AAI_BIN_ALT}" diff --git a/recipes/ezaai/meta.yaml b/recipes/ezaai/meta.yaml index f2ac8a0971924..c3376bf7614bf 100644 --- a/recipes/ezaai/meta.yaml +++ b/recipes/ezaai/meta.yaml @@ -1,16 +1,18 @@ {% set name = "EzAAI" %} -{% set version = "1.2.2" %} -{% set sha256 = "657f2b131e2564f291ef22417cabcd6615cdf88c59f3c553ceccd3ea3b86e564" %} +{% set version = "1.2.3" %} +{% set sha256 = "dbf2433928edb223f5fb6c105e3a32ae7784bac7f2ab506a5d9470d13d240332" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://github.com/endixk/ezaai/archive/refs/tags/v{{ version }}.tar.gz + url: https://github.com/endixk/ezaai/releases/download/v{{ version }}/ezaai-bin.tar.gz sha256: {{ sha256 }} build: + run_exports: + - {{ pin_subpackage('ezaai', max_pin="x") }} noarch: generic number: 0 @@ -24,7 +26,7 @@ requirements: test: commands: - - EzAAI -h + - ezaai -h about: home: http://leb.snu.ac.kr/ezaai diff --git a/recipes/ezomero/meta.yaml b/recipes/ezomero/meta.yaml index c7c97d63bc839..a5586bc74da1a 100644 --- a/recipes/ezomero/meta.yaml +++ b/recipes/ezomero/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.1.0" %} +{% set version = "3.0.0" %} {% set name = "ezomero" %} package: @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 729db284c27067b8accb127c6501b2205f63e639045339e6939f7c991f0759c7 + sha256: dab92f66453f223a949256833dbad8e60281f29535308f378a213bd93a9c78c6 build: noarch: python diff --git a/recipes/f5c/meta.yaml b/recipes/f5c/meta.yaml index 55b96f9534adf..5b8c3e4ee649d 100644 --- a/recipes/f5c/meta.yaml +++ b/recipes/f5c/meta.yaml @@ -1,5 +1,5 @@ {% set name = "f5c" %} -{% set version = "1.3" %} +{% set version = "1.4" %} package: name: {{ name }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/hasindu2008/f5c/releases/download/v{{ version }}/f5c-v{{ version }}-release.tar.gz - sha256: 5688016fe92c8dc6dc5124d4d81bf2ad0ed5fcd78ea0d0a1995f5c868ea1f819 + sha256: 9336b35caf6486f9fffc791591ef7b40bea9156ecfb1d315fe222b6e9957d632 build: number: 0 diff --git a/recipes/fairy/build.sh b/recipes/fairy/build.sh new file mode 100644 index 0000000000000..3662f6efb60db --- /dev/null +++ b/recipes/fairy/build.sh @@ -0,0 +1,8 @@ +#!/bin/bash -euo + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="$(pwd)/.cargo" + +# build statically linked binary with Rust +RUST_BACKTRACE=1 cargo install --verbose --path . --root $PREFIX diff --git a/recipes/fairy/meta.yaml b/recipes/fairy/meta.yaml new file mode 100644 index 0000000000000..068a0072ee13f --- /dev/null +++ b/recipes/fairy/meta.yaml @@ -0,0 +1,36 @@ +{% set version = "0.5.3" %} + +package: + name: fairy + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage('fairy', max_pin='x.x') }} + +source: + url: https://github.com/bluenote-1577/fairy/archive/v{{ version }}.tar.gz + sha256: 8a949dde81a89b8c6f7bea74e793d90df923b34addd360448263a129977771e8 + +requirements: + build: + - {{ compiler("cxx") }} + - rust >=1.61 + - make + - cmake >=3.12 + +test: + commands: + - fairy --help + +about: + home: https://github.com/bluenote-1577/fairy + license: MIT + summary: fairy calculates all-to-all approximate coverage for multi-sample metagenomic binning > 100x faster than alignment. + license_file: LICENSE + +extra: + recipe-maintainers: + - bluenote-1577 + diff --git a/recipes/falco/meta.yaml b/recipes/falco/meta.yaml index 2c839a9280689..766c20816dbf0 100644 --- a/recipes/falco/meta.yaml +++ b/recipes/falco/meta.yaml @@ -1,15 +1,19 @@ -{% set version = "1.2.1" %} +{% set version = "1.2.2" %} package: name: falco version: {{ version }} build: - number: 5 + number: 0 + run_exports: + # falco is currently not intended to be stable between minor versions (x.x). + - {{ pin_subpackage('falco', max_pin="x.x") }} + source: url: https://github.com/smithlabcode/falco/releases/download/v{{ version }}/falco-{{ version }}.tar.gz - sha256: 33de8aafac45c7aea055ed7ab837d0a39d12dcf782816cea8a6c648acb911057 + sha256: 09cfb96eb4292ba0ca48713634e9da48fbe07e57a4ae8f24f356583ed6b1028b requirements: build: diff --git a/recipes/fastani/build.sh b/recipes/fastani/build.sh index 72d67bb7674dc..8008be92c6a0a 100644 --- a/recipes/fastani/build.sh +++ b/recipes/fastani/build.sh @@ -12,5 +12,5 @@ mkdir -p $PREFIX/bin ./bootstrap.sh ./configure --prefix=$PREFIX --with-gsl=$PREFIX -make +make -j ${CPU_COUNT} make install diff --git a/recipes/fastani/meta.yaml b/recipes/fastani/meta.yaml index c24fad941222f..82c05c4c98336 100644 --- a/recipes/fastani/meta.yaml +++ b/recipes/fastani/meta.yaml @@ -7,13 +7,15 @@ package: version: {{ version }} build: - number: 1 + number: 2 run_exports: - {{ pin_subpackage('fastani', max_pin="x") }} source: url: https://github.com/ParBLiSS/{{ name }}/archive/v{{ version }}.tar.gz sha256: {{ sha256 }} + patches: + - wrap-memcpy-only-for-linux-x86_64.patch # [linux and aarch64] requirements: build: @@ -24,7 +26,7 @@ requirements: host: - zlib - gsl >=2.6, <2.7.1 - - openmp # [linux] + - libgomp # [linux] - llvm-openmp # [osx] - clangdev # [osx] - libcxx >=4.0 # [osx] @@ -44,3 +46,7 @@ about: license_family: Apache license_file: LICENSE summary: 'FastANI is developed for fast alignment-free computation of whole-genome Average Nucleotide Identity (ANI).' + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/fastani/wrap-memcpy-only-for-linux-x86_64.patch b/recipes/fastani/wrap-memcpy-only-for-linux-x86_64.patch new file mode 100644 index 0000000000000..4e0f3cd97e967 --- /dev/null +++ b/recipes/fastani/wrap-memcpy-only-for-linux-x86_64.patch @@ -0,0 +1,16 @@ +--- Makefile.in 2024-04-27 14:58:06.238060909 +0300 ++++ Makefile.in.new 2024-04-27 14:58:01.910293221 +0300 +@@ -2,10 +2,11 @@ + CPPFLAGS += @amcppflags@ + + UNAME_S=$(shell uname -s) ++UNAME_M=$(shell uname -m) + + ifeq ($(UNAME_S),Darwin) #macOS clang + CXXFLAGS += -mmacosx-version-min=10.7 -stdlib=libc++ -Xpreprocessor -fopenmp -lomp +-else ++elif ($(UNAME_M),x86_64) + CXXFLAGS += -include src/common/memcpyLink.h -Wl,--wrap=memcpy + CFLAGS += -include src/common/memcpyLink.h + endif + diff --git a/recipes/fasten/meta.yaml b/recipes/fasten/meta.yaml index dc2a8ac7831b5..07b12a9b9b61f 100644 --- a/recipes/fasten/meta.yaml +++ b/recipes/fasten/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.7.2" %} -{% set sha256 = "95e6c224c9afe30b857f002c425929f10ef022180915c0e26199cf01ca18dcab" %} +{% set version = "0.8.3" %} +{% set sha256 = "ae4d56cb81ae1e5ead734aaf3727ae595bb6c8703707f408915b992ee6ba08f1" %} package: name: fasten diff --git a/recipes/fastp/meta.yaml b/recipes/fastp/meta.yaml index 69d01a796d934..5ab71115f3ff3 100644 --- a/recipes/fastp/meta.yaml +++ b/recipes/fastp/meta.yaml @@ -9,7 +9,9 @@ source: sha256: 4fad6db156e769d46071add8a778a13a5cb5186bc1e1a5f9b1ffd499d84d72b5 build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage("fastp", max_pin="x.x") }} requirements: build: @@ -27,6 +29,10 @@ test: commands: - fastp --help +extra: + additional-platforms: + - linux-aarch64 + about: home: https://github.com/OpenGene/fastp license: MIT diff --git a/recipes/fastq-scan/meta.yaml b/recipes/fastq-scan/meta.yaml index ecec567b57cf1..5a1e652f87b45 100644 --- a/recipes/fastq-scan/meta.yaml +++ b/recipes/fastq-scan/meta.yaml @@ -11,7 +11,9 @@ source: sha256: {{ sha256 }} build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} requirements: build: @@ -30,3 +32,7 @@ about: license: MIT license_file: LICENSE summary: FASTQ summary statistics in JSON format + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/fastq/meta.yaml b/recipes/fastq/meta.yaml index 4201b44ec8ee4..936ef2639cd24 100644 --- a/recipes/fastq/meta.yaml +++ b/recipes/fastq/meta.yaml @@ -1,5 +1,5 @@ {% set name = "fastq" %} -{% set version = "2.0.2" %} +{% set version = "2.0.4" %} package: name: {{ name }} @@ -7,33 +7,31 @@ package: source: url: https://github.com/not-a-feature/fastq/archive/refs/tags/v{{ version }}.tar.gz - sha256: 855f2347f3a566fde44ba1d91d033dc0de9e0c1ce72dfe7085c6f92f7eeb7cd4 + sha256: 677a5d2eb2b70d0d90da7bf9c52fabd327e5522cb7a7004a011940a3014c0562 build: noarch: python number: 0 - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation --use-pep517 -vvv" + run_exports: + - {{ pin_subpackage('fastq', max_pin="x") }} requirements: host: - - python >=3.7 + - python >=3.8 - pip run: - - python >=3.7 - - miniFasta >=2.1 + - python >=3.8 + - miniFasta >=3.0.1 test: imports: - fastq - commands: - - pip check - requires: - - pip about: home: https://github.com/not-a-feature/fastq license: GPL-3.0-or-later - license_family: GPL + license_family: GPL3 license_file: LICENSE summary: 'A simple FASTQ toolbox for small to medium size projects without dependencies.' description: | diff --git a/recipes/fasttree/meta.yaml b/recipes/fasttree/meta.yaml index 1051a9da464c4..a91720bc56fc7 100644 --- a/recipes/fasttree/meta.yaml +++ b/recipes/fasttree/meta.yaml @@ -10,7 +10,9 @@ source: sha256: "9026ae550307374be92913d3098f8d44187d30bea07902b9dcbfb123eaa2050f" build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x") }} requirements: build: @@ -33,6 +35,8 @@ about: summary: "FastTree infers approximately-maximum-likelihood phylogenetic trees from alignments of nucleotide or protein sequences" extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:fasttree - doi:10.1093/molbev/msp077 diff --git a/recipes/favites_lite/build.sh b/recipes/favites_lite/build.sh new file mode 100644 index 0000000000000..b6efe41d72ed0 --- /dev/null +++ b/recipes/favites_lite/build.sh @@ -0,0 +1,5 @@ +#!/bin/bash + +mkdir -p ${PREFIX}/bin/FAVITES-Lite +cp -r * ${PREFIX}/bin/FAVITES-Lite/ +ln -s ${PREFIX}/bin/FAVITES-Lite/favites_lite.py ${PREFIX}/bin/favites_lite.py diff --git a/recipes/favites_lite/meta.yaml b/recipes/favites_lite/meta.yaml new file mode 100644 index 0000000000000..8cf7408c77ce3 --- /dev/null +++ b/recipes/favites_lite/meta.yaml @@ -0,0 +1,41 @@ +{% set version = "1.0.1" %} + +package: + name: favites_lite + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage('favites_lite', max_pin="x.x.x") }} + noarch: generic + +source: + url: https://github.com/niemasd/FAVITES-Lite/archive/refs/tags/{{ version }}.tar.gz + sha256: a93435b263a7d9825ab8624c828e569112b4845ca7fafc97e77ee3919053563a + +requirements: + run: + - python >=3.7 + - numpy + - scipy + - treesap + - treeswift + - coatran + - gemf_favites + - niemagraphgen + - seq-gen + +about: + home: https://github.com/niemasd/FAVITES-Lite + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE + summary: "FAVITES-Lite: A lightweight framework for viral transmission and evolution simulation" + dev_url: https://github.com/niemasd/FAVITES-Lite + +test: + commands: + - favites_lite.py -h + identifiers: + - doi:10.1093/bioinformatics/bty921 diff --git a/recipes/ffq/meta.yaml b/recipes/ffq/meta.yaml index 01085e234028f..f1b17c86690cf 100644 --- a/recipes/ffq/meta.yaml +++ b/recipes/ffq/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ffq" %} -{% set version = "0.3.0" %} +{% set version = "0.3.1" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/f/ffq/ffq-{{ version }}.tar.gz - sha256: 247b1da25090519708e3811f849a612c56cdb41eda7845000490992d0a1d98b6 + sha256: 02a82b1130fa1d50558b8e3b9663cc2db1ad95498a7345783e69517f6391884b build: number: 0 @@ -15,6 +15,8 @@ build: - ffq=ffq.main:main script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv " noarch: python + run_exports: + - {{ pin_subpackage('ffq', max_pin="x.x") }} requirements: host: diff --git a/recipes/fgpyo/meta.yaml b/recipes/fgpyo/meta.yaml index a92669798697a..724cfe8711b77 100644 --- a/recipes/fgpyo/meta.yaml +++ b/recipes/fgpyo/meta.yaml @@ -1,5 +1,5 @@ {% set name = "fgpyo" %} -{% set version = "0.1.2" %} +{% set version = "0.3.0" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/fulcrumgenomics/{{ name }}/archive/refs/tags/{{ version }}.tar.gz - sha256: e305049a2961a400519de2426f6b06bac00cd0216ab68e7966ea24420593ab37 + sha256: 787506e574166c9b2cec80f722db7caa2851d24b787cdd665fae1d42f8a9c9e0 build: noarch: python @@ -19,14 +19,13 @@ build: requirements: host: - pip - - python >=3.7 + - python >=3.8 - poetry run: - - python >=3.7 - - typing_extensions >=3.7.4 # [py < 38] - - typing_inspect >=0.3.1 # [py < 38] + - python >=3.8 + - typing_extensions >=3.7.4 # [py > 311] - attrs >=19.3.0 - - pysam >=0.20.0 + - pysam >=0.22.0 - pytest >=7.4.0 run_constrained: - sphinx 4.3.1 diff --git a/recipes/fgsv/meta.yaml b/recipes/fgsv/meta.yaml index ddf5a0053b873..4d064dba5f553 100644 --- a/recipes/fgsv/meta.yaml +++ b/recipes/fgsv/meta.yaml @@ -1,5 +1,5 @@ -{% set version="0.1.1" %} -{% set sha256="e39b24710d80278b7528545b43ce8084e166614054bed55ca898fa79d4be0af9" %} +{% set version="0.2.0" %} +{% set sha256="c2f9536a677e7e99f251cada1338f611cea40477deca144f0c6928505755eb37" %} package: diff --git a/recipes/fibertools-rs/build.sh b/recipes/fibertools-rs/build.sh index 6a4023caabe45..e5418801f8fdf 100644 --- a/recipes/fibertools-rs/build.sh +++ b/recipes/fibertools-rs/build.sh @@ -16,6 +16,8 @@ export DYLD_LIBRARY_PATH=${DYLD_LIBRARY_PATH}:${LIBTORCH}/lib # # download pytorch libraries # +# unfortunetally newish size limits on bioconda packages prevent me from including this. +# keeping this code block here in case the size limits change, or bioconda/conda-forge allow the pytorch channel to be accessed. if [[ "x" == "y" ]]; then export TORCH_VERSION="2.0.1" diff --git a/recipes/fibertools-rs/meta.yaml b/recipes/fibertools-rs/meta.yaml index 078fd91c3b47d..589520189e587 100644 --- a/recipes/fibertools-rs/meta.yaml +++ b/recipes/fibertools-rs/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.3.7" %} +{% set version = "0.4.2" %} {% set name = "fibertools-rs" %} {% set build_number = "0" %} @@ -9,7 +9,7 @@ package: source: url: https://github.com/fiberseq/fibertools-rs/archive/v{{ version }}.tar.gz - sha256: 395615d051a322fa08b1d1453691c7d8ece8ca7cc77b91e5c78d3274e1d15498 + sha256: 8d73b8160d93731435afbccad3f8f8ea33c291383783303e2f88a98815cc3425 build: diff --git a/recipes/fiji-simple_omero_client/meta.yaml b/recipes/fiji-simple_omero_client/meta.yaml index 1a71aba5be3a5..98f1a97ecd7cd 100644 --- a/recipes/fiji-simple_omero_client/meta.yaml +++ b/recipes/fiji-simple_omero_client/meta.yaml @@ -1,5 +1,5 @@ {% set name = "fiji-simple_omero_client" %} -{% set version = "5.16.0" %} +{% set version = "5.18.0" %} package: name: {{ name | lower }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/GReD-Clermont/simple-omero-client/releases/download/{{ version }}/simple-omero-client-{{ version }}.jar - sha256: 577a1edcea00a4f3ad50360e8e53c0f25474b44ae21ffc20afbc757cc6c6c9d3 + sha256: 0b70886437e9cf6c2ab1096d6e711c7319b45bac6784ab4aac5fb8ef98e64e61 build: number: 0 diff --git a/recipes/flams/meta.yaml b/recipes/flams/meta.yaml index 4ead7da071881..47602ac18f84f 100644 --- a/recipes/flams/meta.yaml +++ b/recipes/flams/meta.yaml @@ -1,5 +1,5 @@ {% set name = "flams" %} -{% set version = "1.1.3" %} +{% set version = "1.1.4" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/flams-{{ version }}.tar.gz - sha256: b028cd8e131add01eb012ded0ae7c48bf361f36ae14b477a3d193fc0da4ea5fa + sha256: 0d590d0b51f41bd47830136060f1c5d38475c1905d66a7c2ea11e417b7e641b5 build: entry_points: diff --git a/recipes/floria/build.sh b/recipes/floria/build.sh new file mode 100644 index 0000000000000..3662f6efb60db --- /dev/null +++ b/recipes/floria/build.sh @@ -0,0 +1,8 @@ +#!/bin/bash -euo + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="$(pwd)/.cargo" + +# build statically linked binary with Rust +RUST_BACKTRACE=1 cargo install --verbose --path . --root $PREFIX diff --git a/recipes/floria/meta.yaml b/recipes/floria/meta.yaml new file mode 100644 index 0000000000000..ff7c268607c96 --- /dev/null +++ b/recipes/floria/meta.yaml @@ -0,0 +1,36 @@ +{% set version = "0.0.1" %} + +package: + name: floria + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage('floria', max_pin="x") }} + +source: + url: https://github.com/bluenote-1577/floria/archive/v{{ version }}.tar.gz + sha256: 48430783e411225a90282f65afb05a1e7e3d1d2bfb78fa838e359802530f4be1 + +requirements: + build: + - {{ compiler("cxx") }} + - rust >=1.62 + - make + - cmake >=3.12 + +test: + commands: + - floria --help + +about: + home: https://github.com/bluenote-1577/floria + license: MIT + summary: Floria is method for recovering strain-level haplotypes and clusters of reads from metagenomic short or long read sequencing data by haplotype phasing. + + +extra: + recipe-maintainers: + - bluenote-1577 + diff --git a/recipes/flye/0001-Makefile-aarch64.patch b/recipes/flye/0001-Makefile-aarch64.patch new file mode 100644 index 0000000000000..c408cad27e3e3 --- /dev/null +++ b/recipes/flye/0001-Makefile-aarch64.patch @@ -0,0 +1,15 @@ +diff --git a/Makefile b/Makefile +index 75f62ae..91b9571 100644 +--- a/Makefile ++++ b/Makefile +@@ -16,6 +16,10 @@ ifeq ($(shell uname -m),arm64) + export aarch64=1 + endif + ++ifeq ($(shell uname -m),aarch64) ++ export aarch64=1 ++endif ++ + .PHONY: clean all profile debug minimap2 samtools + + .DEFAULT_GOAL := all diff --git a/recipes/flye/build.sh b/recipes/flye/build.sh index 371f8f3d1246c..56b1d69744ebc 100644 --- a/recipes/flye/build.sh +++ b/recipes/flye/build.sh @@ -7,16 +7,16 @@ export CFLAGS="-L$PREFIX/lib" export INCLUDES="-I$PREFIX/include" #zlib headers for flye binaries -export CXXFLAGS="-I$PREFIX/include" -export LDFLAGS="-L$PREFIX/lib" +export CXXFLAGS="$CXXFLAGS -O3 -I$PREFIX/include" +export LDFLAGS="$LDFLAGS -L$PREFIX/lib" #install_name_tool error fix if [[ "$(uname)" == Darwin ]]; then export LDFLAGS="$LDFLAGS -headerpad_max_install_names" fi -#dynamic flag is needed for backtrace printing, +#dynamic flag is needed for backtrace printing, #but it seems it fails OSX build sed -i.bak 's/-rdynamic//' src/Makefile -$PYTHON setup.py install --single-version-externally-managed --record record.txt +$PYTHON -m pip install --no-deps --no-build-isolation --no-cache-dir . -vvv diff --git a/recipes/flye/meta.yaml b/recipes/flye/meta.yaml index 708a33bcce936..6820267409726 100644 --- a/recipes/flye/meta.yaml +++ b/recipes/flye/meta.yaml @@ -7,26 +7,25 @@ package: source: url: https://github.com/fenderglass/Flye/archive/{{ version }}.tar.gz sha256: 09580390ed0558c131ca0b836a2374d3cc7993cba2a6500024c2ee1d96666edc + patches: + - 0001-Makefile-aarch64.patch build: - number: 0 + number: 1 + entry_points: + - flye = flye.main:main run_exports: - - {{ pin_subpackage("flye", max_pin="x.x") }} + - {{ pin_subpackage("flye", max_pin="x") }} + requirements: build: - {{ compiler('cxx') }} - make host: - python - - setuptools - zlib run: - python - - setuptools - -extra: - skip-lints: - - uses_setuptools #uses pkg_resources test: commands: @@ -37,4 +36,18 @@ test: about: home: https://github.com/fenderglass/Flye/ license: BSD-3-Clause + license_family: BSD + license_file: LICENSE summary: Fast and accurate de novo assembler for single molecule sequencing reads + doc_url: https://github.com/fenderglass/Flye/blob/flye/docs/USAGE.md + dev_url: https://github.com/fenderglass/Flye/ + +extra: + additional-platforms: + - linux-aarch64 + identifiers: + - biotools:Flye + - doi:10.1038/s41592-020-00971-x + - doi:10.1038/s41587-019-0072-8 + - doi:10.1073/pnas.1604560113 + - usegalaxy-eu:flye diff --git a/recipes/foldseek/build.sh b/recipes/foldseek/build.sh index 0d987840efe4b..b06956020200b 100644 --- a/recipes/foldseek/build.sh +++ b/recipes/foldseek/build.sh @@ -1,8 +1,18 @@ -#!/bin/bash -e +#!/bin/bash + +ARCH_BUILD="" +case $(uname -m) in + x86_64) ARCH_BUILD="-DHAVE_SSE4_1=1" ;; + arm64|aarch64) ARCH_BUILD="-DHAVE_ARM8=1" ;; +esac + +if [ -z "${ARCH_BUILD}" ]; then + echo "Invalid architecture" + exit 1 +fi mkdir build cd build -cmake -DCMAKE_INSTALL_PREFIX="${PREFIX}" -DHAVE_TESTS=0 -DHAVE_MPI=0 -DHAVE_SSE4_1=1 -DVERSION_OVERRIDE="${PKG_VERSION}" .. +cmake -DCMAKE_INSTALL_PREFIX="${PREFIX}" -DHAVE_TESTS=0 -DHAVE_MPI=0 ${ARCH_BUILD} -DVERSION_OVERRIDE="${PKG_VERSION}" .. make -j${CPU_COUNT} ${VERBOSE_CM} make install - diff --git a/recipes/foldseek/meta.yaml b/recipes/foldseek/meta.yaml index 1c73a8fb35244..7c189ec2f9628 100644 --- a/recipes/foldseek/meta.yaml +++ b/recipes/foldseek/meta.yaml @@ -6,7 +6,7 @@ package: version: {{ version|replace("-", ".") }} build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('foldseek', max_pin="x") }} @@ -53,3 +53,5 @@ extra: recipe-maintainers: - milot-mirdita - martin-steinegger + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/fq/meta.yaml b/recipes/fq/meta.yaml index a4e3c0e00dae3..473e91edef61f 100644 --- a/recipes/fq/meta.yaml +++ b/recipes/fq/meta.yaml @@ -11,7 +11,7 @@ source: sha256: {{ sha256 }} build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('fq', max_pin="x") }} @@ -33,6 +33,8 @@ about: validating FASTQ files. extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - claymcleod - Midnighter diff --git a/recipes/fragpipe/build.sh b/recipes/fragpipe/build.sh new file mode 100644 index 0000000000000..9ea5f09a40436 --- /dev/null +++ b/recipes/fragpipe/build.sh @@ -0,0 +1,21 @@ +#!/bin/bash + +# Copy entire FragPipe installation including workflows into share location. +TARGET="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" +mkdir -p "$TARGET" + +# DIA-NN license is currently incompatible with bioconda +rm -rf fragpipe_source/tools/diann{,_so} +rm -rf fragpipe_source/tools/diann{,_so} +cp -rp fragpipe_source/* "$TARGET" + +# Copy wrapper script, which checks license keys, into bin. +mkdir "$PREFIX/bin" +cp "$RECIPE_DIR/fragpipe" "$PREFIX/bin" + +# Copy Philosopher installation into share and link to bin. +PHILOSOPHER_DIR="$TARGET/philosopher" +mkdir "$PHILOSOPHER_DIR" +cp philosopher_source/philosopher philosopher_source/philosopher.yml "$PHILOSOPHER_DIR" +ln -s "$PHILOSOPHER_DIR/philosopher" "$PREFIX/bin/philosopher" +chmod ugo+x "$PHILOSOPHER_DIR/philosopher" diff --git a/recipes/fragpipe/fragpipe b/recipes/fragpipe/fragpipe new file mode 100755 index 0000000000000..0de8efde2f0d9 --- /dev/null +++ b/recipes/fragpipe/fragpipe @@ -0,0 +1,64 @@ +#!/bin/bash + +# Wrapper script for command-line FragPipe. Ensures the user agrees to MSFragger and IonQuant academic licenses. + +license_agreement_text=' +Please accept the academic license. + +FragPipe uses tools that are available freely for academic research and educational purposes only. + +Please provide license keys for MSFragger and IonQuant with the --msfragger_key and --ionquant_key flags. By passing these, you verify that you have read the ACADEMIC licenses for the MSFragger and IonQuant tools. You may obtain these keys by agreeing to the terms at http://msfragger-upgrader.nesvilab.org/upgrader/ and https://msfragger.arsci.com/ionquant/.' + +declare -a fragpipe_args + +while [[ $# -gt 0 ]]; do + case "$1" in + --msfragger_key) + shift + msfragger_key=$1 + ;; + --ionquant_key) + shift + ionquant_key=$1 + ;; + --workflow) + fragpipe_args+=("$1") + shift + workflow_file="$1" + fragpipe_args+=("$1") + ;; + *) + fragpipe_args+=("$1") + ;; + esac + shift +done + +if [[ ! -z "$workflow_file" ]]; then + # Because the DIA-NN license is incompatible with bioconda, we remove the feature. + grep 'diann.run-dia-nn=true' "$workflow_file" >/dev/null + if [[ $? -eq 0 ]]; then + echo "Error: DIA-NN is disabled in the FragPipe bioconda package." + exit 1 + fi +fi + +if [[ -z $msfragger_key || -z $ionquant_key ]]; then + echo "$license_agreement_text" + exit 1 +else + msfragger --key $msfragger_key --help | grep 'License key verified' >/dev/null 2>&1 + if [[ $? -ne 0 ]]; then + echo "Error: Invalid MSFragger license key" + echo "$license_agreement_text" + exit 1 + fi + ionquant --key $ionquant_key --help | grep 'License key verified' >/dev/null 2>&1 + if [[ $? -ne 0 ]]; then + echo "Error: Invalid IonQuant license key" + echo "$license_agreement_text" + exit 1 + fi +fi + +sh "$CONDA_PREFIX"/share/fragpipe*/bin/fragpipe "${fragpipe_args[@]}" diff --git a/recipes/coatran/LICENSE b/recipes/fragpipe/licenses/dia-umpire_LICENSE.txt similarity index 100% rename from recipes/coatran/LICENSE rename to recipes/fragpipe/licenses/dia-umpire_LICENSE.txt diff --git a/recipes/fragpipe/licenses/easypqp_LICENSE.txt b/recipes/fragpipe/licenses/easypqp_LICENSE.txt new file mode 100644 index 0000000000000..23f913152b08b --- /dev/null +++ b/recipes/fragpipe/licenses/easypqp_LICENSE.txt @@ -0,0 +1,29 @@ +BSD 3-Clause License + +Copyright (c) 2019, George Rosenberger +All rights reserved. + +Redistribution and use in source and binary forms, with or without +modification, are permitted provided that the following conditions are met: + +1. Redistributions of source code must retain the above copyright notice, this + list of conditions and the following disclaimer. + +2. Redistributions in binary form must reproduce the above copyright notice, + this list of conditions and the following disclaimer in the documentation + and/or other materials provided with the distribution. + +3. Neither the name of the copyright holder nor the names of its + contributors may be used to endorse or promote products derived from + this software without specific prior written permission. + +THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" +AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE +IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE +DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE +FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL +DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR +SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER +CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, +OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE +OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. diff --git a/recipes/fragpipe/licenses/fragpipe_LICENSE.txt b/recipes/fragpipe/licenses/fragpipe_LICENSE.txt new file mode 100644 index 0000000000000..91c8581154fd7 --- /dev/null +++ b/recipes/fragpipe/licenses/fragpipe_LICENSE.txt @@ -0,0 +1,2 @@ +FragPipe GUI is licensed under GPL version 3. +Individual tools, such as MSFragger, DIA-Umpire, Philosopher, MSBooster, PTM-Shepherd, IonQuant, TMT-Integrator, EasyPQP, and DIA-NN, in FragPipe GUI have their own licenses. diff --git a/recipes/fragpipe/licenses/msbooster_LICENSE.txt b/recipes/fragpipe/licenses/msbooster_LICENSE.txt new file mode 100644 index 0000000000000..329b49e199ef5 --- /dev/null +++ b/recipes/fragpipe/licenses/msbooster_LICENSE.txt @@ -0,0 +1,165 @@ + GNU LESSER GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + + This version of the GNU Lesser General Public License incorporates +the terms and conditions of version 3 of the GNU General Public +License, supplemented by the additional permissions listed below. + + 0. Additional Definitions. + + As used herein, "this License" refers to version 3 of the GNU Lesser +General Public License, and the "GNU GPL" refers to version 3 of the GNU +General Public License. + + "The Library" refers to a covered work governed by this License, +other than an Application or a Combined Work as defined below. + + An "Application" is any work that makes use of an interface provided +by the Library, but which is not otherwise based on the Library. +Defining a subclass of a class defined by the Library is deemed a mode +of using an interface provided by the Library. + + A "Combined Work" is a work produced by combining or linking an +Application with the Library. The particular version of the Library +with which the Combined Work was made is also called the "Linked +Version". + + The "Minimal Corresponding Source" for a Combined Work means the +Corresponding Source for the Combined Work, excluding any source code +for portions of the Combined Work that, considered in isolation, are +based on the Application, and not on the Linked Version. + + The "Corresponding Application Code" for a Combined Work means the +object code and/or source code for the Application, including any data +and utility programs needed for reproducing the Combined Work from the +Application, but excluding the System Libraries of the Combined Work. + + 1. Exception to Section 3 of the GNU GPL. + + You may convey a covered work under sections 3 and 4 of this License +without being bound by section 3 of the GNU GPL. + + 2. Conveying Modified Versions. + + If you modify a copy of the Library, and, in your modifications, a +facility refers to a function or data to be supplied by an Application +that uses the facility (other than as an argument passed when the +facility is invoked), then you may convey a copy of the modified +version: + + a) under this License, provided that you make a good faith effort to + ensure that, in the event an Application does not supply the + function or data, the facility still operates, and performs + whatever part of its purpose remains meaningful, or + + b) under the GNU GPL, with none of the additional permissions of + this License applicable to that copy. + + 3. Object Code Incorporating Material from Library Header Files. + + The object code form of an Application may incorporate material from +a header file that is part of the Library. You may convey such object +code under terms of your choice, provided that, if the incorporated +material is not limited to numerical parameters, data structure +layouts and accessors, or small macros, inline functions and templates +(ten or fewer lines in length), you do both of the following: + + a) Give prominent notice with each copy of the object code that the + Library is used in it and that the Library and its use are + covered by this License. + + b) Accompany the object code with a copy of the GNU GPL and this license + document. + + 4. Combined Works. + + You may convey a Combined Work under terms of your choice that, +taken together, effectively do not restrict modification of the +portions of the Library contained in the Combined Work and reverse +engineering for debugging such modifications, if you also do each of +the following: + + a) Give prominent notice with each copy of the Combined Work that + the Library is used in it and that the Library and its use are + covered by this License. + + b) Accompany the Combined Work with a copy of the GNU GPL and this license + document. + + c) For a Combined Work that displays copyright notices during + execution, include the copyright notice for the Library among + these notices, as well as a reference directing the user to the + copies of the GNU GPL and this license document. + + d) Do one of the following: + + 0) Convey the Minimal Corresponding Source under the terms of this + License, and the Corresponding Application Code in a form + suitable for, and under terms that permit, the user to + recombine or relink the Application with a modified version of + the Linked Version to produce a modified Combined Work, in the + manner specified by section 6 of the GNU GPL for conveying + Corresponding Source. + + 1) Use a suitable shared library mechanism for linking with the + Library. A suitable mechanism is one that (a) uses at run time + a copy of the Library already present on the user's computer + system, and (b) will operate properly with a modified version + of the Library that is interface-compatible with the Linked + Version. + + e) Provide Installation Information, but only if you would otherwise + be required to provide such information under section 6 of the + GNU GPL, and only to the extent that such information is + necessary to install and execute a modified version of the + Combined Work produced by recombining or relinking the + Application with a modified version of the Linked Version. (If + you use option 4d0, the Installation Information must accompany + the Minimal Corresponding Source and Corresponding Application + Code. If you use option 4d1, you must provide the Installation + Information in the manner specified by section 6 of the GNU GPL + for conveying Corresponding Source.) + + 5. Combined Libraries. + + You may place library facilities that are a work based on the +Library side by side in a single library together with other library +facilities that are not Applications and are not covered by this +License, and convey such a combined library under terms of your +choice, if you do both of the following: + + a) Accompany the combined library with a copy of the same work based + on the Library, uncombined with any other library facilities, + conveyed under the terms of this License. + + b) Give prominent notice with the combined library that part of it + is a work based on the Library, and explaining where to find the + accompanying uncombined form of the same work. + + 6. Revised Versions of the GNU Lesser General Public License. + + The Free Software Foundation may publish revised and/or new versions +of the GNU Lesser General Public License from time to time. Such new +versions will be similar in spirit to the present version, but may +differ in detail to address new problems or concerns. + + Each version is given a distinguishing version number. If the +Library as you received it specifies that a certain numbered version +of the GNU Lesser General Public License "or any later version" +applies to it, you have the option of following the terms and +conditions either of that published version or of any later version +published by the Free Software Foundation. If the Library as you +received it does not specify a version number of the GNU Lesser +General Public License, you may choose any version of the GNU Lesser +General Public License ever published by the Free Software Foundation. + + If the Library as you received it specifies that a proxy can decide +whether future versions of the GNU Lesser General Public License shall +apply, that proxy's public statement of acceptance of any version is +permanent authorization for you to choose that version for the +Library. diff --git a/recipes/resfinder/LICENSE-2.0.txt b/recipes/fragpipe/licenses/ptm-shepherd_LICENSE.txt similarity index 100% rename from recipes/resfinder/LICENSE-2.0.txt rename to recipes/fragpipe/licenses/ptm-shepherd_LICENSE.txt diff --git a/recipes/fragpipe/meta.yaml b/recipes/fragpipe/meta.yaml new file mode 100644 index 0000000000000..873f31d126e29 --- /dev/null +++ b/recipes/fragpipe/meta.yaml @@ -0,0 +1,72 @@ +{% set name = "FragPipe" %} +{% set version = "20.0" %} +{% set philosopher_version = "5.0.0" %} + +# These keys were generated ONLY for the testing of this bioconda package. +# Users must generate their own key by agreeing to the terms at https://msfragger-upgrader.nesvilab.org/upgrader/ and https://msfragger.arsci.com/ionquant/. +{% set msfragger_academic_use_only_key = "f28c4be2-759b0a11-6c1ea652-1240565a" %} +{% set ionquant_academic_use_only_key = "b6c0ad83-9a4e8900-3e83d29c-aeba3bfb" %} + +package: + name: fragpipe + version: {{ version }} + +build: + number: 2 + noarch: generic + run_exports: + - {{ pin_subpackage('fragpipe', max_pin="x.x") }} + +source: + - url: https://github.com/Nesvilab/{{ name }}/releases/download/{{ version }}/{{ name }}-{{ version }}.zip + sha256: 0d77db85ae26c190a915823e1c68238f3a19533810734b008564b2a8d85d1bd6 + folder: fragpipe_source + - url: https://github.com/Nesvilab/philosopher/releases/download/v{{ philosopher_version }}/philosopher_v{{ philosopher_version }}_linux_amd64.zip + sha256: b0f6a6d22ca72efd54d1143142648e110b211eccaba20fe169ee65509da02fad + folder: philosopher_source + +requirements: + run: + - openjdk >=9 + - python =3.9 + - msfragger >=4.0 + - ionquant >=1.10.12 + - easypqp >=0.1.34 + - lxml + +test: + commands: + - fragpipe --msfragger_key {{ msfragger_academic_use_only_key }} --ionquant_key {{ ionquant_academic_use_only_key }} --help | grep "FragPipe v{{ version }}" + +about: + home: https://github.com/Nesvilab/FragPipe + license: GPL-3.0 + LICENSE files + license_file: + - licenses/fragpipe_LICENSE.txt + - licenses/dia-umpire_LICENSE.txt + - licenses/easypqp_LICENSE.txt + - licenses/msbooster_LICENSE.txt + - licenses/ptm-shepherd_LICENSE.txt + - philosopher_source/License + summary: Pipeline for comprehensive analysis of shotgun proteomics data + description: | + FragPipe is a Java Graphical User Interface (GUI) for a suite of computational tools + enabling comprehensive analysis of mass spectrometry-based proteomics data. + It is powered by MSFragger - an ultrafast proteomic search engine suitable + for both conventional and "open" (wide precursor mass tolerance) peptide identification. + FragPipe includes the Philosopher toolkit for downstream post-processing of + MSFragger search results (PeptideProphet, iProphet, ProteinProphet), FDR filtering, + label-based quantification, and multi-experiment summary report generation. + Crystal-C and PTM-Shepherd are included to aid interpretation of open search results. + Also included in FragPipe binary are TMT-Integrator for TMT/iTRAQ isobaric + labeling-based quantification, IonQuant for label-free quantification with + match-between-run (MBR) functionality, spectral library building with EasyPQP, + and MSFragger-DIA and DIA-Umpire SE modules for direct analysis of data independent + acquisition (DIA) data. + +extra: + recipe-maintainers: + - reid-wagner + identifiers: + - biotools:fragpipe + - doi:10.1074/mcp.TIR120.002048 diff --git a/recipes/freebayes/0003-meson-macos.patch b/recipes/freebayes/0003-meson-macos.patch new file mode 100644 index 0000000000000..47e1176d8d7ad --- /dev/null +++ b/recipes/freebayes/0003-meson-macos.patch @@ -0,0 +1,13 @@ +diff --git a/meson.build b/meson.build +index 66b8016..bf0bf10 100644 +--- a/meson.build ++++ b/meson.build +@@ -16,7 +16,7 @@ + + project('freebayes', ['cpp', 'c'], + version : '1.3.7', +- default_options : ['warning_level=1', 'cpp_std=c++17', 'optimization=3']) ++ default_options : ['warning_level=1', 'cpp_std=c++14', 'optimization=3']) + static_build = get_option('static') + + cc = meson.get_compiler('cpp') diff --git a/recipes/freebayes/build.sh b/recipes/freebayes/build.sh index 660009d1b0fc8..a090a95414a3a 100644 --- a/recipes/freebayes/build.sh +++ b/recipes/freebayes/build.sh @@ -1,9 +1,10 @@ #!/bin/bash mkdir build -meson setup --buildtype debug --prefix "${PREFIX}" -Dprefer_system_deps=true build/ - +mkdir -p ${PREFIX}/bin +CXX="${CXX}" CC="${CC}" meson setup --buildtype release --prefix "${PREFIX}" \ + --strip --prefer-static -Dprefer_system_deps=true build/ cd build ninja -v @@ -13,7 +14,6 @@ ninja -v install ##Copy scripts over ## This will likely need to be removed with an updated build cp -n ../scripts/*.py $PREFIX/bin cp -n ../scripts/*.sh $PREFIX/bin -cp -n ../scripts/*.pl $PREFIX/bin -#cp -n ../scripts/*.R $PREFIX/bin +cp -n ../scripts/*.pl $PREFIX/bin cp -n ../scripts/freebayes-parallel $PREFIX/bin diff --git a/recipes/freebayes/meta.yaml b/recipes/freebayes/meta.yaml index 150a384c7f12c..f10c0fa32a4b2 100644 --- a/recipes/freebayes/meta.yaml +++ b/recipes/freebayes/meta.yaml @@ -1,7 +1,8 @@ +{% set name = "freebayes" %} {% set version = "1.3.7" %} package: - name: freebayes + name: {{ name }} version: {{ version }} source: @@ -10,10 +11,10 @@ source: patches: - 0001-make-meson-build-conda-friendly.patch - 0002-fix-intervaltree-include-path.patch + - 0003-meson-macos.patch # [osx] build: - number: 0 - skip: true # [osx] + number: 2 run_exports: - {{ pin_subpackage("freebayes", max_pin="x") }} @@ -31,25 +32,32 @@ requirements: - tabixpp - vcflib - simde + - zlib run: - parallel - samtools - tabixpp - vcflib - + - zlib + test: commands: - freebayes --version - freebayes-parallel - + about: - home: https://github.com/ekg/freebayes + home: https://github.com/freebayes/freebayes license: MIT license_file: LICENSE license_family: MIT summary: Bayesian haplotype-based polymorphism discovery and genotyping - maintainers: jpuritz + dev_url: https://github.com/freebayes/freebayes extra: - identifiers: + additional-platforms: + - linux-aarch64 + identifiers: - biotools:freebayes + - usegalaxy-eu:freebayes + recipe-maintainers: + - jpuritz diff --git a/recipes/freyja/meta.yaml b/recipes/freyja/meta.yaml index 41ae8a92a8758..361f0291e6932 100644 --- a/recipes/freyja/meta.yaml +++ b/recipes/freyja/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.4.8" %} +{% set version = "1.5.0" %} {% set name = "Freyja" %} package: @@ -16,7 +16,7 @@ build: source: url: https://github.com/andersen-lab/{{ name }}/archive/v{{ version }}.tar.gz - sha256: 4534bf227fc58317c535c2c5d0d031816c8a5b1ae0968175a97cd02cb3530672 + sha256: b7d95ec0a632ffda019ab01d1170bd4550f8ef41039e1987a5bc93bdc5fa0edb requirements: host: diff --git a/recipes/fwdpy11/build.sh b/recipes/fwdpy11/build.sh index b03d77ec6e6a5..00d150e289830 100644 --- a/recipes/fwdpy11/build.sh +++ b/recipes/fwdpy11/build.sh @@ -1,8 +1,16 @@ #!/bin/bash +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" + +if [ `uname` == Darwin ]; then + export HOME=`mktemp -d` +fi + # https://molpopgen.github.io/fwdpy11/misc/developersguide.html # https://doc.rust-lang.org/cargo/commands/cargo-install.html -CARGO_INSTALL_ROOT=$BUILD_PREFIX CARGO_HOME=$BUILD_PREFIX cargo install cbindgen +CARGO_INSTALL_ROOT=$BUILD_PREFIX CARGO_HOME=$CARGO_HOME cargo install cbindgen #CARGO_INSTALL_ROOT=$PREFIX CARGO_HOME=$PREFIX cargo install cbindgen # cmake's "find GSL macro" can barf when conda @@ -10,7 +18,7 @@ CARGO_INSTALL_ROOT=$BUILD_PREFIX CARGO_HOME=$BUILD_PREFIX cargo install cbindgen # fix that: #GSL_ROOT_DIR=$PREFIX $PYTHON -m pip install --no-deps --ignore-installed -vv . # for mac osx need also to add other vars: -CARGO_INSTALL_ROOT=$BUILD_PREFIX CARGO_HOME=$BUILD_PREFIX GSL_ROOT_DIR=$PREFIX $PYTHON -m pip install --no-deps --ignore-installed -vv . +CARGO_INSTALL_ROOT=$BUILD_PREFIX CARGO_HOME=$CARGO_HOME GSL_ROOT_DIR=$PREFIX $PYTHON -m pip install . --no-deps --no-build-isolation --no-cache-dir -vvv # on bioconda's Azure it seems that `$PYTHON` variable is not set because get an error: # /opt/conda/conda-bld/fwdpy11_1670108175931/work/conda_build.sh: line 16: -m: command not found # so will hard-code it: diff --git a/recipes/fwdpy11/meta.yaml b/recipes/fwdpy11/meta.yaml index 318a976b8cc25..cfbac7c97ecc0 100644 --- a/recipes/fwdpy11/meta.yaml +++ b/recipes/fwdpy11/meta.yaml @@ -1,74 +1,69 @@ +{% set name = "fwdpy11" %} +{% set version = "0.22.2" %} + package: - name: fwdpy11 - version: "0.21.0" + name: {{ name|lower }} + version: {{ version }} source: - url: https://files.pythonhosted.org/packages/6e/1b/241bdd1278cb9077d81064bd443159ed07962dbacb513388e80d1a047e93/fwdpy11-0.21.0.tar.gz - sha256: cbf5cd42411146e58874baf37b32f3e7a90b5ba18336b73c1be995bd41bbac98 + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/fwdpy11-{{ version }}.tar.gz + sha256: 4bdd42d749d3c4e12f728c16d6db8c97bb5d03fff7362fe98b3c8cdfa759841d build: - skip: True # [py27 or py<38] + skip: True # [py < 38 or py > 312] number: 0 + script_env: + - SETUPTOOLS_SCM_PRETEND_VERSION={{ version }} + entry_points: + - fwdpy11 = fwdpy11.__main__:main + run_exports: + - {{ pin_subpackage('fwdpy11', max_pin="x.x") }} requirements: build: - {{ compiler('c') }} - {{ compiler('cxx') }} + - {{ compiler('rust') }} - cmake - make host: - - python - - pkgconfig - python - pip - - numpy >=1.20 - - pybind11 ==2.10.0 - - tskit >=0.5 + - setuptools-scm >=8 + - pybind11 ==2.11.1 - gsl - - openblas - - attrs - - setuptools_scm - - rust >=1.62.1 -# - intervaltree -# - pybind11 >=2.10.0 -# - numpy -# - scipy -# - attrs >=0.19.2 -# - black -# - tskit -# - msprime -# - gsl -# - boost -# - pytest -# - pytest-xdist -# - setuptools_scm -# - demes >=0.2.0 -# - rust >=1.62.1 -# - hypothesis + - scikit-build-core >=0.3.3 run: - python - - numpy >=1.20 - - tskit >=0.5 + - numpy <2.0 + - tskit >=0.5.6 - gsl - openblas - scipy - attrs - black - - demes >=0.2 + - demes >=0.2.2 - intervaltree + - deprecated test: - # Python imports imports: - fwdpy11 + commands: + - fwdpy11 --help about: - home: http://pypi.python.org/pypi/fwdpy11 - license: GNU General Public License v3 or later (GPLv3+) + home: https://github.com/molpopgen/fwdpy11 + license: "GPL-3.0-or-later" + license_family: GPL3 license_file: "COPYING" summary: 'Forward-time population genetic simulation in Python.' + dev_url: https://github.com/molpopgen/fwdpy11 + doc_url: https://molpopgen.github.io/fwdpy11 -extras: +extra: identifiers: - - 10.1534/genetics.114.165019 - - 10.1371/journal.pcbi.1006581 + - doi:10.1534/genetics.114.165019 + - doi:10.1371/journal.pcbi.1006581 + additional-platforms: + - linux-aarch64 diff --git a/recipes/gadem/meta.yaml b/recipes/gadem/meta.yaml index 283883945f57a..bf0f5a7c94fa2 100644 --- a/recipes/gadem/meta.yaml +++ b/recipes/gadem/meta.yaml @@ -7,7 +7,9 @@ source: sha256: afe89b8d1ecf7d7dc785b9f59ffdfdb511df68c147934eedc0398873fa2640dc build: - number: 5 + number: 6 + run_exports: + - {{ pin_subpackage('gadem', max_pin="x") }} requirements: build: @@ -23,3 +25,7 @@ about: home: https://www.niehs.nih.gov/research/resources/software/biostatistics/gadem/index.cfm license: GPLv3 summary: A Genetic Algorithm Guided Formation of Spaced Dyads Coupled with an EM Algorithm for Motif Discovery + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/galah/meta.yaml b/recipes/galah/meta.yaml index 362a196815042..f90f03562e182 100644 --- a/recipes/galah/meta.yaml +++ b/recipes/galah/meta.yaml @@ -1,14 +1,16 @@ -{% set version = "0.3.1" %} +{% set version = "0.4.0" %} {% set name = "galah" %} -{% set sha256 = "78a278a2a4d2e5f074115e41a38c426fab328d3deaac84cb55cded77e9c97428" %} +{% set sha256 = "9b40cc805df15461e5b07fd3108663cc92d286030c17fefe5a33716b5b8fa10a" %} package: name: {{ name }} version: {{ version }} build: - number: 3 + number: 1 skip: True # [osx] + run_exports: + - {{ pin_subpackage('galah', max_pin="x.x") }} source: url: https://github.com/wwood/{{ name }}/archive/v{{version}}.tar.gz @@ -20,7 +22,7 @@ requirements: - {{ compiler('c') }} run: - dashing ==0.4.0 - - fastani ==1.31 + - fastani >=1.31 test: commands: @@ -29,5 +31,6 @@ test: about: home: https://github.com/wwood/galah license: GPL-3.0-only + license_family: GPL3 license_file: LICENCE.txt summary: Galah aims to be a more scalable metagenome assembled genome (MAG) dereplication method. diff --git a/recipes/galaxy-files/meta.yaml b/recipes/galaxy-files/meta.yaml index ffe4ded18d97d..574bbf277470b 100644 --- a/recipes/galaxy-files/meta.yaml +++ b/recipes/galaxy-files/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "23.1.4" %} -{% set sha256 = "9d36250e580a29c8982904e90b1ad89b1712de0743750e72bea3f740960a6524" %} +{% set version = "24.0.0" %} +{% set sha256 = "d00dab002d94a6463bb93d6c7fab4d5dce921e7ab54de5ca59c615faa1a14038" %} {% set galaxy_version = version.split(".")[:2]|join(".") %} package: diff --git a/recipes/galaxy-objectstore/meta.yaml b/recipes/galaxy-objectstore/meta.yaml index 148329751bff0..d8ec586420831 100644 --- a/recipes/galaxy-objectstore/meta.yaml +++ b/recipes/galaxy-objectstore/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "23.1.4" %} -{% set sha256 = "548af50412cac61a38299b5ab6a7e9b787afc51db43370e058e4e58f2d10706b" %} +{% set version = "24.0.0" %} +{% set sha256 = "0cd30eff8285b83320b3eb5677bb93e3d368a8e771747c906861f88ca5036cd6" %} {% set galaxy_version = version.split(".")[:2]|join(".") %} package: diff --git a/recipes/galitime/meta.yaml b/recipes/galitime/meta.yaml new file mode 100644 index 0000000000000..5f48c03aab361 --- /dev/null +++ b/recipes/galitime/meta.yaml @@ -0,0 +1,40 @@ +{% set name = "galitime" %} +{% set version = "0.1.3" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: 3d2d77adf50d1f40f42b23070d9b7754fc84e6492d0a4cf466d0cad5cd4d569a + +build: + number: 0 + noarch: python + entry_points: + - galitime=galitime.galitime:main + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('galitime', max_pin="x") }} + +requirements: + host: + - pip + - python >=3 + run: + - python >=3 + +test: + imports: + - galitime + +about: + home: https://github.com/karel-brinda/galitime + license: MIT + license_family: MIT + license_file: LICENSE.txt + doc_url: https://github.com/karel-brinda/galitime + summary: 'benchmarking of scientific computaional experiments' + + diff --git a/recipes/gametes/LICENSE b/recipes/gametes/LICENSE new file mode 100644 index 0000000000000..8a8f06b2d908f --- /dev/null +++ b/recipes/gametes/LICENSE @@ -0,0 +1,362 @@ +# GNU GENERAL PUBLIC LICENSE + +Version 2, June 1991 + + Copyright (C) 1989, 1991 Free Software Foundation, Inc. + 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA + + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + +## Preamble + +The licenses for most software are designed to take away your freedom +to share and change it. By contrast, the GNU General Public License is +intended to guarantee your freedom to share and change free +software--to make sure the software is free for all its users. This +General Public License applies to most of the Free Software +Foundation's software and to any other program whose authors commit to +using it. (Some other Free Software Foundation software is covered by +the GNU Lesser General Public License instead.) You can apply it to +your programs, too. + +When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +this service if you wish), that you receive source code or can get it +if you want it, that you can change the software or use pieces of it +in new free programs; and that you know you can do these things. + +To protect your rights, we need to make restrictions that forbid +anyone to deny you these rights or to ask you to surrender the rights. +These restrictions translate to certain responsibilities for you if +you distribute copies of the software, or if you modify it. + +For example, if you distribute copies of such a program, whether +gratis or for a fee, you must give the recipients all the rights that +you have. You must make sure that they, too, receive or can get the +source code. And you must show them these terms so they know their +rights. + +We protect your rights with two steps: (1) copyright the software, and +(2) offer you this license which gives you legal permission to copy, +distribute and/or modify the software. + +Also, for each author's protection and ours, we want to make certain +that everyone understands that there is no warranty for this free +software. If the software is modified by someone else and passed on, +we want its recipients to know that what they have is not the +original, so that any problems introduced by others will not reflect +on the original authors' reputations. + +Finally, any free program is threatened constantly by software +patents. We wish to avoid the danger that redistributors of a free +program will individually obtain patent licenses, in effect making the +program proprietary. To prevent this, we have made it clear that any +patent must be licensed for everyone's free use or not licensed at +all. + +The precise terms and conditions for copying, distribution and +modification follow. + +## TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION + +**0.** This License applies to any program or other work which +contains a notice placed by the copyright holder saying it may be +distributed under the terms of this General Public License. The +"Program", below, refers to any such program or work, and a "work +based on the Program" means either the Program or any derivative work +under copyright law: that is to say, a work containing the Program or +a portion of it, either verbatim or with modifications and/or +translated into another language. (Hereinafter, translation is +included without limitation in the term "modification".) Each licensee +is addressed as "you". + +Activities other than copying, distribution and modification are not +covered by this License; they are outside its scope. The act of +running the Program is not restricted, and the output from the Program +is covered only if its contents constitute a work based on the Program +(independent of having been made by running the Program). Whether that +is true depends on what the Program does. + +**1.** You may copy and distribute verbatim copies of the Program's +source code as you receive it, in any medium, provided that you +conspicuously and appropriately publish on each copy an appropriate +copyright notice and disclaimer of warranty; keep intact all the +notices that refer to this License and to the absence of any warranty; +and give any other recipients of the Program a copy of this License +along with the Program. + +You may charge a fee for the physical act of transferring a copy, and +you may at your option offer warranty protection in exchange for a +fee. + +**2.** You may modify your copy or copies of the Program or any +portion of it, thus forming a work based on the Program, and copy and +distribute such modifications or work under the terms of Section 1 +above, provided that you also meet all of these conditions: + + +**a)** You must cause the modified files to carry prominent notices +stating that you changed the files and the date of any change. + + +**b)** You must cause any work that you distribute or publish, that in +whole or in part contains or is derived from the Program or any part +thereof, to be licensed as a whole at no charge to all third parties +under the terms of this License. + + +**c)** If the modified program normally reads commands interactively +when run, you must cause it, when started running for such interactive +use in the most ordinary way, to print or display an announcement +including an appropriate copyright notice and a notice that there is +no warranty (or else, saying that you provide a warranty) and that +users may redistribute the program under these conditions, and telling +the user how to view a copy of this License. (Exception: if the +Program itself is interactive but does not normally print such an +announcement, your work based on the Program is not required to print +an announcement.) + +These requirements apply to the modified work as a whole. If +identifiable sections of that work are not derived from the Program, +and can be reasonably considered independent and separate works in +themselves, then this License, and its terms, do not apply to those +sections when you distribute them as separate works. But when you +distribute the same sections as part of a whole which is a work based +on the Program, the distribution of the whole must be on the terms of +this License, whose permissions for other licensees extend to the +entire whole, and thus to each and every part regardless of who wrote +it. + +Thus, it is not the intent of this section to claim rights or contest +your rights to work written entirely by you; rather, the intent is to +exercise the right to control the distribution of derivative or +collective works based on the Program. + +In addition, mere aggregation of another work not based on the Program +with the Program (or with a work based on the Program) on a volume of +a storage or distribution medium does not bring the other work under +the scope of this License. + +**3.** You may copy and distribute the Program (or a work based on it, +under Section 2) in object code or executable form under the terms of +Sections 1 and 2 above provided that you also do one of the following: + + +**a)** Accompany it with the complete corresponding machine-readable +source code, which must be distributed under the terms of Sections 1 +and 2 above on a medium customarily used for software interchange; or, + + +**b)** Accompany it with a written offer, valid for at least three +years, to give any third party, for a charge no more than your cost of +physically performing source distribution, a complete machine-readable +copy of the corresponding source code, to be distributed under the +terms of Sections 1 and 2 above on a medium customarily used for +software interchange; or, + + +**c)** Accompany it with the information you received as to the offer +to distribute corresponding source code. (This alternative is allowed +only for noncommercial distribution and only if you received the +program in object code or executable form with such an offer, in +accord with Subsection b above.) + +The source code for a work means the preferred form of the work for +making modifications to it. For an executable work, complete source +code means all the source code for all modules it contains, plus any +associated interface definition files, plus the scripts used to +control compilation and installation of the executable. However, as a +special exception, the source code distributed need not include +anything that is normally distributed (in either source or binary +form) with the major components (compiler, kernel, and so on) of the +operating system on which the executable runs, unless that component +itself accompanies the executable. + +If distribution of executable or object code is made by offering +access to copy from a designated place, then offering equivalent +access to copy the source code from the same place counts as +distribution of the source code, even though third parties are not +compelled to copy the source along with the object code. + +**4.** You may not copy, modify, sublicense, or distribute the Program +except as expressly provided under this License. Any attempt otherwise +to copy, modify, sublicense or distribute the Program is void, and +will automatically terminate your rights under this License. However, +parties who have received copies, or rights, from you under this +License will not have their licenses terminated so long as such +parties remain in full compliance. + +**5.** You are not required to accept this License, since you have not +signed it. However, nothing else grants you permission to modify or +distribute the Program or its derivative works. These actions are +prohibited by law if you do not accept this License. Therefore, by +modifying or distributing the Program (or any work based on the +Program), you indicate your acceptance of this License to do so, and +all its terms and conditions for copying, distributing or modifying +the Program or works based on it. + +**6.** Each time you redistribute the Program (or any work based on +the Program), the recipient automatically receives a license from the +original licensor to copy, distribute or modify the Program subject to +these terms and conditions. You may not impose any further +restrictions on the recipients' exercise of the rights granted herein. +You are not responsible for enforcing compliance by third parties to +this License. + +**7.** If, as a consequence of a court judgment or allegation of +patent infringement or for any other reason (not limited to patent +issues), conditions are imposed on you (whether by court order, +agreement or otherwise) that contradict the conditions of this +License, they do not excuse you from the conditions of this License. +If you cannot distribute so as to satisfy simultaneously your +obligations under this License and any other pertinent obligations, +then as a consequence you may not distribute the Program at all. For +example, if a patent license would not permit royalty-free +redistribution of the Program by all those who receive copies directly +or indirectly through you, then the only way you could satisfy both it +and this License would be to refrain entirely from distribution of the +Program. + +If any portion of this section is held invalid or unenforceable under +any particular circumstance, the balance of the section is intended to +apply and the section as a whole is intended to apply in other +circumstances. + +It is not the purpose of this section to induce you to infringe any +patents or other property right claims or to contest validity of any +such claims; this section has the sole purpose of protecting the +integrity of the free software distribution system, which is +implemented by public license practices. Many people have made +generous contributions to the wide range of software distributed +through that system in reliance on consistent application of that +system; it is up to the author/donor to decide if he or she is willing +to distribute software through any other system and a licensee cannot +impose that choice. + +This section is intended to make thoroughly clear what is believed to +be a consequence of the rest of this License. + +**8.** If the distribution and/or use of the Program is restricted in +certain countries either by patents or by copyrighted interfaces, the +original copyright holder who places the Program under this License +may add an explicit geographical distribution limitation excluding +those countries, so that distribution is permitted only in or among +countries not thus excluded. In such case, this License incorporates +the limitation as if written in the body of this License. + +**9.** The Free Software Foundation may publish revised and/or new +versions of the General Public License from time to time. Such new +versions will be similar in spirit to the present version, but may +differ in detail to address new problems or concerns. + +Each version is given a distinguishing version number. If the Program +specifies a version number of this License which applies to it and +"any later version", you have the option of following the terms and +conditions either of that version or of any later version published by +the Free Software Foundation. If the Program does not specify a +version number of this License, you may choose any version ever +published by the Free Software Foundation. + +**10.** If you wish to incorporate parts of the Program into other +free programs whose distribution conditions are different, write to +the author to ask for permission. For software which is copyrighted by +the Free Software Foundation, write to the Free Software Foundation; +we sometimes make exceptions for this. Our decision will be guided by +the two goals of preserving the free status of all derivatives of our +free software and of promoting the sharing and reuse of software +generally. + +**NO WARRANTY** + +**11.** BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO +WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. +EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR +OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY +KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE +IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE +PROGRAM IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME +THE COST OF ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + +**12.** IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN +WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY +AND/OR REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU +FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR +CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE +PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING +RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A +FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), EVEN IF +SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH +DAMAGES. + +END OF TERMS AND CONDITIONS + +## How to Apply These Terms to Your New Programs + +If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these +terms. + +To do so, attach the following notices to the program. It is safest to +attach them to the start of each source file to most effectively +convey the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + one line to give the program's name and an idea of what it does. + Copyright (C) yyyy name of author + + This program is free software; you can redistribute it and/or + modify it under the terms of the GNU General Public License + as published by the Free Software Foundation; either version 2 + of the License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program; if not, write to the Free Software + Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. + +Also add information on how to contact you by electronic and paper +mail. + +If the program is interactive, make it output a short notice like this +when it starts in an interactive mode: + + Gnomovision version 69, Copyright (C) year name of author + Gnomovision comes with ABSOLUTELY NO WARRANTY; for details + type `show w'. This is free software, and you are welcome + to redistribute it under certain conditions; type `show c' + for details. + +The hypothetical commands \`show w' and \`show c' should show the +appropriate parts of the General Public License. Of course, the +commands you use may be called something other than \`show w' and +\`show c'; they could even be mouse-clicks or menu items--whatever +suits your program. + +You should also get your employer (if you work as a programmer) or +your school, if any, to sign a "copyright disclaimer" for the program, +if necessary. Here is a sample; alter the names: + + Yoyodyne, Inc., hereby disclaims all copyright + interest in the program `Gnomovision' + (which makes passes at compilers) written + by James Hacker. + + signature of Ty Coon, 1 April 1989 + Ty Coon, President of Vice + +This General Public License does not permit incorporating your program +into proprietary programs. If your program is a subroutine library, +you may consider it more useful to permit linking proprietary +applications with the library. If this is what you want to do, use the +[GNU Lesser General Public +License](https://www.gnu.org/licenses/lgpl.html) instead of this +License. + diff --git a/recipes/gametes/build.sh b/recipes/gametes/build.sh new file mode 100644 index 0000000000000..89d67ad13e340 --- /dev/null +++ b/recipes/gametes/build.sh @@ -0,0 +1,24 @@ +#create target directory +PACKAGE_HOME=$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM +mkdir -p $PACKAGE_HOME + +#create bin +BINARY_HOME=$PREFIX/bin +mkdir -p $BINARY_HOME + +cd $SRC_DIR + +JAR_NAME=GAMETES_2.1.jar + +cp $JAR_NAME $PACKAGE_HOME/gametes.jar + +#mv wrapper script to package home +cp $RECIPE_DIR/gametes.py $PACKAGE_HOME + +#and symlink to $PREFIX/bin +#ln -s $PACKAGE_HOME/gametes.py ${BINARY_HOME} +ln -s $PACKAGE_HOME/gametes.py $BINARY_HOME/gametes + +#chmod +x ${BINARY_HOME} +chmod +x ${BINARY_HOME}/gametes + diff --git a/recipes/gametes/gametes.py b/recipes/gametes/gametes.py new file mode 100644 index 0000000000000..99dc779a47f50 --- /dev/null +++ b/recipes/gametes/gametes.py @@ -0,0 +1,88 @@ +#!/usr/bin/env python + +import os +import subprocess +import sys +from os import access, getenv, path, X_OK + + +# jar file +JAR_NAME = 'gametes.jar' +PKG_NAME = 'gametes' +PKG_VERSION = '2.1' +PKG_BUILDNUM = '0' + + +default_jvm_mem_opts = ['-Xms512m', '-Xmx1g'] + + + +def real_dirname(in_path): + """Return the path to the JAR file""" + #realPath = os.path.dirname(os.path.realpath(in_path)) + realPath = os.path.dirname(os.path.dirname(os.path.realpath(in_path))) + newPath = os.path.realpath(os.path.join(realPath, "..", "share", "{}-{}-{}".format(PKG_NAME, PKG_VERSION, PKG_BUILDNUM))) + return newPath + + + +def java_executable(): + """Returns the name of the Java executable.""" + java_home = getenv('JAVA_HOME') + java_bin = path.join('bin', 'java') + if java_home and access(os.path.join(java_home, java_bin), X_OK): + return os.path.join(java_home, java_bin) + else: + return "java" # Default to using 'java' command directly + + + +def jvm_opts(argv): + """Construct list of Java arguments based on our argument list. + + The argument list passed in argv must not include the script name. + The return value is a 3-tuple lists of strings of the form: + (memory_options, prop_options, passthrough_options) + """ + + + mem_opts, prop_opts, pass_args = [], [], [] + + for arg in argv: + if arg.startswith('-D') or arg.startswith('-XX'): + opts_list = prop_opts + elif arg.startswith('-Xm'): + opts_list = mem_opts + else: + opts_list = pass_args + opts_list.append(arg) + + if mem_opts == [] and getenv('_JAVA_OPTIONS') is None: + mem_opts = default_jvm_mem_opts + + return (mem_opts, prop_opts, pass_args) + +def main(): + java = java_executable() + jar_dir = real_dirname(sys.argv[0]) + (mem_opts, prop_opts, pass_args) = jvm_opts(sys.argv[1:]) + + if pass_args != [] and pass_args[0].startswith('org'): + jar_arg = '-cp' + else: + jar_arg = '-jar' + + jar_path = os.path.join(jar_dir, JAR_NAME) + + if not os.path.isfile(jar_path): + sys.stderr.write('GAMETES jar file not found\n') + sys.exit(1) + + java_args = [java] + mem_opts + prop_opts + [jar_arg] + [jar_path] + pass_args + sys.exit(subprocess.call(java_args)) + + +if __name__ == '__main__': + main() + + diff --git a/recipes/gametes/meta.yaml b/recipes/gametes/meta.yaml new file mode 100644 index 0000000000000..6f6daf12580f6 --- /dev/null +++ b/recipes/gametes/meta.yaml @@ -0,0 +1,38 @@ +{% set name = "gametes" %} +{% set version = "2.1" %} + +package: + name: {{ name }} + version: {{ version }} + +about: + home: https://sourceforge.net/projects/gametes/ + license: GPL-2.0-only + summary: Tool for the generation of complex single SNP models + license_file: LICENSE + + +build: + noarch: generic + number: 0 + run_exports: + - {{ pin_subpackage("gametes", max_pin="x") }} + +source: + url: https://sourceforge.net/projects/gametes/files/GAMETES_2.1.jar + sha256: 5e38b0993f8915e3e3e4c225ce6b684455d02c6189877d6ae219d24ad69e27d7 + +requirements: + run: + - openjdk >=17 + - python + host: + - openjdk >=17 + - python + +test: + commands: + - $(echo $(gametes -h | grep Usage)) + + + diff --git a/recipes/ganon/meta.yaml b/recipes/ganon/meta.yaml index 3f42b377f4284..8138ce24f94e8 100755 --- a/recipes/ganon/meta.yaml +++ b/recipes/ganon/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ganon" %} -{% set version = "2.0.1" %} +{% set version = "2.1.0" %} package: name: "{{ name|lower }}" @@ -8,7 +8,7 @@ package: source: - folder: ganon url: https://github.com/pirovc/{{ name }}/archive/{{ version }}.tar.gz - sha256: e8050f9522e35fe41abd5425ebe35a292081ff179a6a42cd285002ba0ef89f5f + sha256: bba93f9c45c922d6d309fcb81dfeddac6ef5439852ff1c48a1e6fed299e29f8b - folder: robin-hood-hashing url: https://github.com/martinus/robin-hood-hashing/archive/refs/tags/3.11.3.tar.gz sha256: dcf2b7fa9ef9dd0c67102d94c28e8df3effbe1845e0ed1f31f4772ca5e857fc4 @@ -30,7 +30,7 @@ requirements: - catch2 ==2.* - cxxopts >=2.2.0 - python - - pandas >=1.1.0 + - pandas >=1.2.0 - multitax >=1.3.1 - genome_updater >=0.6.3 - grep @@ -38,10 +38,12 @@ requirements: - curl - diffutils - zlib + - parameterized >=0.9.0 + - raptor ==3.* run: - bzip2 - python - - pandas >=1.1.0 + - pandas >=1.2.0 - multitax >=1.3.1 - genome_updater >=0.6.3 - grep @@ -49,7 +51,7 @@ requirements: - curl - diffutils - zlib - - raptor ==3.0.1 + - raptor ==3.* test: commands: diff --git a/recipes/gappa/build.sh b/recipes/gappa/build.sh index 27a186617836b..2456a7bb675f9 100644 --- a/recipes/gappa/build.sh +++ b/recipes/gappa/build.sh @@ -4,7 +4,7 @@ if [ "$(uname)" == Darwin ] ; then CXXFLAGS="$CXXFLAGS -fopenmp" fi -make +make -j ${CPU_COUNT} mkdir -p $PREFIX/bin diff --git a/recipes/gappa/meta.yaml b/recipes/gappa/meta.yaml index f0fd77ade36d8..e2fc50494968b 100644 --- a/recipes/gappa/meta.yaml +++ b/recipes/gappa/meta.yaml @@ -3,7 +3,9 @@ package: version: "0.8.4" build: - number: 0 + number: 1 + run_exports: + - {{ pin_subpackage('gappa', max_pin='x.x') }} source: url: https://github.com/lczech/gappa/archive/refs/tags/v0.8.4.tar.gz @@ -31,5 +33,7 @@ about: summary: Genesis Applications for Phylogenetic Placement Analysis extra: + additional-platforms: + - linux-aarch64 identifiers: - doi:10.1093/bioinformatics/bty767 diff --git a/recipes/gatk/meta.yaml b/recipes/gatk/meta.yaml index 77decd93b1470..cc2a442f6d1b3 100644 --- a/recipes/gatk/meta.yaml +++ b/recipes/gatk/meta.yaml @@ -11,7 +11,9 @@ package: build: noarch: generic - number: 11 + number: 12 + run_exports: + - {{ pin_subpackage("gatk", max_pin="x") }} source: url: https://storage.googleapis.com/gatk-software/package-archive/gatk/GenomeAnalysisTK-3.8-1-0-gf15c1c3ef.tar.bz2 diff --git a/recipes/gatk4/meta.yaml b/recipes/gatk4/meta.yaml index 5e77a8f9a2ef8..f588a9884779c 100644 --- a/recipes/gatk4/meta.yaml +++ b/recipes/gatk4/meta.yaml @@ -1,6 +1,6 @@ {% set name = "GATK4" %} -{% set version = "4.4.0.0" %} -{% set sha256 = "444600f7b38b46ad0b3606b7d40ce921e0ff1910a50165872f1c73c7c4a1a390" %} +{% set version = "4.5.0.0" %} +{% set sha256 = "dc1a4471e8bb566397db9894ca18acbf8f40f3fc312c8fad9a8c5390c218e916" %} package: name: {{ name|lower }} @@ -13,24 +13,26 @@ source: build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage('gatk4', max_pin="x") }} requirements: host: - - r-base + - r-base =3.6 - r-gplots - r-ggplot2 - r-gsalib - r-reshape - - gcnvkernel + - gcnvkernel =0.8 run: - openjdk >=17,<18 - python - - r-base + - r-base =3.6 - r-gplots - r-ggplot2 - r-gsalib - r-reshape - - gcnvkernel + - gcnvkernel =0.8 test: commands: diff --git a/recipes/gb-io/build.sh b/recipes/gb-io/build.sh new file mode 100644 index 0000000000000..a8f3305257de7 --- /dev/null +++ b/recipes/gb-io/build.sh @@ -0,0 +1,12 @@ +#!/bin/bash -e + +set -ex + +# Use a custom temporary directory as home on macOS. +# (not sure why this is useful, but people use it in bioconda recipes) +if [ `uname` == Darwin ]; then + export HOME=`mktemp -d` +fi + +# build statically linked binary with Rust +$PYTHON -m pip install . --no-deps --no-build-isolation -vvv diff --git a/recipes/gb-io/meta.yaml b/recipes/gb-io/meta.yaml new file mode 100644 index 0000000000000..e346cc5b35e5a --- /dev/null +++ b/recipes/gb-io/meta.yaml @@ -0,0 +1,37 @@ +{% set name = "gb-io" %} +{% set version = "0.3.2" %} + +package: + name: "{{ name }}" + version: "{{ version }}" + +build: + number: 0 + run_exports: + - {{ pin_subpackage('gb-io', max_pin="x.x") }} + +source: + url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" + sha256: 5bf0a5b2755e5e4aa928184043a44c28e2658158965901abb003ede8c794ad6e + +requirements: + build: + - {{ compiler('rust') }} + - {{ compiler('c') }} + - {{ compiler('cxx') }} + host: + - pip + - python + - setuptools-rust + run: + - python + +test: + imports: + - gb_io + +about: + home: https://github.com/althonos/gb-io.py + license: MIT + license_file: COPYING + summary: A Python interface to gb-io, a fast GenBank parser and serializer written in Rust. diff --git a/recipes/gcnvkernel/meta.yaml b/recipes/gcnvkernel/meta.yaml index da4ef22df24e6..f8c6448ea98bb 100644 --- a/recipes/gcnvkernel/meta.yaml +++ b/recipes/gcnvkernel/meta.yaml @@ -1,7 +1,7 @@ {% set name = "gcnvkernel" %} {% set version = "0.8" %} -{% set gatk_version = "4.3.0.0" %} -{% set gatk_sha256 = "e2c27229b34c3e22445964adf00639a0909887bbfcc040f6910079177bc6e2dd" %} +{% set gatk_version = "4.5.0.0" %} +{% set gatk_sha256 = "dc1a4471e8bb566397db9894ca18acbf8f40f3fc312c8fad9a8c5390c218e916" %} package: name: {{ name|lower }} @@ -13,7 +13,9 @@ source: build: noarch: python - number: 0 + number: 1 + run_exports: + - {{ pin_subpackage('gcnvkernel', max_pin="x") }} requirements: build: @@ -24,17 +26,17 @@ requirements: # # https://github.com/broadinstitute/gatk/blob/master/scripts/gatkcondaenv.yml.template - conda-forge::python =3.6.10 - - pip =20.0.2 + - pip =21.3.1 - conda-forge::mkl =2019.5 - conda-forge::mkl-service =2.3.0 - conda-forge::numpy =1.17.5 - conda-forge::theano =1.0.4 - - defaults::tensorflow =1.15.0 + - tensorflow <2 - conda-forge::scipy =1.0.0 - conda-forge::pymc3 =3.1 - conda-forge::h5py =2.10.0 - conda-forge::keras =2.2.4 - - defaults::intel-openmp =2019.4 + - conda-forge::intel-openmp - conda-forge::scikit-learn =0.23.1 - conda-forge::matplotlib =3.2.1 - conda-forge::pandas =1.0.3 diff --git a/recipes/gecco/meta.yaml b/recipes/gecco/meta.yaml index 6dec56a044f8e..34a6b65a20e38 100644 --- a/recipes/gecco/meta.yaml +++ b/recipes/gecco/meta.yaml @@ -1,6 +1,6 @@ {% set name = "GECCO" %} {% set name_pypi = "gecco-tool" %} -{% set version = "0.9.8" %} +{% set version = "0.9.10" %} package: name: "{{ name|lower }}" @@ -8,12 +8,14 @@ package: source: url: https://pypi.org/packages/source/g/{{ name_pypi }}/{{ name_pypi }}-{{ version }}.tar.gz - sha256: 4d67a654e84258c574ec1e3506ea1411c2ffa2d8b1abac41c198bb276edd4626 + sha256: 6ab405587824228a2a2baa08ccb9e6df1f6df214fe6c1a531b778a613fb1e90d build: number: 0 noarch: python script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vvv " + run_exports: + - {{ pin_subpackage("gecco", max_pin="x.x") }} requirements: host: @@ -34,8 +36,8 @@ requirements: - numpy >=1.16 - polars >=0.16.1 - psutil >=5.8 - - pyhmmer >=0.8.0 - - pyrodigal >=2.1.0 + - pyhmmer >=0.10.0 + - pyrodigal >=3.0 - rich >=12.4.0 - scikit-learn >=1.0 - scipy >=1.4 diff --git a/recipes/gemf_favites/build.sh b/recipes/gemf_favites/build.sh new file mode 100644 index 0000000000000..f3ceea26ca6f1 --- /dev/null +++ b/recipes/gemf_favites/build.sh @@ -0,0 +1,5 @@ +#!/bin/bash + +mkdir -p ${PREFIX}/bin +make CC=${CC} +cp GEMF GEMF_FAVITES.py ${PREFIX}/bin diff --git a/recipes/gemf_favites/meta.yaml b/recipes/gemf_favites/meta.yaml new file mode 100644 index 0000000000000..12f628887e00f --- /dev/null +++ b/recipes/gemf_favites/meta.yaml @@ -0,0 +1,39 @@ +{% set version = "1.0.3" %} + +package: + name: gemf_favites + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage('gemf_favites', max_pin="x.x.x") }} + +source: + url: https://github.com/niemasd/GEMF/archive/refs/tags/{{ version }}.tar.gz + sha256: 6a342852ff196501022d8814eb86a76fcb1d4ef1c2405ef24e8f4c79e2e1edf5 + +requirements: + build: + - {{ compiler('c') }} + - make + run: + - python >=3.7 + +about: + home: https://github.com/niemasd/GEMF + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE + summary: User-friendly epidemic simulations + dev_url: https://github.com/niemasd/GEMF + +test: + commands: + - GEMF_FAVITES.py -h | grep "usage:" + +extra: + identifiers: + - biotools:gemf_favites + recipe-maintainers: + - niemasd diff --git a/recipes/gemini/meta.yaml b/recipes/gemini/meta.yaml index 58e594f5761c1..4208619313276 100644 --- a/recipes/gemini/meta.yaml +++ b/recipes/gemini/meta.yaml @@ -6,9 +6,10 @@ package: version: {{ version }} build: - number: 5 - skip: True # [not py27] + number: 6 script: {{ PYTHON }} -m pip install . --ignore-installed --no-deps -vv + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} source: url: https://github.com/arq5x/gemini/archive/v{{ version }}.tar.gz @@ -19,12 +20,11 @@ requirements: - {{ compiler('c') }} host: - pip - - python + - python >=3.8 - setuptools - bcolz - bottle - bx-python - - cyordereddict - cython - cyvcf2 >0.6.5 - geneimpacts @@ -38,18 +38,17 @@ requirements: - openpyxl - pandas - pybedtools - - pysam + - pysam >=0.22 - pyyaml - scipy - unidecode - snappy - python-snappy run: - - python + - python >=3.8 - bcolz - bottle - bx-python - - cyordereddict - cyvcf2 >0.6.5 - geneimpacts - inheritance @@ -63,7 +62,7 @@ requirements: - openpyxl - pandas - pybedtools - - pysam + - pysam >=0.22 - pyyaml - scipy - unidecode @@ -84,6 +83,8 @@ about: summary: a lightweight db framework for disease and population genetics. extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:GEMINI - doi:10.1371/journal.pcbi.1003153 diff --git a/recipes/genbank/meta.yaml b/recipes/genbank/meta.yaml new file mode 100644 index 0000000000000..d5a0c8f267aad --- /dev/null +++ b/recipes/genbank/meta.yaml @@ -0,0 +1,37 @@ +{% set name = "genbank" %} +{% set version = "0.110" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/genbank-{{ version }}.tar.gz + sha256: f9a6ba243d62934e9e5ed283d8b475ab3dd9a3760ba329a054d5f6df54a8ec45 + +build: + number: 0 + skip: True # [py < 36] + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + run_exports: + - {{ pin_subpackage('genbank', max_pin="x.x") }} + +requirements: + build: + - {{ compiler('c') }} + host: + - python + - pip + run: + - python + +test: + imports: + - genbank + +about: + home: https://github.com/deprekate/genbank + summary: Code to work with Genbank files + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE diff --git a/recipes/generax/meta.yaml b/recipes/generax/meta.yaml index 6463eb3db5c99..0c662c20d3c3d 100644 --- a/recipes/generax/meta.yaml +++ b/recipes/generax/meta.yaml @@ -1,6 +1,7 @@ {% set name = "generax" %} -{% set version = "2.0.4" %} - +{% set version = "2.1.3" %} + + package: name: {{ name|lower }} version: {{ version }} @@ -9,12 +10,11 @@ source: git_url: https://github.com/benoitmorel/{{ name|lower }}.git git_rev: {{ version }} sha256: unused - patches: - - patch build: - number: 3 - + number: 0 + run_exports: + - {{ pin_subpackage('generax', max_pin="x") }} requirements: build: - make diff --git a/recipes/generax/patch b/recipes/generax/patch deleted file mode 100644 index 20728f85402ef..0000000000000 --- a/recipes/generax/patch +++ /dev/null @@ -1,12 +0,0 @@ -diff --git a/src/core/IO/Model.hpp b/src/core/IO/Model.hpp -index 0eb6ce1..3a16942 100644 ---- a/src/core/IO/Model.hpp -+++ b/src/core/IO/Model.hpp -@@ -6,6 +6,7 @@ - - #include - #include -+#include - extern "C" { - #include - #include diff --git a/recipes/genmod/meta.yaml b/recipes/genmod/meta.yaml index 1cd3b5465f5b2..4b226e225aa97 100644 --- a/recipes/genmod/meta.yaml +++ b/recipes/genmod/meta.yaml @@ -1,5 +1,5 @@ {% set name = "genmod" %} -{% set version = "3.8.1" %} +{% set version = "3.8.2" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: d21f072f6c4a34479bc0f1633bd7a15b04a04c87f63f28457dce58615a0a7f14 + sha256: 72921cce29fd8d6b99eea76921a0a71d3846abcb92bcb02dafd24886ab9264a3 build: number: 0 @@ -16,22 +16,15 @@ build: - {{ pin_subpackage('genmod', max_pin="x") }} entry_points: - genmod = genmod.commands.base:cli - script: "{{ PYTHON }} -m pip install . --no-deps -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" requirements: host: - - click <7 - - configobj - - extract_vcf >=0.4.2 - - interval_tree >=0.3.2 - - intervaltree - - ped_parser >=1.6.2 - pip - - pytabix - - pytest - - python + - python 3.8.* + - pypandoc <1.8 run: - - click <7 + - click >=8.1.3 - configobj - extract_vcf >=0.4.2 - interval_tree >=0.3.2 @@ -39,7 +32,8 @@ requirements: - ped_parser >=1.6.2 - pytabix - pytest - - python + - python 3.8.* + - vcftoolbox >=1.5.1 test: imports: @@ -61,7 +55,7 @@ about: home: "http://github.com/moonso/genmod" license: MIT license_family: MIT - license_file: + license_file: LICENSE.txt summary: "Annotate genetic inheritance models in variant files" extra: diff --git a/recipes/genoboo/build.sh b/recipes/genoboo/build.sh index 76a76236e8b16..d42cfaa60bf28 100644 --- a/recipes/genoboo/build.sh +++ b/recipes/genoboo/build.sh @@ -11,17 +11,20 @@ export ARCH=$(uname -m) export HOME="$(mktemp -d)" # Install meteor here (instead of in npm run bundle) because we need to patch the install script -curl "https://install.meteor.com/?release=2.8.0" > meteor.sh +curl "https://install.meteor.com/?release=2.13.3" > meteor.sh chmod a+x meteor.sh sed -i.bak 's|PREFIX=|#PREFIX=|' meteor.sh ./meteor.sh +sed -i.bak 's/"preinstall".*/"preinstall":"",/g' package.json + npm install --unsafe-perm export PATH=$PATH:"$HOME/.meteor" # Now run the normal gnb install -METEOR_ALLOW_SUPERUSER=1 METEOR_DISABLE_OPTIMISTIC_CACHING=1 npm run bundle + +TOOL_NODE_FLAGS="--max-old-space-size=2048" METEOR_ALLOW_SUPERUSER=1 METEOR_DISABLE_OPTIMISTIC_CACHING=1 npm run bundle cp -R genoboo_v${PKG_VERSION}/* $outdir diff --git a/recipes/genoboo/meta.yaml b/recipes/genoboo/meta.yaml index 1ea6112da89ba..b7eabb53df9ac 100644 --- a/recipes/genoboo/meta.yaml +++ b/recipes/genoboo/meta.yaml @@ -1,6 +1,6 @@ {% set name = 'genoboo' %} -{% set version = '0.4.12' %} -{% set sha256 = 'd8c280a174360c03ad4be4292e628ccf416a170771a369aa4bf32a5cebf1085e' %} +{% set version = '0.4.15' %} +{% set sha256 = 'af315b785b5bf849b1ab859fb56a0fc91dd8dadae130636e8ecc5c99be33c792' %} package: name: {{ name|lower }} diff --git a/recipes/genoflu/meta.yaml b/recipes/genoflu/meta.yaml index c7e66039d4536..4086881aa0d61 100644 --- a/recipes/genoflu/meta.yaml +++ b/recipes/genoflu/meta.yaml @@ -1,8 +1,8 @@ {% set user = "USDA-VS" %} {% set name = "GenoFLU" %} -{% set version = "1.02" %} -{% set sha256 = "8cae43be805ee1822d6acc3d1d51a7c4445c5252b5004ab700b7f807fc78070d" %} +{% set version = "1.03" %} +{% set sha256 = "fe814ff8e256b57e32a3398d4c16d449eb6222cbb02869bd876534484c5b070e" %} package: name: {{ name|lower }} diff --git a/recipes/genomad/meta.yaml b/recipes/genomad/meta.yaml index e52a7e786a2c5..8da527e7cdb54 100644 --- a/recipes/genomad/meta.yaml +++ b/recipes/genomad/meta.yaml @@ -1,5 +1,5 @@ {% set name = "genomad" %} -{% set version = "1.7.4" %} +{% set version = "1.8.0" %} package: name: "{{ name|lower }}" @@ -7,16 +7,16 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 3f7395ef18652c8f4ef1809d7bc97d7c3a7ae59fc86012cbf1ed35b7986ecad2 + sha256: 631599f9fea8ea8d07bdc9334e0fc328aed1274968da78f6f5854c0146022233 build: number: 0 noarch: python - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation --no-cache-dir -vvv" entry_points: - genomad=genomad.cli:cli run_exports: - - {{ pin_subpackage("genomad", max_pin="x.x") }} + - {{ pin_subpackage("genomad", max_pin="x") }} requirements: host: @@ -48,3 +48,8 @@ about: license_file: LICENSE summary: "Identification of mobile genetic elements" dev_url: https://github.com/apcamargo/genomad/ + doc_url: https://portal.nersc.gov/genomad/ + +extra: + identifiers: + - biotools:genomad diff --git a/recipes/geofetch/meta.yaml b/recipes/geofetch/meta.yaml index b98bdafa490ec..bddae8d83699a 100644 --- a/recipes/geofetch/meta.yaml +++ b/recipes/geofetch/meta.yaml @@ -1,5 +1,5 @@ {% set name = "geofetch" %} -{% set version = "0.12.5" %} +{% set version = "0.12.6" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 350cad0e7117ae76087b229f1ea0191bebb3bff53d90484aa8cea117c16f812f + sha256: 7ce07c05bad3f18b6f44b79579342604c2b56890e1dec293373b462bf06690b6 build: number: 0 diff --git a/recipes/getorganelle/meta.yaml b/recipes/getorganelle/meta.yaml index 01453f6f21055..bc62d76f7e438 100644 --- a/recipes/getorganelle/meta.yaml +++ b/recipes/getorganelle/meta.yaml @@ -1,5 +1,5 @@ {% set name = "getorganelle" %} -{% set version = "1.7.7.0" %} +{% set version = "1.7.7.1" %} package: name: {{name}} @@ -7,20 +7,21 @@ package: source: url: https://github.com/Kinggerm/GetOrganelle/archive/{{version}}.tar.gz - sha256: dd351b5cd33688adfcd8bff9794ae0cc0ce01a572dac2bcf6c9d7db77b3e4883 + sha256: cf8e14766de43967182be839de20c9d1709b60fae38a0b3d175742dfad7a5d44 build: number: 0 - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv " + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" noarch: python + run_exports: + - {{ pin_subpackage('getorganelle', max_pin="x") }} requirements: host: - - python + - python >=3.7 - pip - run: - - python + - python >=3.7 - perl - pigz - spades >=3.9 @@ -33,16 +34,25 @@ requirements: - requests test: - imports: - - GetOrganelleLib - + #imports: + #- GetOrganelleLib commands: - get_organelle_from_reads.py -h - get_organelle_from_assembly.py -h - slim_graph.py -h about: - home: http://github.com/Kinggerm/GetOrganelle - license: GPL3 + home: https://github.com/Kinggerm/GetOrganelle + license: "GPL-3.0-or-later" + license_family: GPL3 license_file: LICENSE summary: Get organelle genomes from genome skimming data + dev_url: https://github.com/Kinggerm/GetOrganelle + doc_url: https://github.com/Kinggerm/GetOrganelle/wiki + +extra: + identifiers: + - doi:10.1186/s13059-020-02154-5 + - biotools:getorganelle + - usegalaxy-eu:get_organelle_from_reads + - usegalaxy-eu:get_annotated_regions_from_gb diff --git a/recipes/gffpandas/meta.yaml b/recipes/gffpandas/meta.yaml new file mode 100644 index 0000000000000..0d3f2ead2c06e --- /dev/null +++ b/recipes/gffpandas/meta.yaml @@ -0,0 +1,37 @@ +{% set name = "gffpandas" %} +{% set version = "1.2.2" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/foerstner-lab/gffpandas/archive/v{{ version }}.tar.gz + sha256: bf58757e8d0eb4c2aa800864d2ab6e8ee3d499862473417435b57a05d9bf00b2 + +build: + number: 0 + noarch: python + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + run_exports: + - {{ pin_subpackage('gffpandas', max_pin="x") }} + +requirements: + host: + - python >=3 + - pip + run: + - python >=3 + - pandas + +test: + imports: + - gffpandas + +about: + home: https://github.com/foerstner-lab/gffpandas + summary: "Parse GFF3 into Pandas dataframes" + license: MIT + license_family: MIT + license_file: LICENSE + doc_url: https://gffpandas.readthedocs.io/en/latest/ diff --git a/recipes/gffread/meta.yaml b/recipes/gffread/meta.yaml index cf0bd29fad6db..5ae18c806919d 100644 --- a/recipes/gffread/meta.yaml +++ b/recipes/gffread/meta.yaml @@ -12,7 +12,9 @@ source: - Makefile.patch build: - number: 3 + number: 4 + run_exports: + - {{ pin_subpackage("gffread", max_pin="x.x") }} requirements: build: @@ -34,6 +36,8 @@ about: dev_url: "https://github.com/gpertea/gffread" extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:gffread skip-lints: diff --git a/recipes/gfftk/meta.yaml b/recipes/gfftk/meta.yaml index 0e92ea547b684..60caeb4b3da4a 100644 --- a/recipes/gfftk/meta.yaml +++ b/recipes/gfftk/meta.yaml @@ -1,5 +1,5 @@ {% set name = "gfftk" %} -{% set version = "23.12.5" %} +{% set version = "24.2.4" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/gfftk-{{ version }}.tar.gz - sha256: 447280eee990625ea84eab899400ff1be7c38ef818172dc7f4f2a0bebb6cb5e4 + sha256: 053a95204cfcb24b47e0dc23e5983b57cdc0023a37763a4c80a83d7d92598056 build: number: 0 diff --git a/recipes/gffutils/meta.yaml b/recipes/gffutils/meta.yaml index f1f35d06d9903..f57c8e24baa63 100644 --- a/recipes/gffutils/meta.yaml +++ b/recipes/gffutils/meta.yaml @@ -1,6 +1,6 @@ {% set name = "gffutils" %} -{% set version = "0.12" %} -{% set sha256 = "b31e261db5bd8737cb712c361c129eb2c373ef62f03b62770320589f10da1983" %} +{% set version = "0.13" %} +{% set sha256 = "b0d52f35c014cc0330fb5c4e3c6fea127c90ccf4c5384a825cdb5c8ff330d4eb" %} package: name: "{{ name|lower }}" @@ -14,6 +14,8 @@ build: noarch: python number: 0 script: "{{ PYTHON }} -m pip install . --ignore-installed --no-deps -vv" + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} requirements: host: @@ -25,7 +27,6 @@ requirements: - pyfaidx >=0.5.5.2 - python - simplejson - - six >=1.12.0 test: imports: diff --git a/recipes/gget/meta.yaml b/recipes/gget/meta.yaml index 0c155d5a9aec3..f47038aae5141 100644 --- a/recipes/gget/meta.yaml +++ b/recipes/gget/meta.yaml @@ -1,6 +1,6 @@ {% set name = "gget" %} -{% set version = "0.28.2" %} -{% set sha256 = "2bc24c484e26fdd25646f66089e08edf101c344e9ddb9aaeb1484fac3e1d2a99" %} +{% set version = "0.28.4" %} +{% set sha256 = "bab45530f72b189b233a72be20421176fbc4ca7ed407e36eec758086c2cda7c6" %} package: name: "{{ name|lower }}" diff --git a/recipes/giatools/meta.yaml b/recipes/giatools/meta.yaml new file mode 100644 index 0000000000000..f63d780aa5808 --- /dev/null +++ b/recipes/giatools/meta.yaml @@ -0,0 +1,43 @@ +{% set name = "giatools" %} +{% set version = "0.1.1" %} + +package: + name: "{{ name }}" + version: "{{ version }}" + +source: + url: "https://github.com/BMCV/giatools/archive/refs/tags/{{ version }}.zip" + sha256: 7b4aeb897382d493dd55f5440a3d2a81e70a096ddf88155faebfb38f0ec774f7 + +build: + number: 0 + noarch: python + script: "{{ PYTHON }} -m pip install --no-deps --ignore-installed . -vv " + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} + +requirements: + host: + - python >=3.8,<3.12 + - pip + - setuptools + - numpy >=1.18 + - scikit-image >=0.18 + run: + - python >=3.8,<3.12 + - numpy >=1.18 + - scikit-image >=0.18 + +test: + commands: + - python -c "import giatools; print(giatools.VERSION)" + +about: + home: "https://github.com/BMCV/giatools" + license: MIT + summary: "Tools required for Galaxy Image Analysis" + dev_url: "https://github.com/BMCV/giatools" + +extra: + recipe-maintainers: + - kostrykin diff --git a/recipes/gimbleprep/meta.yaml b/recipes/gimbleprep/meta.yaml index dc28547728e74..1b3c4a90144e5 100644 --- a/recipes/gimbleprep/meta.yaml +++ b/recipes/gimbleprep/meta.yaml @@ -1,5 +1,5 @@ {% set name = "gimbleprep" %} -{% set version = "0.0.2b5" %} +{% set version = "0.0.2b6" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/LohseLab/gimbleprep/archive/refs/tags/v{{ version }}.tar.gz - sha256: 6b9f893ba61fbd27577f87b561b7e2dad609589edfa62e63b6d2517b468bd953 + sha256: 5988eeb374d408f17b23cd3185e25e588c099e257357806979bea8e11e3ed272 build: noarch: python diff --git a/recipes/glimmerhmm/meta.yaml b/recipes/glimmerhmm/meta.yaml index 627e2e08693c2..a23cc5efbff1d 100644 --- a/recipes/glimmerhmm/meta.yaml +++ b/recipes/glimmerhmm/meta.yaml @@ -7,7 +7,9 @@ source: url: https://ccb.jhu.edu/software/glimmerhmm/dl/GlimmerHMM-3.0.4.tar.gz build: - number: 6 + number: 7 + run_exports: + - {{ pin_subpackage('glimmerhmm', max_pin="x") }} requirements: build: @@ -28,3 +30,7 @@ about: home: https://ccb.jhu.edu/software/glimmerhmm/ license: Artistic License summary: "GlimmerHMM is a gene finder based on a Generalized Hidden Markov Model (GHMM)" + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/gmap/build.sh b/recipes/gmap/build.sh index ed5ed8319b2d8..759a24c161362 100644 --- a/recipes/gmap/build.sh +++ b/recipes/gmap/build.sh @@ -1,29 +1,39 @@ -#!/bin/bash +#!/bin/bash -euo -export INCLUDE_PATH=${PREFIX}/include -export LIBRARY_PATH=${PREFIX}/lib +export INCLUDE_PATH="${PREFIX}/include" +export LIBRARY_PATH="${PREFIX}/lib" export LDFLAGS="${LDFLAGS} -L${PREFIX}/lib" export CFLAGS="${CFLAGS} -O3" export CPPFLAGS="${CPPFLAGS} -I${PREFIX}/include" +export LC_ALL=en_US.UTF-8 + if [ "$(uname)" == "Darwin" ]; then # for Mac OSX export LDFLAGS="${LDFLAGS} -headerpad_max_install_names" export CFLAGS="${CFLAGS} -m64" + export LC_ALL=C fi -export LANGUAGE=en_US.UTF-8 -export LANG=en_US.UTF-8 -export LC_ALL=en_US.UTF-8 +case $(uname -m) in + x86_64) + SIMD_LEVEL="sse42" + ;; + aarch64) + SIMD_LEVEL="arm" + ;; + *) + SIMD_LEVEL="none" + ;; +esac -autoconf -autoheader +autoreconf -if ./configure CC="${CC}" CFLAGS="${CFLAGS}" \ CPPFLAGS="${CPPFLAGS}" \ LDFLAGS="${LDFLAGS}" \ --prefix="${PREFIX}" \ --with-gmapdb="${PREFIX}/share" \ - --with-simd-level=sse42 + --with-simd-level=${SIMD_LEVEL} make -j"${CPU_COUNT}" make install @@ -48,5 +58,7 @@ sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' ${PREFIX}/bin/md_coords sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' ${PREFIX}/bin/psl_genes sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' ${PREFIX}/bin/psl_introns sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' ${PREFIX}/bin/psl_splicesites +sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' ${PREFIX}/bin/snpindex sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' ${PREFIX}/bin/vcf_iit +rm -rf ${PREFIX}/bin/*.bak diff --git a/recipes/gmap/meta.yaml b/recipes/gmap/meta.yaml index 13f1ad8b29cb3..4c3580f4d8971 100644 --- a/recipes/gmap/meta.yaml +++ b/recipes/gmap/meta.yaml @@ -1,6 +1,6 @@ {% set name = "GMAP" %} -{% set version = "2023.10.10" %} -{% set sha256 = "f76cc3d0024c6c963ea1c13e46236b62a548d965ad8e295a181f138b82aca36e" %} +{% set version = "2024.03.15" %} +{% set sha256 = "b3004175a06e3111d93021f0cd4d826ffa40ac4d069a2fa5db19fdaaa09fab3d" %} package: name: {{ name|lower }} @@ -13,7 +13,7 @@ source: - single_quote_paths.patch build: - number: 1 + number: 2 run_exports: - {{ pin_subpackage('gmap', max_pin=None) }} @@ -22,8 +22,10 @@ requirements: - make - {{ compiler('c') }} - autoconf - - perl + - automake + - libtool host: + - perl - zlib - bzip2 run: @@ -43,6 +45,8 @@ about: summary: "Genomic mapping and alignment program for mRNA and EST sequences." extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:gmap - biotools:gsnap diff --git a/recipes/gmm-demux/meta.yaml b/recipes/gmm-demux/meta.yaml new file mode 100644 index 0000000000000..7836d387489f5 --- /dev/null +++ b/recipes/gmm-demux/meta.yaml @@ -0,0 +1,50 @@ +{% set name = "GMM-Demux" %} +{% set version = "0.2.2.3" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/GMM_Demux-{{ version }}.tar.gz + sha256: 989092feea7a61e309f6a75ce77246f619c2eff997f1f7a1a7457dfaf5a10ecf + +build: + entry_points: + - GMM-demux = GMM_Demux.GMM_Demux:main + noarch: python + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage('gmm-demux', max_pin="x.x") }} + +requirements: + host: + - python + - pip + run: + - python + - pandas >=1.4.3 + - numpy >=1.22.4 + - scipy >=1.12.0 + - tabulate + - bitvector + - scikit-learn + +test: + imports: + - GMM_Demux + commands: + - GMM-demux --help + +about: + home: https://github.com/CHPGenetics/GMM-demux + summary: GMM-Demux is a Gaussian-Mixture-Model-based software for processing sample barcoding data (cell hashing and MULTI-seq). + license: MIT + license_family: MIT + license_file: LICENSE + dev_url: https://github.com/CHPGenetics/GMM-demux + +extra: + identifiers: + - doi:10.1186/s13059-020-02084-2 diff --git a/recipes/gmsc-mapper/meta.yaml b/recipes/gmsc-mapper/meta.yaml new file mode 100644 index 0000000000000..52d5894f99a1a --- /dev/null +++ b/recipes/gmsc-mapper/meta.yaml @@ -0,0 +1,58 @@ +{% set name = "GMSC-mapper" %} +{% set version = "0.1.0" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: "https://github.com/BigDataBiology/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz" + sha256: 30cc09425028969ce9847a7c55d93919921fef7d91a138bfff2b9a1e31bc2921 + +build: + noarch: python + number: 0 + run_exports: + - {{ pin_compatible(name, max_pin="x.x") }} + entry_points: + - gmsc-mapper=gmsc_mapper.main:main + script: {{ PYTHON }} -m pip install --no-deps . -vv + +requirements: + host: + - pip + - python >=3.7 + run: + - atomicwrites + - biopython + - Bottleneck + - certifi + - numexpr + - numpy + - packaging + - pandas + - pyparsing + - pyrodigal + - python-dateutil + - pytz + - six + - python >=3.7 + - mmseqs2 + - diamond >=2.0.13 + +test: + imports: + - gmsc_mapper + commands: + - gmsc-mapper --help + +about: + home: "https://github.com/BigDataBiology/GMSC-mapper" + license: MIT + license_family: MIT + summary: "GMSC-mapper is a command line tool to query the Global Microbial smORFs Catalog (GMSC)." + +extra: + recipe-maintainers: + - luispedro + - cocodyq diff --git a/recipes/gnparser/meta.yaml b/recipes/gnparser/meta.yaml index 6c8f65f4ec4df..be751375ed4df 100644 --- a/recipes/gnparser/meta.yaml +++ b/recipes/gnparser/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.9.0" %} -{% set sha256 = "c326fe0398fafde9048f67962064cce741996a533e48180b27c5548e4b7289ab" %} +{% set version = "1.9.1" %} +{% set sha256 = "90090b57eb7b1c3f21cdb9abc37151d87e3f03268ddb82c0fd948c2403352501" %} package: name: "gnparser" diff --git a/recipes/gofasta/meta.yaml b/recipes/gofasta/meta.yaml index 243c4d0ec9f15..64a8626a53d44 100644 --- a/recipes/gofasta/meta.yaml +++ b/recipes/gofasta/meta.yaml @@ -13,7 +13,9 @@ requirements: - {{ compiler('go-nocgo') }} build: - number: 0 + number: 1 + run_exports: + - {{ pin_subpackage('gofasta', max_pin="x") }} script: - mkdir -p $PREFIX/bin - go build -o $PREFIX/bin/gofasta @@ -27,3 +29,7 @@ about: license: MIT license_file: LICENSE summary: Genomic epidemiology utilities for short genome alignments + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/goldrush/meta.yaml b/recipes/goldrush/meta.yaml index c4f4260040bd1..14d75ccce8eec 100644 --- a/recipes/goldrush/meta.yaml +++ b/recipes/goldrush/meta.yaml @@ -1,5 +1,5 @@ {% set name = "goldrush" %} -{% set version = "1.1.0" %} +{% set version = "1.1.1" %} package: name: {{ name|lower }} @@ -7,11 +7,11 @@ package: source: url: https://github.com/bcgsc/goldrush/releases/download/{{ version }}/{{ name|lower }}-{{ version }}.tar.xz - sha256: b1687aab7e9b44074fe1e2aa1f49d4e851677622c7869f24c011ba73bb3cbdcf + sha256: f9847c3bed5bb16494789661d4e12137537b1987c6bb19a0932ae0dd90b6e3ed build: skip: true # [py < 38 or win or py > 39] - number: 1 + number: 0 run_exports: {{ pin_subpackage("goldrush", max_pin="x") }} requirements: diff --git a/recipes/goleft/build.sh b/recipes/goleft/build.sh index 49d4ada78fb2a..5b317e41721de 100644 --- a/recipes/goleft/build.sh +++ b/recipes/goleft/build.sh @@ -1,4 +1,4 @@ #!/bin/bash -chmod a+x golef* +chmod a+x goleft* mkdir -p $PREFIX/bin cp goleft* $PREFIX/bin/goleft diff --git a/recipes/goleft/meta.yaml b/recipes/goleft/meta.yaml index 48a4be6f328e7..0b170fe53ab2d 100644 --- a/recipes/goleft/meta.yaml +++ b/recipes/goleft/meta.yaml @@ -1,18 +1,22 @@ -{% set version = "0.2.4" %} +{% set version = "0.2.6" %} package: name: goleft version: '{{ version }}' source: - - url: https://github.com/brentp/goleft/releases/download/v{{ version }}/goleft_linux64 # [linux] - sha256: 5f8df703f7a369213961b4fc583aa625012548fb213dd906eaaeaaed89a319ab # [linux] + - url: https://github.com/brentp/goleft/releases/download/v{{ version }}/goleft_linux64 # [linux and x86_64] + sha256: 3fbb8076c1b2da4a1d7bcb5edd0cc879fe608066c0ca58221db155e7edd5bcb3 # [linux and x86_64] + - url: https://github.com/brentp/goleft/releases/download/v{{ version }}/goleft_linux_aarch64 # [linux and aarch64] + sha256: bf3179de66297b916e720f72a4afd57fef937b098d869926d5ac967f9634b8b8 # [linux and aarch64] - url: https://github.com/brentp/goleft/releases/download/v{{ version }}/goleft_osx # [osx] - sha256: eab89fe80063095f9d01d02bac6770ea9ef102abab900ce01477ebb6fd9bdebc # [osx] + sha256: 1aebf606658b1007669d96a76de9a1a3106b5caa4c4d5b786a75339d35d0e54e # [osx] build: - number: 1 + number: 0 binary_relocation: false + run_exports: + - {{ pin_subpackage('goleft', max_pin='x.x') }} requirements: run: @@ -29,6 +33,8 @@ about: summary: goleft is a collection of bioinformatics tools distributed under MIT license in a single static binary extra: + additional-platforms: + - linux-aarch64 skip-lints: - should_be_noarch_generic - should_not_be_noarch_source diff --git a/recipes/gottcha2/meta.yaml b/recipes/gottcha2/meta.yaml new file mode 100644 index 0000000000000..50a0db70f10d7 --- /dev/null +++ b/recipes/gottcha2/meta.yaml @@ -0,0 +1,51 @@ +{% set name = "GOTTCHA2" %} +{% set version = "2.1.8.6" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +build: + noarch: python + number: 0 + script: {{ PYTHON }} -m pip install -vvv --no-deps --no-build-isolation . + entry_points: + - gottcha2 = cmd:gottcha2_command + run_exports: + - {{ pin_subpackage('gottcha2', max_pin='x') }} + +source: + url: https://github.com/poeli/GOTTCHA2/archive/refs/tags/{{ version }}.tar.gz + sha256: 18ae74fa448e837ade605676334c5c37cda07473a6cf0105937d8afe1b017359 + +requirements: + host: + - python >=3.6 + - pip + run: + - python >=3.6 + - minimap2 >=2.17 + - gawk + - biom-format >=2.1.7 + - numpy + - pandas + - requests + - tqdm + +test: + commands: + - minimap2 -h + - gawk -h + - gottcha2.py --version + +about: + home: https://github.com/poeli/GOTTCHA2 + license: BSD-3-Clause + license_family: BSD + license_file: LICENSE + summary: 'Genomic Origin Through Taxonomic CHAllenge (GOTTCHA) v2' + dev_url: https://github.com/poeli/GOTTCHA2 + +extra: + identifiers: + - biotools:gottcha2 diff --git a/recipes/gottcha2/post-link.sh b/recipes/gottcha2/post-link.sh new file mode 100644 index 0000000000000..11273771bc6f1 --- /dev/null +++ b/recipes/gottcha2/post-link.sh @@ -0,0 +1,5 @@ +echo " +GOTTCHA2 installed. The database can be download at: + +https://ref-db.edgebioinformatics.org/gottcha2/ +" > $PREFIX/.messages.txt \ No newline at end of file diff --git a/recipes/grabix/meta.yaml b/recipes/grabix/meta.yaml index 83e16c66f818a..c08d290d74b4e 100644 --- a/recipes/grabix/meta.yaml +++ b/recipes/grabix/meta.yaml @@ -4,11 +4,14 @@ package: version: "0.1.8" build: - number: 9 + number: 10 + run_exports: + - {{ pin_subpackage('grabix', max_pin="x.x") }} source: url: https://github.com/arq5x/grabix/archive/{{ revision }}.tar.gz md5: eb8805bed149ef56669ef19abba19b80 + requirements: build: - {{ compiler('cxx') }} @@ -16,10 +19,16 @@ requirements: - zlib run: - zlib + test: commands: - grabix + about: home: https://github.com/arq5x/grabix summary: a wee tool for random access into BGZF files. license: MIT + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/graphaligner/meta.yaml b/recipes/graphaligner/meta.yaml index ff837db9ff3f9..38b34e29495ea 100644 --- a/recipes/graphaligner/meta.yaml +++ b/recipes/graphaligner/meta.yaml @@ -1,13 +1,13 @@ {% set name = "GraphAligner" %} -{% set version = "1.0.18" %} +{% set version = "1.0.19" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://github.com/maickrau/{{ name }}/files/13412859/{{ name }}.tar.gz - sha256: 69d248332c1df732b74571f9910d3390bfeb48165fb9d99a892ec0a71ab1291f + url: https://github.com/maickrau/{{ name }}/files/14037134/{{ name }}.tar.gz + sha256: b65d26d415c3fd459bf2fc884b3d48dc0c55f7e9135e700c5c38d62be8ee39fc patches: - version.patch - linux_link.patch # [linux] diff --git a/recipes/graphembed/build.sh b/recipes/graphembed/build.sh new file mode 100644 index 0000000000000..f4634f476014f --- /dev/null +++ b/recipes/graphembed/build.sh @@ -0,0 +1,8 @@ +#!/bin/bash -euo + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="$(pwd)/.cargo" + +# build statically linked binary with Rust +RUST_BACKTRACE=1 cargo install --features intel-mkl-static --verbose --path . --root $PREFIX diff --git a/recipes/graphembed/meta.yaml b/recipes/graphembed/meta.yaml new file mode 100644 index 0000000000000..08b5d38bbf652 --- /dev/null +++ b/recipes/graphembed/meta.yaml @@ -0,0 +1,35 @@ +{% set version = "0.1.1" %} + +package: + name: graphembed + version: {{ version }} + +build: + number: 1 + run_exports: + - {{ pin_subpackage('graphembed', max_pin="x.x") }} + skip: True # [osx] +source: + url: https://github.com/jianshu93/graphembed/archive/v{{ version }}.tar.gz + sha256: 894ffd1e2042ef93501317059c018bef817225dcb994a932ceb7593a134e7d8e + +requirements: + build: + - {{ compiler("cxx") }} + - {{ compiler('c') }} + - rust >=1.39 + - make + - cmake + +test: + commands: + - graphembed -h + +about: + home: https://github.com/jean-pierreBoth/graphembed + license: MIT + summary: Efficient Graph Embedding via Recursive Sketching or High-order Transitivity Preserving with Benchmarking +extra: + maintainers: + - Jean Pierre-Both + - Jianshu Zhao diff --git a/recipes/gridss/0001-fix-samtools-version-check.patch b/recipes/gridss/0001-fix-samtools-version-check.patch new file mode 100644 index 0000000000000..7111cf0e23670 --- /dev/null +++ b/recipes/gridss/0001-fix-samtools-version-check.patch @@ -0,0 +1,11 @@ +--- a/gridss_extract_overlapping_fragments ++++ b/gridss_extract_overlapping_fragments +@@ -206,7 +206,7 @@ for tool in gridsstools samtools ; do + fi + write_status "Found $(which $tool)" + done +-samtools_version=$(samtools --version | grep samtools | cut -b 10-) ++samtools_version=$(samtools --version | head -n1 | grep samtools | cut -b 10-) + write_status "samtools version: $samtools_version" + samtools_major_version=$(echo $samtools_version | cut -f 1 -d ".") + samtools_minor_version=$(echo $samtools_version | cut -f 2 -d ".") diff --git a/recipes/gridss/0002-set-gridssargs-for-virusbreakend-annotation.patch b/recipes/gridss/0002-set-gridssargs-for-virusbreakend-annotation.patch new file mode 100644 index 0000000000000..0cab94a467907 --- /dev/null +++ b/recipes/gridss/0002-set-gridssargs-for-virusbreakend-annotation.patch @@ -0,0 +1,10 @@ +--- a/virusbreakend ++++ b/virusbreakend +@@ -777,6 +777,7 @@ if [[ ! -f $file_host_annotated_vcf ]] ; then + -t $threads \ + -r $reference \ + -j $gridss_jar \ ++ $gridssargs \ + -s setupreference \ + 1>&2 2>> $logfile + $timecmd java -Xmx4g $jvm_args \ diff --git a/recipes/gridss/meta.yaml b/recipes/gridss/meta.yaml index 68671af6301ce..478a47b6b0629 100644 --- a/recipes/gridss/meta.yaml +++ b/recipes/gridss/meta.yaml @@ -8,9 +8,14 @@ package: source: url: https://github.com/PapenfussLab/gridss/releases/download/v{{ version }}/gridss-{{ version }}.tar.gz sha256: '{{ sha256 }}' + patches: + - 0001-fix-samtools-version-check.patch + - 0002-set-gridssargs-for-virusbreakend-annotation.patch build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage('gridss', max_pin="x.x.x") }} skip: True # [osx] requirements: diff --git a/recipes/groot/build.sh b/recipes/groot/build.sh index e318969a521b2..1bd6e5d9aaee4 100644 --- a/recipes/groot/build.sh +++ b/recipes/groot/build.sh @@ -1,7 +1,12 @@ -#!/bin/bash +#!/usr/bin/env bash + +set -xe + mkdir -p $PREFIX/bin go get -d -v ./... +go get github.com/dgryski/go-metro +go get github.com/dgryski/go-spooky go test -v ./... go build -o groot diff --git a/recipes/groot/meta.yaml b/recipes/groot/meta.yaml index 20d9c2ec28ccd..b824757d8e733 100644 --- a/recipes/groot/meta.yaml +++ b/recipes/groot/meta.yaml @@ -9,7 +9,9 @@ source: sha256: 46c6f67990397c2230f580be40697e4fdc284fbe7f0a38999a05d81cd6da5928 build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage('groot', max_pin='x') }} requirements: build: @@ -27,5 +29,7 @@ about: summary: A tool for resistome profiling of metagenomic samples. extra: + additional-platforms: + - linux-aarch64 skip-lints: - should_be_noarch_generic diff --git a/recipes/gseapy/meta.yaml b/recipes/gseapy/meta.yaml index 2f28298f064f6..c2470c14e2619 100644 --- a/recipes/gseapy/meta.yaml +++ b/recipes/gseapy/meta.yaml @@ -1,10 +1,10 @@ package: name: gseapy - version: "1.1.1" + version: "1.1.2" source: - url: https://files.pythonhosted.org/packages/c9/1b/b8bba54953a7ba433b73d701343557103bd96dfd76652698544b75fe5439/gseapy-1.1.1.tar.gz - sha256: 5062fc8d625037beb3d41762cb0cd7cad25653bb3a0c71b8f188ba458da77d4a + url: https://files.pythonhosted.org/packages/bc/54/4e09f7d74d0d1778b081fff8853a3ca6d03a951032424691be6d2df6fbea/gseapy-1.1.2.tar.gz + sha256: fd861b9e75a5103bd4a6bd67925f8f4a3c5b48d51e0ae068f56fb01aa9201e9e build: entry_points: @@ -12,7 +12,7 @@ build: run_exports: - {{ pin_subpackage("gseapy", max_pin="x") }} skip: True # [py2k or py == 36 ] - number: 0 + number: 1 requirements: build: @@ -45,6 +45,8 @@ about: license_family: MIT extra: + additional-platforms: + - linux-aarch64 container: # matplotlib needs opengl support extended-base: true diff --git a/recipes/gsearch/meta.yaml b/recipes/gsearch/meta.yaml index 8e51a1a1372fd..3149d4081ee0d 100644 --- a/recipes/gsearch/meta.yaml +++ b/recipes/gsearch/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.1.7" %} +{% set version = "0.1.9" %} package: name: gsearch @@ -11,7 +11,7 @@ build: skip: True # [osx] source: url: https://github.com/jianshu93/gsearch/archive/v{{ version }}.tar.gz - sha256: ceec9638cbb2bb8f588375a3c3283ca717ba436e9d550624a1039c9d00a76e8a + sha256: 21d87192f55a0826744e474c5e22add204b7d2b634bdc692d29ab88175a34c36 requirements: build: @@ -23,7 +23,7 @@ requirements: test: commands: - - gsearchbin -h + - gsearch -h about: home: https://github.com/jean-pierreBoth/gsearch diff --git a/recipes/gtdbtk/download-db.sh b/recipes/gtdbtk/download-db.sh index c3c77b25d433c..236e3f44671c1 100755 --- a/recipes/gtdbtk/download-db.sh +++ b/recipes/gtdbtk/download-db.sh @@ -1,9 +1,9 @@ set -e # Configuration -N_FILES_IN_TAR=181718 -DB_URL="https://data.gtdb.ecogenomic.org/releases/release214/214.0/auxillary_files/gtdbtk_r214_data.tar.gz" -TARGET_TAR_NAME="gtdbtk_r214_data.tar.gz" +N_FILES_IN_TAR=241860 +DB_URL="https://data.gtdb.ecogenomic.org/releases/release220/220.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r220_data.tar.gz" +TARGET_TAR_NAME="gtdbtk_r220_data.tar.gz" # Script variables (no need to configure) TARGET_DIR=${1:-$GTDBTK_DATA_PATH} diff --git a/recipes/gtdbtk/meta.yaml b/recipes/gtdbtk/meta.yaml index 611e22a30947f..3023022470731 100644 --- a/recipes/gtdbtk/meta.yaml +++ b/recipes/gtdbtk/meta.yaml @@ -1,16 +1,18 @@ {% set name = "gtdbtk" %} -{% set version = "2.3.2" %} +{% set version = "2.4.0" %} package: name: {{ name|lower }} version: {{ version }} source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 80efd31e10007d835f56a3d6fdf039a59db3b6ba4be26b234692da5e688aa99f + sha256: e67bab2c8f3e47c7242c70236c78e85bb9dc4721636bbf5044b171f18f22b1f7 build: - number: 0 + number: 1 noarch: python entry_points: - gtdbtk = gtdbtk.__main__:main + run_exports: + - {{ pin_subpackage('gtdbtk', max_pin="x") }} requirements: host: - pip @@ -27,6 +29,7 @@ requirements: - mash >=2.0 - tqdm >=4.35.0 - pydantic >=1.9.2, <2 + - skani >=0.2.0 test: imports: - gtdbtk diff --git a/recipes/gtdbtk/post-link.sh b/recipes/gtdbtk/post-link.sh index 4ac76d7c003f8..ee340a4676c67 100644 --- a/recipes/gtdbtk/post-link.sh +++ b/recipes/gtdbtk/post-link.sh @@ -1,7 +1,7 @@ #!/usr/bin/env bash echo " - GTDB-Tk v${PKG_VERSION} requires ~78G of external data which needs to be downloaded + GTDB-Tk v${PKG_VERSION} requires ~110G of external data which needs to be downloaded and extracted. This can be done automatically, or manually. Automatic: @@ -12,11 +12,11 @@ echo " Manual: 1. Manually download the latest reference data: - wget https://data.gtdb.ecogenomic.org/releases/release214/214.0/auxillary_files/gtdbtk_r214_data.tar.gz + wget https://data.gtdb.ecogenomic.org/releases/release220/220.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r220_data.tar.gz 2. Extract the archive to a target directory: - tar -xvzf gtdbtk_r214_data.tar.gz -C \"/path/to/target/db\" --strip 1 > /dev/null - rm gtdbtk_r214_data.tar.gz + tar -xvzf gtdbtk_r220_data.tar.gz -C \"/path/to/target/db\" --strip 1 > /dev/null + rm gtdbtk_r220_data.tar.gz 3. Set the GTDBTK_DATA_PATH environment variable by running: conda env config vars set GTDBTK_DATA_PATH=\"/path/to/target/db\" diff --git a/recipes/gtfparse/meta.yaml b/recipes/gtfparse/meta.yaml index e67367f8fe766..41e4bd86031e9 100644 --- a/recipes/gtfparse/meta.yaml +++ b/recipes/gtfparse/meta.yaml @@ -1,6 +1,6 @@ {% set name = "gtfparse" %} -{% set version = "2.4.1" %} -{% set sha256 = "dbb6dd88bc5535b1d6ca8fab3154f3408c9b67d7215bbc1762d8f855919cc8a5" %} +{% set version = "2.5.0" %} +{% set sha256 = "9fea54811cd87f597a110a49dc1b1b6a3325ffb7d1f36ecc62c32d14d3eb9493" %} package: name: {{ name|lower }} diff --git a/recipes/gtfsort/build.sh b/recipes/gtfsort/build.sh new file mode 100644 index 0000000000000..8e10cdc3e3237 --- /dev/null +++ b/recipes/gtfsort/build.sh @@ -0,0 +1,9 @@ +#!/bin/bash + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" + +# build statically linked binary with Rust +RUST_BACKTRACE=1 +cargo install --verbose --path . --root ${PREFIX} diff --git a/recipes/gtfsort/meta.yaml b/recipes/gtfsort/meta.yaml new file mode 100644 index 0000000000000..b04cc6fac6f30 --- /dev/null +++ b/recipes/gtfsort/meta.yaml @@ -0,0 +1,39 @@ +{% set name = "gtfsort" %} +{% set version = "0.2.2" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/alejandrogzi/{{ name }}/archive/refs/tags/v.{{ version }}.tar.gz + sha256: d22a8ef32e30111ad2dd08d1da0e0914ac62a728483b8e39a4ef8ea4e6133b4f + +build: + number: 0 + run_exports: + - {{ pin_subpackage('gtfsort', max_pin="x.x") }} + +requirements: + build: + - {{ compiler("cxx") }} + - rust >=1.39 + - pkg-config + +test: + commands: + - gtfsort --help + - gtfsort --version + +about: + home: https://github.com/alejandrogzi/gtfsort + license: MIT + license_family: MIT + license_file: LICENSE + summary: "A chr/pos/feature GTF sorter that uses a lexicographically-based index ordering algorithm." + +extra: + recipe-maintainers: + - alejandrogzi + identifiers: + - doi:10.1101/2023.10.21.563454 diff --git a/recipes/gubbins/build.sh b/recipes/gubbins/build.sh index e0713f9972a8e..109fbbc99f4dd 100644 --- a/recipes/gubbins/build.sh +++ b/recipes/gubbins/build.sh @@ -3,6 +3,14 @@ export CFLAGS="-I$PREFIX/include" export LDFLAGS="-L$PREFIX/lib" export CPATH=${PREFIX}/include +if [[ $target_platform == osx-* ]]; then + for toolname in "otool" "install_name_tool"; do + tool=$(find "${BUILD_PREFIX}/bin/" -name "*apple*-$toolname") + mv "${tool}" "${tool}.bak" + ln -s "/Library/Developer/CommandLineTools/usr/bin/${toolname}" "$tool" + done +fi + autoreconf -i ./configure --prefix=$PREFIX make diff --git a/recipes/gubbins/meta.yaml b/recipes/gubbins/meta.yaml index 8305801f9caa9..2166a683609f3 100644 --- a/recipes/gubbins/meta.yaml +++ b/recipes/gubbins/meta.yaml @@ -1,6 +1,6 @@ {% set name = "gubbins" %} -{% set version = "3.3.1" %} -{% set sha256 = "1794ba37780f1444131f84fa34fb144e709ec1af239c46f7f18636d8b1b73edf" %} +{% set version = "3.3.5" %} +{% set sha256 = "4ee363f82708bdda0c00d1c6c334cf20127bd852ee488619f61140771a279774" %} package: name: {{ name|lower }} @@ -13,7 +13,7 @@ build: - {{ pin_subpackage('gubbins', max_pin="x") }} source: - url: https://github.com/nickjcroucher/{{ name|lower }}/archive/v{{ version }}.tar.gz + url: https://github.com/nickjcroucher/gubbins/archive/refs/tags/v{{ version }}.tar.gz sha256: {{ sha256 }} requirements: @@ -28,28 +28,27 @@ requirements: host: - perl - zlib - - python - - scipy >=1.5.3 + - python >=3.8,<3.10 + - scipy - setuptools - - dendropy >=4.0.2 - - biopython >=1.59 + - dendropy + - biopython - numpy <=1.23.0 - - numba >=0.53 + - numba run: - - python - - scipy >=1.5.3 - - reportlab >=3.0 - - dendropy >=4.0.2 - - biopython >=1.59 - - multiprocess >=0.70 + - python >=3.8,<3.10 + - scipy + - dendropy + - biopython + - multiprocess - setuptools - raxml =8.2.12 - iqtree >=2.2 - rapidnj - raxml-ng =1.0.1 - fasttree =2.1.10 - - numpy >=1.2 - - numba >=0.56 + - numpy <=1.23.0 + - numba - ska2 >=0.3.0 - r-argparser - r-magrittr diff --git a/recipes/gum/meta.yaml b/recipes/gum/meta.yaml index b8292930c1f83..80d205fd59d79 100644 --- a/recipes/gum/meta.yaml +++ b/recipes/gum/meta.yaml @@ -1,5 +1,5 @@ {% set name = "gum" %} -{% set version = "2.0.1" %} +{% set version = "2.0.2" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: - url: https://github.com/cartoonist/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz - sha256: 70f314ec89d8dc767eaf7184c43fdb793948dbdf6bec63a88ba3e8a539e465aa + sha256: 3afd2bed67cdc053d5afacdb1b951a15dce36738874f92cc74a9fafbf7bb65c0 patches: - 00-fix-ext-cmake.patch - url: https://github.com/cartoonist/sdsl-lite/archive/af1820fa3c25d2eb64bbab37a1a94938af862ec8.tar.gz @@ -16,8 +16,8 @@ source: - url: https://github.com/greg7mdp/parallel-hashmap/archive/d2bed96d2947c13b8fc90337198c315b2200e058.tar.gz sha256: 387ce116c8568f2d2be43658024a233ed807f420cc9152b4723a780472b97c04 folder: ext/parallel-hashmap - - url: https://github.com/cartoonist/gfakluge/archive/e4cd7b02317d65b321385cac5415a3cab0a1d0cc.tar.gz - sha256: 1303152ea59cade4f21528c414da6fba073b86299c11f259ad8a3d50a450b5ab + - url: https://github.com/cartoonist/gfakluge/archive/9f635f2e49dc42443160d30368e07864ab221efd.tar.gz + sha256: 85504b0e9c0a0d68361d65984be9168f728eb0b3faad1ca42fc6e08156d57850 folder: ext/gfakluge - url: https://github.com/cartoonist/tinyFA/archive/bfe1eea6bc5dbd2c87b7b3d48d99e05dafce7073.tar.gz sha256: 92d00462cd770c421a2d30f99aef0de997c732714defead8e05da390e3528755 diff --git a/recipes/gw/meta.yaml b/recipes/gw/meta.yaml index 7bf6ab483b790..5594f0a8c7aa8 100644 --- a/recipes/gw/meta.yaml +++ b/recipes/gw/meta.yaml @@ -1,6 +1,6 @@ -{% set version = "0.9.1" %} -{% set sha256 = "10a65107717811179a124e8bac5b2f202bdbde6679a9e6eb67ef97c990b7cf9d" %} +{% set version = "0.9.3" %} +{% set sha256 = "43445ef6d96bd8a09a9a45cd18e21481d7fefe7e9ab26aec4abd8d1f4bff3fcd" %} package: name: gw @@ -13,7 +13,7 @@ source: build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('gw', max_pin="x") }} @@ -34,7 +34,7 @@ requirements: host: - fontconfig - libcurl - - libdeflate >=1.8 + - libdeflate >=1.0 - htslib >=1.12 - glfw >=3.3 - freetype diff --git a/recipes/gxf2bed/build.sh b/recipes/gxf2bed/build.sh new file mode 100644 index 0000000000000..8e10cdc3e3237 --- /dev/null +++ b/recipes/gxf2bed/build.sh @@ -0,0 +1,9 @@ +#!/bin/bash + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" + +# build statically linked binary with Rust +RUST_BACKTRACE=1 +cargo install --verbose --path . --root ${PREFIX} diff --git a/recipes/gxf2bed/meta.yaml b/recipes/gxf2bed/meta.yaml new file mode 100644 index 0000000000000..a0b0d0160416c --- /dev/null +++ b/recipes/gxf2bed/meta.yaml @@ -0,0 +1,37 @@ +{% set name = "gxf2bed" %} +{% set version = "0.2.2" %} + +package: + name: gxf2bed + version: {{ version }} + +source: + url: https://github.com/alejandrogzi/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: ee500e08e8c94b2663ea511482d6520300cb81c9cbbb05a288563e4a808f5377 + +build: + number: 0 + run_exports: + - {{ pin_subpackage('gxf2bed', max_pin="x.x") }} + +requirements: + build: + - {{ compiler("cxx") }} + - rust >=1.39 + - pkg-config + +test: + commands: + - gxf2bed --help + - gxf2bed --version + +about: + home: https://github.com/alejandrogzi/gxf2bed + license: MIT + license_family: MIT + license_file: LICENSE + summary: "Fastest GTF/GFF-to-BED converter chilling around" + +extra: + recipe-maintainers: + - alejandrogzi diff --git a/recipes/gxf2chrom/build.sh b/recipes/gxf2chrom/build.sh new file mode 100644 index 0000000000000..8e10cdc3e3237 --- /dev/null +++ b/recipes/gxf2chrom/build.sh @@ -0,0 +1,9 @@ +#!/bin/bash + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" + +# build statically linked binary with Rust +RUST_BACKTRACE=1 +cargo install --verbose --path . --root ${PREFIX} diff --git a/recipes/gxf2chrom/meta.yaml b/recipes/gxf2chrom/meta.yaml new file mode 100644 index 0000000000000..d3925fc4bf0dd --- /dev/null +++ b/recipes/gxf2chrom/meta.yaml @@ -0,0 +1,37 @@ +{% set name = "gxf2chrom" %} +{% set version = "0.1.0" %} + +package: + name: gxf2chrom + version: {{ version }} + +source: + url: https://github.com/alejandrogzi/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: 453df8aaff017f2ddb0c977de2e5f494feba8fa17d8f8fcddc908642ecb5fb08 + +build: + number: 0 + run_exports: + - {{ pin_subpackage('gxf2chrom', max_pin="x.x") }} + +requirements: + build: + - {{ compiler("cxx") }} + - rust >=1.39 + - pkg-config + +test: + commands: + - gxf2chrom --help + - gxf2chrom --version + +about: + home: https://github.com/alejandrogzi/gxf2chrom + license: MIT + license_family: MIT + license_file: LICENSE + summary: "Everything in .chrom from GTF/GFF" + +extra: + recipe-maintainers: + - alejandrogzi diff --git a/recipes/haddock_biobb/build.sh b/recipes/haddock_biobb/build.sh new file mode 100644 index 0000000000000..dc60e539c255e --- /dev/null +++ b/recipes/haddock_biobb/build.sh @@ -0,0 +1,24 @@ +#!/usr/bin/env bash + +# Compile FCC +cd src/ +git clone https://github.com/haddocking/fcc.git +cd fcc/src +chmod u+x Makefile +make \ + CPP="${CXX}" +cd $SRC_DIR + +# Compile fast-rmsdmatrix +cd src/ +git clone https://github.com/mgiulini/fast-rmsdmatrix.git +cd fast-rmsdmatrix/src +chmod u+x Makefile +make \ + CC="${CC}" +cd $SRC_DIR + +${PYTHON} setup.py install --single-version-externally-managed --record=record.txt + +mkdir -p $PREFIX/bin +mkdir -p $SRC_DIR/bin diff --git a/recipes/haddock_biobb/meta.yaml b/recipes/haddock_biobb/meta.yaml new file mode 100644 index 0000000000000..4ca7ad9ad9dac --- /dev/null +++ b/recipes/haddock_biobb/meta.yaml @@ -0,0 +1,62 @@ +{% set name = "haddock_biobb" %} +{% set version = "3.0.4" %} + +package: + name: '{{ name|lower }}' + version: '{{ version }}' + +source: + url: https://github.com/haddocking/haddock3/archive/refs/tags/v3.0.0-beta.5.tar.gz + sha256: e0651a4913fb659a57e897ac68c4f8e8f29b61e00abfcab3f3bbd623e1977f7b + +build: + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin='x') }} + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('cxx') }} + - make + - binutils + - pip + - python >=3.9 + - git + - setuptools + + host: + - python >=3.9 + - setuptools + - pip + - git + run: + - python >=3.9 + - pip + - git + - boost-cpp + - cxx-compiler + - c-compiler + - biopython + - jsonpickle + - numpy + - pyyaml + - scipy + - toml + - tox + - pandas + - plotly + - kaleido-core + - freesasa + - pdb-tools + +test: + commands: + - echo "DONE!" + +about: + home: https://github.com/haddocking/haddock3 + license: Apache Software License + license_family: APACHE + summary: HADDOCK3 is the next generation integrative modelling software in the long-lasting HADDOCK project. + description: "HADDOCK3 is the next generation integrative modelling software in the long-lasting HADDOCK project. It represents a complete rethinking and rewriting of the HADDOCK2.X series, implementing a new way to interact with HADDOCK and offering new features to users who can now define custom workflows." diff --git a/recipes/haddock_biobb/post-link.sh b/recipes/haddock_biobb/post-link.sh new file mode 100644 index 0000000000000..616a2388237eb --- /dev/null +++ b/recipes/haddock_biobb/post-link.sh @@ -0,0 +1,2 @@ +echo "Before using HADDOCK please install CNS. Instructions: https://github.com/haddocking/haddock3/blob/main/docs/CNS.md" > "${PREFIX}"/.messages.txt +echo "And create a softlink [ln -s] of the CNS executable to the ${PREFIX}lib/pythonX.XX/bin/ folder (Replace the X by your env python version)" >> "${PREFIX}"/.messages.txt diff --git a/recipes/hairsplitter/build.sh b/recipes/hairsplitter/build.sh new file mode 100644 index 0000000000000..978ddf0265bd8 --- /dev/null +++ b/recipes/hairsplitter/build.sh @@ -0,0 +1,29 @@ +mkdir -p $PREFIX/bin + +mkdir src/build +cd src/build/ +cmake .. +make + +cp ../../hairsplitter.py $PREFIX/bin +chmod +x $PREFIX/bin/hairsplitter.py +cp -r ./HS_call_variants $PREFIX/bin +cp -r ./HS_create_new_contigs $PREFIX/bin +cp -r ./HS_fa2gfa $PREFIX/bin +cp -r ./HS_gfa2fa $PREFIX/bin +cp -r ./HS_separate_reads $PREFIX/bin +cp -r ./HS_GenomeTailor/HS_GenomeTailor $PREFIX/bin +cp -r ../cut_gfa.py $PREFIX/bin +chmod +x $PREFIX/bin/cut_gfa.py + +cp -r ../GraphUnzip/graphunzip.py $PREFIX/bin +chmod +x $PREFIX/bin/graphunzip.py +cp -r ../GraphUnzip/segment.py $PREFIX/bin +cp -r ../GraphUnzip/finish_untangling.py $PREFIX/bin +cp -r ../GraphUnzip/simple_unzip.py $PREFIX/bin +cp -r ../GraphUnzip/repolish.py $PREFIX/bin +cp -r ../GraphUnzip/transform_gfa.py $PREFIX/bin +cp -r ../GraphUnzip/input_output.py $PREFIX/bin +cp -r ../GraphUnzip/determine_multiplicity.py $PREFIX/bin +chmod +x $PREFIX/bin/determine_multiplicity.py + diff --git a/recipes/hairsplitter/conda_build_config.yaml b/recipes/hairsplitter/conda_build_config.yaml new file mode 100644 index 0000000000000..f08c687e0ef69 --- /dev/null +++ b/recipes/hairsplitter/conda_build_config.yaml @@ -0,0 +1,7 @@ +c_compiler_version: + - 11.2.0 # [linux] + - 11.1.0 # [osx] + +cxx_compiler_version: + - 11.2.0 # [linux] + - 11.1.0 # [osx] diff --git a/recipes/hairsplitter/meta.yaml b/recipes/hairsplitter/meta.yaml new file mode 100644 index 0000000000000..1cec99b38b7c2 --- /dev/null +++ b/recipes/hairsplitter/meta.yaml @@ -0,0 +1,49 @@ +{% set name = "HairSplitter" %} +{% set version = "1.7.15" %} +{% set sha256 = "9c713999298c857cf21b964318d6119fc8f2fb6a212a8d907a20e4f0535d7706" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/RolandFaure/HairSplitter/archive/refs/tags/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number : 0 + run_exports: + - {{ pin_subpackage("hairsplitter", max_pin="x.x") }} + +requirements: + build: + - cmake + - make + - openmp + - {{ compiler('cxx') }} + run: + - python + - scipy + - numpy + - minimap2 + - minigraph >=0.20 + - racon + - samtools >=1.16 + - openmp + - raven-assembler + +test: + commands: + - hairsplitter.py --help + +extra: + recipe-maintainers: + - rolandfaure + +about: + home: https://github.com/RolandFaure/HairSplitter + license: GPL-3.0-or-later + license_file: LICENSE + summary: "Recovers collapsed haplotypes from a draft assembly and long reads" + maintainer : RolandFaure # Optional + diff --git a/recipes/handyreadgenotyper/meta.yaml b/recipes/handyreadgenotyper/meta.yaml new file mode 100644 index 0000000000000..9e4c4734d3ee8 --- /dev/null +++ b/recipes/handyreadgenotyper/meta.yaml @@ -0,0 +1,59 @@ +{% set name = "HandyReadGenotyper" %} +{% set version = "0.1.9" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/AntonS-bio/HandyReadGenotyper/archive/{{ version }}.tar.gz + sha256: fdb514deaf7b9c483bef48e1f1bf955d948697e78ef128aaf41e198c0fc38f6e + +build: + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + run_exports: + - {{ pin_subpackage('handyreadgenotyper', max_pin="x.x") }} + number: 0 + +requirements: + build: + - python <3.9.0a0,>=3.8 + - pandas >=2.0.0 + - scikit-learn >=1.3.* + - pysam >=0.22.0 + - numpy >=1.20.* + - tqdm >=4.66.* + - biopython >=1.78 + - tqdm >=4.66.* + host: + - pip + - python <3.9.0a0,>=3.8 + run: + - python <3.9.0a0,>=3.8 + - pandas >=2.0.0 + - scikit-learn >=1.3.* + - pysam >=0.22.0 + - numpy >=1.20.* + - tqdm >=4.66.* + - biopython >=1.78 + - tqdm >=4.66.* + +test: + commands: + - train -h + - classify -h + +about: + license: GPL-3.0 + license_file: LICENSE + home: https://github.com/AntonS-bio/HandyReadGenotyper + summary: 'Tool for training model and classifying reads from environmental ONT amplicon sequencing.' + description: | + Tool for training model and classifying reads from environmental ONT amplicon sequencing. + doc_source_url: https://github.com/AntonS-bio/HandyAmpliconTool/blob/main/README.md + + +extra: + recipe-maintainers: + - AntonS-bio diff --git a/recipes/handyreadgenotyper/setup.py b/recipes/handyreadgenotyper/setup.py new file mode 100644 index 0000000000000..25c9cabb5ea92 --- /dev/null +++ b/recipes/handyreadgenotyper/setup.py @@ -0,0 +1,54 @@ +#!/usr/bin/env python3 +from setuptools import setup +from setuptools.command.install import install +import os +import sys + +__version__ = '0.1.9' + +def readme(): + with open('README.md') as f: + return f.read() + +def check_dir_write_permission(directory): + if os.path.isdir(directory) and not os.access(directory, os.W_OK): + sys.exit('Error: no write permission for ' + directory + ' ' + + 'Perhaps you need to use sudo?') + +class HandyReadGenotyperInstall(install): + + def run(self): + check_dir_write_permission(self.install_lib) + install.run(self) + + + +setup(name='HandyReadGenotyper', + version=__version__, + description='HandyReadGenotyper', + long_description=readme(), + python_requires='>=3.8,<3.9.0a0', + classifiers=['Development Status :: Beta', + 'License :: OSI Approved :: GNU General Public License v3 (GPLv3)', + 'Programming Language :: Python :: 3', + 'Topic :: Scientific/Engineering :: Bio-Informatics', + 'Intended Audience :: Science/Research'], + keywords='PCR amplicon primers', + url='https://github.com/AntonS-bio/HandyReadGenotyper.git', + author='Anton Spadar', + author_email='', + packages=['scripts'], + include_package_data=True, + entry_points={'console_scripts': ['classify = classify:main', 'train = train:main']}, + scripts=[ + 'scripts/classify.py', + 'scripts/data_classes.py', + 'scripts/genotyper_data_classes.py', + 'scripts/input_processing.py', + 'scripts/inputs_validation.py', + 'scripts/model_manager.py', + 'scripts/read_classifier.py', + 'scripts/train.py' + ], + cmdclass={'install': HandyReadGenotyperInstall} +) diff --git a/recipes/hapcut2/meta.yaml b/recipes/hapcut2/meta.yaml index 471c87eb7587e..e27214ae0c444 100644 --- a/recipes/hapcut2/meta.yaml +++ b/recipes/hapcut2/meta.yaml @@ -1,5 +1,5 @@ {% set name = "HapCUT2" %} -{% set version = "1.3.3" %} +{% set version = "1.3.4" %} package: name: {{ name|lower }} @@ -7,10 +7,12 @@ package: source: - url: https://github.com/vibansal/{{ name }}/archive/v{{ version }}.tar.gz - sha256: 95b832e667638aff1de51721e54c906dfe8b46793b1ca8ecf1b6790d4f84aade + sha256: 33d0a047c4d9b7ef4287be979cc580183acbd09a3ab518b9f5ebc5f41c2bf34e build: - number: 5 + number: 0 + run_exports: + - {{ pin_subpackage('hapcut2', max_pin="x") }} requirements: build: @@ -37,4 +39,6 @@ about: summary: Tools for haplotype assembly from sequence data home: https://github.com/vibansal/HapCUT2/ license: BSD-2-Clause + license_family: BSD license_file: LICENSE + dev_url: https://github.com/vibansal/HapCUT2/ diff --git a/recipes/hapog/meta.yaml b/recipes/hapog/meta.yaml index 525046c08f7e6..295b5552dc1d6 100644 --- a/recipes/hapog/meta.yaml +++ b/recipes/hapog/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.3.7" %} +{% set version = "1.3.8" %} package: name: hapog @@ -12,7 +12,7 @@ build: source: url: https://github.com/institut-de-genomique/HAPO-G/archive/refs/tags/{{ version }}.tar.gz - sha256: "727ff2a712b046c7787ac2bb599a7e3808f70219d6b7e22ddfc5942ba38c5841" + sha256: "822f4c7e688ae2b3004ac444911b592beaa25db6800b766503c1d41f0290af4b" requirements: build: @@ -22,11 +22,10 @@ requirements: host: - python - htslib - - setuptools + - zlib run: - htslib - python - - setuptools - biopython - bwa - samtools @@ -45,6 +44,8 @@ about: license_family: OTHER license_file: LICENSE.md summary: Haplotype-Aware Polishing of Genomes + doc_url: https://www.genoscope.cns.fr/hapog/ + dev_url: https://github.com/institut-de-genomique/HAPO-G extra: identifiers: diff --git a/recipes/harpy/build.sh b/recipes/harpy/build.sh index 535a622944105..dacb8c084c852 100644 --- a/recipes/harpy/build.sh +++ b/recipes/harpy/build.sh @@ -1,19 +1,16 @@ -#!/bin/bash +#!/usr/bin/env bash mkdir -p ${PREFIX}/bin -# Harpy executable -#cp harpy ${PREFIX}/bin/ - -# build harpy -${PREFIX}/bin/python -m pip install . --ignore-installed --no-deps -vv +# install harpy proper +${PYTHON} -m pip install . --no-deps -vv # rules -cp rules/*.smk ${PREFIX}/bin/ +cp workflow/rules/*.smk ${PREFIX}/bin/ # associated scripts -chmod +x utilities/* -cp utilities/* ${PREFIX}/bin/ +chmod +x workflow/scripts/* +cp workflow/scripts/* ${PREFIX}/bin/ # reports -cp reports/*.Rmd ${PREFIX}/bin/ \ No newline at end of file +cp workflow/report/*.Rmd ${PREFIX}/bin/ diff --git a/recipes/harpy/meta.yaml b/recipes/harpy/meta.yaml index 616da31c08dfc..1075fe061f052 100644 --- a/recipes/harpy/meta.yaml +++ b/recipes/harpy/meta.yaml @@ -1,74 +1,59 @@ -{% set version = "0.4.0" %} -{% set sha256 = "6062ece4701b6de964d1f25fc6e9e0d6b6525f3b04f9ca22d8b90191c7767928" %} +{% set version = "0.9.1" %} +{% set sha256 = "3d05a4995f6c6c9059b5fba269ff6dee7f8befd1bdc7cb622c7f753dea49af79" %} package: name: harpy version: '{{ version }}' source: - url: https://github.com/pdimens/harpy/archive/{{ version }}.tar.gz + url: https://github.com/pdimens/harpy/releases/download/{{ version }}/harpy.{{ version }}.tar.gz sha256: '{{ sha256 }}' build: skip: True # [osx] number: 0 + missing_dso_whitelist: + - /lib64/libstdc++.so.6 + - /lib64/libc.so.6 run_exports: - {{ pin_subpackage('harpy', max_pin="x.x") }} requirements: host: - - python =3.9 + - python =3.12 + - pip run: - - bcftools - - bioconductor-complexheatmap - - bwa - - fastp - - fastqc - - hapcut2 - - icu - - libzlib - - leviathan - - llvm-openmp - - multiqc - - naibr-plus - - python =3.9 - - pysam - - r-base - - r-circlize - - r-dplyr - - r-dt - - r-ggplot2 - - r-ggridges - - r-knitr - - r-magrittr - - r-plotly - - r-rmarkdown - - r-stitch - - r-tidyr - - r-viridislite + - bcftools =1.19 + - pandas + - python >3.10 - rich-click - - snakemake >=7 - - sambamba + - snakemake-minimal >7 - samtools - seqtk - tabix - - xz test: commands: - "snakemake --version" - - "R --version" - "harpy --version" + about: home: "https://github.com/pdimens/harpy/" - license: MIT + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE summary: "Process raw haplotagging data, from raw sequences to phased haplotypes." + description: | + Harpy is a command-line tool to easily process haplotag or 10x linked-read data. It uses + Snakemake under the hood to execute different workflows (quality control, trimming, + alignment, variant calling, phasing, etc.), but the user is rarely, if ever, exposed + to Snakemake directly. With an emphasis on user-friendliness, parallelization, transparency, + and reproducibility, Harpy aims to quickly handle data processing so that you can focus more + on analyzing your data. doc_url: https://pdimens.github.io/harpy/ dev_url: https://github.com/pdimens/harpy extra: - container: - extended-base: True recipe-maintainers: - pdimens skip-lints: diff --git a/recipes/hecatomb/meta.yaml b/recipes/hecatomb/meta.yaml index 52fb463a7f9b2..3aa74512cf22e 100644 --- a/recipes/hecatomb/meta.yaml +++ b/recipes/hecatomb/meta.yaml @@ -1,5 +1,5 @@ {% set name = "Hecatomb" %} -{% set version = "1.2.0" %} +{% set version = "1.3.2" %} package: name: "{{ name|lower }}" @@ -7,11 +7,13 @@ package: source: url: "https://github.com/shandley/{{ name|lower }}/archive/refs/tags/v{{ version }}.tar.gz" - sha256: 20da6871131a01222d4374194188f766bfdd3ab164ab4dbdd4307db0b80341a7 + sha256: d1699d80bef234c6815333d468721a6c57c24697a26d6e26ab9e0a3167373ff8 build: number: 0 noarch: python + run_exports: + - {{ pin_subpackage('hecatomb', max_pin='x.x') }} script: "{{ PYTHON }} -m pip install . -vv " requirements: @@ -19,12 +21,13 @@ requirements: - python - pip run: - - python >=3.8,<3.11 - - snakemake >=7.14.0 + - python >=3.9,<=3.12 + - snakemake >=7.14.0,<8 + - pulp <2.8 - pyyaml >=6.0 - click >=8.1.3 - - jinja2 >=3.0.2 - - mamba >=0.15.3 + - metasnek >=0.0.7 + - snaketool-utils >=0.0.4 test: commands: diff --git a/recipes/helitronscanner/HelitronScanner.sh b/recipes/helitronscanner/HelitronScanner.sh new file mode 100644 index 0000000000000..1e028d8f50b7e --- /dev/null +++ b/recipes/helitronscanner/HelitronScanner.sh @@ -0,0 +1,64 @@ +#!/bin/bash +# HelitronScanner executable shell script, adapted from bazam shell script +jar_name="HelitronScanner.jar" + +set -eu -o pipefail + +set -o pipefail +export LC_ALL=en_US.UTF-8 + +# Find original directory of bash script, resolving symlinks +# http://stackoverflow.com/questions/59895/can-a-bash-script-tell-what-directory-its-stored-in/246128#246128 +SOURCE="${BASH_SOURCE[0]}" +while [ -h "$SOURCE" ]; do # resolve $SOURCE until the file is no longer a symlink + DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + SOURCE="$(readlink "$SOURCE")" + [[ $SOURCE != /* ]] && SOURCE="$DIR/$SOURCE" # if $SOURCE was a relative symlink, we need to resolve it relative to the path where the symlink file was located +done +DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + +JAR_DIR=$DIR + +java=java + +if [ -n "${JAVA_HOME:=}" ]; then + if [ -e "$JAVA_HOME/bin/java" ]; then + java="$JAVA_HOME/bin/java" + fi +fi + +# extract memory and system property Java arguments from the list of provided arguments +# http://java.dzone.com/articles/better-java-shell-script +default_jvm_mem_opts="-Xms512m -Xmx1g" +jvm_mem_opts="" +jvm_prop_opts="" +pass_args="" +for arg in "$@"; do + case $arg in + '-D'*) + jvm_prop_opts="$jvm_prop_opts $arg" + ;; + '-XX'*) + jvm_prop_opts="$jvm_prop_opts $arg" + ;; + '-Xm'*) + jvm_mem_opts="$jvm_mem_opts $arg" + ;; + *) + pass_args="$pass_args $arg" + ;; + esac +done + +if [ "$jvm_mem_opts" == "" ]; then + jvm_mem_opts="$default_jvm_mem_opts" +fi + +pass_arr=($pass_args) +if [[ ${pass_arr[0]:=} == org* ]] +then + eval "$java" $jvm_mem_opts $jvm_prop_opts -cp "$JAR_DIR/$jar_name" $pass_args +else + eval "$java" $jvm_mem_opts $jvm_prop_opts -jar "$JAR_DIR/$jar_name" $pass_args +fi +exit diff --git a/recipes/helitronscanner/build.sh b/recipes/helitronscanner/build.sh new file mode 100644 index 0000000000000..ba789741a2457 --- /dev/null +++ b/recipes/helitronscanner/build.sh @@ -0,0 +1,28 @@ +#!/bin/sh +set -x -e + +HELITRONSCANNER_DIR=${PREFIX}/share/HelitronScanner +HELITRONSCANNER_TRAININGSET_PATH=${HELITRONSCANNER_DIR}/TrainingSet + +mkdir -p ${PREFIX}/bin +mkdir -p ${HELITRONSCANNER_DIR} +mkdir -p ${HELITRONSCANNER_TRAININGSET_PATH} + +cp -r HelitronScanner/* ${HELITRONSCANNER_DIR} +cp -r TrainingSet/* ${HELITRONSCANNER_TRAININGSET_PATH} + +cp ${RECIPE_DIR}/HelitronScanner.sh ${HELITRONSCANNER_DIR}/HelitronScanner +chmod +x ${HELITRONSCANNER_DIR}/HelitronScanner +ln -s ${HELITRONSCANNER_DIR}/HelitronScanner ${PREFIX}/bin + +## Set HelitronScanner variables on env activation for training set access +mkdir -p ${PREFIX}/etc/conda/activate.d ${PREFIX}/etc/conda/deactivate.d +cat <> ${PREFIX}/etc/conda/activate.d/helitronscanner.sh +export HELITRONSCANNER_PATH=${HELITRONSCANNER_DIR} +export HELITRONSCANNER_TRAININGSET_PATH=${HELITRONSCANNER_TRAININGSET_PATH} +EOF + +cat <> ${PREFIX}/etc/conda/deactivate.d/helitronscanner.sh +unset HELITRONSCANNER_PATH +unset HELITRONSCANNER_TRAININGSET_PATH +EOF diff --git a/recipes/helitronscanner/meta.yaml b/recipes/helitronscanner/meta.yaml new file mode 100644 index 0000000000000..015f10c62f4d1 --- /dev/null +++ b/recipes/helitronscanner/meta.yaml @@ -0,0 +1,31 @@ +{% set name = "HelitronScanner" %} +{% set version = "1.0" %} +{% set sha256 = "936accf4a129bc36b38d10472a5b7295dd00f68cc275952e50fff9d9fa685815" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://sourceforge.net/projects/HelitronScanner/files/HelitronScanner_V{{ version }}.zip + sha256: {{ sha256 }} + +build: + number: 0 + noarch: generic + run_exports: + - {{ pin_subpackage('helitronscanner', max_pin='x') }} + +requirements: + run: + - openjdk + +test: + commands: + - HelitronScanner scanHead -Xmx2g --help | grep 'Scan for Helitron 5' + - cat "${HELITRONSCANNER_TRAININGSET_PATH}/head.lcvs" | grep 'TCCATAATA' + +about: + home: 'https://sourceforge.net/projects/helitronscanner' + license: GPL-3.0-or-later + summary: HelitronScanner uncovers a large overlooked cache of Helitron transposons in many genomes diff --git a/recipes/hhsuite/build.sh b/recipes/hhsuite/build.sh index 7dbbef3e25a4d..17e152530bc6a 100644 --- a/recipes/hhsuite/build.sh +++ b/recipes/hhsuite/build.sh @@ -1,8 +1,20 @@ #!/bin/bash + +ARCH_BUILD="" +case $(uname -m) in + x86_64) ARCH_BUILD="-DHAVE_SSE4_1=1" ;; + arm64|aarch64) ARCH_BUILD="-DHAVE_ARM8=1" ;; +esac + +if [ -z "${ARCH_BUILD}" ]; then + echo "Invalid architecture" + exit 1 +fi + mkdir -p build && cd build cmake -DCHECK_MPI=0 \ -DHAVE_MPI=0 \ - -DHAVE_SSE2=1 \ + ${ARCH_BUILD} \ -DCMAKE_INSTALL_PREFIX="${PREFIX}" \ .. diff --git a/recipes/hhsuite/meta.yaml b/recipes/hhsuite/meta.yaml index e1b23092e49fa..43639d506e046 100644 --- a/recipes/hhsuite/meta.yaml +++ b/recipes/hhsuite/meta.yaml @@ -6,7 +6,9 @@ package: version: {{ version }} build: - number: 9 + number: 10 + run_exports: + - {{ pin_subpackage('hhsuite', max_pin="x") }} source: url: https://github.com/soedinglab/hh-suite/archive/v{{ version }}.tar.gz @@ -47,3 +49,5 @@ extra: - biotools:hh-suite recipe-maintainers: - milot-mirdita + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/hicexplorer/meta.yaml b/recipes/hicexplorer/meta.yaml index 4ee9927c54e42..02e1d69a4de4a 100644 --- a/recipes/hicexplorer/meta.yaml +++ b/recipes/hicexplorer/meta.yaml @@ -1,19 +1,20 @@ -{% set version = "3.7.3" %} +{% set name = "hicexplorer" %} +{% set version = "3.7.4" %} package: - name: hicexplorer - version: '{{ version }}' + name: {{ name }} + version: {{ version }} source: url: https://github.com/deeptools/HiCExplorer/archive/{{ version }}.tar.gz - sha256: db80bb90772795e603136b781f7dc81659509977e1e86dea7b298490cab73444 + sha256: 4c19c0bbb74417a87096ec0c9238bb7e59874020c6c82fadf114efb96d3be0d8 build: number: 0 - script: "{{ PYTHON }} -m pip install . --no-deps -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation --no-cache-dir -vvv" noarch: python run_exports: - - {{ pin_subpackage('hicexplorer', max_pin="x.x") }} + - {{ pin_subpackage('hicexplorer', max_pin="x") }} requirements: host: @@ -36,7 +37,6 @@ requirements: - future - unidecode - hicmatrix >=17 - - cooler >=0.9.3 - pygenometracks >=3.8 - hic2cool >=0.8.3 - fit_nbinom >=1.2 @@ -46,7 +46,7 @@ requirements: - tqdm >=4.66 - hyperopt >=0.2.7 - python-graphviz >=0.20 - - scikit-learn >=1.3.1 + - scikit-learn >=1.3,<1.4 - imbalanced-learn >=0.11 - cleanlab >=2.5 @@ -95,12 +95,16 @@ test: - hicInterIntraTAD --version - hicTADClassifier --version - hicTrainTADClassifier --version - - + + about: - home: https://github.com/deeptools/HiCExplorer - license: GPL3 + home: "https://github.com/deeptools/HiCExplorer" + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE summary: Set of programs to process, analyze and visualize Hi-C and capture Hi-C data + dev_url: "https://github.com/deeptools/HiCExplorer" + doc_url: "https://hicexplorer.readthedocs.org/" extra: identifiers: @@ -108,3 +112,4 @@ extra: - doi:10.1093/nar/gkaa220 - doi:10.1093/gigascience/giac061 - usegalaxy-eu:hicexplorer_hicplotviewpoint + - biotools:hicexplorer diff --git a/recipes/hicmatrix/meta.yaml b/recipes/hicmatrix/meta.yaml index 6d8a5deba2f6a..827c3e2f7aeda 100644 --- a/recipes/hicmatrix/meta.yaml +++ b/recipes/hicmatrix/meta.yaml @@ -10,7 +10,7 @@ source: sha256: 8f431725f7aa548c9774c18e052dabfab10da72e0f0edf0f9dc512b66a4d9df4 build: - number: 0 + number: 1 noarch: python script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv run_exports: @@ -18,7 +18,7 @@ build: requirements: host: - - python >=3.7 + - python >=3.8 - numpy >=1.20 - scipy >=1.2.* - intervaltree >=3.0.* @@ -26,7 +26,7 @@ requirements: - pandas >=0.25.* - cooler >=0.8.10 run: - - python >=3.7 + - python >=3.8 - numpy >=1.20 - scipy >=1.2.* - intervaltree >=3.0.* diff --git a/recipes/hicstuff/meta.yaml b/recipes/hicstuff/meta.yaml index e0c50b567fcdf..fe9ff01dcad2e 100644 --- a/recipes/hicstuff/meta.yaml +++ b/recipes/hicstuff/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "3.2.1" %} +{% set version = "3.2.2" %} package: name: hicstuff @@ -6,7 +6,7 @@ package: source: url: https://pypi.io/packages/source/h/hicstuff/hicstuff-{{ version }}.tar.gz - sha256: cfea38c69d2594168d734f8e292a84b1f4d2135a31dd877fb175fad0aac4bdf4 + sha256: 8d1dc203fa5352e9b0014ec29d03dc796f2dbc0d51fef1a9b0df4c3aedb4065d build: number: 0 diff --git a/recipes/hictk/build.sh b/recipes/hictk/build.sh index 81e494d834d06..237a19ba2e1ad 100755 --- a/recipes/hictk/build.sh +++ b/recipes/hictk/build.sh @@ -2,7 +2,7 @@ export CONAN_NON_INTERACTIVE=1 -export CMAKE_BUILD_PARALLEL_LEVEL=${CPU_COUNT} +export CMAKE_BUILD_PARALLEL_LEVEL=1 # ${CPU_COUNT} export CTEST_PARALLEL_LEVEL=${CPU_COUNT} if [[ ${DEBUG_C} == yes ]]; then diff --git a/recipes/hictk/conanfile.txt.patch b/recipes/hictk/conanfile.txt.patch index 05ea419f8ae85..294d8196b80d7 100644 --- a/recipes/hictk/conanfile.txt.patch +++ b/recipes/hictk/conanfile.txt.patch @@ -1,70 +1,30 @@ diff --git a/conanfile.txt b/conanfile.txt -index 0ea6184..eb94f2c 100644 +index c76a83a..434833d 100644 --- a/conanfile.txt +++ b/conanfile.txt -@@ -3,72 +3,11 @@ - # SPDX-License-Identifier: MIT +@@ -4,33 +4,12 @@ [requires] --boost/1.83.0#7825569cd0622461dec7bc87dfdf47ae - bshoshany-thread-pool/3.5.0#5aaea7ccf37107d3c1ba9ca9ab246e42 --cli11/2.3.2#1424b9b1d9e3682a7122f415b078b4d7 + bshoshany-thread-pool/4.1.0#be1802a8768416a6c9b1393cf0ce5e9c +-catch2/3.5.4#d346ca291f8f62040fd9c1a891654711 +-cli11/2.4.1#afacffd31f631bbb8b7c7d6425fe7a66 + concurrentqueue/1.0.4#1e48e1c712bcfd892087c9c622a51502 -eigen/3.4.0#2e192482a8acff96fe34766adca2b24c --fast_float/6.0.0#6c8a953c57879453982a6ce69c0ba87c --fmt/10.1.1#cd63809a79574a2f9eb73ca35f16a243 +-fast_float/6.1.1#e29acaa3d0543dee343abe3f6815346e +-fmt/10.2.1#9199a7a0611866dea5c8849a77467b25 -hdf5/1.14.3#31ccd8d4de83844f5db48471df1944a1 --highfive/2.8.0#b1de99f678ff5699cce6fb5fcac44d2d +-highfive/2.9.0#c57477beed8b0110fadeb6da8f48bcc5 -libdeflate/1.19#3ea74a4549efc14d4b1202dc4bfbf602 parallel-hashmap/1.3.11#1e67f4855a3f7cdeb977cc472113baf7 readerwriterqueue/1.0.6#aaa5ff6fac60c2aee591e9e51b063b83 - span-lite/0.10.3#1967d71abb32b314387c2ab9c558dd22 --spdlog/1.12.0#0e390a2f5c3e96671d0857bc734e4731 --zstd/1.5.5#b87dc3b185caa4b122979ac4ae8ef7e8 + span-lite/0.11.0#519fd49fff711674cfed8cd17d4ed422 +-spdlog/1.13.0#8e88198fd5b9ee31d329431a6d0ccaa2 +-zstd/1.5.6#67383dae85d33f43823e7751a6745ea1 [generators] CMakeDeps --[options] --boost*:system_no_deprecated=True --boost*:asio_no_deprecated=True --boost*:filesystem_no_deprecated=True --boost*:filesystem_version=4 --boost*:zlib=False --boost*:bzip2=False --boost*:lzma=False --boost*:zstd=False --boost*:without_atomic=False --boost*:without_chrono=True --boost*:without_container=True --boost*:without_context=True --boost*:without_contract=True --boost*:without_coroutine=True --boost*:without_date_time=True --boost*:without_exception=False --boost*:without_fiber=True --boost*:without_filesystem=False --boost*:without_graph=True --boost*:without_graph_parallel=True --boost*:without_iostreams=True --boost*:without_json=True --boost*:without_locale=True --boost*:without_log=True --boost*:without_math=True --boost*:without_mpi=True --boost*:without_nowide=True --boost*:without_program_options=True --boost*:without_python=True --boost*:without_random=True --boost*:without_regex=True --boost*:without_serialization=True --boost*:without_stacktrace=True --boost*:without_system=False --boost*:without_test=True --boost*:without_thread=True --boost*:without_timer=True --boost*:without_type_erasure=True --boost*:without_url=True --boost*:without_wave=True + [options] -fmt*:header_only=True -hdf5*:enable_cxx=False -hdf5*:hl=False @@ -75,3 +35,4 @@ index 0ea6184..eb94f2c 100644 -highfive*:with_opencv=False -highfive*:with_xtensor=False -spdlog*:header_only=True +-zstd*:build_programs=False diff --git a/recipes/hictk/meta.yaml b/recipes/hictk/meta.yaml index aaa53c1d48491..38ec7eed97116 100644 --- a/recipes/hictk/meta.yaml +++ b/recipes/hictk/meta.yaml @@ -1,6 +1,6 @@ {% set name = "hictk" %} -{% set version = "0.0.6" %} -{% set sha256 = "5913792f858304ff82996c9e9720442736b443d56c53aa8eb2a1ac2ae8ccc88f" %} +{% set version = "0.0.12" %} +{% set sha256 = "03e8f7c0076ea6209fdfee1580658e871895f6a59b895407c4a25512b9558fb7" %} package: name: {{ name|lower }} @@ -22,6 +22,7 @@ requirements: - cmake >=3.25 - conan >=2 - make + - catch2 >=3.5 - cli11 >=2.3 - eigen >=3.4 - fast_float >=5 @@ -30,13 +31,11 @@ requirements: - spdlog >=1.12 host: - - boost-cpp >=1.80 - hdf5 >=1.12 - libdeflate - zstd >=1.5 run: - - libboost >=1.80 - hdf5 >=1.12 - libdeflate - zstd >=1.5 @@ -53,12 +52,17 @@ test: requires: - curl - cooler>=0.9.3 - - openjdk>=11 - perl-digest-sha1 - xz source_files: - cmake/FetchTestDataset.cmake - - test/scripts/hictk_balance.sh + - test/scripts/check_test_files_exist.sh + - test/scripts/compare_matrix_files.sh + - test/scripts/compare_plain_files.sh + - test/scripts/compare_weights.py + - test/scripts/hictk_balance_ice.sh + - test/scripts/hictk_balance_scale.sh + - test/scripts/hictk_balance_vc.sh - test/scripts/hictk_convert_hic2cool.sh - test/scripts/hictk_convert_cool2hic.sh - test/scripts/hictk_dump_cells.sh @@ -78,6 +82,9 @@ test: - test/scripts/hictk_rename_chromosomes.sh - test/scripts/hictk_validate.sh - test/scripts/hictk_zoomify.sh + - test/scripts/nproc.sh + - test/scripts/readlink.sh + - test/scripts/shuffle.sh commands: - hictk --help - hictk --version @@ -89,3 +96,5 @@ extra: identifiers: - biotools:hictk - doi:10.5281/zenodo.8214221 + additional-platforms: + - linux-aarch64 diff --git a/recipes/hictk/run_test.sh b/recipes/hictk/run_test.sh index 045b9c4db17c7..40324b44eca22 100755 --- a/recipes/hictk/run_test.sh +++ b/recipes/hictk/run_test.sh @@ -16,16 +16,14 @@ shasum -c checksum.sha256 tar -xf hictk_test_dataset.tar.xz -# Download hictools -hictools_url='https://github.com/aidenlab/HiCTools/releases/download/v3.30.00/hic_tools.3.30.00.jar' -hictools_sha256='2b09b0642a826ca5730fde74e022461a708caf62ed292bc5baaa841946721867' -curl -L "$hictools_url" -o hic_tools.jar -echo "$hictools_sha256 hic_tools.jar" | tee checksum.sha256 -shasum -c checksum.sha256 - hictk="$(which hictk)" # Run integration tests + +test/scripts/hictk_balance_ice.sh "$hictk" +test/scripts/hictk_balance_scale.sh "$hictk" +test/scripts/hictk_balance_vc.sh "$hictk" + test/scripts/hictk_dump_chroms.sh "$hictk" test/scripts/hictk_dump_bins.sh "$hictk" test/scripts/hictk_dump_gw.sh "$hictk" @@ -34,7 +32,7 @@ test/scripts/hictk_dump_trans.sh "$hictk" test/scripts/hictk_dump_balanced.sh "$hictk" test/scripts/hictk_convert_hic2cool.sh "$hictk" -test/scripts/hictk_convert_cool2hic.sh "$hictk" hic_tools.jar +test/scripts/hictk_convert_cool2hic.sh "$hictk" test/scripts/hictk_load_coo.sh "$hictk" sorted test/scripts/hictk_load_coo.sh "$hictk" unsorted diff --git a/recipes/hictkpy/CMakeLists.txt.patch b/recipes/hictkpy/CMakeLists.txt.patch new file mode 100644 index 0000000000000..a5c3cb5839689 --- /dev/null +++ b/recipes/hictkpy/CMakeLists.txt.patch @@ -0,0 +1,13 @@ +diff --git a/CMakeLists.txt b/CMakeLists.txt +index 01a1413..b0dcdb4 100644 +--- a/CMakeLists.txt ++++ b/CMakeLists.txt +@@ -17,6 +17,8 @@ set(CMAKE_C_STANDARD 11) + # -std=gnu++20 for example when compiling with PCH enabled + set(CMAKE_CXX_EXTENSIONS OFF) + ++set(CMAKE_OSX_DEPLOYMENT_TARGET 10.15) ++ + project( + hictkpy + LANGUAGES C CXX diff --git a/recipes/hictkpy/build.sh b/recipes/hictkpy/build.sh index 8b2e7f66b8bd2..a6d756aa71a09 100755 --- a/recipes/hictkpy/build.sh +++ b/recipes/hictkpy/build.sh @@ -1,6 +1,6 @@ #!/bin/bash -export CMAKE_BUILD_PARALLEL_LEVEL=${CPU_COUNT} +# export CMAKE_BUILD_PARALLEL_LEVEL=${CPU_COUNT} scratch=$(mktemp -d) export CONAN_HOME="$scratch/conan" @@ -22,22 +22,20 @@ fi mkdir -p "$CONAN_HOME/profiles/" ln -s "${RECIPE_DIR}/conan_profiles/$conan_profile" "$CONAN_HOME/profiles/default" +# explicitly set CMAKE_OSX_DEPLOYMENT_TARGET +patch CMakeLists.txt < "${RECIPE_DIR}/CMakeLists.txt.patch" + # Remove unnecessary dependencies from conanfile.txt patch conanfile.txt < "${RECIPE_DIR}/conanfile.txt.patch" -# Install header-only deps -conan install conanfile.txt \ - --build="*" \ - --output-folder=build/ +# Build hictkpy as a shared library +patch pyproject.toml < "${RECIPE_DIR}/pyproject.toml.patch" -CMAKE_ARGS="-DCMAKE_PREFIX_PATH=$PWD/build" -CMAKE_ARGS+=" ${CMAKE_PLATFORM_FLAGS[*]}" CMAKE_ARGS+=" -DPython_EXECUTABLE=$PYTHON" echo "$CMAKE_ARGS" export CMAKE_ARGS -HICTKPY_SETUP_SKIP_CONAN=1 \ SETUPTOOLS_SCM_PRETEND_VERSION="$PKG_VERSION" \ "$PYTHON" -m pip install "$SRC_DIR" -vv diff --git a/recipes/hictkpy/conanfile.txt.patch b/recipes/hictkpy/conanfile.txt.patch index 34865b8af6ab4..038babbd4c0df 100644 --- a/recipes/hictkpy/conanfile.txt.patch +++ b/recipes/hictkpy/conanfile.txt.patch @@ -1,27 +1,26 @@ diff --git a/conanfile.txt b/conanfile.txt -index 3bea10b..444d3d1 100644 +index cffb547..66cf415 100644 --- a/conanfile.txt +++ b/conanfile.txt -@@ -4,30 +4,9 @@ - +@@ -5,30 +5,12 @@ [requires] - bshoshany-thread-pool/3.5.0#5aaea7ccf37107d3c1ba9ca9ab246e42 --fast_float/5.3.0#efd9bda97d5f77fa5a98981e014092a0 --fmt/10.1.1#cd63809a79574a2f9eb73ca35f16a243 --hdf5/1.14.2#1e12ccecd5ebc9b5191433862e196743 --highfive/2.8.0#19e1a6e78d9329851aa9da409f07d29a + bshoshany-thread-pool/4.1.0#be1802a8768416a6c9b1393cf0ce5e9c + concurrentqueue/1.0.4#1e48e1c712bcfd892087c9c622a51502 +-fast_float/6.1.1#e29acaa3d0543dee343abe3f6815346e +-fmt/10.2.1#9199a7a0611866dea5c8849a77467b25 +-hdf5/1.14.3#31ccd8d4de83844f5db48471df1944a1 +-highfive/2.9.0#c57477beed8b0110fadeb6da8f48bcc5 -libdeflate/1.19#3ea74a4549efc14d4b1202dc4bfbf602 parallel-hashmap/1.3.11#1e67f4855a3f7cdeb977cc472113baf7 --pybind11/2.11.1#e24cefefdb5561ba8d8bc34ab5ba1607 - span-lite/0.10.3#1967d71abb32b314387c2ab9c558dd22 --spdlog/1.12.0#0e390a2f5c3e96671d0857bc734e4731 --xxhash/0.8.2#03fd1c9a839b3f9cdf5ea9742c312187 --zstd/1.5.5#b87dc3b185caa4b122979ac4ae8ef7e8 + readerwriterqueue/1.0.6#aaa5ff6fac60c2aee591e9e51b063b83 + span-lite/0.11.0#519fd49fff711674cfed8cd17d4ed422 +-spdlog/1.13.0#2775cc949e26b339029a852785b6b276 +-zstd/1.5.6#67383dae85d33f43823e7751a6745ea1 [generators] CMakeDeps --[options] + [options] -fmt*:header_only=True -hdf5*:enable_cxx=False -hdf5*:hl=False @@ -32,4 +31,5 @@ index 3bea10b..444d3d1 100644 -highfive*:with_opencv=False -highfive*:with_xtensor=False -spdlog*:header_only=True --xxhash*:utility=False +-zstd*:build_programs=False + diff --git a/recipes/hictkpy/meta.yaml b/recipes/hictkpy/meta.yaml index 390777733a8ef..22be84e3abea8 100644 --- a/recipes/hictkpy/meta.yaml +++ b/recipes/hictkpy/meta.yaml @@ -1,6 +1,6 @@ {% set name = "hictkpy" %} -{% set version = "0.0.3" %} -{% set sha256 = "5f08caebedd88a389329549722b9f34b3fcb526c5be30c6eb793b855a26806cc" %} +{% set version = "0.0.5" %} +{% set sha256 = "e9576a1a719ce378873da15b76e9f7e699748c0486901607e4d7e87c3f0c6556" %} package: name: {{ name|lower }} @@ -8,7 +8,7 @@ package: build: number: 0 - skip: True # [py < 37] + skip: True # [py < 39] run_exports: - {{ pin_subpackage('hictkpy', max_pin='x.x') }} @@ -23,18 +23,15 @@ requirements: - cmake >=3.25 - conan >=2 - make - - eigen >=3.4 - fast_float >=5 - fmt >=10 - highfive >=2.7 - - pybind11 >=2.11 - spdlog >=1.12 host: - python - hdf5 >=1.12 - libdeflate - - xxhash >=0.8 - - setuptools + - scikit-build-core - setuptools_scm - zstd >=1.5 @@ -70,3 +67,5 @@ extra: identifiers: - biotools:hictkpy - doi:10.5281/zenodo.8220300 + additional-platforms: + - linux-aarch64 diff --git a/recipes/hictkpy/pyproject.toml.patch b/recipes/hictkpy/pyproject.toml.patch new file mode 100644 index 0000000000000..6763068194b11 --- /dev/null +++ b/recipes/hictkpy/pyproject.toml.patch @@ -0,0 +1,13 @@ +diff --git a/pyproject.toml b/pyproject.toml +index 1a03623..36102d0 100644 +--- a/pyproject.toml ++++ b/pyproject.toml +@@ -49,7 +49,7 @@ HICTK_BUILD_EXAMPLES = "OFF" + HICTK_BUILD_BENCHMARKS = "OFF" + HICTK_BUILD_TOOLS = "OFF" + HICTK_ENABLE_GIT_VERSION_TRACKING = "OFF" +-BUILD_SHARED_LIBS = "OFF" ++BUILD_SHARED_LIBS = "ON" + CONAN_INSTALL_ARGS = "--settings=compiler.cppstd=17;--build=missing;--update;--options=*/*:shared=False" + + [tool.setuptools_scm] diff --git a/recipes/hificnv/meta.yaml b/recipes/hificnv/meta.yaml index b95edc171d3b1..e6d3537158283 100644 --- a/recipes/hificnv/meta.yaml +++ b/recipes/hificnv/meta.yaml @@ -1,6 +1,6 @@ {% set name = "hificnv" %} -{% set version = "0.1.7" %} -{% set sha256 = "db74f665c5aeab59d02bb33b86bfe7f0023f4069af8729920faf1b088e5a0d73" %} +{% set version = "1.0.0" %} +{% set sha256 = "276afe35d34171f17a5f30e7aa35eb156765156536ae7411171376565d63cfe5" %} package: name: {{ name }} diff --git a/recipes/hifihla/meta.yaml b/recipes/hifihla/meta.yaml index df508026a76a4..76ca74fd77e83 100644 --- a/recipes/hifihla/meta.yaml +++ b/recipes/hifihla/meta.yaml @@ -1,6 +1,6 @@ {% set name = "hifihla" %} -{% set version = "0.2.3" %} -{% set hifihla_sha256 = "f2c3cf24ca12b1bf1bec88dae6a30089c702077e683eb01451f216b3ee93bbe0" %} +{% set version = "0.3.1" %} +{% set hifihla_sha256 = "edeeb0208a545a0993df78989367da417b918621a8c76c69c16e86505c643dce" %} package: name: {{ name }} diff --git a/recipes/hiphase/meta.yaml b/recipes/hiphase/meta.yaml index e6d8bad778424..92a902546ec07 100644 --- a/recipes/hiphase/meta.yaml +++ b/recipes/hiphase/meta.yaml @@ -1,6 +1,6 @@ {% set name = "hiphase" %} -{% set version = "1.1.0" %} -{% set hiphase_sha256 = "b5034e3adc53c0314ac9b8b5b205553830e43c65f77169e91635f18559c5be3b" %} +{% set version = "1.4.0" %} +{% set hiphase_sha256 = "ca38d56df8c644c3f60db26107d21dcaf58bdf53ee166c316fb51de7b8d21768" %} package: name: {{ name }} diff --git a/recipes/hitac/meta.yaml b/recipes/hitac/meta.yaml index 3a7e214569046..2c881eb7aac3f 100644 --- a/recipes/hitac/meta.yaml +++ b/recipes/hitac/meta.yaml @@ -1,5 +1,5 @@ {% set name = "hitac" %} -{% set version = "2.2.1" %} +{% set version = "2.2.2" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 3015bd17fee7f026ddf08708bf8a935d7a73108bc2cc8e9e9275fdf6b823298c + sha256: 22e69ba328f4d48b6f1dd6c394f37fdc429317a5a810a41c91e8e03454f8db09 build: noarch: python diff --git a/recipes/hmftools-amber/AMBER.sh b/recipes/hmftools-amber/amber.sh similarity index 100% rename from recipes/hmftools-amber/AMBER.sh rename to recipes/hmftools-amber/amber.sh diff --git a/recipes/hmftools-amber/build.sh b/recipes/hmftools-amber/build.sh index 60125bce3446e..b6c245c28bb8e 100644 --- a/recipes/hmftools-amber/build.sh +++ b/recipes/hmftools-amber/build.sh @@ -7,6 +7,6 @@ TGT="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" cd "${SRC_DIR}" mv amber*.jar $TGT/amber.jar -cp $RECIPE_DIR/AMBER.sh $TGT/AMBER -ln -s $TGT/AMBER $PREFIX/bin -chmod 0755 "${PREFIX}/bin/AMBER" +cp $RECIPE_DIR/amber.sh $TGT/amber +ln -s $TGT/amber $PREFIX/bin +chmod 0755 "${PREFIX}/bin/amber" diff --git a/recipes/hmftools-amber/meta.yaml b/recipes/hmftools-amber/meta.yaml index 0b7a3cc9085f9..d9db37e2a08f3 100644 --- a/recipes/hmftools-amber/meta.yaml +++ b/recipes/hmftools-amber/meta.yaml @@ -1,12 +1,12 @@ -{% set version = "3.9.1" %} -{% set sha256 = "47d2dba76b56252bd0f3a21f535096a97e2d51bc66c087f4f975272c4aaf92ef" %} +{% set version = "4.0" %} +{% set sha256 = "9fad1e78b4f177a8d2a9b6e29a34e86b82ec1239959b1f68c8f9c279fe21dc13" %} package: name: hmftools-amber version: '{{ version }}' source: - url: https://github.com/hartwigmedical/hmftools/releases/download/amber-v{{ version }}/amber-{{ version }}.jar + url: https://github.com/hartwigmedical/hmftools/releases/download/amber-v{{ version }}/amber_v{{ version }}.jar sha256: '{{ sha256 }}' build: @@ -24,10 +24,10 @@ requirements: test: commands: - - 'AMBER 2>&1 | grep -q "tumor_bam"' + - 'amber -version | grep Amber' about: home: https://github.com/hartwigmedical/hmftools/blob/master/amber/README.md - license: MIT - license_family: MIT - summary: Generates a tumor BAF file for use in PURPLE + license: GPL-3.0-only + license_family: GPL3 + summary: Generates a tumor BAF file for use in PURPLE. diff --git a/recipes/hmftools-bam-tools/bamtools.sh b/recipes/hmftools-bam-tools/bamtools.sh new file mode 100755 index 0000000000000..b62ff17d5670f --- /dev/null +++ b/recipes/hmftools-bam-tools/bamtools.sh @@ -0,0 +1,69 @@ +#!/bin/bash +# hmftools BamTools executable shell script +# https://github.com/hartwigmedical/hmftools/tree/master/bam-tools +set -eu -o pipefail + +export LC_ALL=en_US.UTF-8 + +# Find original directory of bash script, resolving symlinks +# http://stackoverflow.com/questions/59895/can-a-bash-script-tell-what-directory-its-stored-in/246128#246128 +SOURCE="${BASH_SOURCE[0]}" +while [ -h "$SOURCE" ]; do # resolve $SOURCE until the file is no longer a symlink + DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + SOURCE="$(readlink "$SOURCE")" + [[ $SOURCE != /* ]] && SOURCE="$DIR/$SOURCE" # if $SOURCE was a relative symlink, we need to resolve it relative to the path where the symlink file was located +done +DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + +JAR_DIR=$DIR +ENV_PREFIX="$(dirname $(dirname $DIR))" +# Use Java installed with Anaconda to ensure correct version +java="$ENV_PREFIX/bin/java" + +# if JAVA_HOME is set (non-empty), use it. Otherwise keep "java" +if [ -n "${JAVA_HOME:=}" ]; then + if [ -e "$JAVA_HOME/bin/java" ]; then + java="$JAVA_HOME/bin/java" + fi +fi + +# extract memory and system property Java arguments from the list of provided arguments +# http://java.dzone.com/articles/better-java-shell-script +default_jvm_mem_opts="-Xms512m -Xmx1g" +jvm_mem_opts="" +jvm_prop_opts="" +pass_args="" +for arg in "$@"; do + case $arg in + '-D'*) + jvm_prop_opts="$jvm_prop_opts $arg" + ;; + '-XX'*) + jvm_prop_opts="$jvm_prop_opts $arg" + ;; + '-Xm'*) + jvm_mem_opts="$jvm_mem_opts $arg" + ;; + *) + if [[ ${pass_args} == '' ]] #needed to avoid preceeding space on first arg e.g. ' MarkDuplicates' + then + pass_args="$arg" + else + pass_args="$pass_args \"$arg\"" #quotes later arguments to avoid problem with ()s in MarkDuplicates regex arg + fi + ;; + esac +done + +if [ "$jvm_mem_opts" == "" ]; then + jvm_mem_opts="$default_jvm_mem_opts" +fi + +pass_arr=($pass_args) +if [[ ${pass_arr[0]:=} == com.hartwig.* ]] +then + eval "$java" $jvm_mem_opts $jvm_prop_opts -cp "$JAR_DIR/bamtools.jar" $pass_args +else + eval "$java" $jvm_mem_opts $jvm_prop_opts -jar "$JAR_DIR/bamtools.jar" $pass_args +fi +exit diff --git a/recipes/hmftools-bam-tools/build.sh b/recipes/hmftools-bam-tools/build.sh new file mode 100644 index 0000000000000..4f02d98736648 --- /dev/null +++ b/recipes/hmftools-bam-tools/build.sh @@ -0,0 +1,12 @@ +#!/bin/bash + +TGT="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" +[ -d "$TGT" ] || mkdir -p "$TGT" +[ -d "${PREFIX}/bin" ] || mkdir -p "${PREFIX}/bin" + +cd "${SRC_DIR}" +mv bam-tools*.jar $TGT/bamtools.jar + +cp $RECIPE_DIR/bamtools.sh $TGT/bamtools +ln -s $TGT/bamtools $PREFIX/bin +chmod 0755 "${PREFIX}/bin/bamtools" diff --git a/recipes/hmftools-bam-tools/meta.yaml b/recipes/hmftools-bam-tools/meta.yaml new file mode 100644 index 0000000000000..68e1d104b1102 --- /dev/null +++ b/recipes/hmftools-bam-tools/meta.yaml @@ -0,0 +1,30 @@ +{% set version = "1.2.1" %} +{% set sha256 = "3be174019a397a0ff7049be60c9abf8826c59b58b0a3b416fce26cf2a8c12695" %} + +package: + name: hmftools-bam-tools + version: '{{ version }}' + +source: + url: https://github.com/hartwigmedical/hmftools/releases/download/bam-tools-v{{ version }}/bam-tools_v{{ version }}.jar + sha256: '{{ sha256 }}' + +build: + noarch: generic + number: 0 + run_exports: + - {{ pin_subpackage("hmftools-bam-tools", max_pin="x.x") }} + +requirements: + run: + - openjdk >=8 + +test: + commands: + - 'bamtools -version | grep BamTools' + +about: + home: https://github.com/hartwigmedical/hmftools/blob/master/bam-tools/README.md + license: GPL-3.0-only + license_family: GPL3 + summary: Rapidly process BAMs for various tasks. diff --git a/recipes/hmftools-cobalt/build.sh b/recipes/hmftools-cobalt/build.sh index 990ea8634c707..092a2525d3136 100644 --- a/recipes/hmftools-cobalt/build.sh +++ b/recipes/hmftools-cobalt/build.sh @@ -5,8 +5,8 @@ TGT="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" [ -d "${PREFIX}/bin" ] || mkdir -p "${PREFIX}/bin" cd "${SRC_DIR}" -mv *.jar $TGT/cobalt.jar +mv cobalt*.jar $TGT/cobalt.jar -cp $RECIPE_DIR/COBALT.sh $TGT/COBALT -ln -s $TGT/COBALT $PREFIX/bin -chmod 0755 "${PREFIX}/bin/COBALT" +cp $RECIPE_DIR/cobalt.sh $TGT/cobalt +ln -s $TGT/cobalt $PREFIX/bin +chmod 0755 "${PREFIX}/bin/cobalt" diff --git a/recipes/hmftools-cobalt/COBALT.sh b/recipes/hmftools-cobalt/cobalt.sh similarity index 100% rename from recipes/hmftools-cobalt/COBALT.sh rename to recipes/hmftools-cobalt/cobalt.sh diff --git a/recipes/hmftools-cobalt/meta.yaml b/recipes/hmftools-cobalt/meta.yaml index 9a4418e1c2878..1819596469f37 100644 --- a/recipes/hmftools-cobalt/meta.yaml +++ b/recipes/hmftools-cobalt/meta.yaml @@ -1,17 +1,19 @@ -{% set version = "1.13" %} -{% set sha256 = "d70a6bc73da518d159525caa5186551a771c88441efe1103a3425befd2445215" %} +{% set version = "1.16" %} +{% set sha256 = "9fe1d0f3a1f4270d354b6d3e4a6fa7a556dfbcb2e06775cd6328e1f5dba7a77c" %} package: name: hmftools-cobalt version: '{{ version }}' source: - url: https://github.com/hartwigmedical/hmftools/releases/download/cobalt-v{{ version }}/cobalt-{{ version }}.jar + url: https://github.com/hartwigmedical/hmftools/releases/download/cobalt-v{{ version }}/cobalt_v{{ version }}.jar sha256: '{{ sha256 }}' build: noarch: generic - number: 1 + number: 0 + run_exports: + - {{ pin_subpackage("hmftools-cobalt", max_pin="x.x") }} requirements: run: @@ -21,10 +23,10 @@ requirements: test: commands: - - 'COBALT 2>&1 | grep -q "tumor_bam"' + - 'cobalt -version | grep Cobalt' about: home: https://github.com/hartwigmedical/hmftools/blob/master/cobalt/README.md - license: MIT - license_family: MIT - summary: Counts read starts within each 1000 base window to use in PURPLE + license: GPL-3.0-only + license_family: GPL3 + summary: Calculate read-depth counts and GC ratios to use in PURPLE. diff --git a/recipes/hmftools-cuppa/build.sh b/recipes/hmftools-cuppa/build.sh new file mode 100644 index 0000000000000..a11f515c544f5 --- /dev/null +++ b/recipes/hmftools-cuppa/build.sh @@ -0,0 +1,14 @@ +#!/bin/bash + +TGT="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" +[ -d "$TGT" ] || mkdir -p $TGT/{,chart/} +[ -d "${PREFIX}/bin" ] || mkdir -p "${PREFIX}/bin" + +cd "${SRC_DIR}" +mv jar/cuppa*.jar $TGT/cuppa.jar +mv src/cuppa/src/main/resources/cuppa-chart/* $TGT/chart/ + +cp $RECIPE_DIR/cuppa.sh $TGT/cuppa +cp $RECIPE_DIR/cuppa-chart.sh $TGT/cuppa-chart +ln -s $TGT/cuppa{,-chart} ${PREFIX}/bin/ +chmod 0755 ${PREFIX}/bin/cuppa{,-chart} diff --git a/recipes/hmftools-cuppa/cuppa-chart.sh b/recipes/hmftools-cuppa/cuppa-chart.sh new file mode 100755 index 0000000000000..98ffa9f9ad790 --- /dev/null +++ b/recipes/hmftools-cuppa/cuppa-chart.sh @@ -0,0 +1,23 @@ +#!/bin/bash +# hmftools CUPPA chart executable shell script +# https://github.com/hartwigmedical/hmftools/tree/master/cuppa +set -eu -o pipefail + +export LC_ALL=en_US.UTF-8 + +# Find original directory of bash script, resolving symlinks +# http://stackoverflow.com/questions/59895/can-a-bash-script-tell-what-directory-its-stored-in/246128#246128 +SOURCE="${BASH_SOURCE[0]}" +while [ -h "$SOURCE" ]; do # resolve $SOURCE until the file is no longer a symlink + DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + SOURCE="$(readlink "$SOURCE")" + [[ $SOURCE != /* ]] && SOURCE="$DIR/$SOURCE" # if $SOURCE was a relative symlink, we need to resolve it relative to the path where the symlink file was located +done +DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + +ENV_PREFIX="$(dirname $(dirname $DIR))" +# Use Python installed with Anaconda to ensure correct version +python="$ENV_PREFIX/bin/python" + +# Run with argument passthrough +eval ${python} ${DIR}/chart/cuppa-chart.py ${@} diff --git a/recipes/hmftools-cuppa/cuppa.sh b/recipes/hmftools-cuppa/cuppa.sh new file mode 100755 index 0000000000000..33e257cb82296 --- /dev/null +++ b/recipes/hmftools-cuppa/cuppa.sh @@ -0,0 +1,69 @@ +#!/bin/bash +# hmftools CUPPA executable shell script +# https://github.com/hartwigmedical/hmftools/tree/master/cuppa +set -eu -o pipefail + +export LC_ALL=en_US.UTF-8 + +# Find original directory of bash script, resolving symlinks +# http://stackoverflow.com/questions/59895/can-a-bash-script-tell-what-directory-its-stored-in/246128#246128 +SOURCE="${BASH_SOURCE[0]}" +while [ -h "$SOURCE" ]; do # resolve $SOURCE until the file is no longer a symlink + DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + SOURCE="$(readlink "$SOURCE")" + [[ $SOURCE != /* ]] && SOURCE="$DIR/$SOURCE" # if $SOURCE was a relative symlink, we need to resolve it relative to the path where the symlink file was located +done +DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + +JAR_DIR=$DIR +ENV_PREFIX="$(dirname $(dirname $DIR))" +# Use Java installed with Anaconda to ensure correct version +java="$ENV_PREFIX/bin/java" + +# if JAVA_HOME is set (non-empty), use it. Otherwise keep "java" +if [ -n "${JAVA_HOME:=}" ]; then + if [ -e "$JAVA_HOME/bin/java" ]; then + java="$JAVA_HOME/bin/java" + fi +fi + +# extract memory and system property Java arguments from the list of provided arguments +# http://java.dzone.com/articles/better-java-shell-script +default_jvm_mem_opts="-Xms512m -Xmx1g" +jvm_mem_opts="" +jvm_prop_opts="" +pass_args="" +for arg in "$@"; do + case $arg in + '-D'*) + jvm_prop_opts="$jvm_prop_opts $arg" + ;; + '-XX'*) + jvm_prop_opts="$jvm_prop_opts $arg" + ;; + '-Xm'*) + jvm_mem_opts="$jvm_mem_opts $arg" + ;; + *) + if [[ ${pass_args} == '' ]] #needed to avoid preceeding space on first arg e.g. ' MarkDuplicates' + then + pass_args="$arg" + else + pass_args="$pass_args \"$arg\"" #quotes later arguments to avoid problem with ()s in MarkDuplicates regex arg + fi + ;; + esac +done + +if [ "$jvm_mem_opts" == "" ]; then + jvm_mem_opts="$default_jvm_mem_opts" +fi + +pass_arr=($pass_args) +if [[ ${pass_arr[0]:=} == org* ]] +then + eval "$java" $jvm_mem_opts $jvm_prop_opts -cp "$JAR_DIR/cuppa.jar" $pass_args +else + eval "$java" $jvm_mem_opts $jvm_prop_opts -jar "$JAR_DIR/cuppa.jar" $pass_args +fi +exit diff --git a/recipes/hmftools-cuppa/meta.yaml b/recipes/hmftools-cuppa/meta.yaml new file mode 100644 index 0000000000000..4c09d7747c28f --- /dev/null +++ b/recipes/hmftools-cuppa/meta.yaml @@ -0,0 +1,46 @@ +{% set version = "1.8.1" %} +{% set sha256_jar = "595cf6ba5a60a23cf18005cdc2aed18b3f48470f5479aa4e5ee6f386d23e00bb" %} +{% set sha256_src = "39bb318f590ba905c18c0ed42411c97ba482ed98059e456a0f5ec42ad915c8e1" %} + +package: + name: hmftools-cuppa + version: '{{ version }}' + +source: + - folder: jar + url: https://github.com/hartwigmedical/hmftools/releases/download/cuppa-v{{ version }}/cuppa_v{{ version }}.jar + sha256: '{{ sha256_jar }}' + - folder: src + url: https://github.com/hartwigmedical/hmftools/archive/refs/tags/cuppa-v{{ version }}.tar.gz + sha256: '{{ sha256_src }}' + +build: + noarch: generic + number: 0 + run_exports: + - {{ pin_subpackage("hmftools-cuppa", max_pin="x.x") }} + +requirements: + run: + - openjdk >=8 + - r-base >=4 + - r-cowplot + - r-ggplot2 + - r-gridextra + - r-stringi + - r-tidyr + - matplotlib-base >=3.3,<4 + - numpy >=1.19,<2 + - pandas >=1.1,<2 + - scipy >=1,<2 + - seaborn >=0.11,<1 + +test: + commands: + - 'cuppa | grep Cuppa' + +about: + home: https://github.com/hartwigmedical/hmftools/blob/master/cuppa/README.md + license: GPL-3.0-only + license_family: GPL3 + summary: Predict tissue of origin for tumor samples from WGTS data. diff --git a/recipes/hmftools-gripss/gripss.sh b/recipes/hmftools-gripss/gripss.sh index fe4779d219887..4798d83fbba05 100755 --- a/recipes/hmftools-gripss/gripss.sh +++ b/recipes/hmftools-gripss/gripss.sh @@ -1,5 +1,5 @@ #!/bin/bash -# hmftools gripss executable shell script +# hmftools GRIPSS executable shell script # https://github.com/hartwigmedical/hmftools/tree/master/gripss set -eu -o pipefail diff --git a/recipes/hmftools-gripss/meta.yaml b/recipes/hmftools-gripss/meta.yaml index a0aab8147d630..60be672c9e61f 100644 --- a/recipes/hmftools-gripss/meta.yaml +++ b/recipes/hmftools-gripss/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.3.5" %} -{% set sha256 = "7df02379f416c6131de5f81ad062ab253277b68d7eb71eae0dc9e9bfe34f3bc6" %} +{% set version = "2.4" %} +{% set sha256 = "7e8fb3631c8bb410650e9d84d43d40c85322e0f73e537feae4d186d54d412411" %} package: name: hmftools-gripss @@ -21,10 +21,10 @@ requirements: test: commands: - - 'gripss 2>&1 | grep -q "loading reference data"' + - 'gripss -version | grep Gripss' about: home: https://github.com/hartwigmedical/hmftools/tree/master/gripss license: GPL-3.0-only license_family: GPL - summary: 'GRIPSS applies a set of filtering and post processing steps on GRIDSS paired tumor-normal output to produce a high confidence set of somatic SV for a tumor sample.' + summary: GRIPSS applies a set of filtering and post processing steps on GRIDSS paired tumor-normal output to produce a high confidence set of somatic SV for a tumor sample. diff --git a/recipes/hmftools-isofox/isofox.sh b/recipes/hmftools-isofox/isofox.sh index 91bb67218a3dc..1c57bf313dfd7 100755 --- a/recipes/hmftools-isofox/isofox.sh +++ b/recipes/hmftools-isofox/isofox.sh @@ -1,5 +1,5 @@ #!/bin/bash -# hmftools isofox executable shell script +# hmftools Isofox executable shell script # https://github.com/hartwigmedical/hmftools/tree/master/isofox set -eu -o pipefail diff --git a/recipes/hmftools-isofox/meta.yaml b/recipes/hmftools-isofox/meta.yaml index 9cc47f9fe3d22..e3cd0ebf68cfd 100644 --- a/recipes/hmftools-isofox/meta.yaml +++ b/recipes/hmftools-isofox/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.6.2" %} -{% set sha256 = "b681b48f0a0fc31de30a0721c0094f294b1e8fe1fb567447b7bf153120981cd2" %} +{% set version = "1.7.1" %} +{% set sha256 = "978db2ea04f4b8ba07910ad01c145bb23f57c279608b9bd7f27447403a5e25ae" %} package: name: hmftools-isofox @@ -12,6 +12,8 @@ source: build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage('hmftools-isofox', max_pin="x.x") }} requirements: run: @@ -19,10 +21,10 @@ requirements: test: commands: - - 'isofox 2>&1 | grep -q "Isofox version"' + - 'isofox -version | grep Isofox' about: home: https://github.com/hartwigmedical/hmftools/tree/master/isofox license: GPL-3.0-only license_family: GPL - summary: 'Isofox is a tool for counting fragment support for identifying and counting gene and transcript features using genome aligned RNASeq data in tumor samples.' + summary: Isofox is a tool for counting fragment support for identifying and counting gene and transcript features using genome aligned RNASeq data in tumor samples. diff --git a/recipes/hmftools-lilac/build.sh b/recipes/hmftools-lilac/build.sh index a90fcee0b3303..a65c6f98505e2 100644 --- a/recipes/hmftools-lilac/build.sh +++ b/recipes/hmftools-lilac/build.sh @@ -7,6 +7,6 @@ TGT="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" cd "${SRC_DIR}" mv lilac*.jar $TGT/lilac.jar -cp $RECIPE_DIR/LILAC.sh $TGT/LILAC -ln -s $TGT/LILAC $PREFIX/bin -chmod 0755 "${PREFIX}/bin/LILAC" +cp $RECIPE_DIR/lilac.sh $TGT/lilac +ln -s $TGT/lilac $PREFIX/bin +chmod 0755 "${PREFIX}/bin/lilac" diff --git a/recipes/hmftools-lilac/LILAC.sh b/recipes/hmftools-lilac/lilac.sh similarity index 100% rename from recipes/hmftools-lilac/LILAC.sh rename to recipes/hmftools-lilac/lilac.sh diff --git a/recipes/hmftools-lilac/meta.yaml b/recipes/hmftools-lilac/meta.yaml index 0ca7fb2315494..c444f5345d0a3 100644 --- a/recipes/hmftools-lilac/meta.yaml +++ b/recipes/hmftools-lilac/meta.yaml @@ -1,17 +1,19 @@ -{% set version = "1.4.2" %} -{% set sha256 = "1df4a34f3ea777db8da21cd9eaeca19a30795e5eb0bb44c5b38cd705df5c82fe" %} +{% set version = "1.6" %} +{% set sha256 = "d5f5fc5c2fb047fdbc6292a36dc3a164f5bbf820f87ceebafecf1412c41632f6" %} package: name: hmftools-lilac version: '{{ version }}' source: - url: 'https://github.com/hartwigmedical/hmftools/releases/download/lilac-v{{ version }}/lilac_v{{ version }}.jar' + url: https://github.com/hartwigmedical/hmftools/releases/download/lilac-v{{ version }}/lilac_v{{ version }}.jar sha256: '{{ sha256 }}' build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage('hmftools-lilac', max_pin="x") }} requirements: run: @@ -20,10 +22,10 @@ requirements: test: commands: - - 'LILAC 2>&1 | grep -q "LilacApplication"' + - 'lilac -version | grep Lilac' about: home: https://github.com/hartwigmedical/hmftools/blob/master/lilac/README.md - license: "GNU General Public v3 (GPLv3)" + license: GPL-3.0-only license_family: GPL3 summary: LILAC is a WGS tool to determine HLA Class I types. diff --git a/recipes/hmftools-linx/linx.sh b/recipes/hmftools-linx/linx.sh index 7fe7ef75a7882..7bc92d4b403cb 100755 --- a/recipes/hmftools-linx/linx.sh +++ b/recipes/hmftools-linx/linx.sh @@ -1,5 +1,5 @@ #!/bin/bash -# hmftools linx executable shell script +# hmftools LINX executable shell script # https://github.com/hartwigmedical/hmftools/tree/master/linx set -eu -o pipefail diff --git a/recipes/hmftools-linx/meta.yaml b/recipes/hmftools-linx/meta.yaml index bf53e28de0d52..b7d512fde85ad 100644 --- a/recipes/hmftools-linx/meta.yaml +++ b/recipes/hmftools-linx/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.23.6" %} -{% set sha256 = "6dfeb9c15369d33953193e65db8454e678772c79218643bd122293e59288d297" %} +{% set version = "1.25" %} +{% set sha256 = "2fa9a91801239ded3e82fcd0ee9987e6181d0e400855420ef7f5000f3b4a96da" %} package: name: hmftools-linx @@ -12,6 +12,8 @@ source: build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage('hmftools-linx', max_pin="x") }} requirements: run: @@ -27,10 +29,10 @@ requirements: test: commands: - - 'linx 2>&1 | grep -q "LINX version"' + - 'linx -version | grep Linx' about: home: https://github.com/hartwigmedical/hmftools/tree/master/linx license: GPL-3.0-only license_family: GPL - summary: Linx is an annotation, interpretation and visualisation tool for structural variants + summary: LINX is an annotation, interpretation and visualisation tool for structural variants. diff --git a/recipes/hmftools-mark-dups/build.sh b/recipes/hmftools-mark-dups/build.sh new file mode 100644 index 0000000000000..55784e8b35b79 --- /dev/null +++ b/recipes/hmftools-mark-dups/build.sh @@ -0,0 +1,12 @@ +#!/bin/bash + +TGT="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" +[ -d "$TGT" ] || mkdir -p "$TGT" +[ -d "${PREFIX}/bin" ] || mkdir -p "${PREFIX}/bin" + +cd "${SRC_DIR}" +mv mark-dups*.jar $TGT/markdups.jar + +cp $RECIPE_DIR/markdups.sh $TGT/markdups +ln -s $TGT/markdups $PREFIX/bin +chmod 0755 "${PREFIX}/bin/markdups" diff --git a/recipes/hmftools-mark-dups/markdups.sh b/recipes/hmftools-mark-dups/markdups.sh new file mode 100755 index 0000000000000..c69115b6bee1d --- /dev/null +++ b/recipes/hmftools-mark-dups/markdups.sh @@ -0,0 +1,69 @@ +#!/bin/bash +# hmftools MarkDups executable shell script +# https://github.com/hartwigmedical/hmftools/tree/master/mark-dups +set -eu -o pipefail + +export LC_ALL=en_US.UTF-8 + +# Find original directory of bash script, resolving symlinks +# http://stackoverflow.com/questions/59895/can-a-bash-script-tell-what-directory-its-stored-in/246128#246128 +SOURCE="${BASH_SOURCE[0]}" +while [ -h "$SOURCE" ]; do # resolve $SOURCE until the file is no longer a symlink + DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + SOURCE="$(readlink "$SOURCE")" + [[ $SOURCE != /* ]] && SOURCE="$DIR/$SOURCE" # if $SOURCE was a relative symlink, we need to resolve it relative to the path where the symlink file was located +done +DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + +JAR_DIR=$DIR +ENV_PREFIX="$(dirname $(dirname $DIR))" +# Use Java installed with Anaconda to ensure correct version +java="$ENV_PREFIX/bin/java" + +# if JAVA_HOME is set (non-empty), use it. Otherwise keep "java" +if [ -n "${JAVA_HOME:=}" ]; then + if [ -e "$JAVA_HOME/bin/java" ]; then + java="$JAVA_HOME/bin/java" + fi +fi + +# extract memory and system property Java arguments from the list of provided arguments +# http://java.dzone.com/articles/better-java-shell-script +default_jvm_mem_opts="-Xms512m -Xmx1g" +jvm_mem_opts="" +jvm_prop_opts="" +pass_args="" +for arg in "$@"; do + case $arg in + '-D'*) + jvm_prop_opts="$jvm_prop_opts $arg" + ;; + '-XX'*) + jvm_prop_opts="$jvm_prop_opts $arg" + ;; + '-Xm'*) + jvm_mem_opts="$jvm_mem_opts $arg" + ;; + *) + if [[ ${pass_args} == '' ]] #needed to avoid preceeding space on first arg e.g. ' MarkDuplicates' + then + pass_args="$arg" + else + pass_args="$pass_args \"$arg\"" #quotes later arguments to avoid problem with ()s in MarkDuplicates regex arg + fi + ;; + esac +done + +if [ "$jvm_mem_opts" == "" ]; then + jvm_mem_opts="$default_jvm_mem_opts" +fi + +pass_arr=($pass_args) +if [[ ${pass_arr[0]:=} == com.hartwig.* ]] +then + eval "$java" $jvm_mem_opts $jvm_prop_opts -cp "$JAR_DIR/markdups.jar" $pass_args +else + eval "$java" $jvm_mem_opts $jvm_prop_opts -jar "$JAR_DIR/markdups.jar" $pass_args +fi +exit diff --git a/recipes/hmftools-mark-dups/meta.yaml b/recipes/hmftools-mark-dups/meta.yaml new file mode 100644 index 0000000000000..b3a5ae8fd6f73 --- /dev/null +++ b/recipes/hmftools-mark-dups/meta.yaml @@ -0,0 +1,32 @@ +{% set version = "1.1.5" %} +{% set sha256 = "59cc87f1e7923b11d5c1b59c3c8fb531ace6d5d39dac61a165d76b4d1c472c10" %} + +package: + name: hmftools-mark-dups + version: '{{ version }}' + +source: + url: https://github.com/hartwigmedical/hmftools/releases/download/mark-dups-v{{ version }}/mark-dups_v{{ version }}.jar + sha256: '{{ sha256 }}' + +build: + noarch: generic + number: 0 + run_exports: + - {{ pin_subpackage('hmftools-mark-dups', max_pin="x.x") }} + +requirements: + run: + - openjdk >=8 + - sambamba >=1.0 + - samtools >=1.17 + +test: + commands: + - 'markdups -version | grep MarkDups' + +about: + home: https://github.com/hartwigmedical/hmftools/tree/master/mark-dups + license: GPL-3.0-only + license_family: GPL + summary: Mark read duplicates and form consenus sequences diff --git a/recipes/hmftools-orange/meta.yaml b/recipes/hmftools-orange/meta.yaml index afd2ba038d8f9..d49445d0d739d 100644 --- a/recipes/hmftools-orange/meta.yaml +++ b/recipes/hmftools-orange/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "3.0.0" %} -{% set sha256 = "ba3887c741501bd0d0815e701b68fe7a51dace01560ebd6e0f0647ff8c385e98" %} +{% set version = "3.4.0" %} +{% set sha256 = "a9a4da946a938f3964ada5f213514ee65c4991a7cf9f263f48e55cfbed774196" %} package: name: hmftools-orange diff --git a/recipes/hmftools-pave/meta.yaml b/recipes/hmftools-pave/meta.yaml index 8bb0808513d02..84156f65d0e6f 100644 --- a/recipes/hmftools-pave/meta.yaml +++ b/recipes/hmftools-pave/meta.yaml @@ -1,17 +1,19 @@ -{% set version = "1.4.1" %} -{% set sha256 = "eb6dbf7ff5d2729807e5a33709b256fa1537235eb263c1f0b34fba45e60fc4b3" %} +{% set version = "1.6" %} +{% set sha256 = "c553b5224dae4f61958030d2b544ad990aca6fde145ee03f43214856f3dbf634" %} package: name: hmftools-pave version: '{{ version }}' source: - url: 'https://github.com/hartwigmedical/hmftools/releases/download/pave-v{{ version }}/pave_v{{ version }}.jar' + url: https://github.com/hartwigmedical/hmftools/releases/download/pave-v{{ version }}/pave_v{{ version }}.jar sha256: '{{ sha256 }}' build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage('hmftools-pave', max_pin="x.x") }} requirements: run: @@ -20,10 +22,10 @@ requirements: test: commands: - - 'pave 2>&1 | grep -q "Pave version"' + - 'pave -version | grep Pave' about: home: https://github.com/hartwigmedical/hmftools/tree/master/pave license: GPL-3.0-only license_family: GPL - summary: Pave annotates a somatic variant VCF with gene and transcript coding and protein effects. + summary: PAVE annotates SNV/MNV/INDEL calls with consequence on corresponding genes, transcripts, and proteins. diff --git a/recipes/hmftools-pave/pave.sh b/recipes/hmftools-pave/pave.sh index 73ae4b947b422..d3108a6244903 100755 --- a/recipes/hmftools-pave/pave.sh +++ b/recipes/hmftools-pave/pave.sh @@ -1,5 +1,5 @@ #!/bin/bash -# hmftools pave executable shell script +# hmftools PAVE executable shell script # https://github.com/hartwigmedical/hmftools/tree/master/pave set -eu -o pipefail diff --git a/recipes/hmftools-purple/build.sh b/recipes/hmftools-purple/build.sh index 963fc41560196..05ac0857d05be 100644 --- a/recipes/hmftools-purple/build.sh +++ b/recipes/hmftools-purple/build.sh @@ -7,6 +7,6 @@ TGT="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" cd "${SRC_DIR}" mv purple*.jar $TGT/purple.jar -cp $RECIPE_DIR/PURPLE.sh $TGT/PURPLE -ln -s $TGT/PURPLE $PREFIX/bin -chmod 0755 "${PREFIX}/bin/PURPLE" +cp $RECIPE_DIR/purple.sh $TGT/purple +ln -s $TGT/purple $PREFIX/bin +chmod 0755 "${PREFIX}/bin/purple" diff --git a/recipes/hmftools-purple/meta.yaml b/recipes/hmftools-purple/meta.yaml index 929b228c38a8b..ae81543b0e19c 100644 --- a/recipes/hmftools-purple/meta.yaml +++ b/recipes/hmftools-purple/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "3.7.1" %} -{% set sha256 = "23c5fc9832bfd5e3686c8d2ae2285aff4d6c2ac4683021ff17ec59c48d75694c" %} +{% set version = "4.0.2" %} +{% set sha256 = "fb534734b4a0833c8d68591e009caea5b654714211a95f23570c1fca9bfa57a9" %} package: name: hmftools-purple @@ -12,6 +12,8 @@ source: build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage('hmftools-purple', max_pin="x") }} requirements: run: @@ -28,10 +30,10 @@ requirements: test: commands: - - 'PURPLE -version' + - 'purple -version | grep Purple' about: - home: https://github.com/hartwigmedical/hmftools/tree/master/purity-ploidy-estimator - license: MIT - license_family: MIT - summary: Purity/ploidy estimator. Leverages the read depth and tumor BAF to estimate the purity of a sample and generate a copy number profile + home: https://github.com/hartwigmedical/hmftools/tree/master/purple + license: GPL-3.0-only + license_family: GPL3 + summary: PURPLE is a purity ploidy estimator for tumor samples. diff --git a/recipes/hmftools-purple/PURPLE.sh b/recipes/hmftools-purple/purple.sh similarity index 94% rename from recipes/hmftools-purple/PURPLE.sh rename to recipes/hmftools-purple/purple.sh index 72618b94ab858..68dfb735ed9b0 100755 --- a/recipes/hmftools-purple/PURPLE.sh +++ b/recipes/hmftools-purple/purple.sh @@ -1,6 +1,6 @@ #!/bin/bash # hmftools PURPLE executable shell script -# https://github.com/hartwigmedical/hmftools/tree/master/purity-ploidy-estimator +# https://github.com/hartwigmedical/hmftools/tree/master/purple set -eu -o pipefail export LC_ALL=en_US.UTF-8 @@ -46,8 +46,8 @@ for arg in "$@"; do ;; *) if [[ ${pass_args} == '' ]] #needed to avoid preceeding space on first arg e.g. ' MarkDuplicates' - then - pass_args="$arg" + then + pass_args="$arg" else pass_args="$pass_args \"$arg\"" #quotes later arguments to avoid problem with ()s in MarkDuplicates regex arg fi diff --git a/recipes/hmftools-sage/build.sh b/recipes/hmftools-sage/build.sh index 2763b3328ad10..d7f5400c6ef21 100644 --- a/recipes/hmftools-sage/build.sh +++ b/recipes/hmftools-sage/build.sh @@ -7,6 +7,6 @@ TGT="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" cd "${SRC_DIR}" mv sage*.jar $TGT/sage.jar -cp $RECIPE_DIR/SAGE.sh $TGT/SAGE -ln -s $TGT/SAGE $PREFIX/bin -chmod 0755 "${PREFIX}/bin/SAGE" +cp $RECIPE_DIR/sage.sh $TGT/sage +ln -s $TGT/sage $PREFIX/bin +chmod 0755 "${PREFIX}/bin/sage" diff --git a/recipes/hmftools-sage/meta.yaml b/recipes/hmftools-sage/meta.yaml index 04abf8dab70df..8fe36d6848773 100644 --- a/recipes/hmftools-sage/meta.yaml +++ b/recipes/hmftools-sage/meta.yaml @@ -1,17 +1,19 @@ -{% set version = "3.2.3" %} -{% set sha256 = "a49438afee0f7595ff13f7d44e5ae08edc785dc8f04ef605482d9af59ae940f9" %} +{% set version = "3.4.2" %} +{% set sha256 = "10cf12b1fb8782ad44898fb7ac1e413dc8f9eec3448ae31d03effbd4e01ccc03" %} package: name: hmftools-sage version: '{{ version }}' source: - url: 'https://github.com/hartwigmedical/hmftools/releases/download/sage-v{{ version }}/sage_v{{ version }}.jar' + url: https://github.com/hartwigmedical/hmftools/releases/download/sage-v{{ version }}/sage_v{{ version }}.jar sha256: '{{ sha256 }}' build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage('hmftools-sage', max_pin="x") }} requirements: run: @@ -27,10 +29,10 @@ requirements: test: commands: - - 'SAGE 2>&1 | grep -q "Sage version"' + - 'sage -version | grep Sage' about: home: https://github.com/hartwigmedical/hmftools/tree/master/sage license: GPL-3.0-only license_family: GPL - summary: SAGE is a somatic SNV, MNV and small INDEL caller optimised to call narrow regions of the genome with high prior chance of a variant with very high sensitivity. + summary: SAGE is a somatic SNV, MNV and small INDEL caller optimised 100x tumor / 40x normal coverage, but has a flexible set of filters that can be adapted to lower or higher depth coverage. diff --git a/recipes/hmftools-sage/SAGE.sh b/recipes/hmftools-sage/sage.sh similarity index 95% rename from recipes/hmftools-sage/SAGE.sh rename to recipes/hmftools-sage/sage.sh index 5e9159203c37f..0164c0f1b3c2c 100755 --- a/recipes/hmftools-sage/SAGE.sh +++ b/recipes/hmftools-sage/sage.sh @@ -1,6 +1,6 @@ #!/bin/bash # hmftools SAGE executable shell script -# https://github.com/hartwigmedical/hmftools/tree/master/SAGE +# https://github.com/hartwigmedical/hmftools/tree/master/sage set -eu -o pipefail export LC_ALL=en_US.UTF-8 @@ -60,7 +60,7 @@ if [ "$jvm_mem_opts" == "" ]; then fi pass_arr=($pass_args) -if [[ ${pass_arr[0]:=} == org* ]] +if [[ ${pass_arr[0]:=} == com.hartwig.* ]] then eval "$java" $jvm_mem_opts $jvm_prop_opts -cp "$JAR_DIR/sage.jar" $pass_args else diff --git a/recipes/hmftools-sigs/meta.yaml b/recipes/hmftools-sigs/meta.yaml index 2a510330aeb72..386cadd737c51 100644 --- a/recipes/hmftools-sigs/meta.yaml +++ b/recipes/hmftools-sigs/meta.yaml @@ -1,17 +1,19 @@ -{% set version = "1.1" %} -{% set sha256 = "ef38b1d36e6c326ff06e71f0d690b7503fe38efc91b1e4c4b170277f83093276" %} +{% set version = "1.2.1" %} +{% set sha256 = "b2af1ce3ac401adb145d77b031deb0edcc1d1a5257686cb67a1fc3355a7820e5" %} package: name: hmftools-sigs version: '{{ version }}' source: - url: 'https://github.com/hartwigmedical/hmftools/releases/download/sigs-v{{ version }}/sigs_v{{ version }}.jar' + url: https://github.com/hartwigmedical/hmftools/releases/download/sigs-v{{ version }}/sigs_v{{ version }}.jar sha256: '{{ sha256 }}' build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage('hmftools-sigs', max_pin='x') }} requirements: run: @@ -20,10 +22,10 @@ requirements: test: commands: - - 'sigs 2>&1 | grep -q "running sample signature fit"' + - 'sigs -version | grep -o Sigs' about: home: https://github.com/hartwigmedical/hmftools/blob/master/sigs/README.md - license: "GNU General Public v3 (GPLv3)" + license: GPL-3.0-only license_family: GPL3 summary: Fits sample SNV counts to trinucleotide signature definitions. diff --git a/recipes/hmftools-sigs/sigs.sh b/recipes/hmftools-sigs/sigs.sh index 85cccef267a09..14bd78f53b009 100755 --- a/recipes/hmftools-sigs/sigs.sh +++ b/recipes/hmftools-sigs/sigs.sh @@ -1,5 +1,5 @@ #!/bin/bash -# hmftools sigs executable shell script +# hmftools Sigs executable shell script # https://github.com/hartwigmedical/hmftools/tree/master/sigs set -eu -o pipefail diff --git a/recipes/hmftools-sv-prep/build.sh b/recipes/hmftools-sv-prep/build.sh index 2089a1b4204e8..5b0bbef52c376 100644 --- a/recipes/hmftools-sv-prep/build.sh +++ b/recipes/hmftools-sv-prep/build.sh @@ -7,6 +7,10 @@ TGT="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" cd "${SRC_DIR}" mv sv-prep*.jar $TGT/sv-prep.jar -cp $RECIPE_DIR/SvPrep.sh $TGT/SvPrep -ln -s $TGT/SvPrep $PREFIX/bin -chmod 0755 "${PREFIX}/bin/SvPrep" +cp $RECIPE_DIR/svprep.sh $TGT/svprep +cp $RECIPE_DIR/gridss_shell_with_jar_entrypoint $TGT/ +cp $RECIPE_DIR/gridss_svprep.sh $TGT/gridss_svprep + +ln -s $TGT/svprep $PREFIX/bin/ +ln -s $TGT/gridss_shell_with_jar_entrypoint $PREFIX/bin/gridss_svprep +chmod 0755 ${PREFIX}/bin/{gridss_,}svprep diff --git a/recipes/hmftools-sv-prep/gridss_shell_with_jar_entrypoint b/recipes/hmftools-sv-prep/gridss_shell_with_jar_entrypoint new file mode 100644 index 0000000000000..1b8d632b76499 --- /dev/null +++ b/recipes/hmftools-sv-prep/gridss_shell_with_jar_entrypoint @@ -0,0 +1,30 @@ +#!/bin/bash +# Wrapper scripts that sets --jar gridss.jar command line argument +# so users don't need to know the path to the GRIDSS jar + +# Adapted from bioconda-recipes/picard/picard.sh +set -o pipefail + +resolve_source_directory() { + # Find original directory of bash script, resolving symlinks + # http://stackoverflow.com/questions/59895/can-a-bash-script-tell-what-directory-its-stored-in/246128#246128 + local SOURCE="${1}" + while [ -h "$SOURCE" ]; do # resolve $SOURCE until the file is no longer a symlink + DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + SOURCE="$(readlink "$SOURCE")" + [[ $SOURCE != /* ]] && SOURCE="$DIR/$SOURCE" # if $SOURCE was a relative symlink, we need to resolve it relative to the path where the symlink file was located + done + DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + echo $DIR +} + +# Sanity check for GRIDSS dependency +if ! hash gridss 2>/dev/null; then + echo "Could not find 'gridss' in PATH, exiting"; + exit 1; +fi + +SCRIPT_DIR=$(resolve_source_directory ${BASH_SOURCE[0]}) +JAR_DIR=$(resolve_source_directory $(which gridss)) + +$SCRIPT_DIR/$(basename $0) --jar "$JAR_DIR/gridss.jar" "$@" diff --git a/recipes/hmftools-sv-prep/gridss_svprep.sh b/recipes/hmftools-sv-prep/gridss_svprep.sh new file mode 100755 index 0000000000000..9e0f9f0d519a4 --- /dev/null +++ b/recipes/hmftools-sv-prep/gridss_svprep.sh @@ -0,0 +1,832 @@ +#!/bin/bash +# GRIDSS execution script using SvPrep BAMs + +getopt --test +if [[ ${PIPESTATUS[0]} -ne 4 ]]; then + echo 'WARNING: "getopt --test"` failed in this environment.' 1>&2 + echo "WARNING: The version of getopt(1) installed on this system might not be compatible with the GRIDSS driver script." 1>&2 +fi +unset DISPLAY # Prevents errors attempting to connecting to an X server when starting the R plotting device +ulimit -n $(ulimit -Hn 2>/dev/null) 2>/dev/null # Reduce likelihood of running out of open file handles +set -o errexit -o pipefail -o noclobber -o nounset +last_command="" +current_command="" +trap 'last_command=$current_command; current_command=$BASH_COMMAND' DEBUG +trap 'echo "\"${last_command}\" command completed with exit code $?."' EXIT +#253 forcing C locale for everything +export LC_ALL=C + +EX_USAGE=64 +EX_NOINPUT=66 +EX_CANTCREAT=73 +EX_CONFIG=78 + +workingdir="." +reference="" +output_vcf="" +assembly="" +threads=8 +jvmheap="30g" +otherjvmheap="4g" +blacklist="" +metricsrecords=10000000 +maxcoverage=50000 +config_file="" +labels="" +bams="" +filtered_bams="" +full_bams="" +keepTempFiles="false" + +steps="all" +do_preprocess=false +do_assemble=false +do_call=false + +USAGE_MESSAGE=" +Usage: gridss [options] -r -o -a input1.bam [input2.bam [...]] + + -r/--reference: reference genome to use. + -o/--output: output VCF. + -a/--assembly: location of the GRIDSS assembly BAM. This file will be + created by GRIDSS. + -t/--threads: number of threads to use. (Default: $threads) + -j/--jar: location of GRIDSS jar + -w/--workingdir: directory to place GRIDSS intermediate and temporary files + .gridss.working subdirectories will be created. (Default: $workingdir) + -s/--steps: processing steps to run. Defaults to all steps. + Multiple steps are specified using comma separators. Possible steps are: + preprocess, assemble, call, all + -e/--blacklist: BED file containing regions to ignore + -c/--configuration: configuration file use to override default GRIDSS + settings. + -l/--labels: comma separated labels to use in the output VCF for the input + files. Supporting read counts for input files with the same label are + aggregated (useful for multiple sequencing runs of the same sample). + Labels default to input filenames, unless a single read group with a + non-empty sample name exists in which case the read group sample name + is used (which can be disabled by \"useReadGroupSampleNameCategoryLabel=false\" + in the configuration file). If labels are specified, they must be + specified for all input files. + -b/bams: comma separated full-path BAM files + -f/filtered_bams: comma separated full-path filtered BAM files + --jvmheap: size of JVM heap for the high-memory component of assembly and variant calling. (Default: $jvmheap) + --otherjvmheap: size of JVM heap for everything else. Useful to prevent + java out of memory errors when using large (>4Gb) reference genomes. + Note that some parts of assembly and variant calling use this heap + size. (Default: $otherjvmheap) + " + +OPTIONS=r:o:a:t:j:w:e:s:c:l:b:f: +LONGOPTS=reference:,output:,assembly:,threads:,jar:,workingdir:,jvmheap:,otherjvmheap:,blacklist:,steps:,configuration:,labels:,bams:,filtered_bams: +! PARSED=$(getopt --options=$OPTIONS --longoptions=$LONGOPTS --name "$0" -- "$@") +if [[ ${PIPESTATUS[0]} -ne 0 ]]; then + # e.g. return value is 1 + # then getopt has complained about wrong arguments to stdout + echo "$USAGE_MESSAGE" 1>&2 + exit $EX_USAGE +fi +eval set -- "$PARSED" + +POSITIONAL_ARGS=() + +#while true; do +while [[ $# -gt 0 ]]; do + case "$1" in + -r|--reference) + reference="$2" + shift 2 + ;; + -l|--labels) + labels="$2" + shift 2 + ;; + -b|--bams) + bams="$2" + shift 2 + ;; + -f|--filtered_bams) + filtered_bams="$2" + shift 2 + ;; + -s|--steps) + steps="$2" + shift 2 + ;; + -w|--workingdir) + workingdir="$2" + shift 2 + ;; + -o|--output) + output_vcf="$2" + shift 2 + ;; + -a|--assembly) + if [[ "$assembly" == "" ]] ; then + assembly="$2" + else + assembly="$assembly $2" + fi + # TODO: support multiple assembly files + shift 2 + ;; + -e|--blacklist) + blacklist="$2" + shift 2 + ;; + -j|--jar) + GRIDSS_JAR="$2" + shift 2 + ;; + --jvmheap) + jvmheap="$2" + shift 2 + ;; + --otherjvmheap) + otherjvmheap="$2" + shift 2 + ;; + -t|--threads) + printf -v threads '%d\n' "$2" 2>/dev/null + printf -v threads '%d' "$2" 2>/dev/null + shift 2 + ;; + -c|--configuration) + config_file=$2 + shift 2 + ;; + *) + POSITIONAL_ARGS+=("$1") # save positional arg + # echo "Unparsed param" + shift + ;; + esac +done + +##### --workingdir +echo "Using working directory \"$workingdir\"" 1>&2 +if [[ "$workingdir" == "" ]] ; then + echo "$USAGE_MESSAGE" 1>&2 + echo "Working directory must be specified. Specify using the --workingdir command line argument" 1>&2 + exit $EX_USAGE +fi +if [[ "$(tr -d ' \n' <<< "$workingdir")" != "$workingdir" ]] ; then + echo "workingdir cannot contain whitespace" 1>&2 + exit $EX_USAGE + fi +if [[ ! -d $workingdir ]] ; then + mkdir -p $workingdir + if [[ ! -d $workingdir ]] ; then + echo Unable to create working directory $workingdir 1>&2 + exit $EX_CANTCREAT + fi +fi +workingdir=$(dirname $workingdir/placeholder) +timestamp=$(date +%Y%m%d_%H%M%S) +# Logging +logfile=$workingdir/gridss.full.$timestamp.$HOSTNAME.$$.log +# $1 is message to write +write_status() { + echo "$(date): $1" | tee -a $logfile 1>&2 +} +write_status "Full log file is: $logfile" +trap 'echo "\"${last_command}\" command completed with exit code $?. +***** +The underlying error message can be found in $logfile +*****"' EXIT +# Timing instrumentation +timinglogfile=$workingdir/gridss.timing.$timestamp.$HOSTNAME.$$.log +if which /usr/bin/time >/dev/null ; then + timecmd="/usr/bin/time" + write_status "Found /usr/bin/time" +else + timecmd="" + write_status "Not found /usr/bin/time" +fi +if [[ "$timecmd" != "" ]] ; then + timecmd="/usr/bin/time --verbose -a -o $timinglogfile" + if ! $timecmd echo 2>&1 > /dev/null; then + timecmd="/usr/bin/time -a -o $timinglogfile" + fi + if ! $timecmd echo 2>&1 > /dev/null ; then + timecmd="" + write_status "Unexpected /usr/bin/time version. Not logging timing information." + fi + # We don't need timing info of the echo + rm -f $timinglogfile +fi + +### Find the jars +find_jar() { + env_name=$1 + if [[ -f "${!env_name:-}" ]] ; then + echo "${!env_name}" + else + write_status "Unable to find $2 jar. Specify using the environment variant $env_name, or the --jar command line parameter." + exit $EX_NOINPUT + fi +} +gridss_jar=$(find_jar GRIDSS_JAR gridss) +write_status "Using GRIDSS jar $gridss_jar" + +# Check all key inputs: + +if [[ "$labels" == "" ]] ; then + write_status "Labels must be specified" + exit $EX_USAGE +fi + +if [[ "$bams" == "" ]] ; then + write_status "Full BAMs must be specified" + exit $EX_USAGE +fi + +if [[ "$filtered_bams" == "" ]] ; then + write_status "Filtered BAMs must be specified" + exit $EX_USAGE +fi + +##### --reference +if [[ "$reference" == "" ]] ; then + write_status "$USAGE_MESSAGE" + write_status "Reference genome must be specified. Specify using the --reference command line argument" + exit $EX_USAGE +fi + +if [ ! -f $reference ] ; then + write_status "$USAGE_MESSAGE" + write_status "Missing reference genome $reference. Specify reference location using the --reference command line argument" + exit $EX_USAGE +fi +write_status "Using reference genome \"$reference\"" + +##### --output +if [[ $do_call == "true" ]] ; then + if [[ "$output_vcf" == "" ]] ; then + write_status "$USAGE_MESSAGE" + write_status "Output VCF not specified. Use --output to specify output file." + exit $EX_USAGE + fi + mkdir -p $(dirname $output_vcf) + if [[ ! -d $(dirname $output_vcf) ]] ; then + write_status "Unable to create directory for $output_vcf for output VCF." + exit $EX_CANTCREAT + fi + write_status "Using output VCF $output_vcf" +fi + +##### --assembly +if [[ $do_assemble == "true" ]] || [[ $do_call == "true" ]]; then + if [[ "$assembly" == "" ]] ; then + if [[ "$output_vcf" == "" ]] ; then + write_status "Either the assembly output file must explicitly specified with -a, or the output VCF specified with -o" + exit $EX_USAGE + fi + assembly=$output_vcf.assembly.bam + fi + write_status "Using assembly bam $assembly" + if [[ $do_assemble == "true" ]] ; then + mkdir -p $(dirname $assembly) + if [[ ! -d $(dirname $assembly) ]] ; then + write_status "Unable to parent create directory for $assembly" + exit $EX_CANTCREAT + fi + else + if [[ ! -f $assembly ]] ; then + write_status "Missing assembly file $assembly" + write_status "Ensure the GRIDSS assembly step has been run" + exit $EX_NOINPUT + fi + fi +fi + +##### --threads +if [[ "$threads" -lt 1 ]] ; then + write_status "$USAGE_MESSAGE" + write_status "Illegal thread count: $threads. Specify an integer thread count using the --threads command line argument" + exit $EX_USAGE +fi +if [[ "$threads" -gt 8 ]] ; then + write_status "WARNING: GRIDSS scales sub-linearly at high thread count. Up to 8 threads is the recommended level of parallelism." +fi +write_status "Using $threads worker threads." + +if [[ "$blacklist" == "" ]] ; then + blacklist_arg="" + write_status "Using no blacklist bed. The encode DAC blacklist is recommended for hg19." +elif [[ ! -f $blacklist ]] ; then + write_status "$USAGE_MESSAGE" + write_status "Missing blacklist file $blacklist" + exit $EX_NOINPUT +else + blacklist_arg="BLACKLIST=$blacklist" + write_status "Using blacklist $blacklist" + if [[ "$(tr -d ' \n' <<< "$blacklist_arg")" != "$blacklist_arg" ]] ; then + write_status "blacklist cannot contain whitespace" + exit $EX_USAGE + fi +fi + +if [[ "$jvmheap" == "" ]] ; then + if [[ $threads -gt 8 ]] ; then + write_status "Warning: GRIDSS assembly may stall and run out of memory. with $threads and $jvmheap heap size." + fi +fi + +write_status "Using JVM maximum heap size of $jvmheap for assembly and variant calling." + +config_args="" +if [[ "$config_file" != "" ]] ; then + if [[ ! -f $config_file ]] ; then + write_status "Configuration file $config_file does not exist" + exit $EX_NOINPUT + fi + config_args="CONFIGURATION_FILE=$config_file" +fi + +input_args="" +input_filtered_args="" + +# no longer read in the BAM file list from the end of the arguments list + +nows_labels=$(tr -d ' \n' <<< "$labels") +if [[ "$nows_labels" != "$labels" ]] ; then + write_status "input labels cannot contain whitespace" + exit $EX_USAGE +fi +IFS=',' read -ra LABEL_ARRAY <<< "$nows_labels" +label_count=${#LABEL_ARRAY[@]} + +for label in "${LABEL_ARRAY[@]}" ; do + input_args="$input_args INPUT_LABEL=$label" + input_filtered_args="$input_filtered_args INPUT_LABEL=$label" + #write_status "label is $label" +done + +nows_bams=$(tr -d ' \n' <<< "$bams") +if [[ "$nows_bams" != "$bams" ]] ; then + write_status "input filtered BAMs cannot contain whitespace" + exit $EX_USAGE +fi +IFS=',' read -ra BAM_ARRAY <<< "$nows_bams" +for bam_file in "${BAM_ARRAY[@]}" ; do + + if [[ "$(basename $bam_file)" == "$(basename $assembly)" ]] ; then + write_status "assembly and input filtered bam files must have different filenames" + exit $EX_USAGE + fi + + input_args="$input_args INPUT=$bam_file" + # write_status "full bam file is $bam_file" +done + +nows_bams=$(tr -d ' \n' <<< "$filtered_bams") +if [[ "$nows_bams" != "$filtered_bams" ]] ; then + write_status "input filtered BAMs cannot contain whitespace" + exit $EX_USAGE +fi +IFS=',' read -ra FILT_BAM_ARRAY <<< "$nows_bams" +for filtered_bam_file in "${FILT_BAM_ARRAY[@]}" ; do + + if [[ "$(basename $filtered_bam_file)" == "$(basename $assembly)" ]] ; then + write_status "assembly and input filtered bam files must have different filenames" + exit $EX_USAGE + fi + + input_filtered_args="$input_filtered_args INPUT=$filtered_bam_file" + # write_status "filtered bam file is $filtered_bam_file" +done + +for (( i=0; i < $label_count; ++i )) +do + write_status "Label $i: name=${LABEL_ARRAY[$i]} full-bam=${BAM_ARRAY[$i]} filtered-bam=${FILT_BAM_ARRAY[$i]}" +done + +write_status "Full BAM args: $input_args" +write_status "Filtered BAM args: $input_filtered_args" + + +# Validate tools exist on path +for tool in Rscript samtools java bwa ; do #minimap2 + if ! which $tool >/dev/null; then + write_status "Error: unable to find $tool on \$PATH" + exit $EX_CONFIG + fi + write_status "Found $(which $tool)" +done +if $(samtools --version-only >/dev/null) ; then + write_status "samtools version: $(samtools --version-only 2>&1)" +else + write_status "Your samtools version does not support --version-only. Update samtools." + exit $EX_CONFIG +fi +if [[ "$(samtools --version-only)" =~ ^([0-9]+)[.]([0-9]+) ]] ; then + samtools_major_version=${BASH_REMATCH[1]} + samtools_minor_version=${BASH_REMATCH[2]} + if [[ "$samtools_major_version" -le 1 ]] && [[ "$samtools_minor_version" -lt 10 ]] ; then + write_status "samtools 1.13 or later is required." + exit $EX_CONFIG + fi +else + write_status "Unable to determine samtools version" + exit $EX_CONFIG +fi + +# write_status "R version: $(Rscript --version 2>&1)" + +write_status "bwa $(bwa 2>&1 | grep Version || echo -n)" + +if [[ "$timecmd" != "" ]] ; then + if which /usr/bin/time >/dev/null ; then + write_status "time version: $(/usr/bin/time --version 2>&1)" + fi +fi +write_status "bash version: $(/bin/bash --version 2>&1 | head -1)" + +# check java version is ok using the gridss.Echo entry point +if java -cp $gridss_jar gridss.Echo ; then + write_status "java version: $(java -version 2>&1 | tr '\n' '\t')" +else + write_status "Unable to run GRIDSS jar - requires java 1.8 or later" + write_status "java version: $(java -version 2>&1)" + exit $EX_CONFIG +fi + +if ! java -Xms$jvmheap -cp $gridss_jar gridss.Echo ; then + write_status "Failure invoking java with --jvmheap parameter of \"$jvmheap\". Specify a JVM heap size (e.g. \"31g\") that is valid for this machine." + exit 1 +fi + +write_status "Max file handles: $(ulimit -n)" 1>&2 + +steps_message="Running GRIDSS steps:" + +for step in $(echo $steps | tr ',' ' ' ) ; do + if [[ "$step" == "all" ]] ; then + do_preprocess=true + do_assemble=true + do_call=true + steps_message="$steps_message all" + elif [[ "$step" == "preprocess" ]] ; then + do_preprocess=true + steps_message="$steps_message pre-process" + elif [[ "$step" == "assemble" ]] ; then + do_assemble=true + steps_message="$steps_message assembly" + elif [[ "$step" == "call" ]] ; then + do_call=true + steps_message="$steps_message call" + else + write_status "Unknown step \"$step\"" + exit $EX_USAGE + fi +done + +write_status "$steps_message" + +# don't keep files +if [[ $keepTempFiles == "true" ]] ; then + rmcmd="echo rm disabled:" + jvm_args="-Dgridss.keepTempFiles=true" +else + rmcmd="rm" + jvm_args="" +fi + +jvm_args="$jvm_args \ + -XX:ParallelGCThreads=$threads \ + -Dsamjdk.reference_fasta=$reference \ + -Dsamjdk.use_async_io_read_samtools=true \ + -Dsamjdk.use_async_io_write_samtools=true \ + -Dsamjdk.use_async_io_write_tribble=true \ + -Dsamjdk.buffer_size=4194304 \ + -Dsamjdk.async_io_read_threads=$threads" + +aligner_args=' + ALIGNER_COMMAND_LINE=null + ALIGNER_COMMAND_LINE=bwa + ALIGNER_COMMAND_LINE=mem + ALIGNER_COMMAND_LINE=-K + ALIGNER_COMMAND_LINE=10000000 + ALIGNER_COMMAND_LINE=-L + ALIGNER_COMMAND_LINE=0,0 + ALIGNER_COMMAND_LINE=-t + ALIGNER_COMMAND_LINE=%3$d + ALIGNER_COMMAND_LINE=%2$s + ALIGNER_COMMAND_LINE=%1$s' + +samtools_sort="samtools sort --no-PG -@ $threads" + +readpairing_args="READ_PAIR_CONCORDANT_PERCENT=null" + + +# set-up reference has been removed since can assume to exist + +#### +# Pre-process for each filtered BAM file +#### + +if [[ $do_preprocess == true ]] ; then + write_status "*** PRE-PROCESS ***" + + for (( i=0; i < $label_count; ++i )) + do + label=${LABEL_ARRAY[$i]} + bam_file=${FILT_BAM_ARRAY[$i]} + write_status "Processing: sample ${LABEL_ARRAY[$i]}, filtered-bam ${FILT_BAM_ARRAY[$i]}" + + dir=$workingdir/$(basename $bam_file).gridss.working + prefix=$dir/$(basename $bam_file) + write_status "Start pre-processing: $bam_file, working dir: $dir, prefix: $prefix" + + tmp_prefix=$workingdir/$(basename $bam_file).gridss.working/tmp.$(basename $bam_file) + mkdir -p $dir + if [[ ! -d $dir ]] ; then + write_status "Unable to create directory $dir" + exit $EX_CANTCREAT + fi + + name_sorted_bam=$tmp_prefix.namedsorted.bam + write_status "Creating name-sorted BAM from $bam_file, writing to $name_sorted_bam" + + $timecmd $samtools_sort -l 1 -n \ + -T $tmp_prefix.namedsorted-tmp \ + -Obam \ + -o ${name_sorted_bam} \ + ${bam_file} + + write_status "Running ComputeSamTags|samtools: $bam_file" + + rm -f $tmp_prefix.coordinate-tmp* + + { $timecmd java -Xmx$otherjvmheap $jvm_args \ + -cp $gridss_jar gridss.ComputeSamTags \ + TMP_DIR=$dir \ + WORKING_DIR=$workingdir \ + REFERENCE_SEQUENCE=$reference \ + COMPRESSION_LEVEL=0 \ + I=$name_sorted_bam \ + O=/dev/stdout \ + WORKER_THREADS=$threads \ + ASSUME_SORTED=true \ + REMOVE_TAGS=aa \ + MODIFICATION_SUMMARY_FILE=$prefix.computesamtags.changes.tsv \ + | $timecmd $samtools_sort \ + -l 1 \ + -T $tmp_prefix.coordinate-tmp \ + -Obam \ + -o $tmp_prefix.coordinate.bam \ + /dev/stdin \ + ; } 1>&2 2>> $logfile + + write_status "Removing name-sorted bam: $tmp_prefix.namedsorted.bam" + $rmcmd $tmp_prefix.namedsorted.bam + + write_status "Running SoftClipsToSplitReads: sample $label, input: $tmp_prefix.coordinate.bam, output: $tmp_prefix.sc2sr.primary.sv.bam" + rm -f $tmp_prefix.sc2sr.suppsorted.sv-tmp* + { $timecmd java -Xmx$otherjvmheap $jvm_args \ + -Dsamjdk.create_index=false \ + -cp $gridss_jar gridss.SoftClipsToSplitReads \ + TMP_DIR=$workingdir \ + WORKING_DIR=$workingdir \ + REFERENCE_SEQUENCE=$reference \ + I=$tmp_prefix.coordinate.bam \ + O=$tmp_prefix.sc2sr.primary.sv.bam \ + COMPRESSION_LEVEL=1 \ + OUTPUT_UNORDERED_RECORDS=$tmp_prefix.sc2sr.supp.sv.bam \ + WORKER_THREADS=$threads \ + $aligner_args \ + && $rmcmd $tmp_prefix.coordinate.bam \ + && $timecmd $samtools_sort \ + -l 1 \ + -T $tmp_prefix.sc2sr.suppsorted.sv-tmp \ + -Obam \ + -o $tmp_prefix.sc2sr.suppsorted.sv.bam \ + $tmp_prefix.sc2sr.supp.sv.bam \ + && $rmcmd $tmp_prefix.sc2sr.supp.sv.bam \ + && $rmcmd -f $prefix.sv.tmp.bam $prefix.sv.tmp.bam.bai \ + && $timecmd samtools merge \ + -c \ + -p \ + --write-index \ + -@ $threads \ + $prefix.sv.tmp.bam \ + $tmp_prefix.sc2sr.primary.sv.bam \ + $tmp_prefix.sc2sr.suppsorted.sv.bam \ + && $rmcmd $tmp_prefix.sc2sr.primary.sv.bam \ + && $rmcmd $tmp_prefix.sc2sr.suppsorted.sv.bam \ + && mv $prefix.sv.tmp.bam $prefix.sv.bam \ + && mv $prefix.sv.tmp.bam.csi $prefix.sv.bam.csi \ + ; } 1>&2 2>> $logfile + + write_status "Produced SV bam:: $prefix.sv.bam" + + # create metrics on the full BAM and then copy these over the metrics made from the filtered BAMs + full_bam_file=${BAM_ARRAY[$i]} + write_status "Running CollectGridssMetrics on $label full BAM $full_bam_file" + + # test_prefix=$prefix.cp + + { $timecmd java -Xmx$otherjvmheap $jvm_args \ + -cp $gridss_jar gridss.analysis.CollectGridssMetrics \ + REFERENCE_SEQUENCE=$reference \ + TMP_DIR=$dir \ + ASSUME_SORTED=true \ + I=$full_bam_file \ + O=$prefix \ + THRESHOLD_COVERAGE=$maxcoverage \ + FILE_EXTENSION=null \ + GRIDSS_PROGRAM=null \ + GRIDSS_PROGRAM=CollectCigarMetrics \ + GRIDSS_PROGRAM=CollectMapqMetrics \ + GRIDSS_PROGRAM=CollectTagMetrics \ + GRIDSS_PROGRAM=CollectIdsvMetrics \ + PROGRAM=null \ + PROGRAM=CollectInsertSizeMetrics \ + STOP_AFTER=$metricsrecords \ + ; } 1>&2 2>> $logfile + + write_status "Complete pre-processing sample: $label" + done + + write_status "*** PRE-PROCESS COMPLETE ***" +fi + +##### +# ASSEMBLY +#### + +assembly_args="ASSEMBLY=$assembly" + +if [[ $do_assemble == true ]] ; then + + write_status "*** ASSEMBLY ***" + write_status "Running AssembleBreakends: writing output to dir $assembly" + { $timecmd java -Xmx$jvmheap $jvm_args \ + -Dgridss.output_to_temp_file=true \ + -cp $gridss_jar gridss.AssembleBreakends \ + JOB_INDEX=0 \ + JOB_NODES=1 \ + TMP_DIR=$workingdir \ + WORKING_DIR=$workingdir \ + REFERENCE_SEQUENCE=$reference \ + WORKER_THREADS=$threads \ + $input_filtered_args \ + $blacklist_arg \ + $config_args \ + $readpairing_args \ + O=$assembly \ + ; } 1>&2 2>> $logfile + + write_status "AssemblyBreakends complete" + + dir=$workingdir/$(basename $assembly).gridss.working/ + prefix=$dir/$(basename $assembly) + tmp_prefix=$dir/tmp.$(basename $assembly) + + write_status "RunningSoftClipsToSplitReads: running on assembly output dir $assembly" + rm -f $tmp_prefix.sc2sr.suppsorted.sv-tmp* + { $timecmd java -Xmx$otherjvmheap $jvm_args \ + -Dgridss.async.buffersize=16 \ + -Dsamjdk.create_index=false \ + -Dgridss.output_to_temp_file=true \ + -cp $gridss_jar gridss.SoftClipsToSplitReads \ + TMP_DIR=$dir \ + WORKING_DIR=$workingdir \ + REFERENCE_SEQUENCE=$reference \ + WORKER_THREADS=$threads \ + I=$assembly \ + O=$tmp_prefix.sc2sr.primary.sv.bam \ + OUTPUT_UNORDERED_RECORDS=$tmp_prefix.sc2sr.supp.sv.bam \ + REALIGN_ENTIRE_READ=true \ + READJUST_PRIMARY_ALIGNMENT_POSITION=true \ + $aligner_args \ + && $timecmd $samtools_sort \ + -T $tmp_prefix.sc2sr.suppsorted.sv-tmp \ + -Obam \ + -o $tmp_prefix.sc2sr.suppsorted.sv.bam \ + $tmp_prefix.sc2sr.supp.sv.bam \ + && $rmcmd $tmp_prefix.sc2sr.supp.sv.bam \ + && $rmcmd -f $prefix.sv.tmp.bam $prefix.sv.tmp.bam.bai \ + && $timecmd samtools merge \ + -c \ + -p \ + -@ $threads \ + $prefix.sv.tmp.bam \ + $tmp_prefix.sc2sr.primary.sv.bam \ + $tmp_prefix.sc2sr.suppsorted.sv.bam \ + && $timecmd samtools index $prefix.sv.tmp.bam \ + && $rmcmd $tmp_prefix.sc2sr.primary.sv.bam \ + && $rmcmd $tmp_prefix.sc2sr.suppsorted.sv.bam \ + && mv $prefix.sv.tmp.bam $prefix.sv.bam \ + && mv $prefix.sv.tmp.bam.bai $prefix.sv.bam.bai \ + ; } 1>&2 2>> $logfile + + write_status "Produced assembly BAM: $prefix.sv.bam" + + write_status "Complete Assembly" + + # no idea why this is a for loop, could just be: ASSEMBLY=$assembly + #assembly_args="" + #for ass in $assembly ; do + # assembly_args="$assembly_args ASSEMBLY=$ass" + #done + write_status "Assembly args: $assembly_args" + + write_status "*** ASSEMBLY COMPLETE ***" +fi + +#### +# VARIANT CALLING +#### + +if [[ $do_call == true ]] ; then + write_status "*** VARIANT CALLING ***" + + write_status "Creating variant VCF: $output_vcf" + + dir=$workingdir/$(basename $output_vcf).gridss.working + prefix=$dir/$(basename $output_vcf) + mkdir -p $dir + if [[ ! -d $dir ]] ; then + write_status "Unable to create directory $dir" + exit $EX_CANTCREAT + fi + + # create symbolic links to the full BAM as though they were produced by the pre-process step + # eg: ./gridss_02/COLO829R.bam.gridss.working/COLO829R.bam.sv.bam + for (( i=0; i < $label_count; ++i )) + do + bam_file=${BAM_ARRAY[$i]} + bam_dir=$workingdir/$(basename $bam_file).gridss.working + + if [[ ! -d $bam_dir ]] ; then + mkdir -p $bam_dir + fi + + sv_bam_file=$bam_dir/$(basename $bam_file).sv.bam + # write_status "Making soft-link to ${sv_bam_file}" + #ln -sfr ${bam_file} ${sv_bam_file} + #ln -sfr ${bam_file}.bai ${sv_bam_file}.bai + done + + write_status "Running IdentifyVariants" + { $timecmd java -Xmx$jvmheap $jvm_args \ + -Dgridss.output_to_temp_file=true \ + -cp $gridss_jar gridss.IdentifyVariants \ + TMP_DIR=$workingdir \ + WORKING_DIR=$workingdir \ + REFERENCE_SEQUENCE=$reference \ + WORKER_THREADS=$threads \ + $input_filtered_args \ + $blacklist_arg \ + $config_args \ + $assembly_args \ + OUTPUT_VCF=$prefix.unallocated.vcf \ + $readpairing_args \ + ; } 1>&2 2>> $logfile + write_status "IdentifyVariants complete, produced $prefix.unallocated.vcf" + + write_status "Running AnnotateVariants" + { $timecmd java -Xmx$jvmheap $jvm_args \ + -Dgridss.output_to_temp_file=true \ + -Dgridss.async.buffersize=2048 \ + -cp $gridss_jar gridss.AnnotateVariants \ + TMP_DIR=$workingdir \ + WORKING_DIR=$workingdir \ + REFERENCE_SEQUENCE=$reference \ + WORKER_THREADS=$threads \ + $input_filtered_args \ + $blacklist_arg \ + $config_args \ + $assembly_args \ + INPUT_VCF=$prefix.unallocated.vcf \ + OUTPUT_VCF=$prefix.allocated.vcf \ + $readpairing_args \ + ; } 1>&2 2>> $logfile + $rmcmd $prefix.unallocated.vcf + write_status "AnnotateVariants complete, produced $prefix.allocated.vcf" + + write_status "Running AnnotateInsertedSequence" + + { $timecmd java -Xmx$otherjvmheap $jvm_args \ + -Dgridss.output_to_temp_file=true \ + -cp $gridss_jar gridss.AnnotateInsertedSequence \ + TMP_DIR=$workingdir \ + WORKING_DIR=$workingdir \ + REFERENCE_SEQUENCE=$reference \ + WORKER_THREADS=$threads \ + INPUT=$prefix.allocated.vcf \ + OUTPUT=$output_vcf \ + && $rmcmd $prefix.allocated.vcf \ + ; } 1>&2 2>> $logfile + write_status "AnnotateInsertedSequence complete, produced $output_vcf" + + write_status "*** VARIANT CALLING COMPLETE ***" +fi + +if [[ -f $logfile ]] ; then + write_status "Run complete with $(grep WARNING $logfile | wc -l) warnings and $(grep ERROR $logfile | wc -l) errors." +fi +trap - EXIT +exit 0 # success! diff --git a/recipes/hmftools-sv-prep/meta.yaml b/recipes/hmftools-sv-prep/meta.yaml index c81ed9c3f6a43..17301d9a6a0ec 100644 --- a/recipes/hmftools-sv-prep/meta.yaml +++ b/recipes/hmftools-sv-prep/meta.yaml @@ -1,27 +1,29 @@ -{% set version = "1.1" %} -{% set sha256 = "e7487a16c609ad4d9f3b2d29ebada02b04fbd3bef3dacd26f228bb1928d5606e" %} +{% set version = "1.2.3" %} +{% set sha256 = "8f42be297e1ece6d070324f8b12b0a30106291731ac89f5d3c0fc2d82fd887ab" %} package: name: hmftools-sv-prep version: '{{ version }}' source: - url: 'https://github.com/hartwigmedical/hmftools/releases/download/sv-prep-v{{ version }}/sv-prep_v{{ version }}.jar' + url: https://github.com/hartwigmedical/hmftools/releases/download/sv-prep-v{{ version }}/sv-prep_v{{ version }}.jar sha256: '{{ sha256 }}' build: noarch: generic number: 1 + run_exports: + - {{ pin_subpackage('hmftools-sv-prep', max_pin="x") }} requirements: run: - zlib - openjdk >=8 - - samtools + - gridss =2.13.2=h50ea8bc_3 test: commands: - - 'SvPrep 2>&1 | grep -q "SvPrep version"' + - 'svprep -version | grep SvPrep' about: home: https://github.com/hartwigmedical/hmftools/tree/master/sv-prep diff --git a/recipes/hmftools-sv-prep/SvPrep.sh b/recipes/hmftools-sv-prep/svprep.sh similarity index 98% rename from recipes/hmftools-sv-prep/SvPrep.sh rename to recipes/hmftools-sv-prep/svprep.sh index 053fdd8f1f5e2..6cd23a12769db 100755 --- a/recipes/hmftools-sv-prep/SvPrep.sh +++ b/recipes/hmftools-sv-prep/svprep.sh @@ -60,7 +60,7 @@ if [ "$jvm_mem_opts" == "" ]; then fi pass_arr=($pass_args) -if [[ ${pass_arr[0]:=} == org* ]] +if [[ ${pass_arr[0]:=} == com.hartwig.* ]] then eval "$java" $jvm_mem_opts $jvm_prop_opts -cp "$JAR_DIR/sv-prep.jar" $pass_args else diff --git a/recipes/hmftools-virus-interpreter/build.sh b/recipes/hmftools-virus-interpreter/build.sh new file mode 100644 index 0000000000000..9016c03d49166 --- /dev/null +++ b/recipes/hmftools-virus-interpreter/build.sh @@ -0,0 +1,12 @@ +#!/bin/bash + +TGT="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" +[ -d "$TGT" ] || mkdir -p "$TGT" +[ -d "${PREFIX}/bin" ] || mkdir -p "${PREFIX}/bin" + +cd "${SRC_DIR}" +mv virus-interpreter*.jar $TGT/virusinterpreter.jar + +cp $RECIPE_DIR/virusinterpreter.sh $TGT/virusinterpreter +ln -s $TGT/virusinterpreter $PREFIX/bin +chmod 0755 "${PREFIX}/bin/virusinterpreter" diff --git a/recipes/hmftools-virus-interpreter/meta.yaml b/recipes/hmftools-virus-interpreter/meta.yaml new file mode 100644 index 0000000000000..d667dc1e799d2 --- /dev/null +++ b/recipes/hmftools-virus-interpreter/meta.yaml @@ -0,0 +1,30 @@ +{% set version = "1.3" %} +{% set sha256 = "b2abfcd2526e0de335455fa687fae0bfeda2f9358c53c7aa0a07bb765ea50545" %} + +package: + name: hmftools-virus-interpreter + version: '{{ version }}' + +source: + url: https://github.com/hartwigmedical/hmftools/releases/download/virus-interpreter-v{{ version }}/virus-interpreter_v{{ version }}.jar + sha256: '{{ sha256 }}' + +build: + noarch: generic + number: 0 + run_exports: + - {{ pin_subpackage("hmftools-virus-interpreter", max_pin="x.x") }} + +requirements: + run: + - openjdk >=8 + +test: + commands: + - 'virusinterpreter | grep "Virus Interpreter"' + +about: + home: https://github.com/hartwigmedical/hmftools/blob/master/virus-interpreter/README.md + license: GPL-3.0-only + license_family: GPL3 + summary: Post-process VIRUSBreakend summary results. diff --git a/recipes/hmftools-virus-interpreter/virusinterpreter.sh b/recipes/hmftools-virus-interpreter/virusinterpreter.sh new file mode 100755 index 0000000000000..7ee6eced678ff --- /dev/null +++ b/recipes/hmftools-virus-interpreter/virusinterpreter.sh @@ -0,0 +1,69 @@ +#!/bin/bash +# hmftools Virus Interpreter executable shell script +# https://github.com/hartwigmedical/hmftools/tree/master/virus-interpreter +set -eu -o pipefail + +export LC_ALL=en_US.UTF-8 + +# Find original directory of bash script, resolving symlinks +# http://stackoverflow.com/questions/59895/can-a-bash-script-tell-what-directory-its-stored-in/246128#246128 +SOURCE="${BASH_SOURCE[0]}" +while [ -h "$SOURCE" ]; do # resolve $SOURCE until the file is no longer a symlink + DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + SOURCE="$(readlink "$SOURCE")" + [[ $SOURCE != /* ]] && SOURCE="$DIR/$SOURCE" # if $SOURCE was a relative symlink, we need to resolve it relative to the path where the symlink file was located +done +DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + +JAR_DIR=$DIR +ENV_PREFIX="$(dirname $(dirname $DIR))" +# Use Java installed with Anaconda to ensure correct version +java="$ENV_PREFIX/bin/java" + +# if JAVA_HOME is set (non-empty), use it. Otherwise keep "java" +if [ -n "${JAVA_HOME:=}" ]; then + if [ -e "$JAVA_HOME/bin/java" ]; then + java="$JAVA_HOME/bin/java" + fi +fi + +# extract memory and system property Java arguments from the list of provided arguments +# http://java.dzone.com/articles/better-java-shell-script +default_jvm_mem_opts="-Xms512m -Xmx1g" +jvm_mem_opts="" +jvm_prop_opts="" +pass_args="" +for arg in "$@"; do + case $arg in + '-D'*) + jvm_prop_opts="$jvm_prop_opts $arg" + ;; + '-XX'*) + jvm_prop_opts="$jvm_prop_opts $arg" + ;; + '-Xm'*) + jvm_mem_opts="$jvm_mem_opts $arg" + ;; + *) + if [[ ${pass_args} == '' ]] #needed to avoid preceeding space on first arg e.g. ' MarkDuplicates' + then + pass_args="$arg" + else + pass_args="$pass_args \"$arg\"" #quotes later arguments to avoid problem with ()s in MarkDuplicates regex arg + fi + ;; + esac +done + +if [ "$jvm_mem_opts" == "" ]; then + jvm_mem_opts="$default_jvm_mem_opts" +fi + +pass_arr=($pass_args) +if [[ ${pass_arr[0]:=} == org* ]] +then + eval "$java" $jvm_mem_opts $jvm_prop_opts -cp "$JAR_DIR/virusinterpreter.jar" $pass_args +else + eval "$java" $jvm_mem_opts $jvm_prop_opts -jar "$JAR_DIR/virusinterpreter.jar" $pass_args +fi +exit diff --git a/recipes/hmmcopy/build.sh b/recipes/hmmcopy/build.sh index 221ea7f18365c..2e2b0710805e5 100644 --- a/recipes/hmmcopy/build.sh +++ b/recipes/hmmcopy/build.sh @@ -1,4 +1,4 @@ -#!/bin/bash +#!/usr/bin/env bash # Source archive contains some macOS junk files, # which prevent hoisting the HMMcopy on Linux only. diff --git a/recipes/hmmcopy/meta.yaml b/recipes/hmmcopy/meta.yaml index 950876a55c956..bf1639367da71 100644 --- a/recipes/hmmcopy/meta.yaml +++ b/recipes/hmmcopy/meta.yaml @@ -7,7 +7,9 @@ source: md5: 205a719e7ac9b9f9ba811cdd7cbdae0a build: - number: 9 + number: 10 + run_exports: + - {{ pin_subpackage("hmmcopy", max_pin="x.x") }} requirements: build: @@ -31,3 +33,7 @@ about: home: http://compbio.bccrc.ca/software/hmmcopy/ license: GPL-3 summary: C++ based programs for analyzing BAM files and preparing read counts -- used with bioconductor-hmmcopy + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/hmmer/meta.yaml b/recipes/hmmer/meta.yaml index f6561a1f17117..a5b3120a4bd0d 100644 --- a/recipes/hmmer/meta.yaml +++ b/recipes/hmmer/meta.yaml @@ -7,7 +7,7 @@ source: sha256: ca70d94fd0cf271bd7063423aabb116d42de533117343a9b27a65c17ff06fbf3 build: - number: 0 + number: 1 run_exports: # commands/options have been removed or replaced between minor versions - {{ pin_subpackage('hmmer', max_pin="x.x") }} @@ -43,3 +43,7 @@ about: home: http://hmmer.org/ license: BSD license_file: LICENSE + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/homer/meta.yaml b/recipes/homer/meta.yaml index a02b6c48e4c32..78bc32e2c14c1 100644 --- a/recipes/homer/meta.yaml +++ b/recipes/homer/meta.yaml @@ -16,10 +16,11 @@ source: - configureHomer.patch build: - number: 8 + number: 9 # Ships pre-built binaries that install_name_tool isn't able to fix. skip: True # [osx] - + run_exports: + - {{ pin_subpackage('homer', max_pin="x") }} # Dependencies according to http://homer.ucsd.edu/homer/introduction/install.html requirements: @@ -52,3 +53,6 @@ about: summary: 'Software for motif discovery and next generation sequencing analysis' maintainer: BioNinja, cokelaer, simonvh, r78v10a07 +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/hostile/meta.yaml b/recipes/hostile/meta.yaml index 4f8c76370bf62..59824376f57ac 100644 --- a/recipes/hostile/meta.yaml +++ b/recipes/hostile/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.4.0" %} +{% set version = "1.1.0" %} package: name: hostile @@ -6,7 +6,7 @@ package: source: url: https://pypi.io/packages/source/h/hostile/hostile-{{ version }}.tar.gz - sha256: dd003b09a7f17a8fc126bc81c2b402d1ab5946916f1f55dbcffa4c9c3014a56a + sha256: eee390f97ac9f669f10792a3fb487d92b9cec518c0b072338b3654a162965e2e build: noarch: python @@ -25,6 +25,7 @@ requirements: run: - bowtie2 ==2.4.5 - defopt >=6.4.0 + - dnaio >=1.2.0 - gawk >=5.1.0 - httpx >=0.24.1 - minimap2 >=2.26 @@ -50,4 +51,4 @@ about: extra: identifiers: - - doi:10.1101/2023.07.04.547735 + - doi:10.1093/bioinformatics/btad728 diff --git a/recipes/htseq/meta.yaml b/recipes/htseq/meta.yaml index a68cff9aff26b..712c394b285fb 100644 --- a/recipes/htseq/meta.yaml +++ b/recipes/htseq/meta.yaml @@ -1,17 +1,18 @@ -{% set version = '2.0.4' %} +{% set name = "HTSeq" %} +{% set version = "2.0.5" %} +{% set sha256 = "2519675246dd1639115a76c9aacf19ab5bc5bed2f3598bf89cd97be5c0d066b3" %} package: - name: htseq + name: {{ name|lower }} version: {{ version }} source: - url: https://files.pythonhosted.org/packages/ed/ca/6f1e2f556cb2aad34ea8481f41a5a16dc52bef2e4fa55e7107b0b8e6bfe5/HTSeq-{{ version }}.tar.gz - sha256: 5510d855617d61efff2287af4cdc60a73e94bd735e44c15b57f189ea0634e6e0 + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: {{ sha256 }} build: - number: 0 - skip: True # [py2k or py == 36] - script: "{{ PYTHON }} -m pip install . --ignore-installed --no-deps -vv" + number: 1 + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation run_exports: - {{ pin_subpackage('htseq', max_pin="x") }} @@ -25,6 +26,7 @@ requirements: - pip - cython - numpy + - wheel - pysam >=0.15.1 - swig >=3.0.8 run: @@ -32,6 +34,8 @@ requirements: - {{ pin_compatible('numpy') }} - matplotlib-base >=1.4 - pysam >=0.15.1 + - scipy >=1.5.0 + - pandas >=1.1.0 test: # Python imports @@ -53,6 +57,8 @@ about: summary: 'HTSeq is a Python library to facilitate processing and analysis of data from high-throughput sequencing (HTS) experiments.' extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:htseq - usegalaxy-eu:htseq_count diff --git a/recipes/htsinfer/meta.yaml b/recipes/htsinfer/meta.yaml index a88775a875d23..b853db128b352 100644 --- a/recipes/htsinfer/meta.yaml +++ b/recipes/htsinfer/meta.yaml @@ -1,16 +1,16 @@ {% set name = "HTSinfer" %} -{% set version = "0.9.0" %} +{% set version = "0.11.0" %} package: name: "{{ name|lower }}" version: "{{ version }}" source: - url: https://github.com/zavolanlab/htsinfer/archive/refs/tags/v0.9.0.tar.gz - sha256: f4708d43e56389240752e45ac3f4cdcb620ab3783b57ff068599eec0adbd91f3 + url: https://github.com/zavolanlab/htsinfer/archive/refs/tags/v0.11.0.tar.gz + sha256: f7225290e12bf129bdb654f06f1cb98da577be81d35f7d17844447fcdf058618 build: - number: 0 + number: 1 noarch: python entry_points: - htsinfer = htsinfer.cli:main @@ -26,7 +26,7 @@ requirements: - numpy >=1.22, <1.25 - pandas >=1.3.5, <1.4.0 - biopython >=1.78 - - pydantic >=1.8.1, <2 + - pydantic >=2, <3 - pysam >=0.16.0 - pyahocorasick >=1.4.0 run: @@ -36,7 +36,7 @@ requirements: - numpy >=1.22, <1.25 - pandas >=1.3.5, <1.4.0 - pyahocorasick >=1.4.0 - - pydantic >=1.8.1, <2 + - pydantic >=2, <3 - pysam >=0.16.0 - python >=3.8, <=3.10 - star >=2.7.6 @@ -54,4 +54,4 @@ about: extra: recipe-maintainers: - - balajtimate \ No newline at end of file + - balajtimate diff --git a/recipes/htslib/arm_hwcap.patch b/recipes/htslib/arm_hwcap.patch new file mode 100644 index 0000000000000..40733dcc33b1d --- /dev/null +++ b/recipes/htslib/arm_hwcap.patch @@ -0,0 +1,15 @@ +Conda-forge's build environment on ARM uses sysroot_linux-aarch64 2.17, which +is based on glibc 2.17 so does not define HWCAP_* values on ARM. +Work around this by including the kernel header to get the desired values. + +--- a/htscodecs/htscodecs/rANS_static4x16pr.c 2023-10-10 02:54:16 ++++ b/htscodecs/htscodecs/rANS_static4x16pr.c 2024-03-06 00:01:14 +@@ -1030,6 +1030,8 @@ + + #if defined(__linux__) || defined(__FreeBSD__) + #include ++// Ensure ARM HWCAP_* values are defined even on old glibc ++#include + #elif defined(_WIN32) + #include + #endif diff --git a/recipes/htslib/meta.yaml b/recipes/htslib/meta.yaml index de1440505082b..0ed226673ba88 100644 --- a/recipes/htslib/meta.yaml +++ b/recipes/htslib/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.19" %} +{% set version = "1.20" %} package: name: htslib @@ -11,7 +11,9 @@ build: source: url: https://github.com/samtools/htslib/releases/download/{{ version }}/htslib-{{ version }}.tar.bz2 - sha256: 8751c40c4fa7d1f23a6864c5b20a73744f8be68239535ae7729c5f7d394d0736 + sha256: e52d95b14da68e0cfd7d27faf56fef2f88c2eaf32a2be51c72e146e3aa928544 + patches: + - arm_hwcap.patch requirements: build: @@ -40,9 +42,14 @@ test: about: home: https://github.com/samtools/htslib license: MIT + license_family: MIT + license_file: LICENSE summary: C library for high-throughput sequencing data formats. + doc_url: http://www.htslib.org/ extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:HTSlib skip-lints: diff --git a/recipes/humid/meta.yaml b/recipes/humid/meta.yaml index bbc1e7ba47dc4..77f3ae3e1d436 100644 --- a/recipes/humid/meta.yaml +++ b/recipes/humid/meta.yaml @@ -1,4 +1,4 @@ -{% set version="1.0.2" %} +{% set version = "1.0.4" %} package: name: humid @@ -6,10 +6,12 @@ package: source: url: https://github.com/jfjlaros/HUMID/releases/download/v{{ version }}/humid-v{{ version }}.tar.gz - sha256: 3e35f663884cb47b089740629a61537e56536479c0c9b560819e599fd047d34e + sha256: 5da8a2a95514304b7a32a6525bb6047bae16b96e56a9737a57a745470eac7733 build: - number: 2 + number: 0 + run_exports: + - {{ pin_subpackage('humid', max_pin="x") }} requirements: build: @@ -17,7 +19,6 @@ requirements: - {{ compiler('c') }} - {{ compiler('cxx') }} - isa-l - - libdeflate host: - isa-l - libdeflate @@ -32,4 +33,6 @@ test: about: home: https://github.com/jfjlaros/HUMID license: MIT + license_family: MIT summary: HUMID -- High-performance UMI Deduplicator + doc_url: https://humid.readthedocs.io/en/latest/usage.html diff --git a/recipes/hybracter/meta.yaml b/recipes/hybracter/meta.yaml index 8e85a27f1af6e..15305a69002fc 100644 --- a/recipes/hybracter/meta.yaml +++ b/recipes/hybracter/meta.yaml @@ -1,5 +1,5 @@ {% set name = "hybracter" %} -{% set version = "0.5.0" %} +{% set version = "0.7.3" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/hybracter-{{ version }}.tar.gz - sha256: 6bdc2376e0000556622b957e765f27014972784700f306943b345956739d4592 + sha256: 01ee53bb84c37ba2a4c37431dd34ada4383cf29aab4127acb3131ab1be58adac build: number: 0 diff --git a/recipes/hybran/meta.yaml b/recipes/hybran/meta.yaml index 5b4b6abd05446..4d343203276db 100644 --- a/recipes/hybran/meta.yaml +++ b/recipes/hybran/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.7.1" %} +{% set version = "1.8" %} package: name: hybran @@ -6,12 +6,14 @@ package: source: url: https://gitlab.com/LPCDRP/hybran/-/archive/{{ version }}/hybran-{{ version }}.tar.gz - sha256: 'c256e88009d0a2cc3fffcb021613392f6a71ee6905bfe1a1d806b962b5243017' + sha256: 'cd46ec155109e59ddadf6942a54edcd9c350c6571ae81524eab44d4b695cbbdb' build: noarch: python number: 0 script: python -m pip install --no-deps --ignore-installed . + run_exports: + - {{ pin_subpackage('hybran', max_pin=None) }} requirements: host: @@ -26,8 +28,10 @@ requirements: - eggnog-mapper - emboss - entrez-direct + - intervaltree - mcl - multiprocess + - networkx - prokka >=1.14 - python >=3.9 - ratt @@ -42,4 +46,4 @@ about: dev_url: https://gitlab.com/LPCDRP/hybran license: GPLv3 license_file: LICENSE - summary: Hybrid reference transfer and ab initio prokaryotic genome annotation + summary: Comparative prokaryotic genome annotation diff --git a/recipes/hyphy/build.sh b/recipes/hyphy/build.sh index 133335196642c..50ac0f9bd45ef 100644 --- a/recipes/hyphy/build.sh +++ b/recipes/hyphy/build.sh @@ -1,3 +1,14 @@ -cmake -DCMAKE_INSTALL_PREFIX=$PREFIX -DNOAVX=ON . +#!/usr/bin/env bash + +case $(uname -m) in + aarch64) + HYPHY_OPTS="" + ;; + *) + HYPHY_OPTS="-DNOAVX=ON" + ;; +esac + +cmake -DCMAKE_INSTALL_PREFIX=$PREFIX ${HYPHY_OPTS} . make hyphy HYPHYMPI make install diff --git a/recipes/hyphy/meta.yaml b/recipes/hyphy/meta.yaml index 7e05e89fcba7a..eaa7cacaec924 100644 --- a/recipes/hyphy/meta.yaml +++ b/recipes/hyphy/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.5.59" %} -{% set sha256 = "18d7fc1569ca9fa5cbd7df0517ccb3e03de118fb42ab339073dbf3a7d82c8546" %} +{% set version = "2.5.60" %} +{% set sha256 = "bc3a5062ee3cee47de16c394189fb8a5feed48f9a8c12302432d6faa7f2ac301" %} package: name: hyphy @@ -10,7 +10,7 @@ source: sha256: '{{ sha256 }}' build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage("hyphy", max_pin="x.x") }} requirements: @@ -45,5 +45,7 @@ about: dev_url: https://github.com/veg/hyphy extra: + additional-platforms: + - linux-aarch64 container: extended-base: true diff --git a/recipes/icescreen/meta.yaml b/recipes/icescreen/meta.yaml index aac6a83ed3f11..09c46a851ab4f 100644 --- a/recipes/icescreen/meta.yaml +++ b/recipes/icescreen/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ICEscreen" %} -{% set version = "1.2.0" %} +{% set version = "1.3.2" %} package: name: "{{ name|lower }}" @@ -7,11 +7,13 @@ package: source: url: https://forgemia.inra.fr/ices_imes_analysis/icescreen/-/archive/v{{ version }}/icescreen-v{{ version }}.tar.gz - sha256: 21b163a5dc0f6a745d97aa6185aa94ccc4ecfe14553cc75ed71429ee1da9c122 + sha256: f8d691891bd92e2dc4a72b14a5404645d26f30d3fbe09d407b45c548d37f2ca3 build: number: 0 noarch: generic + run_exports: + - {{ pin_subpackage('icescreen', max_pin="x") }} requirements: host: @@ -20,12 +22,12 @@ requirements: - hmmer =3.3.2 run: - python - - pandas >=2.0.0 - - snakemake-minimal >=7.25.0 - - biopython >=1.81 - - bcbio-gff >=0.7.0 - - blast =2.12 - - hmmer =3.3.2 + - pandas >=2.1.0 + - snakemake-minimal >=8.4 + - biopython =1.83 + - blast =2.15 + - hmmer =3.4 + - pyarrow test: commands: @@ -35,9 +37,10 @@ about: home: https://forgemia.inra.fr/ices_imes_analysis/icescreen license: AGPL-3.0-or-later license_family: AGPL - summary: "ICEscreen detects and annotates ICEs (Integrative and Conjugative Elements) and IMEs (Integrative and Mobilizable Elements) in Firmicutes genomes." - doc_url: icescreen.migale.inrae.fr + summary: "ICEscreen detects and annotates ICEs (Integrative and Conjugative Elements) and IMEs (Integrative and Mobilizable Elements) in Bacillota genomes." + doc_url: https://icescreen.migale.inrae.fr extra: recipe-maintainers: - thomas-lacroix + diff --git a/recipes/igblast/build.sh b/recipes/igblast/build.sh index 8a7cbeb95c655..131eeeb29c598 100644 --- a/recipes/igblast/build.sh +++ b/recipes/igblast/build.sh @@ -13,37 +13,17 @@ mkdir -p $PREFIX/bin mkdir -p $SHARE_DIR/bin if [[ $(uname) == Linux ]]; then - export CPPFLAGS="$CPPFLAGS -I$PREFIX/include/ncbi-vdb" - export CC_FOR_BUILD=$CC export AR="$AR rcs" cd c++ - # IgBLAST is based on the BLAST source code and building it produces - # a similar set of shared libraries if --with-dll is used. To avoid - # conflicts when installing IgBLAST and BLAST simultaneously, - # we link IgBLAST statically. - ./configure.orig \ - --with-static-exe \ - --with-mt \ - --with-openmp \ - --without-autodep \ - --without-makefile-auto-update \ - --with-flat-makefile \ - --with-caution \ - --without-lzo \ - --without-debug \ - --with-strip \ - --with-z=$PREFIX \ - --with-bz2=$PREFIX \ - --with-vdb=$PREFIX \ - --without-krb5 \ - --without-openssl \ - --without-gnutls \ - --without-gcrypt \ - --with-build-root=ReleaseMT \ - --prefix=$PREFIX + ./configure \ + --with-z=$PREFIX \ + --with-bz2=$PREFIX \ + --with-vdb=$PREFIX + make -j2 + # Move one up so it looks like the binary release mv ReleaseMT/bin . mv src/app/igblast/{internal_data,optional_file} $SHARE_DIR diff --git a/recipes/igblast/meta.yaml b/recipes/igblast/meta.yaml index 92909eef6c732..b3d81839b3f4b 100644 --- a/recipes/igblast/meta.yaml +++ b/recipes/igblast/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.21.0" %} +{% set version = "1.22.0" %} package: name: igblast @@ -20,14 +20,16 @@ about: source: url: ftp://ftp.ncbi.nih.gov/blast/executables/igblast/release/{{ version }}/ncbi-igblast-{{ version }}-src.tar.gz # [linux] - sha256: f679a417b170e96103c088a9d1e82bfd40571526080da00fdf62de74aee82d16 # [linux] + sha256: a04eb195087447cf42e673401ae2d9f6ef8414b34f1534724a6953f41224df68 # [linux] url: ftp://ftp.ncbi.nih.gov/blast/executables/igblast/release/{{ version }}/ncbi-igblast-{{ version }}-x64-macosx.tar.gz # [osx] - sha256: 9d8f13a7ab3b2ab42df3565cdf3b480bd9c04fb0ffb1d54834e67fa37d4fc09b # [osx] + sha256: b8a0034642b5dbef7f41c7fcfbb4bc035d2c5877d3e987af43605ea8e3d55c40 # [osx] patches: - shared_vdb.patch # [linux] build: - number: 1 + number: 0 + run_exports: + - {{ pin_subpackage('igblast', max_pin="x") }} requirements: build: @@ -41,6 +43,7 @@ requirements: - gnutls # [osx] - libidn11 - lzo # [osx] + - libsqlite >=3 - ncbi-vdb >=2.9.6 run: - ncbi-vdb >=2.9.6 diff --git a/recipes/igblast/shared_vdb.patch b/recipes/igblast/shared_vdb.patch index 8e099e4a7c5a1..1ee0a5e8c12a9 100644 --- a/recipes/igblast/shared_vdb.patch +++ b/recipes/igblast/shared_vdb.patch @@ -1,12 +1,11 @@ -diff -u -ru ncbi-igblast-1.15.0-src/c++/src/app/igblast/Makefile.igblastn.app ncbi-igblast-1.15.0-src-patched/c++/src/app/igblast/Makefile.igblastn.app ---- ncbi-igblast-1.15.0-src/c++/src/app/igblast/Makefile.igblastn.app 2019-08-04 23:12:21.000000000 +0200 -+++ ncbi-igblast-1.15.0-src-patched/c++/src/app/igblast/Makefile.igblastn.app 2020-02-19 14:30:43.571473876 +0100 -@@ -11,7 +11,7 @@ - CXXFLAGS = $(FAST_CXXFLAGS:ppc=i386) +--- ncbi-igblast-1.22.0-src/c++/src/app/igblast/Makefile.igblastn.app 2023-10-06 15:33:05.000000000 -0400 ++++ ncbi-igblast-1.22.0-src-patched/c++/src/app/igblast/Makefile.igblastn.app 2024-01-10 11:35:41.231820985 -0500 +@@ -12,7 +12,7 @@ LDFLAGS = $(FAST_LDFLAGS:ppc=i386) --LIBS = $(GENBANK_THIRD_PARTY_LIBS) $(VDB_STATIC_LIBS) $(CMPRS_LIBS) $(DL_LIBS) $(NETWORK_LIBS) $(BLAST_THIRD_PARTY_LIBS) $(ORIG_LIBS) -+LIBS = $(GENBANK_THIRD_PARTY_LIBS) $(VDB_LIBS) $(CMPRS_LIBS) $(DL_LIBS) $(NETWORK_LIBS) $(BLAST_THIRD_PARTY_LIBS) $(ORIG_LIBS) + LIBS = $(BLAST_THIRD_PARTY_LIBS) $(GENBANK_THIRD_PARTY_LIBS) \ +- $(VDB_STATIC_LIBS) $(CMPRS_LIBS) $(DL_LIBS) $(NETWORK_LIBS) $(ORIG_LIBS) ++ $(VDB_LIBS) $(CMPRS_LIBS) $(DL_LIBS) $(NETWORK_LIBS) $(ORIG_LIBS) REQUIRES = VDB objects -Cygwin diff --git a/recipes/igfinder/build.sh b/recipes/igfinder/build.sh new file mode 100644 index 0000000000000..399e98c07b4a2 --- /dev/null +++ b/recipes/igfinder/build.sh @@ -0,0 +1,12 @@ +#!/bin/bash + +set -x -e + +export LIBRARY_PATH="${PREFIX}/lib" +cp igfinder.py ${LIBRARY_PATH} + +export BINARY_HOME="${PREFIX}/bin" +script=${BINARY_HOME}/igfinder + +echo "#!/bin/bash" > $script +echo "python2 ${LIBRARY_PATH}/igfinder.py \$@" >> $script diff --git a/recipes/igfinder/meta.yaml b/recipes/igfinder/meta.yaml new file mode 100644 index 0000000000000..10c40ce484fd1 --- /dev/null +++ b/recipes/igfinder/meta.yaml @@ -0,0 +1,39 @@ +{% set name = "igfinder" %} +{% set version = "1.0" %} +{% set sha256 = "dc5f65e7e6661c4cd424d7e43ef82e00cd335f688bc0a9f076946d117f57349a" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://tx.bioreg.kyushu-u.ac.jp/igfinder/igfinder.py + sha256: {{ sha256 }} + +build: + number: 0 + noarch: python + run_exports: + - {{ pin_subpackage('igfinder', max_pin="x.x") }} + +requirements: + build: + - python =2.7 + - biopython + + host: + - python <3 + + run: + - python =2.7 + - biopython + - numpy + +test: + commands: + - "igfinder -h" + +about: + home: https://tx.bioreg.kyushu-u.ac.jp/igfinder + license: MIT + summary: A tool to extract Igh and Igl/Igk gene sequences from assembled transcripts diff --git a/recipes/igv-reports/meta.yaml b/recipes/igv-reports/meta.yaml index 6335f9d235f6d..1e69cef3c08a1 100644 --- a/recipes/igv-reports/meta.yaml +++ b/recipes/igv-reports/meta.yaml @@ -1,5 +1,5 @@ {% set name = "igv-reports" %} -{% set version = "1.10.0" %} +{% set version = "1.12.0" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 8cbe26d120ca4d599c7ffb8077dc4501a5ef29cf76a69f187ce1cd948ef0f451 + sha256: 2a4bb08945e7872108a83037468249581b2fb42b2934cf33446971443175611d build: noarch: python diff --git a/recipes/igv/build.sh b/recipes/igv/build.sh index b156b5aa9d4df..2dcf09d8be126 100644 --- a/recipes/igv/build.sh +++ b/recipes/igv/build.sh @@ -1,5 +1,7 @@ #!/bin/bash +set -eux -o pipefail + mkdir -p ${PREFIX}/lib/igv # Build diff --git a/recipes/igv/meta.yaml b/recipes/igv/meta.yaml index f3a127e2f9d6b..de70d2e597401 100644 --- a/recipes/igv/meta.yaml +++ b/recipes/igv/meta.yaml @@ -1,6 +1,6 @@ {% set name = "IGV" %} -{% set version = "2.16.2" %} -{% set sha256 = "d08e785d9d44f4e3c16dfe22514133fa0a80d067b677c0cc3c64d2e3d2c12d21" %} +{% set version = "2.17.4" %} +{% set sha256 = "1c42fcca6fcb17d6ca6eced4bc27075f45aed62d2f9cc0d6a149e69cc56113c0" %} package: name: {{ name|lower }} @@ -13,12 +13,14 @@ source: build: number: 0 noarch: generic + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x") }} requirements: build: - - openjdk 11 + - openjdk 17 run: - - openjdk 11 + - openjdk 17 test: commands: diff --git a/recipes/igvtools/igvtools.sh b/recipes/igvtools/igvtools.sh index 08f3849b0afa5..a2702832d9ce0 100644 --- a/recipes/igvtools/igvtools.sh +++ b/recipes/igvtools/igvtools.sh @@ -16,13 +16,4 @@ while [[ -h "$SOURCE" ]]; do # resolve $SOURCE until the file is no longer a sym done DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" -# Check whether or not to use the bundled JDK -if [ -d "${DIR}/jdk-11" ]; then - echo echo "Using bundled JDK." - JAVA_HOME="${DIR}/jdk-11" - PATH=$JAVA_HOME/bin:$PATH -else - echo "Using system JDK." -fi - java -Djava.awt.headless=true --module-path="${DIR}/lib" -Xmx1500m --module=org.igv/org.broad.igv.tools.IgvTools "$@" diff --git a/recipes/igvtools/meta.yaml b/recipes/igvtools/meta.yaml index 63dc7743ed394..55cc6343b6e61 100644 --- a/recipes/igvtools/meta.yaml +++ b/recipes/igvtools/meta.yaml @@ -1,22 +1,24 @@ {% set name = "IGVtools" %} -{% set version = "2.16.2" %} -{% set sha256 = "489d34ed4e807a3d32a3720f11248d2ddf1e21d264b06bea44fbe1ccb74b3aa2" %} +{% set version = "2.17.3" %} +{% set sha256 = "58369ad1e156dc27a7cd2861c238049563396be605a2ab1b172a008a69ad7cb4" %} package: name: {{ name|lower }} version: {{ version }} source: - url: http://data.broadinstitute.org/igv/projects/downloads/2.16/IGV_{{ version }}.zip + url: http://data.broadinstitute.org/igv/projects/downloads/2.17/IGV_{{ version }}.zip sha256: {{ sha256 }} build: number: 0 noarch: generic + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x") }} requirements: run: - - openjdk 11 + - openjdk >=17 test: commands: diff --git a/recipes/illumina-interop/build.sh b/recipes/illumina-interop/build.sh index faaf3519bce3b..37efdca568dbf 100644 --- a/recipes/illumina-interop/build.sh +++ b/recipes/illumina-interop/build.sh @@ -1,12 +1,14 @@ #!/bin/bash +set -ex + mkdir -p $PREFIX/interop/bin mkdir -p $PREFIX/bin mkdir -p build cd build cmake -DCMAKE_INSTALL_PREFIX:PATH=$PREFIX/interop .. -make +make -j ${CPU_COUNT} make install for FPATH in $(find $PREFIX/interop/bin -maxdepth 1 -mindepth 1 -type f -or -type l); do ln -sfvn $FPATH $PREFIX/bin/interop_$(basename $FPATH) diff --git a/recipes/illumina-interop/meta.yaml b/recipes/illumina-interop/meta.yaml index 6417abb1d19e2..4d1c368792cfd 100644 --- a/recipes/illumina-interop/meta.yaml +++ b/recipes/illumina-interop/meta.yaml @@ -6,7 +6,7 @@ package: version: '{{version}}' build: - number: 0 + number: 1 skip: true # [osx] run_exports: - {{ pin_subpackage('illumina-interop', max_pin="x.x") }} @@ -47,3 +47,7 @@ about: faster display of a subset of the original data (collapsed quality scores). dev_url: https://github.com/Illumina/interop license_family: GPL + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/impg/build.sh b/recipes/impg/build.sh new file mode 100644 index 0000000000000..d70db500fe871 --- /dev/null +++ b/recipes/impg/build.sh @@ -0,0 +1,9 @@ +#!/bin/bash -euo + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" + +# build statically linked binary with Rust +RUST_BACKTRACE=1 +cargo install --verbose --path . --root ${PREFIX} diff --git a/recipes/impg/meta.yaml b/recipes/impg/meta.yaml new file mode 100644 index 0000000000000..04999b4407314 --- /dev/null +++ b/recipes/impg/meta.yaml @@ -0,0 +1,35 @@ +{% set name = "impg" %} +{% set version = "0.2.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/pangenome/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: ad2f4f4ea68e0c3feb5ecef5b408bb8649c4a67f5203ca7320434ed9a070c7ee + +build: + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} + +requirements: + build: + - {{ compiler('rust') }} + +test: + commands: + - impg --help + +about: + home: https://github.com/pangenome/{{ name }} + license: MIT + license_family: MIT + license_file: LICENSE + summary: "impg: implicit pangenome graphs" + dev_url: https://github.com/pangenome/{{ name }} + +extra: + recipe-maintainers: + - AndreaGuarracino diff --git a/recipes/infernal/build.sh b/recipes/infernal/build.sh index e81bb592239ce..96e0f326ebabc 100644 --- a/recipes/infernal/build.sh +++ b/recipes/infernal/build.sh @@ -4,8 +4,21 @@ set -ex grep -l -r "/usr/bin/perl" . | xargs sed -i.bak -e 's/usr\/bin\/perl/usr\/bin\/env perl/g' +autoreconf -i -./configure --prefix=$PREFIX -make -j 2 -make check +case $(uname -m) in + "x86_64") + ARCH_OPTS="--enable-sse" + ;; + "aarch64") + # Download newer config.{sub,guess} files that support aarch64-conda-linux-gnu + wget "http://git.savannah.gnu.org/gitweb/?p=config.git;a=blob_plain;f=config.guess;hb=HEAD" -O config.guess + wget "http://git.savannah.gnu.org/gitweb/?p=config.git;a=blob_plain;f=config.sub;hb=HEAD" -O config.sub + ;; + *) + ;; +esac + +./configure --prefix="${PREFIX}" "${ARCH_OPTS}" +make -j${CPU_COUNT} make install diff --git a/recipes/infernal/meta.yaml b/recipes/infernal/meta.yaml index 67b3bcad6bc71..e98e342633c4d 100644 --- a/recipes/infernal/meta.yaml +++ b/recipes/infernal/meta.yaml @@ -1,29 +1,37 @@ -{% set version = "1.1.4" %} +{% set name = "infernal" %} +{% set version = "1.1.5" %} package: - name: infernal + name: {{ name }} version: {{ version }} source: - url: http://eddylab.org/infernal/infernal-{{ version }}.tar.gz - sha256: f9493c7dee9fbf25f6405706818883d24b9f5e455121a0662c96c8f0307f95fc + url: http://eddylab.org/infernal/{{ name }}-{{ version }}.tar.gz + sha256: ad4ddae02f924ca7c85bc8c4a79c9f875af8df96aeb726702fa985cbe752497f build: - number: 4 + number: 1 + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: build: - - make - {{ compiler('c') }} + - make + - autoconf + - automake + - libtool host: - perl - run: + - libgomp # [linux] + - llvm-openmp # [osx] + - wget test: commands: - cmalign -h - cmbuild -h - - cmcalibrate -h + - cmcalibrate -h - cmconvert -h - cmemit -h - cmfetch -h @@ -35,6 +43,16 @@ test: about: home: http://eddylab.org/infernal license: BSD-3-Clause + license_family: BSD license_file: LICENSE summary: Infernal is for searching DNA sequence databases for RNA structure and sequence similarities. description: Infernal ("INFERence of RNA ALignment") is for searching DNA sequence databases for RNA structure and sequence similarities. + doc_url: http://eddylab.org/infernal/Userguide.pdf + dev_url: https://github.com/EddyRivasLab/infernal + +extra: + additional-platforms: + - linux-aarch64 + identifiers: + - doi:10.1093/bioinformatics/btt509 + - biotools:infernal diff --git a/recipes/influx-si-data-manager/meta.yaml b/recipes/influx-si-data-manager/meta.yaml index dade7d4fe4c17..5165c63acd2c4 100644 --- a/recipes/influx-si-data-manager/meta.yaml +++ b/recipes/influx-si-data-manager/meta.yaml @@ -1,5 +1,5 @@ {% set name = "influx-si-data-manager" %} -{% set version = "1.0.0" %} +{% set version = "1.0.2" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/influx_si_data_manager-{{ version }}.tar.gz - sha256: 0cea604084022f74b0886a7ce088cd1966f29cc35b2854b33b62545bafe84eb9 + sha256: 5bac948f0c781e50a7e47f746cb7fc71f1f5de1182356a8b6952f0a622bd8fe8 build: entry_points: diff --git a/recipes/influx_si/meta.yaml b/recipes/influx_si/meta.yaml index 2604d723ff941..6a7c84a478a97 100644 --- a/recipes/influx_si/meta.yaml +++ b/recipes/influx_si/meta.yaml @@ -1,5 +1,5 @@ {% set name = "influx_si" %} -{% set version = "7.0.1" %} +{% set version = "7.0.3" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: "24756a8c4ae1882244ffb2fd1faf83fe51e0cb6bb0d81756ce2c97c816764f3d" + sha256: "0685631a20ab422ae558fedd4184b2256fa4289f660227b1729ec71d0306116e" build: number: 0 @@ -21,8 +21,8 @@ build: - ftbl2netan = influx_si.cli:cli - ftbl2optR = influx_si.cli:cli - ftbl2xgmml = influx_si.cli:cli - - influx_s = influx_si.cli:cli - - influx_i = influx_si.cli:cli + - influx_s = influx_si.influx_s:main + - influx_i = influx_si.influx_i:main - res2ftbl_meas = influx_si.cli:cli - txt2ftbl = influx_si.txt2ftbl:main - ftbl2mtf = influx_si.ftbl2mtf:main diff --git a/recipes/insilicoseq/checksums.md5 b/recipes/insilicoseq/checksums.md5 index 62eea9823d41f..d0cfecf9e2afb 100644 --- a/recipes/insilicoseq/checksums.md5 +++ b/recipes/insilicoseq/checksums.md5 @@ -1,2 +1,2 @@ -80319ebef7bd8f98c3d589c42ba852da bogus-reads_R1.fastq -f883f153efbbc1a1519c21f4829ba8dd bogus-reads_R2.fastq +9aeb0f7da8af96b9ce20270a50b20aec bogus-reads_R1.fastq +638e4fe4e8470feeb40e359995d803db bogus-reads_R2.fastq diff --git a/recipes/insilicoseq/meta.yaml b/recipes/insilicoseq/meta.yaml index 7270ab4cc77fe..9839e23b74ac0 100644 --- a/recipes/insilicoseq/meta.yaml +++ b/recipes/insilicoseq/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.6.0" %} -{% set sha256 = "4cbd8e30a17e9591899be42aaa776e0748907709ac56db8133050335f24d35e5" %} +{% set version = "2.0.1" %} +{% set sha256 = "a1b452fbb6781c5c04bad269836893bf8d2103215e8d131c37baa95a74b2cbaa" %} package: name: insilicoseq @@ -13,8 +13,10 @@ build: noarch: python entry_points: - iss = iss.app:main - script: python -m pip install --no-deps --ignore-installed . + script: {{ PYTHON }} -m pip install --no-deps --no-build-isolation . -vvv number: 0 + run_exports: + - {{ pin_subpackage('insilicoseq', max_pin="x") }} requirements: host: @@ -33,6 +35,8 @@ requirements: test: imports: - iss + commands: + - iss --help files: - bogus-genome.fasta.gz - checksums.md5 @@ -41,8 +45,10 @@ about: home: https://github.com/HadrienG/InSilicoSeq license: MIT license_family: MIT + license_file: LICENSE summary: A sequencing simulator. dev_url: https://github.com/HadrienG/InSilicoSeq + doc_url: https://insilicoseq.readthedocs.io/en/latest/ extra: recipe-maintainers: diff --git a/recipes/instrain/meta.yaml b/recipes/instrain/meta.yaml index bb970379926a2..b3390694f6173 100644 --- a/recipes/instrain/meta.yaml +++ b/recipes/instrain/meta.yaml @@ -1,5 +1,5 @@ {% set name = "inStrain" %} -{% set version = "1.8.0" %} +{% set version = "1.8.1" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: b3d88c885658a9db393be7ce201e89454c3ea593128fdb673521640e5c1ecae4 + sha256: 0eab49f8f4bd64037f4314c228a193f6dfeaf37dec96eee81cf63851adeb9a59 build: noarch: python diff --git a/recipes/intarna/build.sh b/recipes/intarna/build.sh index fd174c6efa2cd..5e5ab3a2b0308 100644 --- a/recipes/intarna/build.sh +++ b/recipes/intarna/build.sh @@ -34,5 +34,7 @@ export LDFLAGS=${LDFLAGS} make -j ${CPU_COUNT} -make tests -j ${CPU_COUNT} +if [ `uname` != Darwin ] ; then # skip tests for osx to avoid timeout + make tests -j ${CPU_COUNT} +fi make install diff --git a/recipes/intarna/meta.yaml b/recipes/intarna/meta.yaml index 26009b219a7b8..bb6a0cf472278 100644 --- a/recipes/intarna/meta.yaml +++ b/recipes/intarna/meta.yaml @@ -1,5 +1,5 @@ -{% set INTARNA_VERSION = "3.3.2" %} -{% set INTARNA_SHA256 = "57d273fa5bb6b62636e316465240b95089273e7e9e34224ea48c9cd747e88ed1" %} +{% set INTARNA_VERSION = "3.4.0" %} +{% set INTARNA_SHA256 = "4b0c53472dad49f3fbe6f0d3b1613d22d7b438bf650936da6a351a25fa9d535c" %} {% set VRNA_VERSION = "2.4.14" %} package: @@ -13,6 +13,8 @@ about: build: number: 1 + run_exports: + - {{ pin_subpackage('intarna', max_pin="x.x") }} source: url: "https://github.com/BackofenLab/IntaRNA/releases/download/v{{INTARNA_VERSION}}/intaRNA-{{INTARNA_VERSION}}.tar.gz" @@ -41,6 +43,8 @@ test: - IntaRNA -t CCCCCCCCGGGGGGGGGGGGGG -q CCCCCCC extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:intarna - doi:10.1093/nar/gkx279 diff --git a/recipes/integron_finder/meta.yaml b/recipes/integron_finder/meta.yaml index ddbeab522060d..7e8566ea79450 100644 --- a/recipes/integron_finder/meta.yaml +++ b/recipes/integron_finder/meta.yaml @@ -1,46 +1,59 @@ -{% set name="integron_finder" %} -{% set version="2.0.2" %} +{% set name = "integron_finder" %} +{% set version = "2.0.3" %} package: - name: {{ name }} + name: {{ name|lower }} version: {{ version }} +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/integron_finder-{{ version }}.tar.gz + sha256: 2ecc0579490daf5b75a5cedfb22b446e830a0ca547c8acae92ee2ab2a755aa01 + build: + entry_points: + - integron_finder=integron_finder.scripts.finder:main + - integron_split=integron_finder.scripts.split:main + - integron_merge=integron_finder.scripts.merge:main noarch: python - number: 0 - script: python -m pip install --no-deps --ignore-installed . - -source: - url: https://files.pythonhosted.org/packages/4a/39/816165ed051a41560c9167590bf974a83de34e5a43509e9501f79cdf4ba4/integron_finder-2.0.2.tar.gz - sha256: 62444c43895c2b68289bc7ceaa2da417766c82852b5ecf1c3280e41ba3beaa6f + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + number: 1 + run_exports: + - {{ pin_subpackage('integron_finder', max_pin="x") }} requirements: host: - - python >=3.7,<=3.10 + - python >=3.10 - pip run: - - python >=3.7,<=3.10 - - biopython ==1.78 - - numpy ==1.19.4 - - matplotlib-base ==3.3.3 - - colorlog <=6.6.0 - - pandas ==1.1.5 + - python >=3.10 + - numpy >=1.26 + - matplotlib-base >=3.8 + - pandas >=2 + - biopython >=1.82 + - colorlog - hmmer >=3.1b2,<=3.3.2 - infernal >=1.1.2,<=1.1.4 - prodigal >=2.6.3 test: + imports: + - integron_finder commands: - - integron_finder --version + - integron_finder --help + - integron_split --help + - integron_merge --help about: - home: https://github.com/gem-pasteur/Integron_Finder - license: 'GPLv3' + home: https://github.com/gem-pasteur/Integron_Finder/ + summary: Integron Finder aims at detecting integrons in DNA sequences + license: GPL-3.0-or-later + license_family: GPL3 license_file: COPYING - summary: 'Finds integrons in DNA sequences' + doc_url: https://integronfinder.readthedocs.io/en/latest/ + dev_url: https://github.com/gem-pasteur/Integron_Finder/ extra: recipe-maintainers: - - thanhleviet - doi: - - 10.1093/nar/gkw319 + - bneron + identifiers: + - doi:10.3390/microorganisms10040700 diff --git a/recipes/ionquant/academic_install.py b/recipes/ionquant/academic_install.py new file mode 100755 index 0000000000000..fb4adafac6868 --- /dev/null +++ b/recipes/ionquant/academic_install.py @@ -0,0 +1,74 @@ +#!/usr/bin/env python3 + +# Automates accepting the academic license agreements in order to download IonQuant. A user of this package is then expected to accept the terms themselves when they download a license key from the IonQuant site, which is enforced by the wrapper script and IonQuant jar file. + +import argparse +import hashlib +import os +import re +import sys +import urllib.request +import urllib.parse + +IONQUANT_URL = 'http://msfragger-upgrader.nesvilab.org/ionquant/upgrade_download.php' +DOWNLOAD_READ_SIZE = 1000000 + +def download_url(url, post_dict, dest): + data = urllib.parse.urlencode(post_dict).encode('ascii') + with open(dest, 'wb') as wh: + size = 0 + m = hashlib.sha256() + with urllib.request.urlopen(url, data) as f: + while True: + seg = f.read(DOWNLOAD_READ_SIZE) + m.update(seg) + bytes_read = len(seg) + if bytes_read < 1: + break + size += bytes_read + wh.write(seg) + + return m.hexdigest() + +def parse_version(version_string): + version_pattern = '([\\d.]+)' + m = re.search(version_pattern, version_string.strip()) + if m: + return m.groups()[0] + return None + +parser = argparse.ArgumentParser( + description="Download IonQuant zip file." +) +parser.add_argument( + '-n', '--name', help='user name' +) +parser.add_argument( + '-e', '--email', help='email' +) +parser.add_argument( + '-o', '--organization', help='institutional organization' +) +parser.add_argument( + '-i', '--ionquant_version', help='IonQuant version', required=True +) +parser.add_argument( + '-p', '--path', default='.', help='path in which to install' +) +parser.add_argument( + '--hash', default='.', help='SHA256 hash of downloaded zip' +) + +args = parser.parse_args() +iq_ver = parse_version(args.ionquant_version) +if iq_ver == None: + print(f'Could not find version: {args.ionquant_version}', file=sys.stderr) + sys.exit(1) + +iq_zip = iq_ver + '$zip' +dest = os.path.join(args.path, 'IonQuant-' + iq_ver + '.zip') +data = {'transfer': 'academic', 'agreement1': 'true', 'name': args.name, 'email' : args.email, 'organization' : args.organization, 'download': iq_zip} + +if download_url(IONQUANT_URL, data, dest) != args.hash: + print('Invalid hash calculated.', file=sys.stderr) + sys.exit(1) diff --git a/recipes/ionquant/build.sh b/recipes/ionquant/build.sh new file mode 100644 index 0000000000000..2d90fc8dea952 --- /dev/null +++ b/recipes/ionquant/build.sh @@ -0,0 +1,34 @@ +#!/bin/bash + +# These values are submitted to the IonQuant site when downloading the application zip. +if [[ -z "$NAME" ]]; then + NAME="${USERNAME:-bioconda}"; +fi +if [[ -z "$EMAIL" ]]; then + EMAIL="${NAME}@${HOSTNAME:-bioconda.org}"; +fi +if [[ -z "$INSTITUTION" ]]; then + INSTITUTION="${HOSTNAME:-bioconda.org}"; +fi + +# Create directories +TARGET="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" +mkdir -p "$TARGET" + +# Add wrapper python script and link to unprefixed name. +cp "$RECIPE_DIR/ionquant.py" "$TARGET" +ln -s "$TARGET/ionquant.py" "$PREFIX/bin/ionquant" +chmod 0755 "${PREFIX}/bin/ionquant" + +# This script automates accepting the academic license agreements in order to download the software and build the package. A user of this package is then expected to accept the terms themselves when they download a license key from the IonQuant site, which is enforced by the wrapper script and IonQuant jar file. +"${RECIPE_DIR}/academic_install.py" -n galaxy -e "$EMAIL" -o "$INSTITUTION" -i "$PKG_VERSION" -p "$TARGET" --hash "$SHA256SUM" +if [[ $? -ne 0 ]]; then + echo "Problem downloading jar file." > /dev/stderr + exit 1; +fi + +# Unzip and link jar. +cd "$TARGET" +unzip "IonQuant-$PKG_VERSION.zip" +ln -s "IonQuant-$PKG_VERSION/IonQuant-$PKG_VERSION.jar" "IonQuant.jar" +rm "IonQuant-$PKG_VERSION.zip" diff --git a/recipes/ionquant/ionquant.py b/recipes/ionquant/ionquant.py new file mode 100755 index 0000000000000..a56491cf08d33 --- /dev/null +++ b/recipes/ionquant/ionquant.py @@ -0,0 +1,86 @@ +#!/usr/bin/env python +# +# Wrapper script for Java Conda packages that ensures that the java runtime +# is invoked with the right options. Adapted from the bash script (http://stackoverflow.com/questions/59895/can-a-bash-script-tell-what-directory-its-stored-in/246128#246128). +# + +import os +import sys +import subprocess +from os import access, getenv, X_OK + +jar_file = os.path.join(os.path.dirname(os.path.realpath(__file__)), "IonQuant.jar") + +default_jvm_mem_opts = ['-Xms512m', '-Xmx1g'] + +license_agreement_text = ''' +Please provide pass a license key with the --key argument. You may obtain a key by agreeing to the terms at https://msfragger.arsci.com/ionquant/. +''' + +def real_dirname(path): + """Return the symlink-resolved, canonicalized directory-portion of path.""" + return os.path.dirname(os.path.realpath(path)) + + +def java_executable(): + """Return the executable name of the Java interpreter.""" + java_home = getenv('JAVA_HOME') + java_bin = os.path.join('bin', 'java') + + if java_home and access(os.path.join(java_home, java_bin), X_OK): + return os.path.join(java_home, java_bin) + else: + return 'java' + + +def jvm_opts(argv): + """Construct list of Java arguments based on our argument list. + + The argument list passed in argv must not include the script name. + The return value is a 3-tuple lists of strings of the form: + (memory_options, prop_options, passthrough_options) + """ + mem_opts = [] + prop_opts = [] + pass_args = [] + + for arg in argv: + if arg.startswith('-D'): + prop_opts.append(arg) + elif arg.startswith('-XX'): + prop_opts.append(arg) + elif arg.startswith('-Xm'): + mem_opts.append(arg) + else: + pass_args.append(arg) + + # In the original shell script the test coded below read: + # if [ "$jvm_mem_opts" == "" ] && [ -z ${_JAVA_OPTIONS+x} ] + # To reproduce the behaviour of the above shell code fragment + # it is important to explictly check for equality with None + # in the second condition, so a null envar value counts as True! + + if mem_opts == [] and getenv('_JAVA_OPTIONS') == None: + mem_opts = default_jvm_mem_opts + + return (mem_opts, prop_opts, pass_args) + + +def main(): + java = java_executable() + jar_dir = real_dirname(sys.argv[0]) + jar_path = os.path.join(jar_dir, jar_file) + jar_arg = '-jar' + + (mem_opts, prop_opts, pass_args) = jvm_opts(sys.argv[1:]) + + if '--key' not in sys.argv: + print(license_agreement_text) + sys.exit(1) + + java_args = [java] + mem_opts + prop_opts + [jar_arg] + [jar_path] + pass_args + + sys.exit(subprocess.call(java_args)) + +if __name__ == '__main__': + main() diff --git a/recipes/ionquant/meta.yaml b/recipes/ionquant/meta.yaml new file mode 100644 index 0000000000000..aa9cf7e1b9ded --- /dev/null +++ b/recipes/ionquant/meta.yaml @@ -0,0 +1,50 @@ +{% set version = "1.10.12" %} + +# This key was generated ONLY for the testing of this bioconda package. +# Users must generate their own key by agreeing to the terms at https://msfragger.arsci.com/ionquant/IonQuant%20Academic%20Use%20License%2005162022.pdf. +{% set academic_use_only_key = "47cb2953-b4bf7726-2c96f5fe-8f1013aa" %} +{% set sha256sum = "861a633ab815a34ea54e6e26f318e19b510b25cb8955f3daeb83d6d10c6938ea" %} + +package: + name: ionquant + version: {{ version }} + +build: + number: 1 + noarch: generic + run_exports: + - {{ pin_subpackage('ionquant', max_pin="x.x") }} + script_env: + - SHA256SUM={{ sha256sum }} + +requirements: + host: + - python >=3.9 + - unzip + run: + - openjdk >=11 + - python >=3.8 + +test: + commands: + - ionquant --key {{ academic_use_only_key }} -Xms512m -Xmx1g --help | grep 'License key verified' + +about: + home: https://github.com/Nesvilab/IonQuant + license: Academic License (https://msfragger.arsci.com/ionquant/IonQuant%20Academic%20Use%20License%2005162022.pdf) + summary: A label free quantification tool + description: | + IonQuant is a fast and comprehensive tool for MS1 precursor intensity-based quantification for timsTOF PASEF DDA and non-timsTOF (e.g., Orbitrap) data. + It enables label-free quantification with false discovery (FDR) controlled match-between-runs (MBR). + It can also be used for quantification in labelling-based experiments such as those involving SILAC, dimethyl, or similar labelling strategies. + + IonQuant is available freely for academic research and educational purposes only, in accordance with the terms at https://msfragger.arsci.com/ionquant/IonQuant%20Academic%20Use%20License%2005162022.pdf. + +extra: + recipe-maintainers: + - reid-wagner + notes: | + The "ionquant" command runs the IonQuant java program. + identifiers: + - biotools:fragpipe + - doi:10.1074/mcp.TIR120.002048 diff --git a/recipes/iow/meta.yaml b/recipes/iow/meta.yaml index 3e2c487b8cf80..22163552ec6cb 100644 --- a/recipes/iow/meta.yaml +++ b/recipes/iow/meta.yaml @@ -10,8 +10,10 @@ source: sha256: 6b3ddb08f7ec1dec265de4a0f6025c7a4c81df5aa613f3ead5633073b0fe2271 build: - number: 3 + number: 4 skip: True # [py2k] + run_exports: + - {{ pin_subpackage('iow', max_pin='x') }} requirements: build: @@ -50,5 +52,7 @@ about: dev_url: https://github.com/biocore/improved-octo-waddle extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - wasade diff --git a/recipes/ipk/0001_makes_python_wrapper_to_expect_binaries_in_same_directory.patch b/recipes/ipk/0001_makes_python_wrapper_to_expect_binaries_in_same_directory.patch new file mode 100644 index 0000000000000..09fbddb9e465f --- /dev/null +++ b/recipes/ipk/0001_makes_python_wrapper_to_expect_binaries_in_same_directory.patch @@ -0,0 +1,20 @@ +diff --git a/ipk.py b/ipk.py +index fb884f3..71bf356 100755 +--- a/ipk.py ++++ b/ipk.py +@@ -268,12 +268,12 @@ def build_database(ar, + if keep_positions: + raise RuntimeError("--keep-positions is not supported for DNA.") + else: +- bin = f"{current_dir}/bin/ipk/ipk-dna" ++ bin = f"{current_dir}/ipk-dna" + else: + if keep_positions: +- bin = f"{current_dir}/bin/ipk/ipk-aa-pos" ++ bin = f"{current_dir}/ipk-aa-pos" + else: +- bin = f"{current_dir}/bin/ipk/ipk-aa" ++ bin = f"{current_dir}/ipk-aa" + + + command = [ diff --git a/recipes/ipk/0002_default_threads_to_1_to_avoid_raxmlng_oversubscription.patch b/recipes/ipk/0002_default_threads_to_1_to_avoid_raxmlng_oversubscription.patch new file mode 100644 index 0000000000000..a8ca9c821a683 --- /dev/null +++ b/recipes/ipk/0002_default_threads_to_1_to_avoid_raxmlng_oversubscription.patch @@ -0,0 +1,13 @@ +diff --git a/ipk.py b/ipk.py +index fb884f3..1310237 100755 +--- a/ipk.py ++++ b/ipk.py +@@ -191,7 +191,7 @@ def validate_model(ctx, param, value): + Saves time during database load and save, but requires more disk space.""") + @click.option('--threads', + type=int, +- default=4, ++ default=1, + show_default=True, + help="Number of threads used to compute phylo-k-mers.") + def build(ar, diff --git a/recipes/ipk/0003_osx_compilation_requires_sstream_for_std-basic_istringstream.patch b/recipes/ipk/0003_osx_compilation_requires_sstream_for_std-basic_istringstream.patch new file mode 100644 index 0000000000000..3e26523c379f4 --- /dev/null +++ b/recipes/ipk/0003_osx_compilation_requires_sstream_for_std-basic_istringstream.patch @@ -0,0 +1,11 @@ +diff --git a/ipk/src/ar.cpp b/ipk/src/ar.cpp +index 2ea4eed..cebe283 100644 +--- a/ipk/src/ar.cpp ++++ b/ipk/src/ar.cpp +@@ -1,5 +1,6 @@ + #include + #include ++#include + #include + #include + #include diff --git a/recipes/ipk/build.sh b/recipes/ipk/build.sh new file mode 100644 index 0000000000000..7bc80e3d09470 --- /dev/null +++ b/recipes/ipk/build.sh @@ -0,0 +1,28 @@ +#!/bin/bash +set -ex + +export CPLUS_INCLUDE_PATH=${PREFIX}/include +export CPP_INCLUDE_PATH=${PREFIX}/include +export CXX_INCLUDE_PATH=${PREFIX}/include + +#to ensure zlib location +export CFLAGS="$CFLAGS -I$PREFIX/include" +export LDFLAGS="$LDFLAGS -L$PREFIX/lib" + +mkdir -p $PREFIX/bin +mkdir -p $PREFIX/lib + +cmake -B build -DHASH_MAP=USE_TSL_ROBIN_MAP -DCMAKE_CXX_FLAGS="-O3" -DBUILD_SHARED_LIBS=ON --install-prefix=$PREFIX +cmake --build build --target all +cmake --install build + +ls build/ipk + +cp build/ipk/ipk-aa $PREFIX/bin +cp build/ipk/ipk-aa-pos $PREFIX/bin +cp build/ipk/ipk-dna $PREFIX/bin + +chmod +x $PREFIX/bin/ipk-aa +chmod +x $PREFIX/bin/ipk-dna +chmod +x $PREFIX/bin/ipk-aa-pos +chmod +x $PREFIX/bin/ipk.py diff --git a/recipes/ipk/meta.yaml b/recipes/ipk/meta.yaml new file mode 100644 index 0000000000000..a44263c3004b3 --- /dev/null +++ b/recipes/ipk/meta.yaml @@ -0,0 +1,56 @@ +{% set name = "IPK" %} +{% set version = "0.5.0" %} +{% set sha256 = "7d073583d0f9891a30ec6865fee33818b526086a1f0de04028409496b279004c" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/phylo42/{{ name|lower }}/releases/download/v{{ version }}/IPK-v{{ version }}_src_for_bioconda.tar.gz + sha256: {{ sha256 }} + patches: + - 0001_makes_python_wrapper_to_expect_binaries_in_same_directory.patch + - 0002_default_threads_to_1_to_avoid_raxmlng_oversubscription.patch + - 0003_osx_compilation_requires_sstream_for_std-basic_istringstream.patch + +build: + number: 0 + run_exports: + - {{ pin_subpackage('ipk', max_pin="x.x") }} + +requirements: + build: + - make + - {{ compiler('cxx') }} + - cmake + host: + - boost-cpp >=1.67 + - zlib + run: + - boost-cpp >=1.67 + - raxml-ng + - phyml + - python + - click + +# git-lfs is absent from the docker image, so test files are not cloned +# unstable workaround it to set wget as a test dependancy +# and download them from github in the run_tests.sh script +test: + requires: + - wget + # because they are not cloned, we cannot copy them from source in the test environment + #source_files: + # - tests/data/neotrop/reference.fasta + # - tests/data/neotrop/tree.rooted.newick + + +about: + home: https://github.com/phylo42/ipk + license: MIT + license_family: MIT + license_file: LICENSE + summary: "IPK is a tool for computing phylo-k-mers for a fixed phylogeny." + description: "IPK is a tool for computing phylo-k-mers for a fixed phylogeny. Please cite: doi.org/10.1093/bioinformatics/btad692" + diff --git a/recipes/ipk/run_test.sh b/recipes/ipk/run_test.sh new file mode 100644 index 0000000000000..64be368cb924b --- /dev/null +++ b/recipes/ipk/run_test.sh @@ -0,0 +1,67 @@ +#!/usr/bin/env bash + +PASS=true + +# A +echo "test A" +command -v ipk-dna +if [ $? -ne 0 ]; then + echo "failed" + PASS=false +fi + +# B +echo "test B" +command -v ipk-aa +if [ $? -ne 0 ]; then + echo "failed" + PASS=false +fi + +# C +echo "test C" +ipk-dna 2>&1 | grep "the option '--ar-binary' is required" +if [ $? -ne 0 ]; then + echo "failed" + PASS=false +fi + +# D +echo "test D" +ipk.py build --help +if [ $? -ne 0 ]; then + echo "failed" + PASS=false +fi + +# E +# test files cannot be retrieved via meta.yaml (field test:source) +# because git-lfs is not available in the github tarball release +# we need to download them manually +#echo "test E" + +#wget -O reference.fasta https://github.com/phylo42/IPK/raw/main/tests/data/neotrop/reference.fasta +#wget -O tree.rooted.newick https://github.com/phylo42/IPK/raw/main/tests/data/neotrop/tree.rooted.newick +#test -s reference.fasta +#test -s tree.rooted.newick +#mkdir -p tests_output +#ipk.py build -r reference.fasta -t tree.rooted.newick -m GTR -k 7 --omega 2.0 -u 1.0 -b $(which raxml-ng) -w tests_output +#if [ $? -ne 0 ]; then +# echo "failed" +# PASS=false +#fi + +#ls tests_output +#echo $PASS + +# F +#echo "test F" +#if [ ! -s tests_output/DB_k7_o2.0.rps ]; then +# echo "failed" +# PASS=false +#fi + +if [ "$PASS" = false ]; then + echo "At least 1 test failed !" + exit 1 +fi diff --git a/recipes/ipyrad/meta.yaml b/recipes/ipyrad/meta.yaml index 4375514b5f3e1..dc31ad13e636f 100644 --- a/recipes/ipyrad/meta.yaml +++ b/recipes/ipyrad/meta.yaml @@ -1,21 +1,23 @@ {% set name = "ipyrad" %} -{% set version = "0.9.93" %} -{% set sha256 = "7f42396c0baa284dde0e9896270006f3c7e2211fa93bb149decccd39b4ab557e" %} +{% set version = "0.9.95" %} +{% set sha256 = "c0a25f057cf5a6e812c4ff180291212b33bc50cd76f014b4d37337fd7ac0c335" %} package: - name: {{name}} - version: {{version}} + name: {{ name }} + version: {{ version }} source: - url: https://github.com/dereneaton/{{name}}/archive/{{version}}.tar.gz - sha256: {{sha256}} + url: https://github.com/dereneaton/{{ name }}/archive/{{ version }}.tar.gz + sha256: {{ sha256 }} build: number: 0 - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv " - noarch: python + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vv" + noarch: python entry_points: - ipyrad = ipyrad.__main__:main + run_exports: + - {{ pin_subpackage('ipyrad', max_pin="x.x") }} requirements: host: @@ -36,7 +38,7 @@ requirements: - mpi4py >=3.0 # [ py >= 37 ] - notebook - bedtools - - muscle <5 # Pin muscle < v5 see issue #477 + - muscle <5 # Pin muscle < v5 see issue #477 - vsearch >=2.13 - bwa - samtools @@ -52,5 +54,6 @@ test: about: home: http://github.com/dereneaton/ipyrad license: GPL-3.0-only + license_family: GPL3 license_file: LICENSE.txt summary: Interactive assembly and analysis of RAD-seq data sets. diff --git a/recipes/iqtree/build.sh b/recipes/iqtree/build.sh index 402ef72c00afd..9d0866d98fcbe 100644 --- a/recipes/iqtree/build.sh +++ b/recipes/iqtree/build.sh @@ -1,21 +1,31 @@ #!/bin/bash +set -ex export INCLUDES="-I${PREFIX}/include" export LIBPATH="-L${PREFIX}/lib" export LDFLAGS="${LDFLAGS} -L${PREFIX}/lib" export CFLAGS="${CFLAGS} -O3" export CPPFLAGS="${CPPFLAGS} -I${PREFIX}/include" +export CXXFLAGS="$CXXFLAGS -std=c++14" if [ "$(uname)" == Darwin ]; then export CMAKE_C_COMPILER="clang" export CMAKE_CXX_COMPILER="clang++" fi -mkdir build -cd build +cmake -S . -B build -DCMAKE_INSTALL_PREFIX="${PREFIX}" -DCMAKE_BUILD_TYPE=Release \ + -DUSE_LSD2=ON -DIQTREE_FLAGS=omp -DCMAKE_CXX_COMPILER="${CXX}" \ + -DCMAKE_CXX_FLAGS="${CXXFLAGS}" -cmake -D CMAKE_INSTALL_PREFIX:PATH="${PREFIX}" -DUSE_LSD2=ON -DIQTREE_FLAGS=omp .. +case $(uname -m) in + aarch64) + JOBS=1 # CircleCI's arm.medium VM runs out of memory with higher values + ;; + *) + JOBS=${CPU_COUNT} + ;; +esac -make --jobs "${CPU_COUNT}" -make install -cp "${PREFIX}"/bin/iqtree2 "${PREFIX}"/bin/iqtree +cmake --build build --target install -j 1 + +cp -f "${PREFIX}"/bin/iqtree2 "${PREFIX}"/bin/iqtree diff --git a/recipes/iqtree/meta.yaml b/recipes/iqtree/meta.yaml index 546ddf58b9357..66ad8876e27f2 100644 --- a/recipes/iqtree/meta.yaml +++ b/recipes/iqtree/meta.yaml @@ -1,6 +1,6 @@ {% set name = "IQTREE" %} -{% set version = "2.2.6" %} -{% set sha256 = "8026bf089a135f4586ebca43fff9af6d4718a936f262b5ea11648b8947782c42" %} +{% set version = "2.3.3" %} +{% set sha256 = "dace30a921f10380dafdc6d4725254fdcf7611d9f89f7c8e33bb8943bc8e75c7" %} package: name: {{ name|lower }} @@ -12,7 +12,8 @@ build: - {{ pin_subpackage('iqtree', max_pin="x") }} source: - - url: https://github.com/iqtree/iqtree2/archive/refs/tags/v{{ version }}.tar.gz + # v2.3.3 release has an extra "." after "v" + - url: https://github.com/iqtree/iqtree2/archive/refs/tags/v.{{ version }}.tar.gz sha256: {{ sha256 }} - url: https://github.com/tothuhien/lsd2/archive/refs/tags/v.2.4.1.tar.gz sha256: 3d0921c96edb8f30498dc8a27878a76d785516043fbede4a72eefd84b5955458 @@ -23,9 +24,10 @@ requirements: - {{ compiler('cxx') }} - make - cmake - - llvm-openmp # [osx] - - ld64 # [osx] host: + - libgomp # [linux] + - llvm-openmp # [osx] + - ld64 # [osx] - boost-cpp - eigen - zlib @@ -38,15 +40,19 @@ test: about: home: "http://www.iqtree.org/" dev_url: "https://github.com/iqtree/iqtree2" - license: GPL-2.0-or-later + license: "GPL-2.0-or-later" license_family: GPL2 license_file: LICENSE summary: "Efficient phylogenomic software by maximum likelihood." + doc_url: "http://www.iqtree.org/doc/" extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:iq-tree - doi:10.1093/molbev/msu300 - doi:10.1038/nmeth.4285 - doi:10.1093/molbev/msx281 + - doi:10.1093/sysbio/syae008 - usegalaxy-eu:{{ name|lower }} diff --git a/recipes/irissv/meta.yaml b/recipes/irissv/meta.yaml index 88b85d9548522..842485ab0d1d9 100644 --- a/recipes/irissv/meta.yaml +++ b/recipes/irissv/meta.yaml @@ -1,16 +1,19 @@ -{% set version = "1.0.4" %} +{% set name = "irissv" %} +{% set version = "1.0.5" %} package: - name: irissv + name: "{{ name }}" version: {{ version }} source: - url: https://github.com/mkirsche/Iris/archive/{{ version }}.tar.gz - sha256: 1a7b609fa582abf901ef7392dd84fbcdabdca930be28cb0decb9fd7389aff6a2 + url: https://github.com/mkirsche/Iris/archive/refs/tags/v{{ version }}.tar.gz + sha256: a71718d418fb8b1afacbe2b3a6b91fd50cadc9e12c0b532739b955e455913b0b build: noarch: generic - number: 2 + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} requirements: run: diff --git a/recipes/isonform/meta.yaml b/recipes/isonform/meta.yaml new file mode 100644 index 0000000000000..8ae2d4739eed3 --- /dev/null +++ b/recipes/isonform/meta.yaml @@ -0,0 +1,39 @@ +{% set name = "isonform" %} +{% set version = "0.3.4" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/isONform-{{ version }}.tar.gz + sha256: fb96c32e0ce177bf7866b7a19fa6855b1e9fac8f8f164cdccc972e284fbcce47 + +build: + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage("isonform", max_pin="x.x") }} + +requirements: + host: + - python + - pip + run: + - python + - recordclass >=0.17.2 + - networkx >=2.7.1 + - parasail-python >=1.3.3 + - edlib >=1.1.2 + - spoa + +test: + commands: + - isONform_parallel --help + +about: + home: https://github.com/aljpetri/isONform + summary: De novo construction of isoforms from long-read data + license: GPL-3.0 + license_file: LICENSE diff --git a/recipes/isospecpy/meta.yaml b/recipes/isospecpy/meta.yaml index a40f7264077e9..a162dafa99b55 100644 --- a/recipes/isospecpy/meta.yaml +++ b/recipes/isospecpy/meta.yaml @@ -1,5 +1,5 @@ {% set name = "isospecpy" %} -{% set version = "2.2.1" %} +{% set version = "2.2.2" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/IsoSpecPy-{{ version }}.tar.gz - sha256: 5426cd5ff70835b9d6b54de60b8d7b850eb63758c7443378bcb6d84601a69075 + sha256: ca838870d31c4879f7e8d0ff782876858888532b6eb0d501fb9650bf5395578e build: script: {{ PYTHON }} -m pip install . -vv diff --git a/recipes/itol-config/meta.yaml b/recipes/itol-config/meta.yaml new file mode 100644 index 0000000000000..069a6ee5a623a --- /dev/null +++ b/recipes/itol-config/meta.yaml @@ -0,0 +1,46 @@ +{% set name = "itol-config" %} +{% set version = "0.1.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/jodyphelan/itol-config/archive/v{{ version }}.tar.gz + sha256: e4fb28eb6c434a7a2c823f0d34b86a483c67a7f139e2c18832d564b9b4555bb6 + +build: + number: 0 + noarch: python + entry_points: + - itol-config = itol_config.cli:cli + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + run_exports: + - {{ pin_subpackage('itol-config', max_pin="x.x") }} + +requirements: + host: + - python >=3.8 + - flit-core >=3.2,<4 + - pip + run: + - python >=3.8 + - tomli + +test: + imports: + - itol_config + commands: + - itol-config --help + +about: + home: https://github.com/jodyphelan/itol-config + license: MIT + license_family: MIT + license_file: LICENSE + doc_url: https://jodyphelan.github.io/itol-config/ + summary: Package to create iTOL config files + +extra: + recipe-maintainers: + - jodyphelan diff --git a/recipes/itolapi/meta.yaml b/recipes/itolapi/meta.yaml index 89d85e715441f..0e664d28481a5 100644 --- a/recipes/itolapi/meta.yaml +++ b/recipes/itolapi/meta.yaml @@ -1,5 +1,5 @@ {% set name = "itolapi" %} -{% set version = "4.1.2" %} +{% set version = "4.1.4" %} package: name: '{{ name|lower }}' @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 37a866a117a80d3d72a6eb6b2cba30444751c644cc6bc4242f050750375a8397 + sha256: 68e87ba51d209da556b0e373b3b0456b644a1a732c193fedbd7785ff37b6a2cb build: noarch: python diff --git a/recipes/itsxpress/meta.yaml b/recipes/itsxpress/meta.yaml index 5339657193c68..2ecd49b405f60 100644 --- a/recipes/itsxpress/meta.yaml +++ b/recipes/itsxpress/meta.yaml @@ -1,8 +1,8 @@ {% set name = "itsxpress" %} -{% set version = "2.0.1" %} +{% set version = "2.1.0" %} {% set file_ext = "tar.gz" %} {% set hash_type = "sha256" %} -{% set hash_value = "b5797107ee3f21cbaba0b9625aa931741babdee3eeb5a3218a8b8bc9783e2e72" %} +{% set hash_value = "608e5c55526d4c084f8ea552c7bd2d232505ae83751fc517c8ceabb2eb483aed" %} package: name: '{{ name|lower }}' diff --git a/recipes/ivar/build.sh b/recipes/ivar/build.sh index efb9691a31967..ae5ec4a1259df 100644 --- a/recipes/ivar/build.sh +++ b/recipes/ivar/build.sh @@ -4,7 +4,7 @@ export CPATH=${PREFIX}/include ./autogen.sh ./configure --prefix=$PREFIX --with-hts=$PREFIX -make +make -j${CPU_COUNT} # removing this for now as it triggers a build error from -Werror=maybe-uninitialized - pvanheus # make check make install diff --git a/recipes/ivar/meta.yaml b/recipes/ivar/meta.yaml index 9efba2fd8a3f7..fc9fd87e943eb 100644 --- a/recipes/ivar/meta.yaml +++ b/recipes/ivar/meta.yaml @@ -10,7 +10,9 @@ source: sha256: "{{ sha256 }}" build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage('ivar', max_pin='x') }} requirements: build: @@ -23,6 +25,7 @@ requirements: - pkg-config host: - htslib + - zlib run: - htslib - samtools @@ -39,6 +42,8 @@ about: dev_url: https://github.com/andersen-lab/ivar extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:ivar - usegalaxy-eu:ivar_variants diff --git a/recipes/jaeger-bio/meta.yaml b/recipes/jaeger-bio/meta.yaml new file mode 100644 index 0000000000000..388ff7957b63e --- /dev/null +++ b/recipes/jaeger-bio/meta.yaml @@ -0,0 +1,62 @@ +{% set name = "jaeger-bio" %} +{% set version = "1.1.26" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" + sha256: 7f7d8794cd04185f7787d92a6ccc89fa59bb58acbe0fe929c6bffbee39a90fe4 + +build: + number: 0 + script: "{{ PYTHON }} -m pip install . --no-cache-dir -vvv" + noarch: python + run_exports: + - {{ pin_subpackage('jaeger-bio', max_pin="x.x.x") }} + +requirements: + host: + - python =3 + - pip + run: + - python =3 + - pip + - h5py >=3.8 + - biopython >=1.78 + - kneed >=0.8.5 + - matplotlib-base >=3.7 + - numpy >=1.24 + - pandas >=1.5 + - psutil >=5 + - ruptures >=1.1.9 + - scikit-learn ==1.3.2 + - seaborn >=0.12.2 + - tqdm >=4.64.0 + - tensorflow >=2.15,<2.16 + - parasail-python >=1.3.4 + +test: + imports: + - jaegeraa + - jaegeraa.data + - jaegeraa.nnlib + + commands: + - Jaeger --help + +about: + home: "https://github.com/Yasas1994/Jaeger" + license: MIT + license_family: MIT + license_file: LICENSE + summary: "A quick and precise pipeline for detecting phages in sequence assemblies." + dev_url: https://github.com/Yasas1994/Jaeger + doc_url: https://readthedocs.org/projects/jaeger-docs/ + +extra: + identifiers: + - biotools:jaeger + recipe-maintainers: + - Yasas1994 diff --git a/recipes/jbrowse2/meta.yaml b/recipes/jbrowse2/meta.yaml index 48774c686d68b..c4d285c98c707 100644 --- a/recipes/jbrowse2/meta.yaml +++ b/recipes/jbrowse2/meta.yaml @@ -1,12 +1,12 @@ # When updating, check the @jbrowse/cli version in build.sh too -{% set version = "2.10.1" %} +{% set version = "2.11.0" %} package: name: jbrowse2 version: {{ version }} source: - sha256: 9495e73d98e4eb287c8a48d8d4a61f2523755a4582681ce4e8e09b9e0fbef291 + sha256: e6bed6c3043ef5b87bcda83944c30e869d2a8b5c7ee224692a928f1d6624f515 url: https://github.com/GMOD/jbrowse-components/releases/download/v{{ version }}/jbrowse-web-v{{ version }}.zip build: diff --git a/recipes/jolytree/meta.yaml b/recipes/jolytree/meta.yaml index 5e7a9410d0d4a..ba38a2d116e19 100644 --- a/recipes/jolytree/meta.yaml +++ b/recipes/jolytree/meta.yaml @@ -1,7 +1,7 @@ {% set name = "JolyTree" %} -{% set version = "1.1b" %} +{% set version = "2.1" %} {% set owner = "GIPhy" %} -{% set sha256 = "e356c18d933f23bca900b6a620d6364bdbf0c39e7aeea2241f63f906fbc015ac" %} +{% set sha256 = "e3af4675c564e7d77bc104ae63f473dd1cdd7be6a82c883db70e7599acfb763b" %} package: name: {{ name|lower }} @@ -13,14 +13,16 @@ source: build: noarch: generic - number: 1 + number: 0 + run_exports: + - {{ pin_subpackage("jolytree", max_pin="x") }} requirements: run: - mash >=1.0.2 - gawk >=4.1.3 - fastme >=2.1.5 - - req >=v1.3.190304ac + - req >=1.2 test: commands: diff --git a/recipes/jronn/build.gradle b/recipes/jronn/build.gradle new file mode 100644 index 0000000000000..a205cea7dbc3d --- /dev/null +++ b/recipes/jronn/build.gradle @@ -0,0 +1,26 @@ +plugins { + id "java" +} + +version = "$System.env.PKG_VERSION" +sourceCompatibility = 11 + +repositories { + mavenCentral() +} + +dependencies { + implementation "org.biojava:biojava-protein-disorder:$System.env.PKG_VERSION" +} + +jar { + manifest { + attributes "Main-Class": "org.biojava.nbio.ronn.ORonn" + } + + archiveBaseName = "jronn" + duplicatesStrategy = DuplicatesStrategy.EXCLUDE + from { + configurations.runtimeClasspath.collect { it.isDirectory() ? it : zipTree(it) } + } +} diff --git a/recipes/jronn/build.sh b/recipes/jronn/build.sh new file mode 100644 index 0000000000000..e91ffbeb416a5 --- /dev/null +++ b/recipes/jronn/build.sh @@ -0,0 +1,12 @@ +#!/bin/bash +set -eu + +OUTDIR=$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM +mkdir -p $OUTDIR +mkdir -p $PREFIX/bin + +PKG_VERSION="$PKG_VERSION" gradle jar +cp build/libs/jronn-$PKG_VERSION.jar $OUTDIR/ +sed "s/{{PKG_VERSION}}/$PKG_VERSION/" $RECIPE_DIR/jronn.sh > $OUTDIR/jronn +ln -s $OUTDIR/jronn $PREFIX/bin/jronn +chmod +x $PREFIX/bin/jronn diff --git a/recipes/jronn/jronn.sh b/recipes/jronn/jronn.sh new file mode 100644 index 0000000000000..e0be794a48630 --- /dev/null +++ b/recipes/jronn/jronn.sh @@ -0,0 +1,11 @@ +#!/bin/bash +set -e + +JAR_NAME="jronn-{{PKG_VERSION}}.jar" + +if [ -x "$JAVA_HOME/bin/java" ]; then + JAVA=$JAVA_HOME/bin/java +else + JAVA=$(which java) +fi +$JAVA -jar "$(dirname $(readlink -f "$0"))/$JAR_NAME" "$@" diff --git a/recipes/jronn/meta.yaml b/recipes/jronn/meta.yaml new file mode 100644 index 0000000000000..3e5f84db816be --- /dev/null +++ b/recipes/jronn/meta.yaml @@ -0,0 +1,54 @@ +# no need to update version anywhere else +{% set version="7.1.0" %} + +package: + name: jronn + version: {{ version }} + +build: + number: 1 + noarch: generic + run_exports: + - {{ pin_subpackage('jronn', max_pin="x.x") }} + +source: + path: "./build.gradle" + sha256: b554e160a0f7b40a528d2c85c2d9a2e943d42150381ea9290a1df4a2ef0efc91 + +requirements: + build: + - gradle =7.4 + host: + - openjdk >=11,<18 + run: + - openjdk >=11 + +test: + commands: + - jronn 2>&1 | grep "JRONN version 3.1" + +about: + home: https://biojava.org/ + dev_url: https://github.com/biojava/biojava/tree/master/biojava-protein-disorder + license: LGPL-2.1 + summary: "JRONN is based on the C implementation of RONN algorithm." + description: >- + JRONN is a Java implementation of RONN. JRONN is based on RONN and uses the + same model data, therefore gives the same predictions. Main motivation + behind JRONN development was providing an implementation of RONN more + suitable to use by the automated analysis pipelines and web services. + + Original version of RONN is described in Yang,Z.R., Thomson,R., + McMeil,P. and Esnouf,R.M. (2005) RONN: the bio-basis function neural network + technique applied to the detection of natively disordered regions in proteins + Bioinformatics 21: 3369-3376 + See also http://www.strubi.ox.ac.uk/RONN + +extra: + notes: + JRONN is a Java program that comes with a custom wrapper shell script. + The shell wrapper is called "jronn" and is present on $PATH by default. + The Java program is executed by jvm pointed to by the $JAVA_HOME variable. + Otherwise, a "java" program from the current environment is used. + identifiers: + - biotools:protein-disorder diff --git a/recipes/jvarkit/meta.yaml b/recipes/jvarkit/meta.yaml index edd61c75b9c09..2df572a94b08a 100644 --- a/recipes/jvarkit/meta.yaml +++ b/recipes/jvarkit/meta.yaml @@ -1,6 +1,6 @@ {% set name = "jvarkit" %} -{% set version = "2023.09.07" %} -{% set sha256 = "8cd3554d4614a323a6bb1d1b342d2d271f8b896769e595022c20198cf10bd254" %} +{% set version = "2024.04.20" %} +{% set sha256 = "e4bb5ad1d8743cccc2a94af2ea6f17e883c3ec5e6674d9dcd3162a84b7de9d45" %} package: name: {{ name|lower }} diff --git a/recipes/kaiju/build.sh b/recipes/kaiju/build.sh index 18d6b28918644..8ce3705bf9885 100755 --- a/recipes/kaiju/build.sh +++ b/recipes/kaiju/build.sh @@ -11,7 +11,7 @@ mkdir -p $PREFIX/bin cd $SRC_DIR/src/ -make CC=${CC} CXX=${CXX} +make CC=${CC} CXX=${CXX} -j ${CPU_COUNT} cd $SRC_DIR/bin/ cp kaiju* $PREFIX/bin diff --git a/recipes/kaiju/meta.yaml b/recipes/kaiju/meta.yaml index a12694188896f..db305614f3c6f 100644 --- a/recipes/kaiju/meta.yaml +++ b/recipes/kaiju/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.10.0" %} +{% set version = "1.10.1" %} package: name: kaiju @@ -6,10 +6,10 @@ package: source: url: https://github.com/bioinformatics-centre/kaiju/archive/v{{ version }}.tar.gz - sha256: 328c85ee1d5e4eafb18b8dd0bcf26b6ba88ba15ab4f14443ac643cd7e6675267 + sha256: 3cc05533bf6007ffeff2d755c935354952b09a6b903c5e538dff14285b3c86e8 build: - number: 0 + number: 1 no_link: - bin/kaiju-makedb.sh run_exports: @@ -42,6 +42,8 @@ about: dev_url: https://github.com/bioinformatics-centre/kaiju extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:kaiju - doi:10.1038/ncomms11257 diff --git a/recipes/kalign2/meta.yaml b/recipes/kalign2/meta.yaml index 12287cdb17f9d..0c5f0efab39a6 100644 --- a/recipes/kalign2/meta.yaml +++ b/recipes/kalign2/meta.yaml @@ -6,8 +6,9 @@ package: version: {{ version }} build: - number: 5 - skip: True # [osx] + number: 6 + run_exports: + - {{ pin_subpackage('kalign2', max_pin='x') }} source: url: http://msa.sbc.su.se/downloads/kalign/current.tar.gz @@ -31,3 +32,5 @@ about: extra: identifiers: - doi:10.1186/1471-2105-6-298 + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/kallisto/meta.yaml b/recipes/kallisto/meta.yaml index 88a82fc9c9e7f..44bbf45c4ae97 100644 --- a/recipes/kallisto/meta.yaml +++ b/recipes/kallisto/meta.yaml @@ -9,7 +9,7 @@ source: sha256: 030752bab3b0e33cd3f23f6d8feddd74194e5513532ffbf23519e84db2a86d34 build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('kallisto', max_pin="x.x") }} @@ -51,3 +51,5 @@ extra: - mjsteinbaugh skip-lints: - missing_tests + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/kaptive/build.sh b/recipes/kaptive/build.sh deleted file mode 100644 index 8792b601d75fa..0000000000000 --- a/recipes/kaptive/build.sh +++ /dev/null @@ -1,9 +0,0 @@ -#!/bin/bash -mkdir -p $PREFIX/bin -mv kaptive.py $PREFIX/bin -chmod +x $PREFIX/bin/kaptive.py -mkdir -p $PREFIX/opt/kaptive_reference_database -mkdir -p $PREFIX/opt/kaptive_sample_data - -mv $SRC_DIR/reference_database/*.* $PREFIX/opt/kaptive_reference_database/ -mv $SRC_DIR/sample_data/*.* $PREFIX/opt/kaptive_reference_database/ diff --git a/recipes/kaptive/meta.yaml b/recipes/kaptive/meta.yaml index 84ac9c281a046..60b9b840802d8 100644 --- a/recipes/kaptive/meta.yaml +++ b/recipes/kaptive/meta.yaml @@ -1,30 +1,47 @@ -{% set version = "2.0.6" %} +{% set name = "kaptive" %} +{% set version = "3.0.0b1" %} package: - name: kaptive + name: {{ name|lower }} version: {{ version }} source: - url: https://github.com/katholt/Kaptive/archive/v{{ version }}.tar.gz - sha256: 53a90693c00a05b55e7ebb6f2eb999a89f47f6c279600ac2018f831287119019 + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/kaptive-{{ version }}.tar.gz + sha256: ee3f4dc710b91580db84f9eb24bfc8adf6bc9d52871a018f0aabb0c4b6dd5790 build: + entry_points: + - kaptive = kaptive.__main__:main + noarch: python + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation --no-cache-dir number: 0 - noarch: generic + run_exports: + - {{ pin_subpackage('kaptive', max_pin="x") }} requirements: + host: + - python >=3.9 + - pip run: - - python >=3 - - biopython <1.78 - - numpy - - blast >=2.3.0 + - python >=3.9 + - biopython + - dna_features_viewer test: + imports: + - kaptive commands: - - kaptive.py -h + - kaptive --help about: - home: https://github.com/katholt/Kaptive - license: GPL3 + home: "https://kaptive.readthedocs.io/en/latest" + dev_url: "https://github.com/klebgenomics/Kaptive" + summary: "Reports information about surface polysaccharide loci for Klebsiella pneumoniae species complex and Acinetobacter baumannii genome assemblies." + license: "GPL-3.0-or-later" + license_family: GPL3 license_file: LICENSE - summary: Reports information about surface polysaccharide loci for Klebsiella and Acinetobacter baumannii genome assemblies + doc_url: "https://kaptive.readthedocs.io/en/latest" + +extra: + recipe-maintainers: + - tomdstanton diff --git a/recipes/kaptive/post-link.sh b/recipes/kaptive/post-link.sh deleted file mode 100644 index 04984ece131ff..0000000000000 --- a/recipes/kaptive/post-link.sh +++ /dev/null @@ -1,5 +0,0 @@ -#!/bin/bash -echo "Kaptive is installed with its database at...$PREFIX/opt/kaptive_reference_database. When you run kaptive.py, you can specify -path to one of the databases as the following example: -kaptive.py -fa /path/to/a/file.fasta -k $PREFIX/opt/kaptive_reference_database/Klebsiella_k_locus_primary_reference.gbk -o output -" diff --git a/recipes/kb-python/config.py.patch b/recipes/kb-python/config.py.patch deleted file mode 100644 index d1bf314ad1f56..0000000000000 --- a/recipes/kb-python/config.py.patch +++ /dev/null @@ -1,19 +0,0 @@ ---- a/kb_python/config.py -+++ b/kb_python/config.py -@@ -19,6 +19,7 @@ def get_provided_kallisto_path(): - :return: path to the binary, `None` if not found - :rtype: str - """ -+ return "kallisto" - bin_filename = 'kallisto.exe' if PLATFORM == 'windows' else 'kallisto' - path = os.path.join( - PACKAGE_PATH, BINS_DIR, PLATFORM, 'kallisto', bin_filename -@@ -34,6 +35,7 @@ def get_provided_bustools_path(): - :return: path to the binary, `None` if not found - :rtype: str - """ -+ return "bustools" - bin_filename = 'bustools.exe' if PLATFORM == 'windows' else 'bustools' - path = os.path.join( - PACKAGE_PATH, BINS_DIR, PLATFORM, 'bustools', bin_filename - diff --git a/recipes/kb-python/meta.yaml b/recipes/kb-python/meta.yaml index 23a0ad79fcaaa..f7bd0adb17bd0 100644 --- a/recipes/kb-python/meta.yaml +++ b/recipes/kb-python/meta.yaml @@ -8,10 +8,9 @@ package: source: url: https://github.com/pachterlab/kb_python/archive/v{{ version }}.tar.gz sha256: e8c910865fd5196b1b3163e18a565ef96c8518b2cf34f87f288dfdc85b339078 - patches: config.py.patch build: - number: 0 + number: 2 noarch: python script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" entry_points: @@ -21,10 +20,10 @@ build: requirements: host: - - python >=3.7 + - python >=3.7, <3.9 - pip run: - - python >=3.7 + - python >=3.7, <3.9 - anndata >=0.6.22.post1 - h5py >=2.10.0 - jinja2 >2.10.1 @@ -33,13 +32,11 @@ requirements: - nbformat >=4.4.0 - ngs-tools >=1.5.11 - numpy >=1.17.2 - - pandas >=1.0.0 + - pandas >=1.0.0, <2 - plotly >=4.5.0 - scanpy >=1.4.4.post1 - scikit-learn >=0.21.3 - tqdm >=4.39.0 - - kallisto >=0.46.2 - - bustools >=0.40.0 - requests >=2.22.0 - typing-extensions >=3.7.4 diff --git a/recipes/kingfisher/meta.yaml b/recipes/kingfisher/meta.yaml index 855fa0bd6e4fb..82a4ed31a27c7 100644 --- a/recipes/kingfisher/meta.yaml +++ b/recipes/kingfisher/meta.yaml @@ -1,5 +1,5 @@ {% set name = "kingfisher" %} -{% set version = "0.3.1" %} +{% set version = "0.4.1" %} package: name: {{ name }} @@ -7,12 +7,12 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/kingfisher-{{ version }}.tar.gz - sha256: 2d2dae22f7345a5ad7ba8d64e310a9033667ca09aabdf3bea4ace05a629c388f + sha256: b74510c997db71432b4feb03398b8432b883d873d0d05eb2f0e5a1dafbce42f6 build: noarch: python number: 0 - script: {{ PYTHON }} -m pip install . --ignore-installed --no-deps -vv + script: {{ PYTHON }} -m pip install . --no-build-isolation --no-deps -vvv run_exports: - {{ pin_subpackage('kingfisher', max_pin="x") }} @@ -39,15 +39,13 @@ test: imports: - kingfisher commands: - - pip check - kingfisher --version | grep {{ version }} - requires: - - pip about: home: https://github.com/wwood/kingfisher-download summary: Download/extract biological FASTA/Q read data and metadata license: GPL-3.0-or-later + license_family: GPL3 license_file: LICENCE.txt extra: diff --git a/recipes/kma/build.sh b/recipes/kma/build.sh index 202febb333a5e..20626f6691fb4 100755 --- a/recipes/kma/build.sh +++ b/recipes/kma/build.sh @@ -1,5 +1,7 @@ +#!/bin/bash + BINARIES="kma kma_index kma_shm kma_update" -make CFLAGS="-w -O3 -I$PREFIX/include -L$PREFIX/lib" +make CFLAGS="${CFLAGS} -w -O3 -I${PREFIX}/include -L${PREFIX}/lib" mkdir -p ${PREFIX}/bin cp $BINARIES $PREFIX/bin diff --git a/recipes/kma/meta.yaml b/recipes/kma/meta.yaml index 8cfa498075d15..0ba3d848b9a81 100644 --- a/recipes/kma/meta.yaml +++ b/recipes/kma/meta.yaml @@ -1,6 +1,6 @@ {% set name = "kma" %} -{% set version = "1.4.9" %} -{% set sha256 = "6434e6fcc23420edc29922baf289e4a6d923f31949c34d8efd2331f3bb5e8e8b" %} +{% set version = "1.4.14" %} +{% set sha256 = "85971fcb2e806d2ee95d3499cd9b358f313b1635d5d71cb189eabc503be4b10f" %} package: name: {{ name|lower }} @@ -11,7 +11,9 @@ source: sha256: {{ sha256 }} build: - number: 2 + number: 1 + run_exports: + - {{ pin_subpackage('kma', max_pin="x") }} requirements: build: @@ -21,7 +23,7 @@ requirements: - zlib run: - zlib - + test: commands: - kma -h | grep KMA >/dev/null @@ -33,6 +35,10 @@ about: home: https://bitbucket.org/genomicepidemiology/kma summary: 'KMA is mapping a method designed to map raw reads directly against redundant databases, in an ultra-fast manner using seed and extend.' license: Apache-2.0 + license_family: APACHE + extra: + additional-platforms: + - linux-aarch64 identifiers: - doi:10.1186/s12859-018-2336-6 diff --git a/recipes/kmc/Makefile.patch b/recipes/kmc/Makefile.patch deleted file mode 100644 index fb9711ad7ff95..0000000000000 --- a/recipes/kmc/Makefile.patch +++ /dev/null @@ -1,71 +0,0 @@ -From 4a29584d69d40a41d2569899b03a5660af85f97c Mon Sep 17 00:00:00 2001 -From: marekkokot -Date: Thu, 20 Jan 2022 19:51:36 +0100 -Subject: [PATCH] makefile for bioconda - ---- - Makefile | 27 ++++++++++++++++++--------- - 1 file changed, 18 insertions(+), 9 deletions(-) - -diff --git a/Makefile b/Makefile -index bc07d35..d2784a7 100644 ---- a/Makefile -+++ b/Makefile -@@ -22,8 +22,8 @@ ifeq ($(UNAME_S),Darwin) - else - CC = g++ - -- CFLAGS = -Wall -O3 -m64 -static -Wl,--whole-archive -lpthread -Wl,--no-whole-archive -std=c++14 -- CLINK = -lm -static -O3 -Wl,--whole-archive -lpthread -Wl,--no-whole-archive -std=c++14 -+ CFLAGS = -Wall -O3 -m64 -pthread -std=c++14 -+ CLINK = -lm -O3 -std=c++14 - - PY_KMC_API_CFLAGS = -fPIC -Wall -shared -std=c++14 -O3 - endif -@@ -69,13 +69,9 @@ else - $(KMC_MAIN_DIR)/raduls_avx2.o \ - $(KMC_MAIN_DIR)/raduls_avx.o - -- KMC_LIBS = \ -- $(KMC_MAIN_DIR)/libs/libz.a \ -- $(KMC_MAIN_DIR)/libs/libbz2.a -- -- KMC_TOOLS_LIBS = \ -- $(KMC_TOOLS_DIR)/libs/libz.a \ -- $(KMC_TOOLS_DIR)/libs/libbz2.a -+ KMC_LIBS = -lz -lbz2 -lpthread -+ -+ KMC_TOOLS_LIBS = -lz -lbz2 -lpthread - - LIB_KMC_CORE = $(OUT_BIN_DIR)/libkmc_core.a - endif -@@ -90,6 +86,12 @@ $(KMC_API_DIR)/mmer.o \ - $(KMC_API_DIR)/kmc_file.o \ - $(KMC_API_DIR)/kmer_api.o - -+KMC_API_PICO = \ -+$(KMC_API_DIR)/mmer.pico \ -+$(KMC_API_DIR)/kmc_file.pico \ -+$(KMC_API_DIR)/kmer_api.pico -+ -+ - KMC_API_SRC_FILES = $(wildcard $(KMC_API_DIR)/*.cpp) - PY_KMC_API_OBJS = $(patsubst $(KMC_API_DIR)/%.cpp,$(PY_KMC_API_DIR)/%.o,$(KMC_API_SRC_FILES)) - -@@ -110,6 +112,13 @@ $(KMC_TOOLS_DIR)/kff_info_reader.o - $(KMC_CLI_OBJS) $(KMC_CORE_OBJS) $(KMC_DUMP_OBJS) $(KMC_API_OBJS) $(KFF_OBJS) $(KMC_TOOLS_OBJS): %.o: %.cpp - $(CC) $(CFLAGS) -c $< -o $@ - -+$(KMC_API_PICO): %.pico: %.cpp -+ $(CC) $(CFLAGS) -fpic -c -o $@ $< -+ -+$(OUT_BIN_DIR)/libkmc_api.so: $(KMC_API_PICO) -+ -mkdir -p $(OUT_BIN_DIR) -+ $(CC) -shared $(LDFLAGS) -o $@ $^ -+ - $(KMC_MAIN_DIR)/raduls_sse2.o: $(KMC_MAIN_DIR)/raduls_sse2.cpp - $(CC) $(CFLAGS) -msse2 -c $< -o $@ - $(KMC_MAIN_DIR)/raduls_sse41.o: $(KMC_MAIN_DIR)/raduls_sse41.cpp --- -2.34.1 - diff --git a/recipes/kmc/build.sh b/recipes/kmc/build.sh index 7cb93486302dd..2b3e4f0ef50b6 100644 --- a/recipes/kmc/build.sh +++ b/recipes/kmc/build.sh @@ -1,23 +1,17 @@ #!/bin/bash -mkdir -p $PREFIX/bin -mkdir -p $PREFIX/lib -mkdir -p $PREFIX/include +mkdir -p ${PREFIX}/bin +mkdir -p ${PREFIX}/lib +mkdir -p ${PREFIX}/include -if [ "$(uname)" == "Darwin" ]; then +if [ "$(uname)" == "Darwin" ]; then mv bin/kmc ${PREFIX}/bin mv bin/kmc_tools ${PREFIX}/bin mv bin/kmc_dump ${PREFIX}/bin else - make CC=${CXX} -j32 all bin/libkmc_api.so - mv bin/kmc $PREFIX/bin - mv bin/kmc_tools $PREFIX/bin - mv bin/kmc_dump $PREFIX/bin - mv bin/libkmc_core.a $PREFIX/lib - mv bin/libkmc_api.so $PREFIX/lib/libkmc.so - mv kmc_api/*.h $PREFIX/include - mv include/kmc_runner.h $PREFIX/include + mv bin/kmc ${PREFIX}/bin + mv bin/kmc_tools ${PREFIX}/bin + mv bin/kmc_dump ${PREFIX}/bin + mv bin/libkmc_core.a ${PREFIX}/lib + mv include/kmc_runner.h ${PREFIX}/include fi - - - diff --git a/recipes/kmc/build_failure.linux-64.yaml b/recipes/kmc/build_failure.linux-64.yaml deleted file mode 100644 index fc88366e0a16b..0000000000000 --- a/recipes/kmc/build_failure.linux-64.yaml +++ /dev/null @@ -1,2 +0,0 @@ -recipe_sha: abc0774a2c2552b5cc367cf53ea0fd7ea3f67f838a2b3ad526a5a43886553235 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. diff --git a/recipes/kmc/meta.yaml b/recipes/kmc/meta.yaml index b58633c5e5856..bde88e12d619b 100644 --- a/recipes/kmc/meta.yaml +++ b/recipes/kmc/meta.yaml @@ -1,29 +1,28 @@ -{% set version = "3.2.1" %} -{% set url = "https://github.com/refresh-bio/KMC/archive/v3.2.1.tar.gz" %} # [linux] -{% set sha256 = "7db333091a754508163a097c41720cf32a80abe160bef60f3fc82c8da1d67896" %} # [linux] -{% set url = "https://github.com/refresh-bio/kmc/releases/download/v3.2.1/kmc3.2.1.mac.tar.gz" %} # [osx] -{% set sha256 = "d4bd30d5e16bcbaac7f979f18e49e7447b0148709fb26f754490be9e3e766e73" %} # [osx] - +{% set name = "kmc" %} +{% set version = "3.2.4" %} +{% set url = "https://github.com/refresh-bio/KMC/releases/download/v3.2.4/KMC3.2.4.linux.x64.tar.gz" %} # [linux and x86_64] +{% set sha256 = "158f2084f8d928b3f33b8aaf7d1220fee4183bf46837787e5e6b16bbdf54d31d" %} # [linux and x86_64] +{% set url = "https://github.com/refresh-bio/KMC/releases/download/v3.2.4/KMC3.2.4.linux.arm64.tar.gz" %} # [linux and aarch64] +{% set sha256 = "3049745a71c4219fb05cf003a53b03a9f434e8afacb79c710488f1aefae0a9c8" %} # [linux and aarch64] +{% set url = "https://github.com/refresh-bio/KMC/releases/download/v3.2.4/KMC3.2.4.mac.x64.tar.gz" %} # [osx] +{% set sha256 = "70d66545d5802cf116469e41acb2a04631271feac81ff5c4d1c299e9407ca326" %} # [osx] package: - name: kmc + name: {{ name }} version: {{ version }} source: url: {{ url }} sha256: {{ sha256 }} - patches: - - Makefile.patch # [linux] build: - number: 3 + number: 1 + run_exports: + - {{ pin_subpackage("kmc", max_pin="x") }} requirements: build: - make - - bzip2 - - zlib - - {{ compiler('c') }} - {{ compiler('cxx') }} host: - zlib @@ -32,6 +31,10 @@ requirements: - zlib - bzip2 +test: + commands: + - kmc --help # [not aarch64] + about: home: https://github.com/refresh-bio/kmc summary: "Tools for efficient k-mer counting and filtering of reads based on k-mer content." @@ -39,8 +42,13 @@ about: KMC is a utility designed for counting k-mers (sequences of consecutive k symbols) in a set of DNA sequences. KMC tools allow performing various operations on k-mers sets. license: GPL-3 - license_family: GPL + license_family: GPL3 license_file: gpl-3.0.txt -test: - commands: - - kmc --help + dev_url: https://github.com/refresh-bio/kmc + +extra: + additional-platforms: + - linux-aarch64 + identifiers: + - biotools:kmc + - doi:10.1093/bioinformatics/btx304 diff --git a/recipes/kmer-jellyfish/build.sh b/recipes/kmer-jellyfish/build.sh index c10cb1869a9c5..071a68120b44c 100644 --- a/recipes/kmer-jellyfish/build.sh +++ b/recipes/kmer-jellyfish/build.sh @@ -1,6 +1,5 @@ #!/bin/bash -autoreconf -fi ./configure --prefix=$PREFIX -make +make -j 4 make install diff --git a/recipes/kmer-jellyfish/meta.yaml b/recipes/kmer-jellyfish/meta.yaml index 14cf2981e3866..9d58c7c727f83 100644 --- a/recipes/kmer-jellyfish/meta.yaml +++ b/recipes/kmer-jellyfish/meta.yaml @@ -1,26 +1,22 @@ -{% set version = "2.3.0" %} +{% set version = "2.3.1" %} package: name: kmer-jellyfish version: {{ version }} build: - number: 4 + number: 0 + run_exports: + - {{ pin_subpackage("kmer-jellyfish", max_pin="2.3.1") }} source: url: https://github.com/gmarcais/Jellyfish/releases/download/v{{ version }}/jellyfish-{{ version }}.tar.gz - sha256: e195b7cf7ba42a90e5e112c0ed27894cd7ac864476dc5fb45ab169f5b930ea5a + sha256: ee032b57257948ca0f0610883099267572c91a635eecbd88ae5d8974c2430fcd requirements: build: - make - {{ compiler('cxx') }} - - autoconf <2.7 # configure script has a problem with later autoconf - - automake - - gettext - - libtool - - pkg-config - - yaggo >=1.5.8 test: commands: diff --git a/recipes/koverage/meta.yaml b/recipes/koverage/meta.yaml index 385acafa06329..fb97ab5265ccd 100644 --- a/recipes/koverage/meta.yaml +++ b/recipes/koverage/meta.yaml @@ -1,5 +1,5 @@ {% set name = "koverage" %} -{% set version = "0.1.7" %} +{% set version = "0.1.11" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 75561037d21f1577200b659d097ef72ccb305f2cf5323eabda5d86cee15916ff + sha256: 24d785d654524a59c109f6fb3b3f6fc211b5f7177d643597f144fc6954a74d57 build: noarch: python @@ -18,18 +18,18 @@ build: requirements: host: - - python >=3.8 + - python >=3.10 - pip run: - - python >=3.8 + - python >=3.10 - snaketool-utils >=0.0.4 - metasnek >=0.0.8 - - snakemake >=7.14.0 + - snakemake >=7.14.0,<8 + - pulp <2.8 - pyyaml >=6.0 - Click >=8.1.3 - zstandard >=0.21.0 - numpy >=1.24.3 - - py-spy >=0.3.14 - datapane >=0.16.7 - plotly >=5.15.0 diff --git a/recipes/kpop/build.sh b/recipes/kpop/build.sh new file mode 100644 index 0000000000000..5a56f71b06c0b --- /dev/null +++ b/recipes/kpop/build.sh @@ -0,0 +1,7 @@ +#!/bin/bash + +mkdir -p $PREFIX/bin +cp $SRC_DIR/KPop* $PREFIX/bin + +chmod +x $PREFIX/bin +chmod +x $PREFIX/bin/KPop* diff --git a/recipes/kpop/meta.yaml b/recipes/kpop/meta.yaml new file mode 100644 index 0000000000000..2ed264f8d134b --- /dev/null +++ b/recipes/kpop/meta.yaml @@ -0,0 +1,50 @@ +{% set name = "kpop" %} +{% set version = "1.1.1" %} +{% set sha_linux = "915eb6d4e0b41b4f6409b5fd97188193106b3300734c92131ab8ad0618051e4a" %} +{% set sha_macos = "06c15129e9ecea58092f5e4d5df136a0c227815f011f80f63ad9093d70cc46d3" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + - url: https://github.com/PaoloRibeca/KPop/releases/download/v{{ version }}/KPop-{{ version }}-Linux_x86-64.tar.xz # [linux] + sha256: {{ sha_linux }} # [linux] + - url: https://github.com/PaoloRibeca/KPop/releases/download/v{{ version }}/KPop-{{ version }}-MacOS_x86-64.tar.xz # [osx] + sha256: {{ sha_macos }} # [osx] + +build: + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} + number: 0 + +requirements: + run: + - r-data.table + - r-ca + +test: + commands: + - KPopCount -V + - KPopCountDB -V + - KPopTwist_ -V + - KPopTwistDB -V + +about: + home: https://github.com/PaoloRibeca/KPop + license: GPL-3.0-only + license_file: LICENSE + summary: 'An assembly-free and scalable method for the comparative analysis of microbial genomes, based on full k-mer spectra and dataset-specific transformations.' + description: + KPop is an assembly-free and scalable method for the comparative analysis of microbial genomes, + based on full k-mer spectra and dataset-specific transformations. It is built using OCaml and R . + dev_url: https://github.com/PaoloRibeca/KPop + +extra: + skip-lints: + - should_be_noarch_generic + identifiers: + - doi:10.1101/2022.06.22.497172 + recipe-maintainers: + - PaoloRibeca + - ryanmorrison22 diff --git a/recipes/kseqpp/meta.yaml b/recipes/kseqpp/meta.yaml index 97cc6aefc36aa..595e642475766 100644 --- a/recipes/kseqpp/meta.yaml +++ b/recipes/kseqpp/meta.yaml @@ -1,5 +1,5 @@ {% set name = "kseqpp" %} -{% set version = "1.1.1" %} +{% set version = "1.1.2" %} package: name: {{ name|lower }} @@ -7,10 +7,12 @@ package: source: url: https://github.com/cartoonist/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz - sha256: 7bad18d7b00b74f15503f1961c71455d5dcf751e539287aa8fc74c31a63a513f + sha256: 80d5da09f725517fe27c13bbc3efea55735ef426ffe086fd0544e18e670190be build: - number: 1 + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: host: diff --git a/recipes/lamassemble/meta.yaml b/recipes/lamassemble/meta.yaml index 1c0464b1f1233..dc72a38790941 100644 --- a/recipes/lamassemble/meta.yaml +++ b/recipes/lamassemble/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.7.0" %} +{% set version = "1.7.2" %} package: name: lamassemble @@ -6,7 +6,7 @@ package: source: url: https://gitlab.com/mcfrith/lamassemble/-/archive/{{ version }}/lamassemble-{{ version }}.tar.gz - sha256: e30c1450fb2d17e9203ff702971e100a2e9e842c4fa06d6c605105d1b895957f + sha256: 786f509c4b4b61521ff4d6bbe589acd7fdd49969bf190db345d501a823a91a75 build: number: 0 diff --git a/recipes/last/build.sh b/recipes/last/build.sh new file mode 100644 index 0000000000000..869569e244d1f --- /dev/null +++ b/recipes/last/build.sh @@ -0,0 +1,11 @@ +#!/usr/bin/env bash + +set -xe + +ARCH=$(uname -m) +case ${ARCH} in + x86_64) ARCH_FLAGS="-msse4" ;; + *) ARCH_FLAGS="" ;; +esac + +make install CXXFLAGS="$CXXFLAGS ${ARCH_FLAGS} -pthread" prefix=$PREFIX \ No newline at end of file diff --git a/recipes/last/meta.yaml b/recipes/last/meta.yaml index 673ba234ef336..7f57e5ad79a0a 100644 --- a/recipes/last/meta.yaml +++ b/recipes/last/meta.yaml @@ -1,5 +1,5 @@ {% set name = "LAST" %} -{% set version = "1522" %} +{% set version = "1542" %} package: name: {{ name|lower }} @@ -7,13 +7,12 @@ package: source: url: https://gitlab.com/mcfrith/last/-/archive/{{ version }}/last-{{ version }}.zip - sha256: 0cc27dce53693c4d97864c012f9b9b34e4c02ebd0c38db23c5c5d978dbfd4d4e + sha256: ee26e762fe76d167241f7e85b5e72ef8d17ed243c405e38dbbd06de97003596a build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('last', max_pin=None) }} - script: make install CXXFLAGS="$CXXFLAGS -msse4 -pthread" prefix=$PREFIX requirements: build: @@ -59,6 +58,8 @@ about: description: "LAST finds & aligns related regions of sequences. It is designed for moderately large data (e.g. genomes, DNA reads, proteomes). It's especially good at: finding rearrangements and recombinations; finding DNA-versus-protein related regions; unusual data like AT-rich DNA; sensitive DNA-DNA search." extra: + additional-platforms: + - linux-aarch64 container: extended-base: True identifiers: diff --git a/recipes/learnmsa/meta.yaml b/recipes/learnmsa/meta.yaml index dacfbf73ca0a2..393e43a11f17d 100644 --- a/recipes/learnmsa/meta.yaml +++ b/recipes/learnmsa/meta.yaml @@ -1,5 +1,5 @@ {% set name = "learnMSA" %} -{% set version = "1.3.2" %} +{% set version = "2.0.1" %} package: name: "{{ name|lower }}" @@ -7,14 +7,16 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: da7ec9b5f89685098cbeb272918e9c89f2e67bd6698dbbc7bfa49a036d06d73c + sha256: 1f1322d33a83358b989cf26569865cd89235abfecce743aab62c8b8fe3681a51 build: number: 0 entry_points: - learnMSA = learnMSA.run:run_main - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vvv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" noarch: python + run_exports: + - {{ pin_subpackage('learnmsa', max_pin="x") }} requirements: host: @@ -26,9 +28,12 @@ requirements: - seaborn - python >=3.9 - tensorflow >=2.7.0,<2.11 + - tensorflow-probability <=0.18.0 - biopython >=1.69 - pyfamsa - transformers + - imageio + - sentencepiece test: imports: @@ -50,3 +55,6 @@ about: extra: recipe-maintainers: - felbecker + identifiers: + - doi:10.1093/gigascience/giac104 + - biotools:learnMSA diff --git a/recipes/lemur/meta.yaml b/recipes/lemur/meta.yaml new file mode 100644 index 0000000000000..1e8ba3fb9aaa2 --- /dev/null +++ b/recipes/lemur/meta.yaml @@ -0,0 +1,35 @@ +{% set name = "lemur" %} +{% set version = "1.0.1" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: 'https://github.com/treangenlab/lemur/archive/refs/tags/v{{version}}.tar.gz' + sha256: 190b6302deabe5d09428bc541e5ab924ab6b727c30fc0c93554c2a131e7fd0d7 + +build: + run_exports: + - {{ pin_subpackage('lemur', max_pin="x") }} + noarch: generic + number: 0 + script: mkdir -p ${PREFIX}/bin && cp lemur ${PREFIX}/bin + +requirements: + run: + - python >=3.7 + - pysam >=0.15 + - numpy >=1.11 + - pandas >=1.1.3 + - minimap2 >=2.22 + +test: + commands: + - lemur --help + +about: + home: https://github.com/treangenlab/lemur + license: MIT + license_file: LICENSE + summary: Lemur is a tool for rapid and accurate taxonomic profiling on long-read metagenomic datasets diff --git a/recipes/libmaus2/build.sh b/recipes/libmaus2/build.sh index 7cead9ea7ceff..cdd58fb79e892 100644 --- a/recipes/libmaus2/build.sh +++ b/recipes/libmaus2/build.sh @@ -6,5 +6,5 @@ export LIBS="-lstdc++fs -lcurl" cat config.log -make +make -j${CPU_COUNT} make install diff --git a/recipes/libmaus2/meta.yaml b/recipes/libmaus2/meta.yaml index defd4a7cbe7c2..455532e4245a8 100644 --- a/recipes/libmaus2/meta.yaml +++ b/recipes/libmaus2/meta.yaml @@ -10,7 +10,7 @@ package: build: # There's some issue with clang skip: True # [osx] - number: 4 + number: 5 run_exports: - {{ pin_subpackage('libmaus2', max_pin='x.x') }} @@ -50,3 +50,7 @@ about: test: commands: - echo + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/liftover/meta.yaml b/recipes/liftover/meta.yaml index 8c82c1069fba5..8c484a1d7355b 100644 --- a/recipes/liftover/meta.yaml +++ b/recipes/liftover/meta.yaml @@ -1,6 +1,6 @@ {% set name = "liftover" %} -{% set version = "1.1.17" %} -{% set sha256 = "cb06a3843b570ec554fbc0dd871c0b87d3645200e2c65f6cc97cd4b6146efaf9" %} +{% set version = "1.2.2" %} +{% set sha256 = "f858aed016227882263d369969790adf6df2c07399e16f063aec8a248a2b4513" %} package: name: {{ name|lower }} diff --git a/recipes/lighter/build.sh b/recipes/lighter/build.sh index 5cb63338fa2d8..a4d8ba8f7756a 100644 --- a/recipes/lighter/build.sh +++ b/recipes/lighter/build.sh @@ -1,5 +1,7 @@ -#!/bin/sh +#!/bin/bash -mkdir -p $PREFIX/bin -make CXX=${CXX} CXXFLAGS="${CXXFLAGS}" LDFLAGS="${LDFLAGS}" -cp lighter $PREFIX/bin +mkdir -p ${PREFIX}/bin + +make CXX="${CXX}" CXXFLAGS="${CXXFLAGS} -O3 -I${PREFIX}/include" LDFLAGS="${LDFLAGS} -L${PREFIX}/lib" + +cp -f lighter ${PREFIX}/bin diff --git a/recipes/lighter/meta.yaml b/recipes/lighter/meta.yaml index 11f471c96217b..b33f35505bc38 100644 --- a/recipes/lighter/meta.yaml +++ b/recipes/lighter/meta.yaml @@ -1,6 +1,6 @@ {% set name = "Lighter" %} -{% set version = "1.1.2" %} -{% set sha256 = "89abc34137beffc43382fbe53deb25c3c2f5cee7e6ca2b7f669931d70065993a" %} +{% set version = "1.1.3" %} +{% set sha256 = "c8a251c410805f82dad77e40661f0faf14ec82dedb3ff717094ba8ff4ef94465" %} package: name: '{{ name|lower }}' @@ -13,7 +13,9 @@ source: - 0001-makefile.patch build: - number: 6 + number: 0 + run_exports: + - {{ pin_subpackage('lighter', max_pin="x") }} requirements: build: @@ -21,8 +23,6 @@ requirements: - {{ compiler('cxx') }} host: - zlib - run: - - zlib test: commands: @@ -31,10 +31,14 @@ test: about: home: https://github.com/mourisl/Lighter - license: GPLv3 + license: GPL-3.0-or-later + license_family: GPL3 license_file: LICENSE summary: Lighter is a kmer-based error correction method for whole genome sequencing data + dev_url: https://github.com/mourisl/Lighter extra: identifiers: - biotools:{{ name }} + - doi:10.1186/s13059-014-0509-9 + - usegalaxy-eu:lighter diff --git a/recipes/linearfold/0001-FIX-command-broken-with-symbolic-link.patch b/recipes/linearfold/0001-FIX-command-broken-with-symbolic-link.patch index 3709632b08a68..2efbe34655620 100644 --- a/recipes/linearfold/0001-FIX-command-broken-with-symbolic-link.patch +++ b/recipes/linearfold/0001-FIX-command-broken-with-symbolic-link.patch @@ -1,25 +1,13 @@ -From bb95a8f98b874fb9061c5ee1b3178f4d40f96416 Mon Sep 17 00:00:00 2001 -From: Fabien Pertuy -Date: Fri, 21 May 2021 09:23:34 +0000 -Subject: [PATCH] FIX command broken with symbolic link - ---- - linearfold | 2 +- - 1 file changed, 1 insertion(+), 1 deletion(-) - diff --git a/linearfold b/linearfold -index f5541d2..2c86b63 100755 +index fca4a30..7e68544 100755 --- a/linearfold +++ b/linearfold -@@ -28,7 +28,7 @@ def main(): - zuker_subopt = '1' if FLAGS.zuker else '0' - delta = str(FLAGS.delta) +@@ -38,7 +38,7 @@ def main(): + + dangles = str(FLAGS.dangles) - path = os.path.dirname(os.path.abspath(__file__)) + path = os.path.dirname(os.path.realpath(__file__)) - cmd = ["%s/%s" % (path, ('bin/linearfold_v' if use_vienna else 'bin/linearfold_c')), beamsize, is_sharpturn, is_verbose, is_eval, is_constraints, zuker_subopt, delta] + cmd = ["%s/%s" % (path, ('bin/linearfold_v' if use_vienna else 'bin/linearfold_c')), beamsize, is_sharpturn, is_verbose, is_eval, is_constraints, zuker_subopt, delta, shape_file_path, is_fasta, dangles] subprocess.call(cmd, stdin=sys.stdin) --- -2.30.2 - diff --git a/recipes/linearfold/meta.yaml b/recipes/linearfold/meta.yaml index 68bd8d83073a7..62e614174d93e 100644 --- a/recipes/linearfold/meta.yaml +++ b/recipes/linearfold/meta.yaml @@ -1,17 +1,20 @@ {% set name = "LinearFold" %} -{% set version = "1.0" %} -{% set sha256 = "2ae56b5f183472c2de96782e770a91e57f82e0ab511dfc0d9d612aa4e6155f60" %} +{% set git_sha1 = "c3ee9bd80c06c2fc39a7bb7ae5e77b9566227cac" %} +{% set version = "1.0.1.dev20220829" %} +{% set sha256 = "cad8b93ba961820ca3701a1d931944bd307b1d1f92d74e1b02d5bd34d4ffe998" %} package: name: {{ name | lower }} version: {{ version }} build: - number: 3 + number: 0 skip: True # [osx] + run_exports: + - {{ pin_subpackage(name | lower, max_pin="x.x.x") }} source: - url: https://github.com/{{ name }}/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + url: https://github.com/{{ name }}/{{ name }}/archive/{{ git_sha1 }}.tar.gz sha256: {{ sha256 }} patches: - 0001-FIX-command-broken-with-symbolic-link.patch @@ -23,7 +26,7 @@ requirements: run: - python-gflags - - python=2.7 + - python >=3,<4 test: source_files: diff --git a/recipes/linearpartition/0001-FIX-command-broken-with-symbolic-link.patch b/recipes/linearpartition/0001-FIX-command-broken-with-symbolic-link.patch index 95a8be08c0583..53c9c754a9810 100644 --- a/recipes/linearpartition/0001-FIX-command-broken-with-symbolic-link.patch +++ b/recipes/linearpartition/0001-FIX-command-broken-with-symbolic-link.patch @@ -1,25 +1,13 @@ -From 7413bfa18dddf47924be0839df0147045db0d045 Mon Sep 17 00:00:00 2001 -From: Fabien Pertuy -Date: Fri, 21 May 2021 10:39:10 +0000 -Subject: [PATCH] FIX command broken with symbolic link - ---- - linearpartition | 2 +- - 1 file changed, 1 insertion(+), 1 deletion(-) - diff --git a/linearpartition b/linearpartition -index 6c9d877..9d8a5b6 100755 +index f6c2a4e..7b0fe1d 100755 --- a/linearpartition +++ b/linearpartition -@@ -87,7 +87,7 @@ def main(): - # if os.path.exists(ThreshKnot_output): os.remove(ThreshKnot_output) - +@@ -80,7 +80,7 @@ def main(): + print("Exit!\n"); + exit(); - path = os.path.dirname(os.path.abspath(__file__)) + path = os.path.dirname(os.path.realpath(__file__)) - cmd = ["%s/%s" % (path, ('bin/linearpartition_v' if use_vienna else 'bin/linearpartition_c')), beamsize, is_sharpturn, is_verbose, bpp_file, bpp_prefix, pf_only, bpp_cutoff, forest_file, mea, gamma, TK, threshold, ThreshKnot_prefix, MEA_prefix, MEA_bpseq] + cmd = ["%s/%s" % (path, ('bin/linearpartition_v' if use_vienna else 'bin/linearpartition_c')), beamsize, is_sharpturn, is_verbose, bpp_file, bpp_prefix, pf_only, bpp_cutoff, forest_file, mea, gamma, TK, threshold, ThreshKnot_prefix, MEA_prefix, MEA_bpseq, shape_file_path, is_fasta, dangles] subprocess.call(cmd, stdin=sys.stdin) --- -2.30.2 - diff --git a/recipes/linearpartition/meta.yaml b/recipes/linearpartition/meta.yaml index eaa4d137d8ee7..7a42168cc778e 100644 --- a/recipes/linearpartition/meta.yaml +++ b/recipes/linearpartition/meta.yaml @@ -1,17 +1,20 @@ {% set name = "LinearPartition" %} -{% set version = "1.0" %} -{% set sha256 = "4fdea96f7ffbd4804d9308ddb46db5f96d1abc4b7bd737725f9bedcae3c88178" %} +{% set version = "1.0.1.dev20240123" %} +{% set git_sha1 = "fa953f6323274eeadd92cc1f4e5535417f3fb821" %} +{% set sha256 = "e93c6a26c246c2e0927592052516d6fb15e7e1e8a378f74474136ba85746be58" %} package: name: {{ name | lower }} version: {{ version }} build: - number: 3 + number: 0 skip: True # [osx] + run_exports: + - {{ pin_subpackage(name | lower, max_pin="x.x.x") }} source: - url: https://github.com/LinearFold/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + url: https://github.com/LinearFold/{{ name }}/archive/{{ git_sha1 }}.tar.gz sha256: {{ sha256 }} patches: - 0001-FIX-command-broken-with-symbolic-link.patch @@ -25,7 +28,7 @@ requirements: - matplotlib-base - numpy - pandas - - python=2.7 + - python >=3,<4 - python-gflags - seaborn @@ -41,3 +44,4 @@ about: license: custom license_file: LICENSE summary: 'Linear-Time Approximation of RNA Folding Partition Function and Base Pairing Probabilities' + diff --git a/recipes/lisa2/meta.yaml b/recipes/lisa2/meta.yaml index 2725f8ee5badf..20859b72ef139 100644 --- a/recipes/lisa2/meta.yaml +++ b/recipes/lisa2/meta.yaml @@ -10,7 +10,7 @@ source: sha256: dc9df3495322c94f93c12372fb8d88d355447f7b8b69ea639394fc6274e9affb build: - number: 0 + number: 1 noarch: python script: {{ PYTHON }} -m pip install . -vv run_exports: @@ -22,10 +22,10 @@ requirements: - python >=3.5 run: - h5py >=2 - - numpy <2,>=1.17 + - numpy >=1.17,<2 - python >=3.5 - - scikit-learn <2,>=0.22 - - scipy <2,>=1.4 + - scikit-learn >=0.22,<2 + - scipy >=1.4,<2 test: imports: diff --git a/recipes/localhgt/build.sh b/recipes/localhgt/build.sh new file mode 100644 index 0000000000000..a2d8631a97701 --- /dev/null +++ b/recipes/localhgt/build.sh @@ -0,0 +1,9 @@ +#!/bin/bash + +make + +mkdir -p $PREFIX/bin + +cp $SRC_DIR/scripts/*py $PREFIX/bin +cp $SRC_DIR/scripts/*sh $PREFIX/bin +cp $SRC_DIR/scripts/extract_ref $PREFIX/bin diff --git a/recipes/localhgt/meta.yaml b/recipes/localhgt/meta.yaml new file mode 100644 index 0000000000000..94f06028c03df --- /dev/null +++ b/recipes/localhgt/meta.yaml @@ -0,0 +1,53 @@ +{% set version = "1.0.1" %} + +package: + name: localhgt + version: {{ version }} + +build: + number: 2 + run_exports: + - {{ pin_subpackage("localhgt", max_pin="x") }} + entry_points: + - localhgt = localhgt:main + +source: + url: https://github.com/deepomicslab/LocalHGT/archive/refs/tags/v{{ version }}.tar.gz + sha256: 4e1dca6c41f4f8519fd848d1d7fc3d290a62e4565bd12b27172846f1871ac4f8 + +requirements: + build: + - make + - {{ compiler('cxx') }} + host: + run: + - python >=3.7.12 + - scikit-bio >=0.5.6 + - networkx >=2.6.3 + - typing-extensions >=4.11.0 + - pyfaidx + - pysam + - biopython + - scikit-learn + - scipy + - numpy <=1.24 + - pandas + - samtools >=1.11 + - seqkit >=2.6.1 + - bwa >=0.7.17 + - fastp >=0.23.2 + +about: + home: https://github.com/deepomicslab/LocalHGT + license: MIT + summary: An ultrafast horizontal gene transfer detection method from large microbial communities + +test: + commands: + - localhgt --help + +extra: + identifiers: + - biotools:localhgt + recipe-maintainers: + - wshuai294 diff --git a/recipes/locarna/meta.yaml b/recipes/locarna/meta.yaml index 6575d3c121e45..8b20692981d04 100644 --- a/recipes/locarna/meta.yaml +++ b/recipes/locarna/meta.yaml @@ -13,7 +13,9 @@ about: summary: Multiple alignment of RNAs build: - number: 1 + number: 2 + run_exports: + - {{ pin_subpackage('locarna', max_pin="x.x") }} source: url: "https://github.com/s-will/LocARNA/releases/download/v{{ version }}/locarna-{{ version }}.tar.gz" @@ -27,9 +29,9 @@ requirements: - make - {{ compiler('cxx') }} host: - - viennarna =={{ vrnaversion }} + - viennarna >={{ vrnaversion }},<3 run: - - viennarna =={{ vrnaversion }} + - viennarna >={{ vrnaversion }},<3 - perl test: diff --git a/recipes/locidex/meta.yaml b/recipes/locidex/meta.yaml new file mode 100644 index 0000000000000..213ecab088d71 --- /dev/null +++ b/recipes/locidex/meta.yaml @@ -0,0 +1,54 @@ +{% set name = "locidex" %} +{% set version = "0.1.2" %} +{% set sha256 = "00134512c81ce4d752ca568e2fc5c3497004be4b8a4458fa38e4195e5cfb72d0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/locidex-{{ version }}.tar.gz + sha256: {{ sha256 }} + + +build: + number: 0 + noarch: python + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} + script: {{ PYTHON }} -m pip install . --use-pep517 --no-deps -vvv + entry_points: + - locidex=locidex.main:main + +requirements: + host: + - python >=3.8,<4 + - pip + run: + - python >=3.8,<4 + - {{ pin_compatible('numpy', max_pin="x") }} + - pandas >=2.0.2 + - numba >=0.57.1 + - pytables >=3.8 + - six >=1.16 + - pyrodigal >=3.0 + - biopython >=1.83 + - mafft + - blast >=2.9.0 + +test: + commands: + - locidex -h + - locidex search -h + - locidex extract -h + - locidex report -h + - locidex merge -h + - locidex format -h + - locidex build -h + +about: + home: 'https://pypi.org/project/locidex/' + summary: 'Locidex: Common search engine for similarity based typing applications' + license: Apache-2.0 + dev_url: 'https://github.com/phac-nml/locidex' + diff --git a/recipes/locityper/build.sh b/recipes/locityper/build.sh new file mode 100644 index 0000000000000..0563cd7748405 --- /dev/null +++ b/recipes/locityper/build.sh @@ -0,0 +1,13 @@ +#!/bin/bash -euo + +if [ "$(uname)" == "Darwin" ]; then + export HOME="/Users/distiller" + export HOME=`pwd` +fi + +export C_INCLUDE_PATH="$BUILD_PREFIX/include:$C_INCLUDE_PATH" +export LIBRARY_PATH="$BUILD_PREFIX/lib:$LIBRARY_PATH" + +git clone https://github.com/smarco/WFA2-lib WFA2 +cargo install --no-track --verbose --root "${PREFIX}" --path . + diff --git a/recipes/locityper/meta.yaml b/recipes/locityper/meta.yaml new file mode 100644 index 0000000000000..291ae3258fcc6 --- /dev/null +++ b/recipes/locityper/meta.yaml @@ -0,0 +1,41 @@ +{% set version = "0.15.0" %} + +package: + name: locityper + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage("locityper", max_pin="x.x") }} + +source: + url: https://github.com/tprodanov/locityper/archive/refs/tags/v{{ version }}.tar.gz + sha256: 23e6505c4e31ad3f27ba9ac86128d3e554012601ea84ebd06d6b2f3b1f067020 + +requirements: + build: + - {{ compiler('rust') }} + - {{ compiler('cxx') }} + - cmake + - make + - clangdev + - llvm-openmp + run: + - samtools >=1.18 + - jellyfish >=1.0 + - minimap2 >=2.25 + - strobealign >=0.12 + - python + - pysam + +test: + commands: + - locityper version + +about: + summary: Targeted genotyper for complex polymorphic loci from short and long read WGS. + home: https://github.com/tprodanov/locityper + license: MIT + license_file: LICENSE + diff --git a/recipes/lofreq/build.sh b/recipes/lofreq/build.sh index 14aa9cefba636..d349a75b80adb 100644 --- a/recipes/lofreq/build.sh +++ b/recipes/lofreq/build.sh @@ -2,5 +2,5 @@ set -eu -o pipefail ./configure --with-htslib=system --prefix=${PREFIX} -make +make -j ${CPU_COUNT} make install diff --git a/recipes/lofreq/meta.yaml b/recipes/lofreq/meta.yaml index 8599a1283fd08..0f18251ee95d3 100644 --- a/recipes/lofreq/meta.yaml +++ b/recipes/lofreq/meta.yaml @@ -9,7 +9,9 @@ source: sha256: 43028af07faa23c7ec0e167855492ae7bd31c4e7f8158114e51ec12aba5fd184 build: - number: 10 + number: 11 + run_exports: + - {{ pin_subpackage('lofreq', max_pin='x') }} requirements: build: @@ -34,5 +36,7 @@ about: summary: A fast and sensitive variant-caller for inferring SNVs and indels from next-generation sequencing data extra: + additional-platforms: + - linux-aarch64 identifiers: - usegalaxy-eu:lofreq_call diff --git a/recipes/longshot/build.sh b/recipes/longshot/build.sh index 86b3387a1a49e..f7112e78ae4b7 100644 --- a/recipes/longshot/build.sh +++ b/recipes/longshot/build.sh @@ -1,19 +1,11 @@ #!/bin/bash set -ex -# this build script is taken from the rust-bio-tools recipe -# https://github.com/bioconda/bioconda-recipes/blob/master/recipes/rust-bio-tools/build.sh - -# taken from yacrd recipe, see: https://github.com/bioconda/bioconda-recipes/blob/2b02c3db6400499d910bc5f297d23cb20c9db4f8/recipes/yacrd/build.sh -#if [ "$(uname)" == "Darwin" ]; then -# # apparently the HOME variable isn't set correctly, and circle ci output indicates the following as the home directory -# #export HOME="/Users/distiller" -# export HOME="/Users/runner" -# # according to https://github.com/rust-lang/cargo/issues/2422#issuecomment-198458960 removing circle ci default configuration solves cargo trouble downloading crates -# git config --global --unset url.ssh://git@github.com.insteadOf -#fi +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" # build statically linked binary with Rust -export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="$(pwd)/.cargo" -export LD=$CC -C_INCLUDE_PATH=$PREFIX/include LIBRARY_PATH=$PREFIX/lib cargo install --path . --root $PREFIX +export LD="${CC}" C_INCLUDE_PATH="${PREFIX}/include" LIBRARY_PATH="${PREFIX}/lib" +RUST_BACKTRACE=1 +cargo install --path . --root "${PREFIX}" --verbose diff --git a/recipes/longshot/meta.yaml b/recipes/longshot/meta.yaml index ca77b08ec44aa..10c98313b10f1 100644 --- a/recipes/longshot/meta.yaml +++ b/recipes/longshot/meta.yaml @@ -1,26 +1,31 @@ -{% set version = "0.4.5" %} +{% set name = "longshot" %} +{% set version = "1.0.0" %} package: - name: longshot - version: {{version}} - -build: - number: 2 - skip: True # [osx] + name: {{ name }} + version: {{ version }} source: url: https://github.com/pjedge/longshot/archive/v{{ version }}.tar.gz - sha256: 7c9f570e17012b2fee386892ae64daf5f104d59adeb59dc7e710b876c1a11cad + sha256: f6981892beb966eef40986c46928301dec1fef38591cc291e00a546f9866c5e2 + patches: + - update-rust-htslib.patch + +build: + number: 1 + skip: True # [osx] + run_exports: + - {{ pin_subpackage('longshot', max_pin="x") }} requirements: build: - - rust >=1.4 - - make + - {{ compiler('rust') }} - {{ compiler('c') }} - {{ compiler('cxx') }} - pkg-config # [osx] - clangdev - cmake + - make host: - zlib - xz @@ -34,6 +39,14 @@ test: about: home: https://github.com/pjedge/longshot license: MIT + license_family: MIT license_file: LICENSE - summary: | - Diploid SNV caller for error-prone reads. + summary: "Diploid SNV caller for error-prone reads." + dev_url: https://github.com/pjedge/longshot + +extra: + additional-platforms: + - linux-aarch64 + identifiers: + - doi:10.1038/s41467-019-12493-y + - biotools:longshot diff --git a/recipes/longshot/update-rust-htslib.patch b/recipes/longshot/update-rust-htslib.patch new file mode 100644 index 0000000000000..1f2ec95d71d9f --- /dev/null +++ b/recipes/longshot/update-rust-htslib.patch @@ -0,0 +1,23 @@ +From 9457f89b8200c238f4696eb86f7e979d23b3ae2c Mon Sep 17 00:00:00 2001 +From: Martin Grigorov +Date: Thu, 25 Apr 2024 11:05:07 +0300 +Subject: [PATCH] Update rust-htslib to 0.46.0 + +This allows building the project on Linux ARM64! +--- + Cargo.toml | 2 +- + 1 file changed, 1 insertion(+), 1 deletion(-) + +diff --git a/Cargo.toml b/Cargo.toml +index c8592eb..e3a32db 100644 +--- a/Cargo.toml ++++ b/Cargo.toml +@@ -5,7 +5,7 @@ authors = ["Peter Edge "] + + [dependencies] + bio = "0.25.0" +-rust-htslib = "0.38.2" ++rust-htslib = "0.46.0" + clap = "2.26.2" + chrono = "0.4" + rand = { version = "0.8", features = ["std_rng"] } diff --git a/recipes/ltr_finder_parallel/build.sh b/recipes/ltr_finder_parallel/build.sh new file mode 100644 index 0000000000000..5967719b8716f --- /dev/null +++ b/recipes/ltr_finder_parallel/build.sh @@ -0,0 +1,24 @@ +#!/bin/sh +set -x -e + +LTR_FINDER_PARALLEL_DIR=${PREFIX}/share/LTR_FINDER_parallel + +mkdir -p ${PREFIX}/bin +mkdir -p ${LTR_FINDER_PARALLEL_DIR} +cp -r * ${LTR_FINDER_PARALLEL_DIR} + +# LTR_FINDER_parallel creates the path to ltr_finder by using `which ltr_finder` +# `which ltr_finder` returns the path along with a newline character '\n'. +# To replace the newline character, LTR_FINDER_parallel matches regex 'ltr_finder\\n?' +# This regex logic fails in the case of this CONDA recipe because the path to +# ltr_finder includes ltr_finder_parallel which is replaced as _parallel, resulting in +# an invalid path. I have changed the regex so that ltr_finder_parallel is not replaced. +sed -i.bak 's|\$ltr_finder=~s/ltr_finder\\n?//;|\$ltr_finder=~s/\\bltr_finder\\n?\$//m;|' \ + ${LTR_FINDER_PARALLEL_DIR}/LTR_FINDER_parallel + +cat <>${PREFIX}/bin/LTR_FINDER_parallel +#!/bin/bash +perl ${LTR_FINDER_PARALLEL_DIR}/LTR_FINDER_parallel \$@ +END + +chmod a+x ${PREFIX}/bin/LTR_FINDER_parallel diff --git a/recipes/ltr_finder_parallel/meta.yaml b/recipes/ltr_finder_parallel/meta.yaml new file mode 100644 index 0000000000000..90c1ab418a74c --- /dev/null +++ b/recipes/ltr_finder_parallel/meta.yaml @@ -0,0 +1,39 @@ +{% set name = "LTR_FINDER_parallel" %} +{% set version = "1.1" %} +{% set sha256 = "5d1fed2a3a38c0927ccd7fc6cc38ba13ce293c5b1805299c999c5d52d085a1b9" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://github.com/oushujun/LTR_FINDER_parallel/archive/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 1 + noarch: generic + run_exports: + - {{ pin_subpackage('ltr_finder_parallel', max_pin='x') }} + +requirements: + run: + - ltr_finder + +test: + commands: + - ltr_finder 2>&1 | grep -i usage + - LTR_FINDER_parallel -check_dependencies > /dev/null + +about: + home: https://github.com/oushujun/LTR_FINDER_parallel + license: MIT + license_family: MIT + license_file: LICENSE + summary: Perl wrapper to parallelize ltr_finder + dev_url: https://github.com/oushujun/LTR_FINDER_parallel + doc_url: https://github.com/oushujun/LTR_FINDER_parallel + +extra: + identifiers: + - doi:10.1186/s13100-019-0193-0 diff --git a/recipes/ltr_harvest_parallel/build.sh b/recipes/ltr_harvest_parallel/build.sh new file mode 100644 index 0000000000000..ebadfe1bb70e0 --- /dev/null +++ b/recipes/ltr_harvest_parallel/build.sh @@ -0,0 +1,15 @@ +#!/bin/sh +set -x -e + +LTR_HARVEST_PARALLEL_DIR=${PREFIX}/share/LTR_HARVEST_parallel + +mkdir -p ${PREFIX}/bin +mkdir -p ${LTR_HARVEST_PARALLEL_DIR} +cp -r bin/LTR_HARVEST_parallel/* ${LTR_HARVEST_PARALLEL_DIR} + +cat <>${PREFIX}/bin/LTR_HARVEST_parallel +#!/bin/bash +perl ${LTR_HARVEST_PARALLEL_DIR}/LTR_HARVEST_parallel \$@ +END + +chmod a+x ${PREFIX}/bin/LTR_HARVEST_parallel diff --git a/recipes/ltr_harvest_parallel/meta.yaml b/recipes/ltr_harvest_parallel/meta.yaml new file mode 100644 index 0000000000000..31bb99212a8ba --- /dev/null +++ b/recipes/ltr_harvest_parallel/meta.yaml @@ -0,0 +1,41 @@ +{% set name = "LTR_HARVEST_parallel" %} +{% set version = "1.1" %} +{% set edta_version = "2.2.0" %} +{% set sha256 = "3515667804437f749f0bb934812ca83b23ec5472c221786f6e5a0d4b613a1a7a" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://github.com/oushujun/EDTA/archive/v{{ edta_version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 1 + noarch: generic + run_exports: + - {{ pin_subpackage('ltr_harvest_parallel', max_pin='x') }} + +requirements: + run: + - perl + - genometools-genometools + +test: + commands: + - LTR_HARVEST_parallel -check_dependencies > /dev/null + +about: + home: https://github.com/oushujun/EDTA/tree/8980f498f05ad63dbffa3241842d3d38e939531b/bin/LTR_HARVEST_parallel + license: MIT + license_family: MIT + license_file: LICENSE + summary: Perl wrapper for parallel execution of LTR_harvest + dev_url: https://github.com/oushujun/EDTA/tree/8980f498f05ad63dbffa3241842d3d38e939531b/bin/LTR_HARVEST_parallel + doc_url: https://github.com/oushujun/EDTA/tree/8980f498f05ad63dbffa3241842d3d38e939531b/bin/LTR_HARVEST_parallel + +extra: + identifiers: + - doi:10.1186/s13059-019-1905-y + - doi:10.1101/2022.10.09.511471 diff --git a/recipes/lusstr/meta.yaml b/recipes/lusstr/meta.yaml index 0b597aa0df8f1..58fb667975528 100644 --- a/recipes/lusstr/meta.yaml +++ b/recipes/lusstr/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.8" %} -{% set sha256 = "0a0de8e921ec072843c9aba3d02c9fd7afd429df72246ddb335bbd6705b3f430" %} +{% set version = "0.9" %} +{% set sha256 = "abb32bac6d4fd86fbbcd630ef2b254ff66a5658bb3ef6efeb014c7304118561e" %} package: name: lusstr @@ -27,7 +27,7 @@ requirements: - pandas >=1.0,<2.0 - xlrd >=1.0,<2.0 - openpyxl >=3.0.6 - - snakemake-minimal >=7.22.0 + - snakemake-minimal >=7.22.0,<8.0 - pyyaml >=6.0 - matplotlib-base >=3.5.3 diff --git a/recipes/maaslin2/meta.yaml b/recipes/maaslin2/meta.yaml index 08fb4ed966786..faa14bf9d455a 100644 --- a/recipes/maaslin2/meta.yaml +++ b/recipes/maaslin2/meta.yaml @@ -1,19 +1,21 @@ {% set name = "MaAsLin2" %} -{% set version = "0.99.12" %} -{% set sha256 = "694b79550c59ad1d872bc89d68e516b0682ba5ce4a5fdc9dfe3b29a9e7524849" %} +{% set version = "1.16.0" %} +{% set sha256 = "38261a85db7dce552590110eed241e679307f5e6c0b67f1667d68c65c86e25b5" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://bitbucket.org/biobakery/maaslin2/get/0.99.12.tar.gz + url: https://www.bioconductor.org/packages/release/bioc/src/contrib/Maaslin2_{{ version }}.tar.gz sha256: {{ sha256 }} patches: - rpath.patch build: - number: 1 + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x") }} + number: 0 noarch: generic # This is required to make R link correctly on Linux. rpaths: @@ -41,6 +43,7 @@ requirements: - r-optparse - r-hash - r-cplm + - r-glmmtmb run: - r-base - bioconductor-edger @@ -61,6 +64,7 @@ requirements: - r-optparse - r-hash - r-cplm + - r-glmmtmb test: commands: @@ -70,8 +74,10 @@ test: about: home: http://huttenhower.sph.harvard.edu/maaslin2 license: Custom OSS + license_file: LICENSE summary: "MaAsLin2 is comprehensive R package for efficiently determining multivariable association between microbial meta'omic features and clinical metadata." extra: maintainers: - npavlovikj + - ljmciver diff --git a/recipes/macs3/meta.yaml b/recipes/macs3/meta.yaml new file mode 100644 index 0000000000000..53b070ffb72c9 --- /dev/null +++ b/recipes/macs3/meta.yaml @@ -0,0 +1,63 @@ +{% set name = "MACS3" %} +{% set version = "3.0.1" %} +{% set sha256 = "9e1a63685629852e6128a3270d264f990790538f48610aac7fd2fd139ef8fe12" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + git_url: https://github.com/macs3-project/MACS.git + git_rev: 34f9a81398ec2af78317cd0b128f3a1e52a68f17 + +build: + number: 2 + skip: True # [py < 39] + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv + run_exports: + - {{ pin_subpackage('macs3', max_pin="x.x") }} + +requirements: + build: + - {{ compiler('c') }} + host: + - python + - zlib + - pip + - numpy >=1.25 + - scipy >=1.12 + - cython >=3.0 + - hmmlearn 0.3 + - scikit-learn >=1.3 + - cykhash >=2.0,<3.0 + run: + - python + - numpy >=1.25 + - scipy >=1.12 + - hmmlearn 0.3 + - scikit-learn >=1.3 + - cykhash >=2.0,<3.0 + +test: + imports: + - MACS3 + commands: + - macs3 -h + +about: + dev_url: https://github.com/macs3-project/MACS/ + doc_url: https://macs3-project.github.io/MACS/ + home: https://pypi.org/project/MACS3/ + license: BSD-3-Clause + license_family: BSD + license_file: LICENSE + summary: Model Based Analysis for ChIP-Seq data + +extra: + identifiers: + - biotools:macs + - doi:10.1186/gb-2008-9-9-r137 + - usegalaxy-eu:peakcalling_macs + skip-lints: + - uses_vcs_url + - missing_hash diff --git a/recipes/maegatk/meta.yaml b/recipes/maegatk/meta.yaml new file mode 100644 index 0000000000000..a7a26ecda678c --- /dev/null +++ b/recipes/maegatk/meta.yaml @@ -0,0 +1,64 @@ +{% set name = "maegatk" %} +{% set version = "0.2.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/maegatk-{{ version }}.tar.gz + sha256: fce1ec287914e03ce2b317a4f6a338f1806cd82e5c77f4e4cb1efbd48c87bdda + +build: + number: 1 + noarch: python + entry_points: + - maegatk = maegatk.cli:main + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation --no-cache-dir + run_exports: + - {{ pin_subpackage('maegatk', max_pin="x.x") }} + +requirements: + host: + - python >=3 + - pip + run: + - python >=3 + - click + - pysam + - pytest + - snakemake-minimal <8 + - pulp <2.8 + - biopython + - optparse-pretty + - regex + - ruamel.yaml + - openjdk + - fgbio + - bwa + - samtools + - freebayes + - r-base + - r-dplyr + - r-data.table + - r-matrix + - bioconductor-genomicranges + - bioconductor-summarizedexperiment + +test: + imports: + - maegatk + commands: + - maegatk --help + +about: + home: https://github.com/caleblareau/maegatk + summary: Mitochondrial Alteration Enrichment and Genome Analysis Toolkit + license: MIT + license_family: MIT + license_file: LICENSE.txt + description: Processing and quality control of mitochondrial genome variants from MAESTER data. + +extra: + recipe-maintainers: + - mencian diff --git a/recipes/mafft/7.310/build.sh b/recipes/mafft/7.310/build.sh deleted file mode 100644 index 4b6aa5d8f2884..0000000000000 --- a/recipes/mafft/7.310/build.sh +++ /dev/null @@ -1,8 +0,0 @@ -#!/bin/bash - -# cd to location of Makefile and source -cd $SRC_DIR/core - -export PRFX=$PREFIX -make CC="${CC} -fcommon" CXX="${CXX} -fcommon" -make install diff --git a/recipes/mafft/7.310/linux-makefile.patch b/recipes/mafft/7.310/linux-makefile.patch deleted file mode 100644 index 214b12eabf75d..0000000000000 --- a/recipes/mafft/7.310/linux-makefile.patch +++ /dev/null @@ -1,8 +0,0 @@ ---- core/Makefile 2015-10-19 11:46:17.000000000 -0400 -+++ core/linux-makefile 2015-10-19 12:06:49.000000000 -0400 -@@ -1,4 +1,4 @@ --PREFIX = /usr/local -+PREFIX = $(PRFX) - LIBDIR = $(PREFIX)/libexec/mafft - BINDIR = $(PREFIX)/bin - MANDIR = $(PREFIX)/share/man/man1 diff --git a/recipes/mafft/7.310/meta.yaml b/recipes/mafft/7.310/meta.yaml deleted file mode 100644 index 88bd286f36a22..0000000000000 --- a/recipes/mafft/7.310/meta.yaml +++ /dev/null @@ -1,33 +0,0 @@ -package: - name: mafft - version: '7.310' - -source: - md5: fcb68a47d4506b93bb8463ff29b3cbc4 - url: http://mafft.cbrc.jp/alignment/software/mafft-7.310-without-extensions-src.tgz - patches: - - osx-makefile.patch # [osx] - - linux-makefile.patch # [linux] - -build: - number: 7 - skip: True # [osx] - -requirements: - build: - - make - - {{ compiler('c') }} - - {{ compiler('cxx') }} - -test: - commands: - - mafft --version - -about: - home: 'http://mafft.cbrc.jp/alignment/software/' - license: BSD - summary: Multiple alignment program for amino acid or nucleotide sequences based on fast Fourier transform - -extra: - skip-lints: - - should_not_be_noarch_source diff --git a/recipes/mafft/7.310/osx-makefile.patch b/recipes/mafft/7.310/osx-makefile.patch deleted file mode 100644 index 65ef81f93161d..0000000000000 --- a/recipes/mafft/7.310/osx-makefile.patch +++ /dev/null @@ -1,17 +0,0 @@ ---- core/Makefile 2015-10-19 11:46:17.000000000 -0400 -+++ core/osx-makefile 2015-10-19 12:06:49.000000000 -0400 -@@ -1,4 +1,4 @@ --PREFIX = /usr/local -+PREFIX = $(PRFX) - LIBDIR = $(PREFIX)/libexec/mafft - BINDIR = $(PREFIX)/bin - MANDIR = $(PREFIX)/share/man/man1 -@@ -6,7 +6,7 @@ - - #MNO_CYGWIN = -mno-cygwin - --ENABLE_MULTITHREAD = -Denablemultithread -+#ENABLE_MULTITHREAD = -Denablemultithread - # Comment out the above line if your compiler - # does not support TLS (thread-local strage). - diff --git a/recipes/mafft/build.sh b/recipes/mafft/build.sh deleted file mode 100644 index 918d2ffe0c2db..0000000000000 --- a/recipes/mafft/build.sh +++ /dev/null @@ -1,7 +0,0 @@ -#!/bin/bash - -# cd to location of Makefile and source -cd $SRC_DIR/core - -make CC="$CC" CFLAGS="$CFLAGS" PREFIX="$PREFIX" DASH_CLIENT="dash_client" -make install PREFIX="$PREFIX" DASH_CLIENT="dash_client" diff --git a/recipes/mafft/meta.yaml b/recipes/mafft/meta.yaml deleted file mode 100644 index 132c40b37520a..0000000000000 --- a/recipes/mafft/meta.yaml +++ /dev/null @@ -1,38 +0,0 @@ -{% set name = "mafft" %} -{% set version = "7.520" %} - -package: - name: {{ name|lower }} - version: {{ version }} - -source: -# url: https://mafft.cbrc.jp/alignment/software/mafft-{{ version }}-without-extensions-src.tgz - url: https://gitlab.com/sysimm/mafft/-/archive/v{{ version }}/mafft-v{{ version }}.zip - sha256: "986042f7eb9d5aba237b7b9701974e20b6952cb7d585c66fd979137ed4a34c9b" - -build: - number: 3 - run_exports: - - {{ pin_subpackage(name, max_pin="x") }} - -requirements: - build: - - make - - {{ compiler('c') }} - - {{ compiler('go-cgo') }} - run: - - gawk - -test: - commands: - - mafft --version - -about: - home: 'http://mafft.cbrc.jp/alignment/software/' - license: BSD - summary: Multiple alignment program for amino acid or nucleotide sequences based on fast Fourier transform - -extra: - identifiers: - - doi:10.1093/nar/gkf436 - - usegalaxy-eu:rbc_mafft diff --git a/recipes/mageck/meta.yaml b/recipes/mageck/meta.yaml index 9ed1fab66174c..d711f9765c5dc 100644 --- a/recipes/mageck/meta.yaml +++ b/recipes/mageck/meta.yaml @@ -7,7 +7,9 @@ source: sha256: b06a18036da63959cd7751911a46727aefe2fb1d8dd79d95043c3e3bdaf1d93a build: - number: 3 + number: 4 + run_exports: + - {{ pin_subpackage('mageck', max_pin="x.x") }} requirements: build: @@ -32,3 +34,7 @@ about: home: http://mageck.sourceforge.net license: BSD License summary: MAGeCK (Model-based Analysis of Genome-wide CRISPR-Cas9 Knockout), an algorithm to process, QC, analyze and visualize CRISPR screening data. + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/magic-impute/LICENSE b/recipes/magic-impute/LICENSE new file mode 100644 index 0000000000000..23cb790338e19 --- /dev/null +++ b/recipes/magic-impute/LICENSE @@ -0,0 +1,339 @@ + GNU GENERAL PUBLIC LICENSE + Version 2, June 1991 + + Copyright (C) 1989, 1991 Free Software Foundation, Inc., + 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The licenses for most software are designed to take away your +freedom to share and change it. By contrast, the GNU General Public +License is intended to guarantee your freedom to share and change free +software--to make sure the software is free for all its users. This +General Public License applies to most of the Free Software +Foundation's software and to any other program whose authors commit to +using it. (Some other Free Software Foundation software is covered by +the GNU Lesser General Public License instead.) You can apply it to +your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +this service if you wish), that you receive source code or can get it +if you want it, that you can change the software or use pieces of it +in new free programs; and that you know you can do these things. + + To protect your rights, we need to make restrictions that forbid +anyone to deny you these rights or to ask you to surrender the rights. +These restrictions translate to certain responsibilities for you if you +distribute copies of the software, or if you modify it. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must give the recipients all the rights that +you have. You must make sure that they, too, receive or can get the +source code. And you must show them these terms so they know their +rights. + + We protect your rights with two steps: (1) copyright the software, and +(2) offer you this license which gives you legal permission to copy, +distribute and/or modify the software. + + Also, for each author's protection and ours, we want to make certain +that everyone understands that there is no warranty for this free +software. If the software is modified by someone else and passed on, we +want its recipients to know that what they have is not the original, so +that any problems introduced by others will not reflect on the original +authors' reputations. + + Finally, any free program is threatened constantly by software +patents. We wish to avoid the danger that redistributors of a free +program will individually obtain patent licenses, in effect making the +program proprietary. To prevent this, we have made it clear that any +patent must be licensed for everyone's free use or not licensed at all. + + The precise terms and conditions for copying, distribution and +modification follow. + + GNU GENERAL PUBLIC LICENSE + TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION + + 0. This License applies to any program or other work which contains +a notice placed by the copyright holder saying it may be distributed +under the terms of this General Public License. The "Program", below, +refers to any such program or work, and a "work based on the Program" +means either the Program or any derivative work under copyright law: +that is to say, a work containing the Program or a portion of it, +either verbatim or with modifications and/or translated into another +language. (Hereinafter, translation is included without limitation in +the term "modification".) Each licensee is addressed as "you". + +Activities other than copying, distribution and modification are not +covered by this License; they are outside its scope. The act of +running the Program is not restricted, and the output from the Program +is covered only if its contents constitute a work based on the +Program (independent of having been made by running the Program). +Whether that is true depends on what the Program does. + + 1. You may copy and distribute verbatim copies of the Program's +source code as you receive it, in any medium, provided that you +conspicuously and appropriately publish on each copy an appropriate +copyright notice and disclaimer of warranty; keep intact all the +notices that refer to this License and to the absence of any warranty; +and give any other recipients of the Program a copy of this License +along with the Program. + +You may charge a fee for the physical act of transferring a copy, and +you may at your option offer warranty protection in exchange for a fee. + + 2. You may modify your copy or copies of the Program or any portion +of it, thus forming a work based on the Program, and copy and +distribute such modifications or work under the terms of Section 1 +above, provided that you also meet all of these conditions: + + a) You must cause the modified files to carry prominent notices + stating that you changed the files and the date of any change. + + b) You must cause any work that you distribute or publish, that in + whole or in part contains or is derived from the Program or any + part thereof, to be licensed as a whole at no charge to all third + parties under the terms of this License. + + c) If the modified program normally reads commands interactively + when run, you must cause it, when started running for such + interactive use in the most ordinary way, to print or display an + announcement including an appropriate copyright notice and a + notice that there is no warranty (or else, saying that you provide + a warranty) and that users may redistribute the program under + these conditions, and telling the user how to view a copy of this + License. (Exception: if the Program itself is interactive but + does not normally print such an announcement, your work based on + the Program is not required to print an announcement.) + +These requirements apply to the modified work as a whole. If +identifiable sections of that work are not derived from the Program, +and can be reasonably considered independent and separate works in +themselves, then this License, and its terms, do not apply to those +sections when you distribute them as separate works. But when you +distribute the same sections as part of a whole which is a work based +on the Program, the distribution of the whole must be on the terms of +this License, whose permissions for other licensees extend to the +entire whole, and thus to each and every part regardless of who wrote it. + +Thus, it is not the intent of this section to claim rights or contest +your rights to work written entirely by you; rather, the intent is to +exercise the right to control the distribution of derivative or +collective works based on the Program. + +In addition, mere aggregation of another work not based on the Program +with the Program (or with a work based on the Program) on a volume of +a storage or distribution medium does not bring the other work under +the scope of this License. + + 3. You may copy and distribute the Program (or a work based on it, +under Section 2) in object code or executable form under the terms of +Sections 1 and 2 above provided that you also do one of the following: + + a) Accompany it with the complete corresponding machine-readable + source code, which must be distributed under the terms of Sections + 1 and 2 above on a medium customarily used for software interchange; or, + + b) Accompany it with a written offer, valid for at least three + years, to give any third party, for a charge no more than your + cost of physically performing source distribution, a complete + machine-readable copy of the corresponding source code, to be + distributed under the terms of Sections 1 and 2 above on a medium + customarily used for software interchange; or, + + c) Accompany it with the information you received as to the offer + to distribute corresponding source code. (This alternative is + allowed only for noncommercial distribution and only if you + received the program in object code or executable form with such + an offer, in accord with Subsection b above.) + +The source code for a work means the preferred form of the work for +making modifications to it. For an executable work, complete source +code means all the source code for all modules it contains, plus any +associated interface definition files, plus the scripts used to +control compilation and installation of the executable. However, as a +special exception, the source code distributed need not include +anything that is normally distributed (in either source or binary +form) with the major components (compiler, kernel, and so on) of the +operating system on which the executable runs, unless that component +itself accompanies the executable. + +If distribution of executable or object code is made by offering +access to copy from a designated place, then offering equivalent +access to copy the source code from the same place counts as +distribution of the source code, even though third parties are not +compelled to copy the source along with the object code. + + 4. You may not copy, modify, sublicense, or distribute the Program +except as expressly provided under this License. Any attempt +otherwise to copy, modify, sublicense or distribute the Program is +void, and will automatically terminate your rights under this License. +However, parties who have received copies, or rights, from you under +this License will not have their licenses terminated so long as such +parties remain in full compliance. + + 5. You are not required to accept this License, since you have not +signed it. However, nothing else grants you permission to modify or +distribute the Program or its derivative works. These actions are +prohibited by law if you do not accept this License. Therefore, by +modifying or distributing the Program (or any work based on the +Program), you indicate your acceptance of this License to do so, and +all its terms and conditions for copying, distributing or modifying +the Program or works based on it. + + 6. Each time you redistribute the Program (or any work based on the +Program), the recipient automatically receives a license from the +original licensor to copy, distribute or modify the Program subject to +these terms and conditions. You may not impose any further +restrictions on the recipients' exercise of the rights granted herein. +You are not responsible for enforcing compliance by third parties to +this License. + + 7. If, as a consequence of a court judgment or allegation of patent +infringement or for any other reason (not limited to patent issues), +conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot +distribute so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you +may not distribute the Program at all. For example, if a patent +license would not permit royalty-free redistribution of the Program by +all those who receive copies directly or indirectly through you, then +the only way you could satisfy both it and this License would be to +refrain entirely from distribution of the Program. + +If any portion of this section is held invalid or unenforceable under +any particular circumstance, the balance of the section is intended to +apply and the section as a whole is intended to apply in other +circumstances. + +It is not the purpose of this section to induce you to infringe any +patents or other property right claims or to contest validity of any +such claims; this section has the sole purpose of protecting the +integrity of the free software distribution system, which is +implemented by public license practices. Many people have made +generous contributions to the wide range of software distributed +through that system in reliance on consistent application of that +system; it is up to the author/donor to decide if he or she is willing +to distribute software through any other system and a licensee cannot +impose that choice. + +This section is intended to make thoroughly clear what is believed to +be a consequence of the rest of this License. + + 8. If the distribution and/or use of the Program is restricted in +certain countries either by patents or by copyrighted interfaces, the +original copyright holder who places the Program under this License +may add an explicit geographical distribution limitation excluding +those countries, so that distribution is permitted only in or among +countries not thus excluded. In such case, this License incorporates +the limitation as if written in the body of this License. + + 9. The Free Software Foundation may publish revised and/or new versions +of the General Public License from time to time. Such new versions will +be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + +Each version is given a distinguishing version number. If the Program +specifies a version number of this License which applies to it and "any +later version", you have the option of following the terms and conditions +either of that version or of any later version published by the Free +Software Foundation. If the Program does not specify a version number of +this License, you may choose any version ever published by the Free Software +Foundation. + + 10. If you wish to incorporate parts of the Program into other free +programs whose distribution conditions are different, write to the author +to ask for permission. For software which is copyrighted by the Free +Software Foundation, write to the Free Software Foundation; we sometimes +make exceptions for this. Our decision will be guided by the two goals +of preserving the free status of all derivatives of our free software and +of promoting the sharing and reuse of software generally. + + NO WARRANTY + + 11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY +FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN +OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES +PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED +OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF +MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE RISK AS +TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. SHOULD THE +PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING, +REPAIR OR CORRECTION. + + 12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR +REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, +INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING +OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED +TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY +YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER +PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE +POSSIBILITY OF SUCH DAMAGES. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +convey the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + {description} + Copyright (C) {year} {fullname} + + This program is free software; you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation; either version 2 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License along + with this program; if not, write to the Free Software Foundation, Inc., + 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. + +Also add information on how to contact you by electronic and paper mail. + +If the program is interactive, make it output a short notice like this +when it starts in an interactive mode: + + Gnomovision version 69, Copyright (C) year name of author + Gnomovision comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + +The hypothetical commands `show w' and `show c' should show the appropriate +parts of the General Public License. Of course, the commands you use may +be called something other than `show w' and `show c'; they could even be +mouse-clicks or menu items--whatever suits your program. + +You should also get your employer (if you work as a programmer) or your +school, if any, to sign a "copyright disclaimer" for the program, if +necessary. Here is a sample; alter the names: + + Yoyodyne, Inc., hereby disclaims all copyright interest in the program + `Gnomovision' (which makes passes at compilers) written by James Hacker. + + {signature of Ty Coon}, 1 April 1989 + Ty Coon, President of Vice + +This General Public License does not permit incorporating your program into +proprietary programs. If your program is a subroutine library, you may +consider it more useful to permit linking proprietary applications with the +library. If this is what you want to do, use the GNU Lesser General +Public License instead of this License. diff --git a/recipes/magic-impute/meta.yaml b/recipes/magic-impute/meta.yaml new file mode 100644 index 0000000000000..af8166a8e5aaa --- /dev/null +++ b/recipes/magic-impute/meta.yaml @@ -0,0 +1,47 @@ +{% set name = "magic-impute" %} +{% set version = "3.0.0" %} +{% set sha256 = "0c3f6d17baf586c412c174709a19164f04e693fd1933a8c0399ae5c5bf1cfd7a" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/magic-impute-{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + script: {{ PYTHON }} -m pip install . --no-deps -vvv + run_exports: + - {{ pin_subpackage('magic-impute', max_pin="x.x") }} + noarch: python + +requirements: + host: + - python + - pip + run: + - python + - matplotlib-base + - pandas + - numpy + - scprep + - graphtools + +test: + imports: + - magic + +about: + home: https://github.com/KrishnaswamyLab/MAGIC + summary: "Markov Affinity-based Graph Imputation of Cells" + license: GPL-2.0 + license_family: GPL + license_file: LICENSE + doc_url: https://magic.readthedocs.io/en/stable/ + dev_url: https://github.com/KrishnaswamyLab/MAGIC + +extra: + identifiers: + - doi:10.1016/j.cell.2018.05.061 diff --git a/recipes/magus-msa/meta.yaml b/recipes/magus-msa/meta.yaml index 1693c9e79db90..cde6aeeb6ad37 100644 --- a/recipes/magus-msa/meta.yaml +++ b/recipes/magus-msa/meta.yaml @@ -1,33 +1,28 @@ {% set name = "magus-msa" %} -{% set version = "0.1.2" %} -{% set sha256 = "9ee1156921dba68b55d6d737aab75e68f6f3b29d76ce31a9a30cb3dcb69b2eb8" %} +{% set version = "0.2.0" %} +{% set sha256 = "4152ab0d5cedfe0691dc1a3fce2cd38e3549bcd0883227a346cc47f093570141" %} package: name: {{ name }} version: {{ version }} source: - # url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz url: https://github.com/vlasmirnov/MAGUS/archive/refs/tags/v{{ version }}.tar.gz sha256: {{ sha256 }} build: noarch: python number: 0 - script: python -m pip install --no-deps --ignore-installed . + script: {{ PYTHON }} -m pip install --no-deps --no-build-isolation --no-cache-dir . -vvv + entry_points: + - magus = magus.main:main run_exports: - - {{ pin_subpackage('magus-msa', max_pin="x") }} + - {{ pin_subpackage('magus-msa', max_pin="x.x") }} requirements: host: - python >=3.6 - pip - - setuptools - - mafft - - mcl - - fasttree - - clustalo - - hmmer run: - python >=3.6 - dendropy >=4.5.2 @@ -39,22 +34,30 @@ requirements: test: imports: - - magus_align - - magus_align.decompose - - magus_align.merge - - magus_align.merge.graph_build - - magus_align.merge.graph_cluster - - magus_align.merge.graph_trace - - magus_helpers - - magus_tasks - - magus_tools + - magus + - magus.align + - magus.align.decompose + - magus.align.merge + - magus.align.merge.graph_build + - magus.align.merge.graph_cluster + - magus.align.merge.graph_trace + - magus.helpers + - magus.tasks + - magus.tools commands: - magus --help about: home: "https://github.com/vlasmirnov/MAGUS" license: MIT + license_family: MIT + license_file: LICENSE.txt summary: "Multiple Sequence Alignment using Graph Clustering" doc_url: "https://github.com/vlasmirnov/MAGUS/blob/master/README.md" dev_url: "https://github.com/vlasmirnov/MAGUS" + +extra: + identifiers: + - biotools:magus + - doi:10.1093/bioinformatics/btaa992 diff --git a/recipes/malt/build.sh b/recipes/malt/build.sh index 49b33d38c0310..61ca8fc5e25e0 100755 --- a/recipes/malt/build.sh +++ b/recipes/malt/build.sh @@ -1,9 +1,9 @@ #!/bin/bash # call installer -chmod u+x MALT_unix_0_6_1.sh +chmod u+x MALT_unix_0_6_2.sh MALT="$PREFIX/opt/$PKG_NAME-$PKG_VERSION" -./MALT_unix_0_6_1.sh -q -dir "$MALT" +./MALT_unix_0_6_2.sh -q -dir "$MALT" ln -s "$MALT"/malt-build "$PREFIX"/bin/malt-build ln -s "$MALT"/malt-run "$PREFIX"/bin/malt-run diff --git a/recipes/malt/meta.yaml b/recipes/malt/meta.yaml index 154885195a594..28c4fe7bffb80 100755 --- a/recipes/malt/meta.yaml +++ b/recipes/malt/meta.yaml @@ -1,12 +1,14 @@ package: name: malt - version: 0.61 # Keep without patch release decimal. Versioning style changed in 0.5 causing latest-version sorting problems when installing from bioconda. + version: 0.62 # Keep without patch release decimal. Versioning style changed in 0.5 causing latest-version sorting problems when installing from bioconda. build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage("malt", max_pin="x.x") }} source: - md5: 41573f8c652fc81f3745729dee2d5e2d - url: https://software-ab.informatik.uni-tuebingen.de/download/malt/MALT_unix_0_6_1.sh + md5: 3e9b7516c722ca959d92722bea209b04 + url: https://maira.cs.uni-tuebingen.de/download/malt/MALT_unix_0_6_2.sh requirements: build: - openjdk diff --git a/recipes/malva/build_failure.linux-64.yaml b/recipes/malva/build_failure.linux-64.yaml deleted file mode 100644 index 414662d68c286..0000000000000 --- a/recipes/malva/build_failure.linux-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: d1651f674064650225149083c22db4ade1849d8d8ac92fd1d03fd7168e972dce # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |- - export PREFIX=/opt/conda/conda-bld/malva_1685353511262/_h_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placeho - export BUILD_PREFIX=/opt/conda/conda-bld/malva_1685353511262/_build_env - export SRC_DIR=/opt/conda/conda-bld/malva_1685353511262/work - INFO: activate-binutils_linux-64.sh made the following environmental changes: - ADDR2LINE=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-addr2line - AR=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ar - AS=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-as - CXXFILT=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-cfilt - ELFEDIT=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-elfedit - GPROF=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gprof - LD=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ld - LD_GOLD=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ld.gold - NM=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-nm - OBJCOPY=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-objcopy - OBJDUMP=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-objdump - RANLIB=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ranlib - READELF=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-readelf - SIZE=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-size - STRINGS=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-strings - STRIP=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-strip - INFO: activate-gcc_linux-64.sh made the following environmental changes: - BUILD=x86_64-conda-linux-gnu - CC=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-cc - CC_FOR_BUILD=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-cc - CFLAGS=-march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/malva-2.0.0 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix - CMAKE_ARGS=-DCMAKE_AR=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ar -DCMAKE_CXX_COMPILER_AR=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-ar -DCMAKE_C_COMPILER_AR=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-ar -DCMAKE_RANLIB=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ranlib -DCMAKE_CXX_COMPILER_RANLIB=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-ranlib -DCMAKE_C_COMPILER_RANLIB=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-ranlib -DCMAKE_LINKER=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ld -DCMAKE_STRIP=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-strip -DCMAKE_FIND_ROOT_PATH_MODE_PROGRAM=NEVER -DCMAKE_FIND_ROOT_PATH_MODE_LIBRARY=ONLY -DCMAKE_FIND_ROOT_PATH_MODE_INCLUDE=ONLY -DCMAKE_FIND_ROOT_PATH=$PREFIX;$BUILD_PREFIX/x86_64-conda-linux-gnu/sysroot -DCMAKE_INSTALL_PREFIX=$PREFIX -DCMAKE_INSTALL_LIBDIR=lib -DCMAKE_PROGRAM_PATH=$BUILD_PREFIX/bin;$PREFIX/bin - CMAKE_PREFIX_PATH=$PREFIX:$BUILD_PREFIX/x86_64-conda-linux-gnu/sysroot/usr - CONDA_BUILD_SYSROOT=$BUILD_PREFIX/x86_64-conda-linux-gnu/sysroot - CONDA_TOOLCHAIN_BUILD=x86_64-conda-linux-gnu - CONDA_TOOLCHAIN_HOST=x86_64-conda-linux-gnu - CPP=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-cpp - CPPFLAGS=-DNDEBUG -D_FORTIFY_SOURCE=2 -O2 -isystem $PREFIX/include - DEBUG_CFLAGS=-march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-all -fno-plt -Og -g -Wall -Wextra -fvar-tracking-assignments -ffunction-sections -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/malva-2.0.0 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix - DEBUG_CPPFLAGS=-D_DEBUG -D_FORTIFY_SOURCE=2 -Og -isystem $PREFIX/include - GCC=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc - GCC_AR=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-ar - GCC_NM=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-nm - GCC_RANLIB=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-ranlib - HOST=x86_64-conda-linux-gnu - LDFLAGS=-Wl,-O2 -Wl,--sort-common -Wl,--as-needed -Wl,-z,relro -Wl,-z,now -Wl,--disable-new-dtags -Wl,--gc-sections -Wl,--allow-shlib-undefined -Wl,-rpath,$PREFIX/lib -Wl,-rpath-link,$PREFIX/lib -L$PREFIX/lib - MESON_ARGS=--buildtype release --prefix=$PREFIX -Dlibdir=lib - _CONDA_PYTHON_SYSCONFIGDATA_NAME=_sysconfigdata_x86_64_conda_cos6_linux_gnu - build_alias=x86_64-conda-linux-gnu - host_alias=x86_64-conda-linux-gnu - -BUILD=x86_64-conda_cos6-linux-gnu - -CONDA_BUILD_SYSROOT= - INFO: activate-gxx_linux-64.sh made the following environmental changes: - CXX=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-c - CXXFLAGS=-fvisibility-inlines-hidden -fmessage-length=0 -march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/malva-2.0.0 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix - CXX_FOR_BUILD=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-c - DEBUG_CXXFLAGS=-fvisibility-inlines-hidden -fmessage-length=0 -march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-all -fno-plt -Og -g -Wall -Wextra -fvar-tracking-assignments -ffunction-sections -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/malva-2.0.0 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix - GXX=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-g - -- The C compiler identification is GNU 12.2.0 - -- The CXX compiler identification is GNU 12.2.0 - -- Detecting C compiler ABI info - -- Detecting C compiler ABI info - done - -- Check for working C compiler: $BUILD_PREFIX/bin/x86_64-conda-linux-gnu-cc - skipped - -- Detecting C compile features - -- Detecting C compile features - done - -- Detecting CXX compiler ABI info - -- Detecting CXX compiler ABI info - done - -- Check for working CXX compiler: $BUILD_PREFIX/bin/x86_64-conda-linux-gnu-c - skipped - -- Detecting CXX compile features - -- Detecting CXX compile features - done - -- SDSL found $BUILD_PREFIX/lib/libsdsl.a - -- KMC includes found $PREFIX/include - -- ZSTD found $BUILD_PREFIX/lib/libzstd.a - -- ZSTD includes found $PREFIX/include - -- Configuring done (0.4s) - -- Generating done (0.0s) - -- Build files have been written to: $SRC_DIR/build - [ 25%] Building CXX object CMakeFiles/malva-geno.dir/zstdstream.cpp.o - [ 50%] Building C object CMakeFiles/malva-geno.dir/xxhash.c.o - [ 75%] Building CXX object CMakeFiles/malva-geno.dir/main.cpp.o - In file included from /opt/conda/conda-bld/malva_1685353511262/work/main.cpp:44: - /opt/conda/conda-bld/malva_1685353511262/work/bloom_filter.hpp:28:10: fatal error: sdsl/bit_vectors.hpp: No such file or directory - 28 | #include - | ^~~~~~~~~~~~~~~~~~~~~~ - compilation terminated. - make[2]: *** [CMakeFiles/malva-geno.dir/build.make:104: CMakeFiles/malva-geno.dir/main.cpp.o] Error 1 - make[1]: *** [CMakeFiles/Makefile2:83: CMakeFiles/malva-geno.dir/all] Error 2 - make: *** [Makefile:91: all] Error 2 - Traceback (most recent call last): - File "/opt/conda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/conda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 2198, in build - utils.check_call_env(cmd, env=env, rewrite_stdout_env=rewrite_env, - File "/opt/conda/lib/python3.8/site-packages/conda_build/utils.py", line 451, in check_call_env - return _func_defaulting_env_to_os_environ("call", *popenargs, **kwargs) - File "/opt/conda/lib/python3.8/site-packages/conda_build/utils.py", line 427, in _func_defaulting_env_to_os_environ - raise subprocess.CalledProcessError(proc.returncode, _args) - subprocess.CalledProcessError: Command '['/bin/bash', '-o', 'errexit', '/opt/conda/conda-bld/malva_1685353511262/work/conda_build.sh']' returned non-zero exit status 2. -# Last 100 lines of the build log. diff --git a/recipes/malva/malva.CMakeList.patch b/recipes/malva/malva.CMakeList.patch index 46fe9a0cedf2c..6f7bc733d2c36 100644 --- a/recipes/malva/malva.CMakeList.patch +++ b/recipes/malva/malva.CMakeList.patch @@ -1,8 +1,22 @@ diff --git a/CMakeLists.txt b/CMakeLists.txt -index 5796d8b..9030264 100644 +index 5796d8b..351fd24 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt -@@ -32,9 +32,17 @@ else () +@@ -18,6 +18,13 @@ else () + message(STATUS "SDSL found ${SDSL}") + endif () + ++find_path(SDSL_INCLUDE_DIR NAMES sdsl/bit_vectors.hpp PATHS ${CMAKE_SYSTEM_PREFIX_PATH}) ++if (NOT SDSL_INCLUDE_DIR) ++ message(FATAL_ERROR "bit_vectors.hpp (part of sdsl-lite) required") ++else () ++ message(STATUS "SDSL includes found ${SDSL_INCLUDE_DIR}") ++endif () ++ + find_path(KMC_INCLUDE_DIR NAMES kmc_file.h PATHS ${CMAKE_SYSTEM_PREFIX_PATH} PATH_SUFFIXES "kmc") + if (NOT KMC_INCLUDE_DIR) + message(FATAL_ERROR "kmc_file.h (part of libkmc-dev) required") +@@ -32,9 +39,18 @@ else () message(STATUS "ZSTD found ${ZSTD}") endif () @@ -16,6 +30,7 @@ index 5796d8b..9030264 100644 target_include_directories(malva-geno PRIVATE ${PROJECT_SOURCE_DIR} PRIVATE ${KMC_INCLUDE_DIR} ++ PRIVATE ${SDSL_INCLUDE_DIR} + PRIVATE ${ZSTD_INCLUDE_DIR} ) diff --git a/recipes/malva/meta.yaml b/recipes/malva/meta.yaml index f82ac08b27bfd..72c392b21a442 100644 --- a/recipes/malva/meta.yaml +++ b/recipes/malva/meta.yaml @@ -13,8 +13,10 @@ source: - malva.CMakeList.patch build: - number: 3 + number: 4 skip: True # [osx] + run_exports: + - {{ pin_subpackage('malva', max_pin="x") }} requirements: build: @@ -27,10 +29,10 @@ requirements: host: - zlib - htslib - - kmc + - kmc =3.1 run: - htslib - - kmc + - kmc =3.1 test: commands: @@ -40,6 +42,7 @@ test: about: home: https://algolab.github.io/malva/ license: GPL-3.0-or-later + license_file: LICENSE summary: genotyping by Mapping-free ALternate-allele detection of known VAriants extra: diff --git a/recipes/mappy/build.sh b/recipes/mappy/build.sh index b574ab80d53e9..f8457f291b1a6 100644 --- a/recipes/mappy/build.sh +++ b/recipes/mappy/build.sh @@ -3,4 +3,4 @@ export C_INCLUDE_PATH=$PREFIX/include export LIBRARY_PATH=$PREFIX/lib -$PYTHON setup.py install --single-version-externally-managed --record=record.txt +${PYTHON} -m pip install . --no-build-isolation --no-deps -vvv diff --git a/recipes/mappy/build_failure.osx-64.yaml b/recipes/mappy/build_failure.osx-64.yaml deleted file mode 100644 index 8c01d13a166b7..0000000000000 --- a/recipes/mappy/build_failure.osx-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: 624d20276cc122996176684e48e0e6d529dbccfcf7a07d55454e754e178d9d32 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |- - map.c:367:70: warning: comparison of integers of different signs: 'size_t' (aka 'unsigned long') and 'const int64_t' (aka 'const long long') [-Wsign-compare] - if (kmst.largest > 1U<<28 || (opt->cap_kalloc > 0 && kmst.capacity > opt->cap_kalloc)) { - ~~~~~~~~~~~~~ ^ ~~~~~~~~~~~~~~~ - 1 warning generated. - x86_64-apple-darwin13.4.0-clang -Wno-unused-result -Wsign-compare -Wunreachable-code -DNDEBUG -fwrapv -O2 -Wall -fPIC -O2 -isystem $PREFIX/include -fPIC -O2 -isystem $PREFIX/include -march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/mappy-2.26 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix -D_FORTIFY_SOURCE=2 -isystem $PREFIX/include -mmacosx-version-min=10.9 -I. -I$PREFIX/include/python3.10 -c misc.c -o build/temp.macosx-10.9-x86_64-cpython-310/misc.o -DHAVE_KALLOC -msse4.1 - x86_64-apple-darwin13.4.0-clang -Wno-unused-result -Wsign-compare -Wunreachable-code -DNDEBUG -fwrapv -O2 -Wall -fPIC -O2 -isystem $PREFIX/include -fPIC -O2 -isystem $PREFIX/include -march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/mappy-2.26 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix -D_FORTIFY_SOURCE=2 -isystem $PREFIX/include -mmacosx-version-min=10.9 -I. -I$PREFIX/include/python3.10 -c options.c -o build/temp.macosx-10.9-x86_64-cpython-310/options.o -DHAVE_KALLOC -msse4.1 - x86_64-apple-darwin13.4.0-clang -Wno-unused-result -Wsign-compare -Wunreachable-code -DNDEBUG -fwrapv -O2 -Wall -fPIC -O2 -isystem $PREFIX/include -fPIC -O2 -isystem $PREFIX/include -march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/mappy-2.26 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix -D_FORTIFY_SOURCE=2 -isystem $PREFIX/include -mmacosx-version-min=10.9 -I. -I$PREFIX/include/python3.10 -c pe.c -o build/temp.macosx-10.9-x86_64-cpython-310/pe.o -DHAVE_KALLOC -msse4.1 - x86_64-apple-darwin13.4.0-clang -Wno-unused-result -Wsign-compare -Wunreachable-code -DNDEBUG -fwrapv -O2 -Wall -fPIC -O2 -isystem $PREFIX/include -fPIC -O2 -isystem $PREFIX/include -march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/mappy-2.26 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix -D_FORTIFY_SOURCE=2 -isystem $PREFIX/include -mmacosx-version-min=10.9 -I. -I$PREFIX/include/python3.10 -c python/mappy.c -o build/temp.macosx-10.9-x86_64-cpython-310/python/mappy.o -DHAVE_KALLOC -msse4.1 - python/mappy.c:10830:21: warning: fallthrough annotation in unreachable code [-Wunreachable-code-fallthrough] - CYTHON_FALLTHROUGH; - ^ - python/mappy.c:345:34: note: expanded from macro 'CYTHON_FALLTHROUGH' - #define CYTHON_FALLTHROUGH __attribute__((fallthrough)) - ^ - python/mappy.c:10841:21: warning: fallthrough annotation in unreachable code [-Wunreachable-code-fallthrough] - CYTHON_FALLTHROUGH; - ^ - python/mappy.c:345:34: note: expanded from macro 'CYTHON_FALLTHROUGH' - #define CYTHON_FALLTHROUGH __attribute__((fallthrough)) - ^ - python/mappy.c:10941:21: warning: fallthrough annotation in unreachable code [-Wunreachable-code-fallthrough] - CYTHON_FALLTHROUGH; - ^ - python/mappy.c:345:34: note: expanded from macro 'CYTHON_FALLTHROUGH' - #define CYTHON_FALLTHROUGH __attribute__((fallthrough)) - ^ - python/mappy.c:10952:21: warning: fallthrough annotation in unreachable code [-Wunreachable-code-fallthrough] - CYTHON_FALLTHROUGH; - ^ - python/mappy.c:345:34: note: expanded from macro 'CYTHON_FALLTHROUGH' - #define CYTHON_FALLTHROUGH __attribute__((fallthrough)) - ^ - python/mappy.c:11089:21: warning: fallthrough annotation in unreachable code [-Wunreachable-code-fallthrough] - CYTHON_FALLTHROUGH; - ^ - python/mappy.c:345:34: note: expanded from macro 'CYTHON_FALLTHROUGH' - #define CYTHON_FALLTHROUGH __attribute__((fallthrough)) - ^ - python/mappy.c:11100:21: warning: fallthrough annotation in unreachable code [-Wunreachable-code-fallthrough] - CYTHON_FALLTHROUGH; - ^ - python/mappy.c:345:34: note: expanded from macro 'CYTHON_FALLTHROUGH' - #define CYTHON_FALLTHROUGH __attribute__((fallthrough)) - ^ - 6 warnings generated. - x86_64-apple-darwin13.4.0-clang -Wno-unused-result -Wsign-compare -Wunreachable-code -DNDEBUG -fwrapv -O2 -Wall -fPIC -O2 -isystem $PREFIX/include -fPIC -O2 -isystem $PREFIX/include -march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/mappy-2.26 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix -D_FORTIFY_SOURCE=2 -isystem $PREFIX/include -mmacosx-version-min=10.9 -I. -I$PREFIX/include/python3.10 -c sdust.c -o build/temp.macosx-10.9-x86_64-cpython-310/sdust.o -DHAVE_KALLOC -msse4.1 - x86_64-apple-darwin13.4.0-clang -Wno-unused-result -Wsign-compare -Wunreachable-code -DNDEBUG -fwrapv -O2 -Wall -fPIC -O2 -isystem $PREFIX/include -fPIC -O2 -isystem $PREFIX/include -march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/mappy-2.26 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix -D_FORTIFY_SOURCE=2 -isystem $PREFIX/include -mmacosx-version-min=10.9 -I. -I$PREFIX/include/python3.10 -c seed.c -o build/temp.macosx-10.9-x86_64-cpython-310/seed.o -DHAVE_KALLOC -msse4.1 - seed.c:9:12: warning: comparison of integers of different signs: 'size_t' (aka 'unsigned long') and 'int32_t' (aka 'int') [-Wsign-compare] - if (mv->n <= q_occ_max || q_occ_frac <= 0.0f || q_occ_max <= 0) return; - ~~~~~ ^ ~~~~~~~~~ - seed.c:65:14: warning: comparison of integers of different signs: 'uint32_t' (aka 'unsigned int') and 'int' [-Wsign-compare] - if (a[i].n > max_occ) m; - ~~~~~~ ^ ~~~~~~~ - seed.c:68:24: warning: comparison of integers of different signs: 'uint32_t' (aka 'unsigned int') and 'int' [-Wsign-compare] - if (i == n || a[i].n <= max_occ) { - ~~~~~~ ^ ~~~~~~~ - seed.c:81:18: warning: comparison of integers of different signs: 'uint32_t' (aka 'unsigned int') and 'int32_t' (aka 'int') [-Wsign-compare] - if (a[j].n < (int32_t)(b[0]>>32)) { // then update the heap - ~~~~~~ ^ ~~~~~~~~~~~~~~~~~~~ - seed.c:90:17: warning: comparison of integers of different signs: 'uint32_t' (aka 'unsigned int') and 'int' [-Wsign-compare] - if (a[j].n > max_max_occ) - ~~~~~~ ^ ~~~~~~~~~~~ - seed.c:109:17: warning: comparison of integers of different signs: 'size_t' (aka 'unsigned long') and 'int' [-Wsign-compare] - for (i = 0; i < n_m0; i) - ~ ^ ~~~~ - seed.c:110:15: warning: comparison of integers of different signs: 'uint32_t' (aka 'unsigned int') and 'int' [-Wsign-compare] - if (m[i].n > max_occ) - ~~~~~~ ^ ~~~~~~~ - seed.c:113:49: warning: comparison of integers of different signs: 'size_t' (aka 'unsigned long') and 'int' [-Wsign-compare] - for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < n_m0; i) { - ~ ^ ~~~~ - 8 warnings generated. - x86_64-apple-darwin13.4.0-clang -Wno-unused-result -Wsign-compare -Wunreachable-code -DNDEBUG -fwrapv -O2 -Wall -fPIC -O2 -isystem $PREFIX/include -fPIC -O2 -isystem $PREFIX/include -march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/mappy-2.26 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix -D_FORTIFY_SOURCE=2 -isystem $PREFIX/include -mmacosx-version-min=10.9 -I. -I$PREFIX/include/python3.10 -c sketch.c -o build/temp.macosx-10.9-x86_64-cpython-310/sketch.o -DHAVE_KALLOC -msse4.1 - x86_64-apple-darwin13.4.0-clang -Wno-unused-result -Wsign-compare -Wunreachable-code -DNDEBUG -fwrapv -O2 -Wall -fPIC -O2 -isystem $PREFIX/include -fPIC -O2 -isystem $PREFIX/include -march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/mappy-2.26 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix -D_FORTIFY_SOURCE=2 -isystem $PREFIX/include -mmacosx-version-min=10.9 -I. -I$PREFIX/include/python3.10 -c splitidx.c -o build/temp.macosx-10.9-x86_64-cpython-310/splitidx.o -DHAVE_KALLOC -msse4.1 - creating build/lib.macosx-10.9-x86_64-cpython-310 - x86_64-apple-darwin13.4.0-clang -bundle -undefined dynamic_lookup -Wl,-rpath,$PREFIX/lib -L$PREFIX/lib -Wl,-rpath,$PREFIX/lib -L$PREFIX/lib -Wl,-pie -Wl,-headerpad_max_install_names -Wl,-dead_strip_dylibs -Wl,-rpath,$PREFIX/lib -L$PREFIX/lib -march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/mappy-2.26 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix -D_FORTIFY_SOURCE=2 -isystem $PREFIX/include -mmacosx-version-min=10.9 build/temp.macosx-10.9-x86_64-cpython-310/align.o build/temp.macosx-10.9-x86_64-cpython-310/bseq.o build/temp.macosx-10.9-x86_64-cpython-310/esterr.o build/temp.macosx-10.9-x86_64-cpython-310/format.o build/temp.macosx-10.9-x86_64-cpython-310/hit.o build/temp.macosx-10.9-x86_64-cpython-310/index.o build/temp.macosx-10.9-x86_64-cpython-310/kalloc.o build/temp.macosx-10.9-x86_64-cpython-310/ksw2_extd2_sse.o build/temp.macosx-10.9-x86_64-cpython-310/ksw2_exts2_sse.o build/temp.macosx-10.9-x86_64-cpython-310/ksw2_extz2_sse.o build/temp.macosx-10.9-x86_64-cpython-310/ksw2_ll_sse.o build/temp.macosx-10.9-x86_64-cpython-310/kthread.o build/temp.macosx-10.9-x86_64-cpython-310/lchain.o build/temp.macosx-10.9-x86_64-cpython-310/map.o build/temp.macosx-10.9-x86_64-cpython-310/misc.o build/temp.macosx-10.9-x86_64-cpython-310/options.o build/temp.macosx-10.9-x86_64-cpython-310/pe.o build/temp.macosx-10.9-x86_64-cpython-310/python/mappy.o build/temp.macosx-10.9-x86_64-cpython-310/sdust.o build/temp.macosx-10.9-x86_64-cpython-310/seed.o build/temp.macosx-10.9-x86_64-cpython-310/sketch.o build/temp.macosx-10.9-x86_64-cpython-310/splitidx.o -lz -lm -lpthread -o build/lib.macosx-10.9-x86_64-cpython-310/mappy.cpython-310-darwin.so - dyld[21993]: Library not loaded: '@rpath/libtapi.dylib' - Referenced from: '/opt/mambaforge/envs/bioconda/pkgs/ld64_osx-64-609-h8ce0179_13/bin/x86_64-apple-darwin13.4.0-ld' - Reason: tried: '/opt/mambaforge/envs/bioconda/pkgs/ld64_osx-64-609-h8ce0179_13/bin/../lib/libtapi.dylib' (no such file), '/opt/mambaforge/envs/bioconda/pkgs/ld64_osx-64-609-h8ce0179_13/bin/../lib/libtapi.dylib' (no such file), '/usr/local/lib/libtapi.dylib' (no such file), '/usr/lib/libtapi.dylib' (no such file) - clang-15: error: unable to execute command: Abort trap: 6 - clang-15: error: linker command failed due to signal (use -v to see invocation) - error: command '/opt/mambaforge/envs/bioconda/conda-bld/mappy_1686046171677/_build_env/bin/x86_64-apple-darwin13.4.0-clang' failed with exit code 1 - Traceback (most recent call last): - File "/opt/mambaforge/envs/bioconda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 2198, in build - utils.check_call_env(cmd, env=env, rewrite_stdout_env=rewrite_env, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/utils.py", line 451, in check_call_env - return _func_defaulting_env_to_os_environ("call", *popenargs, **kwargs) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/utils.py", line 427, in _func_defaulting_env_to_os_environ - raise subprocess.CalledProcessError(proc.returncode, _args) - subprocess.CalledProcessError: Command '['/bin/bash', '-o', 'errexit', '/opt/mambaforge/envs/bioconda/conda-bld/mappy_1686046171677/work/conda_build.sh']' returned non-zero exit status 1. -# Last 100 lines of the build log. diff --git a/recipes/mappy/meta.yaml b/recipes/mappy/meta.yaml index 8125b86d3352f..422595563dc9d 100644 --- a/recipes/mappy/meta.yaml +++ b/recipes/mappy/meta.yaml @@ -1,15 +1,18 @@ -{% set version = "2.26" %} +{% set name = "mappy" %} +{% set version = "2.28" %} package: - name: mappy + name: {{ name }} version: {{ version }} source: - url: https://pypi.io/packages/source/m/mappy/mappy-{{ version }}.tar.gz - sha256: e53fbe9a3ea8762a64b8103f4f779c9fb16d418eaa0a731f45cebc83867a9b71 + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/mappy-{{ version }}.tar.gz + sha256: 0ebf7a5d62bd668f5456028215e26176e180ca68161ac18d4f7b48045484cebb build: - number: 1 + number: 0 + run_exports: + - {{ pin_subpackage('mappy', max_pin="x") }} requirements: build: @@ -17,7 +20,7 @@ requirements: host: - python - cython - - setuptools + - pip - zlib run: - python @@ -30,4 +33,10 @@ test: about: home: https://github.com/lh3/minimap2 license: MIT + license_family: MIT + license_file: LICENSE.txt summary: 'Minimap2 Python binding' + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/marti/meta.yaml b/recipes/marti/meta.yaml index 53848307a0c89..e86203beedb7e 100644 --- a/recipes/marti/meta.yaml +++ b/recipes/marti/meta.yaml @@ -1,5 +1,5 @@ {% set name = "MARTi" %} -{% set version = "0.9.15" %} +{% set version = "0.9.16" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/richardmleggett/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz - sha256: 8bb5851d382ce91bda51602d6af46ace995b25520635836dcddf1e5de069e6f6 + sha256: 85b06a61df8860d17c6de5282a820a8bd1b66bbb3d1f2351dbf5b54522aa1cb6 build: noarch: generic diff --git a/recipes/mashpit/meta.yaml b/recipes/mashpit/meta.yaml index 59823e05bd435..16a7f9b314a25 100644 --- a/recipes/mashpit/meta.yaml +++ b/recipes/mashpit/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.9.2" %} +{% set version = "0.9.6" %} package: name: mashpit @@ -6,12 +6,14 @@ package: source: url: https://github.com/tongzhouxu/mashpit/archive/refs/tags/v{{ version }}.tar.gz - sha256: 8556e02af3d2478bff6cc83f0446690d77c171e7fd6f7d071eec19e70e8ef75b + sha256: 94754449251e51fff771c5d9579ef7016cf1d2984dfcdc5f01a558ceac772d14 build: noarch: python script: python -m pip install --no-deps --ignore-installed . number: 0 + run_exports: + - {{ pin_subpackage("mashpit", max_pin="x.x") }} requirements: host: @@ -19,14 +21,19 @@ requirements: - pip run: - biopython =1.78 + - dask >=2024.1 + - flask >=3.0 + - ncbi-datasets-cli >=16.10 + - ncbi-datasets-pylib >=16.6.0 - numpy >=1.19.5 - python >=3.8 - - python-dotenv - pandas >=1.1.5 - - scipy =1.7.3 + - requests + - scikit-bio + - scipy >=1.0 - screed >=1.0.5 - - sourmash >=4.2.2 - - sra-tools >=2.10.8 + - sourmash >=4.6.1 + - tqdm test: commands: diff --git a/recipes/mass2chem/meta.yaml b/recipes/mass2chem/meta.yaml index 7f7f765b95914..c5a5ce11d8bf2 100644 --- a/recipes/mass2chem/meta.yaml +++ b/recipes/mass2chem/meta.yaml @@ -1,5 +1,5 @@ {% set name = "mass2chem" %} -{% set version = "0.4.9" %} +{% set version = "0.5.0" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/mass2chem-{{ version }}.tar.gz - sha256: 5f570440aa217f2f2847f8b2d7cba06c2b46a4088921079db1ed0941b30c1e4b + sha256: 0ef8a49e9ae7e39502edf881249bbdeb445225ae91e6b96da3828a3793f0f8f5 build: noarch: python diff --git a/recipes/massdash/meta.yaml b/recipes/massdash/meta.yaml new file mode 100644 index 0000000000000..09f269a84b383 --- /dev/null +++ b/recipes/massdash/meta.yaml @@ -0,0 +1,56 @@ +{% set name = "massdash" %} +{% set version = "0.0.9" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" + sha256: 68d90f668312d94ec44f744376c0dad0b671fe78f01906d2e36ce43cc9c85ffa + +build: + number: 0 + noarch: python + script: "{{ PYTHON }} -m pip install . -vv" + run_exports: + - {{ pin_subpackage('massdash', max_pin='x.x') }} + +requirements: + host: + - pip + - python + - flake8 + - flit + - flit-core + - pylint + - snapshottest + run: + - bokeh ==2.4.3 + - click + - joblib + - matplotlib-base + - matplotlib-venn + - upsetplot + - numpy >=1.9.0 + - pandas >=0.17 + - plotly + - psutil + - pyopenms + - scipy + - streamlit + - tqdm + +test: + imports: + - massdash + +about: + home: https://github.com/Roestlab/massdash + license: BSD + license_family: BSD + summary: MassDash is a streamlined DIA mass spec visualization, analysis, optimization, and rapid prototyping. + +extra: + recipe-maintainers: + - singjc diff --git a/recipes/masurca/meta.yaml b/recipes/masurca/meta.yaml index d9b9f6bd806ec..1663a0fe1c87f 100644 --- a/recipes/masurca/meta.yaml +++ b/recipes/masurca/meta.yaml @@ -1,5 +1,5 @@ {% set name = "masurca" %} -{% set version = "4.1.0" %} +{% set version = "4.1.1" %} package: name: {{ name }} @@ -7,11 +7,13 @@ package: source: url: https://github.com/alekseyzimin/masurca/releases/download/v{{ version }}/MaSuRCA-{{ version }}.tar.gz - sha256: 15078e24c79fe5aabe42748d64f95d15f3fbd7708e84d88fc07c4b7f2e4b0902 + sha256: 8758f6196bf7f57e24e08bda84abddfff08feb4cea204c0eb5e1cb9fe8198573 build: - number: 1 + number: 0 skip: True # [osx] + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} requirements: build: diff --git a/recipes/matchms/meta.yaml b/recipes/matchms/meta.yaml index 20b110efe079c..c61d978f84e73 100644 --- a/recipes/matchms/meta.yaml +++ b/recipes/matchms/meta.yaml @@ -1,5 +1,5 @@ {% set name = "matchms" %} -{% set version = "0.24.0" %} +{% set version = "0.24.4" %} package: name: "{{ name|lower }}" @@ -7,10 +7,10 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: e62b1591782b01c3ef83850245609d85e3d612a7f7c350b4fc2ad067d8bc9d15 + sha256: 012afda1e28ea0f06592e3b7fab07748ed348d31349416869b35af25859d7619 build: - number: 1 + number: 0 script: "{{ PYTHON }} -m pip install . --no-deps -vvv" noarch: python run_exports: diff --git a/recipes/mawk/meta.yaml b/recipes/mawk/meta.yaml index 28545184f83bf..90a8f6efb736d 100644 --- a/recipes/mawk/meta.yaml +++ b/recipes/mawk/meta.yaml @@ -4,20 +4,31 @@ package: name: mawk version: "1.3.4" + source: url: https://invisible-mirror.net/archives/mawk/mawk-{{ version }}-{{ date }}.tgz sha256: db17115d1ed18ed1607c8b93291db9ccd4fe5e0f30d2928c3c5d127b23ec9e5b + build: - number: 7 + number: 8 + run_exports: + - {{ pin_subpackage('mawk', max_pin="x") }} + requirements: build: - make - {{ compiler('c') }} run: + test: commands: - mawk -W usage + about: home: http://invisible-island.net/mawk/ license: Copyright (c) 2009-2014,2015 by Thomas E. Dickey summary: mawk is an interpreter for the AWK Programming Language. + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/megahit/linux-aarch64-support-pr-368.patch b/recipes/megahit/linux-aarch64-support-pr-368.patch new file mode 100644 index 0000000000000..01b9f2d556f98 --- /dev/null +++ b/recipes/megahit/linux-aarch64-support-pr-368.patch @@ -0,0 +1,74 @@ +From 296ad6b5359ac5072a97fe0b7f72cad08031542f Mon Sep 17 00:00:00 2001 +From: Martin Tzvetanov Grigorov +Date: Wed, 27 Mar 2024 15:07:02 +0200 +Subject: [PATCH 1/5] Add support for non-x86_64 architectures (e.g. Linux + ARM64) + +Fixes https://github.com/voutcn/megahit/issues/320 +Based on: https://github.com/voutcn/megahit/pull/329 + +Preserves the x86_64 specifics when building on x86_64 machine + +Signed-off-by: Martin Tzvetanov Grigorov +--- + CMakeLists.txt | 8 ++++++-- + src/kmlib/kmrns.h | 2 ++ + src/utils/cpu_dispatch.h | 6 ++++++ + 3 files changed, 14 insertions(+), 2 deletions(-) + +diff --git a/CMakeLists.txt b/CMakeLists.txt +index 172a03d..d21b2d3 100644 +--- a/CMakeLists.txt ++++ b/CMakeLists.txt +@@ -73,8 +73,12 @@ add_executable(megahit_core_popcnt ${OTHER_SOURCE} ${ASMBL_SOURCE} ${IDBA_SOURCE + ${CX1_SOURCE} ${TOOLKIT_SOURCE}) + add_executable(megahit_core_no_hw_accel ${OTHER_SOURCE} ${ASMBL_SOURCE} ${IDBA_SOURCE} ${SDBG_SOURCE} ${LCASM_SOURCE} + ${SEQ_SOURCE} ${CX1_SOURCE} ${TOOLKIT_SOURCE}) +-set_target_properties(megahit_core PROPERTIES COMPILE_FLAGS "-mbmi2 -DUSE_BMI2 -mpopcnt") +-set_target_properties(megahit_core_popcnt PROPERTIES COMPILE_FLAGS "-mpopcnt") ++ ++if (CMAKE_SYSTEM_PROCESSOR MATCHES "(x86_64)|(amd64)|(AMD64)") ++ set_target_properties(megahit_core PROPERTIES COMPILE_FLAGS "-mbmi2 -DUSE_BMI2 -mpopcnt") ++ set_target_properties(megahit_core_popcnt PROPERTIES COMPILE_FLAGS "-mpopcnt") ++endif () ++ + + if (STATIC_BUILD) + # TODO dirty +diff --git a/src/kmlib/kmrns.h b/src/kmlib/kmrns.h +index 9f2e9dd..0352858 100644 +--- a/src/kmlib/kmrns.h ++++ b/src/kmlib/kmrns.h +@@ -8,7 +8,9 @@ + #include + #include + #include ++#if defined(__x86_64__) + #include ++#endif + #include + + namespace kmlib { +diff --git a/src/utils/cpu_dispatch.h b/src/utils/cpu_dispatch.h +index ec01bb6..44ba1e2 100644 +--- a/src/utils/cpu_dispatch.h ++++ b/src/utils/cpu_dispatch.h +@@ -5,6 +5,7 @@ + #ifndef MEGAHIT_CPU_DISPATCH_H + #define MEGAHIT_CPU_DISPATCH_H + ++#if defined(__x86_64__) + inline bool HasPopcnt() { + unsigned eax, ebx, ecx, edx; + #ifdef _MSC_VER +@@ -32,5 +33,10 @@ inline bool HasBmi2() { + #endif + return ebx >> 8U & 1U; + } ++#else ++inline bool HasPopcnt() { return false; } ++inline bool HasBmi2() { return false; } ++#endif ++ + + #endif // MEGAHIT_CPU_DISPATCH_H \ No newline at end of file diff --git a/recipes/megahit/meta.yaml b/recipes/megahit/meta.yaml index cdc6d877dde6a..35673ec2df9ee 100644 --- a/recipes/megahit/meta.yaml +++ b/recipes/megahit/meta.yaml @@ -8,12 +8,16 @@ package: source: sha256: '{{sha256}}' url: https://github.com/voutcn/megahit/archive/v{{version}}.tar.gz + patches: + - linux-aarch64-support-pr-368.patch build: - number: 4 + number: 5 # TODO test fails on osx without visible error. # Feel free to fix and enable again. skip: true # [osx] + run_exports: + - {{ pin_subpackage('megahit', max_pin='x') }} requirements: build: @@ -45,6 +49,8 @@ about: metagenomics assembly via succinct de Bruijn graph extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:megahit - doi:10.1093/bioinformatics/btv033 diff --git a/recipes/megalodon/meta.yaml b/recipes/megalodon/meta.yaml index 9056a14a6a404..c619becf36135 100644 --- a/recipes/megalodon/meta.yaml +++ b/recipes/megalodon/meta.yaml @@ -16,7 +16,7 @@ build: - megalodon = megalodon.__main__:_main - megalodon_extras = megalodon_extras.__main__:_main script: {{ PYTHON }} -m pip install . --no-deps -vv - number: 0 + number: 1 run_exports: - {{ pin_subpackage(name, max_pin="x") }} @@ -60,6 +60,8 @@ about: dev_url: https://github.com/nanoporetech/megalodon extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - marcus1487 - npavlovikj diff --git a/recipes/megan/meta.yaml b/recipes/megan/meta.yaml index b630ebb5fdfad..d3014d47e4e3c 100644 --- a/recipes/megan/meta.yaml +++ b/recipes/megan/meta.yaml @@ -1,13 +1,13 @@ {% set name = "megan" %} -{% set version = "6.24.20" %} +{% set version = "6.25.9" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://software-ab.cs.uni-tuebingen.de/download/megan6/MEGAN_Community_unix_{{ version|replace(".", "_") }}.sh # [linux] - sha256: 4eaf7797b4a2b9cdc2157b2780810504b9b8b539dd81bb6130f4b69e453f009b # [linux] + url: https://maira.cs.uni-tuebingen.de/download/megan6/MEGAN_Community_unix_{{ version|replace(".", "_") }}.sh # [linux] + sha256: 09975351baff29e620d49f14145bde7840ec5d58828ba9ddf187c9ba54e46b4b # [linux] # url: https://software-ab.informatik.uni-tuebingen.de/download/megan6/MEGAN_Community_macos_{{ version|replace(".", "_") }}.dmg # [osx] # sha256: dd843e823f358f496834a2034e1b638e9602ba83251a5f0542f20b0d22d7dc70 # [osx] @@ -15,6 +15,8 @@ build: # detect_binary_files_with_prefix: true number: 0 skip: True # [osx] + run_exports: + - {{ pin_subpackage("megan", max_pin="x.x") }} requirements: host: diff --git a/recipes/mehari/meta.yaml b/recipes/mehari/meta.yaml index c36b6f1c6475a..4dce1d8acc046 100644 --- a/recipes/mehari/meta.yaml +++ b/recipes/mehari/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.21.1" %} -{% set sha256 = "6dcdd453ca44a531e4b4903ebf32921707bebe9d51f389a463dc2df3b3042f12" %} +{% set version = "0.25.5" %} +{% set sha256 = "4986b6249fdc4e726e9494c55340234f50307fc4442e4683ecf18c1bd6ace8fd" %} package: name: mehari @@ -12,7 +12,7 @@ build: - {{ pin_subpackage("mehari", max_pin="x.x") }} source: - url: https://github.com/bihealth/mehari/archive/v{{ version }}.tar.gz + url: https://github.com/varfish-org/mehari/archive/v{{ version }}.tar.gz sha256: {{ sha256 }} requirements: @@ -38,6 +38,6 @@ test: - mehari -h about: - home: https://github.com/bihealth/mehari + home: https://github.com/varfish-org/mehari license: MIT summary: VEP-like tool for sequence ontology and HGVS annotation of VCF files written in Rust. diff --git a/recipes/melon/meta.yaml b/recipes/melon/meta.yaml index 0474c549414fa..1859cf993abd9 100644 --- a/recipes/melon/meta.yaml +++ b/recipes/melon/meta.yaml @@ -1,5 +1,5 @@ {% set name = "melon" %} -{% set version = "0.1.2" %} +{% set version = "0.1.5" %} package: name: '{{ name|lower }}' @@ -7,7 +7,7 @@ package: source: url: https://github.com/xinehc/melon/archive/refs/tags/v{{ version }}.tar.gz - sha256: a9c1f3bfb09c204c9be760cc156f8e604ac9138525b5b6c6e5ecc965a637016d + sha256: 4cd77a0262e589c125627d89fea9a340ccbf0dc53b67bfc40f907008c95864da build: noarch: python @@ -28,6 +28,7 @@ requirements: - seqkit - numpy - scipy + - tqdm test: imports: diff --git a/recipes/memote/meta.yaml b/recipes/memote/meta.yaml new file mode 100644 index 0000000000000..ee4d6467bc3cd --- /dev/null +++ b/recipes/memote/meta.yaml @@ -0,0 +1,77 @@ +{% set name = "memote" %} +{% set version = "0.17.0" %} +{% set sha256 = "b61b222c6fe7719f0f916f01a5c68679567bad8884ed36eb634311ddbc565f19" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + entry_points: + - memote = memote.suite.cli.runner:cli + script: + - {{ PYTHON }} -m pip install --no-deps -vv . + noarch: python + number: 0 + run_exports: + - {{ pin_subpackage("memote", max_pin="x") }} + +requirements: + host: + - python >=3.9,<=3.11 + - setuptools >=40.6.0 + - versioneer-518 + - wheel + - versioneer + - pip + run: + - click + - click-configfile + - click-log + - cobra >=0.28 + - cookiecutter + - depinfo >=2.2 + - future + - git + - gitpython + - importlib_resources + - jinja2 + - jsonschema + - numpy + - numpydoc + - optlang >=1.8 + - pandas + - pandera + - pygithub <2 + - pylru + - pytest + - python >=3.9,<=3.11 + - requests + - ruamel.yaml + - six + - sqlalchemy + - sympy + +test: + imports: + - memote + commands: + - memote --help + - pip check + requires: + - pip + +about: + home: https://memote.readthedocs.io/ + summary: the genome-scale metabolic model test suite + license: Apache-2.0 + license_file: LICENSE + + +extra: + recipe-maintainers: + - Midnighter diff --git a/recipes/mercat2/meta.yaml b/recipes/mercat2/meta.yaml index 1808493425f7d..9de650d4cebc2 100644 --- a/recipes/mercat2/meta.yaml +++ b/recipes/mercat2/meta.yaml @@ -1,5 +1,5 @@ {% set name = "mercat2" %} -{% set version = "1.3" %} +{% set version = "1.4.1" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: edcee22e339bdf15ce4709c3192f85c32f576f07eedfd044bad8d3a396cbe0a9 + sha256: 5a090b19db6beecae8d3a1f2014a239b306fa428e92cc8f02e98e0e4b4a89d31 build: number: 0 diff --git a/recipes/merge-gbk-records/meta.yaml b/recipes/merge-gbk-records/meta.yaml new file mode 100644 index 0000000000000..38aaf9585a484 --- /dev/null +++ b/recipes/merge-gbk-records/meta.yaml @@ -0,0 +1,42 @@ +{% set name = "merge-gbk-records" %} +{% set version = "0.2.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: "4e204552a87787e1fbe3eba629c0e05dbe0cd6bddc81c256cc813066d67b8be4" + +build: + noarch: python + number: 0 + script: "{{ PYTHON }} -m pip install . --no-deps -vv" + run_exports: + - {{ pin_subpackage("merge-gbk-records", max_pin="x.x") }} + +requirements: + host: + - python >=3.8 + - pip + run: + - python >=3.7 + - biopython >=1.79 + +test: + commands: + - merge-gbk-records --help + +about: + home: http://github.com/kblin/{{ name }} + license: Apache-2.0 + license_family: Apache + license_file: LICENSE + summary: 'Turn multiple GenBank records (either in multiple files or a single multi-record file) into a single record' + description: | + A small script to turn multiple GenBank records (either in multiple files or a single multi-record file) into a + single record. + Sequences are merged by concatenating them in order, and putting a spacer sequence between them. + Spacer sequence length can be given in kbp. It is possible to pick an all-N spacer, or using a spacer + consisting of all-frame stop codons. diff --git a/recipes/merqury/meta.yaml b/recipes/merqury/meta.yaml index 9949181ef7d8d..583ae7429b8e1 100644 --- a/recipes/merqury/meta.yaml +++ b/recipes/merqury/meta.yaml @@ -11,8 +11,10 @@ source: sha256: {{ sha256 }} build: - number: 1 + number: 2 noarch: generic + run_exports: + - {{ pin_subpackage("merqury", max_pin='x.x') }} requirements: run: @@ -25,6 +27,8 @@ requirements: - bedtools >=2.29.2 - samtools >=1.10 - mscorefonts + - gawk + - sed test: commands: diff --git a/recipes/meryl/build_failure.osx-64.yaml b/recipes/meryl/build_failure.osx-64.yaml deleted file mode 100644 index 37b4e5de4af67..0000000000000 --- a/recipes/meryl/build_failure.osx-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: 734dbf449636d9f4e478ff96788290d11ba5393ad8dec20baac7580c10ec0e34 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |- - In file included from meryl/meryl.H:22: - In file included from meryl/merylInput.H:23: - In file included from utility/src/kmers.H:51: - In file included from utility/src/kmers-v2/kmers-writer.H:27: - utility/src/kmers-v2/kmers-files.H:27:20: warning: nested namespace definition is a C17 extension; define each namespace separately [-Wc17-extensions] - namespace merylutil::inline kmers::v2 { - ^~~~~~~~~~~~~~~~~~ - { inline namespace kmers { namespace v2 - utility/src/kmers-v2/kmers-files.H:27:22: warning: inline nested namespace definition is a C20 extension [-Wc20-extensions] - namespace merylutil::inline kmers::v2 { - ^ - utility/src/kmers-v2/kmers-files.H:143:36: warning: format specifies type 'unsigned long' but the argument has type 'uint64' (aka 'unsigned long long') [-Wformat] - toHex(_blockPrefix), _blockPosition, _numKmers, - ^~~~~~~~~~~~~~ - utility/src/kmers-v2/kmers-files.H:143:52: warning: format specifies type 'unsigned long' but the argument has type 'uint64' (aka 'unsigned long long') [-Wformat] - toHex(_blockPrefix), _blockPosition, _numKmers, - ^~~~~~~~~ - utility/src/kmers-v2/kmers-files.H:144:15: warning: format specifies type 'unsigned long' but the argument has type 'off_t' (aka 'long long') [-Wformat] - merylutil::ftell(F), _numKmers nKmers); - ^~~~~~~~~~~~~~~~~~~ - utility/src/kmers-v2/kmers-files.H:144:36: warning: format specifies type 'unsigned long' but the argument has type 'unsigned long long' [-Wformat] - merylutil::ftell(F), _numKmers nKmers); - ^~~~~~~~~~~~~~~~~~ - In file included from meryl/meryl.C:19: - In file included from meryl/meryl.H:22: - In file included from meryl/merylInput.H:23: - In file included from utility/src/kmers.H:51: - In file included from utility/src/kmers-v2/kmers-writer.H:28: - utility/src/kmers-v2/kmers-writer-block.H:32:20: warning: nested namespace definition is a C17 extension; define each namespace separately [-Wc17-extensions] - namespace merylutil::inline kmers::v2 { - ^~~~~~~~~~~~~~~~~~ - { inline namespace kmers { namespace v2 - utility/src/kmers-v2/kmers-writer-block.H:32:22: warning: inline nested namespace definition is a C20 extension [-Wc20-extensions] - namespace merylutil::inline kmers::v2 { - ^ - In file included from meryl/meryl.C:19: - In file included from meryl/meryl.H:22: - In file included from meryl/merylInput.H:23: - In file included from utility/src/kmers.H:51: - In file included from utility/src/kmers-v2/kmers-writer.H:29: - utility/src/kmers-v2/kmers-writer-stream.H:27:20: warning: nested namespace definition is a C17 extension; define each namespace separately [-Wc17-extensions] - namespace merylutil::inline kmers::v2 { - ^~~~~~~~~~~~~~~~~~ - { inline namespace kmers { namespace v2 - utility/src/kmers-v2/kmers-writer-stream.H:27:22: warning: inline nested namespace definition is a C20 extension [-Wc20-extensions] - namespace merylutil::inline kmers::v2 { - ^ - In file included from meryl/meryl.C:19: - In file included from meryl/meryl.H:22: - In file included from meryl/merylInput.H:23: - In file included from utility/src/kmers.H:51: - utility/src/kmers-v2/kmers-writer.H:31:20: warning: nested namespace definition is a C17 extension; define each namespace separately [-Wc17-extensions] - namespace merylutil::inline kmers::v2 { - ^~~~~~~~~~~~~~~~~~ - { inline namespace kmers { namespace v2 - utility/src/kmers-v2/kmers-writer.H:31:22: warning: inline nested namespace definition is a C20 extension [-Wc20-extensions] - namespace merylutil::inline kmers::v2 { - ^ - In file included from meryl/meryl.C:19: - In file included from meryl/meryl.H:22: - In file included from meryl/merylInput.H:23: - In file included from utility/src/kmers.H:52: - utility/src/kmers-v2/kmers-reader.H:27:20: warning: nested namespace definition is a C17 extension; define each namespace separately [-Wc17-extensions] - namespace merylutil::inline kmers::v2 { - ^~~~~~~~~~~~~~~~~~ - { inline namespace kmers { namespace v2 - utility/src/kmers-v2/kmers-reader.H:27:22: warning: inline nested namespace definition is a C20 extension [-Wc20-extensions] - namespace merylutil::inline kmers::v2 { - ^ - In file included from meryl/meryl.C:19: - In file included from meryl/meryl.H:22: - In file included from meryl/merylInput.H:23: - In file included from utility/src/kmers.H:55: - utility/src/kmers-v2/kmers-lookup.H:30:20: warning: nested namespace definition is a C17 extension; define each namespace separately [-Wc17-extensions] - namespace merylutil::inline kmers::v2 { - ^~~~~~~~~~~~~~~~~~ - { inline namespace kmers { namespace v2 - utility/src/kmers-v2/kmers-lookup.H:30:22: warning: inline nested namespace definition is a C20 extension [-Wc20-extensions] - namespace merylutil::inline kmers::v2 { - ^ - 103 warnings generated. - make: Leaving directory '$SRC_DIR/src' - Traceback (most recent call last): - File "/opt/mambaforge/envs/bioconda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 2198, in build - utils.check_call_env(cmd, env=env, rewrite_stdout_env=rewrite_env, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/utils.py", line 451, in check_call_env - return _func_defaulting_env_to_os_environ("call", *popenargs, **kwargs) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/utils.py", line 427, in _func_defaulting_env_to_os_environ - raise subprocess.CalledProcessError(proc.returncode, _args) - subprocess.CalledProcessError: Command '['/bin/bash', '-o', 'errexit', '/opt/mambaforge/envs/bioconda/conda-bld/meryl_1689693773712/work/conda_build.sh']' returned non-zero exit status 2. -# Last 100 lines of the build log. diff --git a/recipes/mess/meta.yaml b/recipes/mess/meta.yaml index c442de1ebc1a2..5a859cde3d82a 100644 --- a/recipes/mess/meta.yaml +++ b/recipes/mess/meta.yaml @@ -1,48 +1,58 @@ -{% set version = "0.2.2" %} -{% set sha256 = "84aca7989768a00d6ea0410645c3398d9a459a48b2fabf68552f9b68b0a711c1" %} +{% set name = "MeSS" %} +{% set version = "0.8.2" %} package: - name: mess + name: "{{ name|lower }}" version: {{ version }} source: - url: https://github.com/metagenlab/MeSS/archive/refs/tags/v{{ version }}.tar.gz - sha256: {{ sha256 }} + url: https://github.com/metagenlab/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: 157ce1f1426211ead7deebf5da1620d65de2b3f89cc3cf20fdf55a42df146a6d build: number: 0 - entry_points: - - mess=mess.mess:cli noarch: python - script: "python -m pip install --no-deps --ignore-installed ." + entry_points: + - mess=mess.__main__:main + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + run_exports: + - {{ pin_subpackage('mess', max_pin="x.x") }} + requirements: host: - - python>3.6,<3.9 + - python >=3.10 - pip run: - - python>3.6,<3.9 - - snakemake-minimal=6.2.1 - - pandas >1 - - click>=7 + - python >=3.10 + - snakemake-minimal >=7.32.4 + - pulp <2.8 + - snaketool-utils >=0.0.5 + - attrmap >=0.0.7 + - pyyaml >=6.0.1 + - pandas >=2.2.1 + - biopython >=1.83 + - rich-click >=1.7.4 test: - imports: - - mess - commands: - - mess run -h - - mess --version + commands: + - mess -h + - mess -v about: home: https://github.com/metagenlab/MeSS - license: GPL-3.0 + license: MIT + license_family: MIT license_file: LICENSE - summary: The Metagenomic Sequence Simulator (MeSS) is a snakemake workflow used for simulating metagenomic mock communities. + summary: "Snakemake pipeline for simulating shotgun metagenomic samples" + dev_url: https://github.com/metagenlab/MeSS + doc_url: https://metagenlab.github.io/MeSS extra: + container: + extended-base: true recipe-maintainers: - - idfarbanecha + - farchaab + - tpillone -container: - extended-base: true diff --git a/recipes/metabuli/build.sh b/recipes/metabuli/build.sh index dccd8da45922c..b06956020200b 100644 --- a/recipes/metabuli/build.sh +++ b/recipes/metabuli/build.sh @@ -1,7 +1,18 @@ #!/bin/bash +ARCH_BUILD="" +case $(uname -m) in + x86_64) ARCH_BUILD="-DHAVE_SSE4_1=1" ;; + arm64|aarch64) ARCH_BUILD="-DHAVE_ARM8=1" ;; +esac + +if [ -z "${ARCH_BUILD}" ]; then + echo "Invalid architecture" + exit 1 +fi + mkdir build cd build -cmake -DCMAKE_INSTALL_PREFIX="${PREFIX}" -DHAVE_TESTS=0 -DHAVE_MPI=0 -DHAVE_SSE4_1=1 -DVERSION_OVERRIDE="${PKG_VERSION}" .. +cmake -DCMAKE_INSTALL_PREFIX="${PREFIX}" -DHAVE_TESTS=0 -DHAVE_MPI=0 ${ARCH_BUILD} -DVERSION_OVERRIDE="${PKG_VERSION}" .. make -j${CPU_COUNT} ${VERBOSE_CM} make install diff --git a/recipes/metabuli/meta.yaml b/recipes/metabuli/meta.yaml index 3c74fd689a9fd..0ff53ad0a4ce5 100644 --- a/recipes/metabuli/meta.yaml +++ b/recipes/metabuli/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.0.2" %} -{% set sha256 = "cf5c74a7aa585457c0014614e59cf850aaacfab03f326e6113466fa2b436d2c2" %} +{% set version = "1.0.5" %} +{% set sha256 = "c84a4e2436904f0cbea7126abf2a5f665a870735c8af786883e10f3f872bda28" %} package: name: metabuli @@ -48,3 +48,5 @@ extra: recipe-maintainers: - milot-mirdita - jaebeom-kim + additional-platforms: + - linux-aarch64 diff --git a/recipes/metacache/meta.yaml b/recipes/metacache/meta.yaml index 4712e702cb10f..6960be24fcb92 100644 --- a/recipes/metacache/meta.yaml +++ b/recipes/metacache/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.3.1" %} +{% set version = "2.4.2" %} package: name: metacache @@ -6,11 +6,13 @@ package: source: url: https://github.com/muellan/metacache/archive/refs/tags/v{{ version }}.tar.gz - sha256: bd31f9ab2a1251c0264480ff16b711c2c548648ac3c15fc142309c12aa8e5e7f + sha256: 2062de4c13cc9ed3962c8903b81dca05ccabd5820305362229bc446c11c9b111 build: - number: 2 + number: 0 skip: True # [osx] + run_exports: + - {{ pin_subpackage('metacache', max_pin="x") }} requirements: build: diff --git a/recipes/metacerberus/meta.yaml b/recipes/metacerberus/meta.yaml index 5983b3673b124..8fac178cb00f0 100644 --- a/recipes/metacerberus/meta.yaml +++ b/recipes/metacerberus/meta.yaml @@ -1,5 +1,5 @@ {% set name = "MetaCerberus" %} -{% set version = "1.1" %} +{% set version = "1.2.1" %} package: name: "{{ name|lower }}" @@ -7,12 +7,14 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 65610ac32ca00ad7917cb5fa49fc2282db66590fc5310115c32e0090600eff90 + sha256: 1140732198b95c0d670fccb213c84464eb80bbe27127e4a85560de30c4873ac6 build: number: 1 noarch: python script: "{{ PYTHON }} -m pip install . -vv" + run_exports: + - {{ pin_compatible('MetaCerberus', max_pin="x") }} requirements: host: @@ -27,6 +29,9 @@ requirements: - porechop - bbmap - prodigal + - prodigal-gv + - trnascan-se + - phanotate - hmmer - ray-default - ray-core @@ -54,7 +59,7 @@ about: home: "https://github.com/raw-lab/metacerberus" license: BSD-3-Clause license_family: BSD - license_file: + license_file: LICENSE.txt summary: "Versatile Functional Ontology Assignments for Metagenomes via Hidden Markov Model (HMM) searching with environmental focus of shotgun meta'omics data" doc_url: dev_url: diff --git a/recipes/metacoag/meta.yaml b/recipes/metacoag/meta.yaml index 1f17d44b66cce..495e6305e02c9 100644 --- a/recipes/metacoag/meta.yaml +++ b/recipes/metacoag/meta.yaml @@ -1,5 +1,5 @@ {% set name = "MetaCoAG" %} -{% set version = "1.1.4" %} +{% set version = "1.2.0" %} package: name: "{{ name|lower }}" @@ -7,22 +7,26 @@ package: source: url: "https://github.com/metagentools/{{ name }}/archive/v{{ version }}.tar.gz" - sha256: de300e1abfe38b2595e5d7253da26dc29fcd1fd9f7d17ab958d1f75d7582a6ef + sha256: 994917716c50beb748730bada2d9e76901635fa52e4b64e1f2e5b73c88059587 build: number: 0 noarch: python entry_points: - - combine_cov=metacoag_utils.support.combine_cov:main + - metacoag = metacoag.cli:main + - combine_cov = metacoag.metacoag_utils.support.combine_cov:main script: - - "{{ PYTHON }} -m pip install . -vv" + - "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation --no-cache-dir -vvv" + run_exports: + - {{ pin_subpackage('metacoag', max_pin="x") }} requirements: host: - pip - - python + - python >=3.9,<3.13 + - flit-core >=3.2 run: - - python + - python >=3.9,<3.13 - click - biopython - cairocffi @@ -42,8 +46,8 @@ test: about: home: "https://github.com/metagentools/MetaCoAG" - license: GPL-3.0 - license_family: GPL + license: GPL-3.0-or-later + license_family: GPL3 license_file: LICENSE summary: "MetaCoAG: Binning Metagenomic Contigs via Composition, Coverage and Assembly Graphs" description: | diff --git a/recipes/metaeuk/build.sh b/recipes/metaeuk/build.sh index 0d987840efe4b..b06956020200b 100644 --- a/recipes/metaeuk/build.sh +++ b/recipes/metaeuk/build.sh @@ -1,8 +1,18 @@ -#!/bin/bash -e +#!/bin/bash + +ARCH_BUILD="" +case $(uname -m) in + x86_64) ARCH_BUILD="-DHAVE_SSE4_1=1" ;; + arm64|aarch64) ARCH_BUILD="-DHAVE_ARM8=1" ;; +esac + +if [ -z "${ARCH_BUILD}" ]; then + echo "Invalid architecture" + exit 1 +fi mkdir build cd build -cmake -DCMAKE_INSTALL_PREFIX="${PREFIX}" -DHAVE_TESTS=0 -DHAVE_MPI=0 -DHAVE_SSE4_1=1 -DVERSION_OVERRIDE="${PKG_VERSION}" .. +cmake -DCMAKE_INSTALL_PREFIX="${PREFIX}" -DHAVE_TESTS=0 -DHAVE_MPI=0 ${ARCH_BUILD} -DVERSION_OVERRIDE="${PKG_VERSION}" .. make -j${CPU_COUNT} ${VERBOSE_CM} make install - diff --git a/recipes/metaeuk/meta.yaml b/recipes/metaeuk/meta.yaml index 1123976a0fc78..92bb339c597cb 100644 --- a/recipes/metaeuk/meta.yaml +++ b/recipes/metaeuk/meta.yaml @@ -7,7 +7,9 @@ package: version: {{ version|replace("-", ".") }} build: - number: 3 + number: 4 + run_exports: + - {{ pin_subpackage('metaeuk', max_pin="x") }} source: url: https://github.com/soedinglab/metaeuk/archive/{{ version }}.tar.gz @@ -50,3 +52,5 @@ extra: recipe-maintainers: - milot-mirdita - elileka + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/metamaps/meta.yaml b/recipes/metamaps/meta.yaml index 1f2146738044e..7f0573516b435 100644 --- a/recipes/metamaps/meta.yaml +++ b/recipes/metamaps/meta.yaml @@ -1,16 +1,18 @@ -{% set version = "0.1.98102e9" %} -{% set sha256 = "f73d80be084dc73128d4795e9d03abcd35be2ddc7ef81684fcadec154a28b7af" %} +{% set version = "0.1.633d2e0" %} +{% set sha256 = "9740c7882fe2ff39c0df9d44e85a725f73b531117ea265e2b45eeb1661d6a3e7" %} package: name: metamaps version: {{ version }} source: - url: https://github.com/DiltheyLab/MetaMaps/archive/98102e9e684efa6a9903d8abe93600132c101ad0.tar.gz + url: https://github.com/DiltheyLab/MetaMaps/archive/633d2e0ec1ffb4fd9111aca52a54d236ef5ef379.tar.gz sha256: {{ sha256 }} build: - number: 2 + number: 0 + run_exports: + - {{ pin_subpackage("metamaps", max_pin=None) }} requirements: build: diff --git a/recipes/metamate/meta.yaml b/recipes/metamate/meta.yaml new file mode 100644 index 0000000000000..221da4c5f830c --- /dev/null +++ b/recipes/metamate/meta.yaml @@ -0,0 +1,69 @@ +{% set name = "metamate" %} +{% set version = "0.4.3" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/tjcreedy/metamate/archive/v{{ version }}.tar.gz + sha256: e86a26643f770dae3739d8bd70f1db1a0561ad4554113a5d60b007fd0089cfe3 + +build: + noarch: python + entry_points: + - metamate = metamate.metamate:main + - metaMATE = metamate.metamate:main + - filtertranslate = metamate.filtertranslate:main + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + run_exports: {{ pin_subpackage("metamate", max_pin="x") }} + number: 0 + +requirements: + build: + - python + - mafft + - pysam + - bbmap + - r-base + - biopython + - r-getopt + - r-ape + - r-fastcluster + - r-cluster + host: + - python + - bbmap + - pysam + - mafft + - r-base + - r-getopt + - r-ape + - r-fastcluster + - r-cluster + run: + - python >=3.6 + - biopython >=1.76 + - scipy >=1.4.1 + - pysam + - r-base + - bbmap + - mafft +test: + imports: + - metamate + commands: + - metamate --help + - metaMATE --help + - filtertranslate --help + +about: + home: https://github.com/tjcreedy/metamate + license: GPL-3.0 + license_file: LICENSE + summary: 'metaMATE: your metabarcoding friend!' + +extra: + recipe-maintainers: + - tjcreedy + - johnrandallia diff --git a/recipes/metaphlan/meta.yaml b/recipes/metaphlan/meta.yaml index 26ea15ee0a30e..362577e6f15ae 100644 --- a/recipes/metaphlan/meta.yaml +++ b/recipes/metaphlan/meta.yaml @@ -1,5 +1,5 @@ {% set name = "metaphlan" %} -{% set version = "4.0.6" %} +{% set version = "4.1.0" %} package: name: {{ name }} @@ -7,13 +7,15 @@ package: source: url: https://github.com/biobakery/MetaPhlAn/archive/{{version}}.tar.gz - sha256: f69e9499056a259829a50f4eb5ab8e62e76f57852df921784d66fb5d7c4379a4 + sha256: 7552ee617a1ca7d862cc07bbb4f238ab0a8872f2702fb49192bee0461264d376 build: noarch: python number: 0 script: {{ PYTHON }} -m pip install -vv --no-deps . + run_exports: + - {{ pin_subpackage('metaphlan', max_pin='x.x') }} requirements: host: @@ -24,10 +26,9 @@ requirements: run: - python >=3.7 - bowtie2 >=2.3.0 - - cmseq - - phylophlan - dendropy - numpy + - phylophlan >=3.1 - biom-format - matplotlib-base - biopython @@ -39,7 +40,15 @@ requirements: - pysam - raxml >=8.2.10 - samtools >=1.9 - + - r-base >=4 + - r-essentials + - r-optparse + - r-rbiom + - r-ape + - r-compositions + - r-biocmanager + - bioconductor-microbiome + - hclust2 test: commands: - metaphlan -v @@ -51,6 +60,12 @@ test: - plot_tree_graphlan.py -h - sample2markers.py -h - strain_transmission.py -h + - sgb_to_gtdb_profile.py -h + - metaphlan2krona.py -h + - hclust2.py -h + - run_treeshrink.py -h + - treeshrink.py -h + - create_toy_database.py -h - bowtie2-align-s --help about: diff --git a/recipes/metaphor/meta.yaml b/recipes/metaphor/meta.yaml index a5d1801709fb8..5833df5021a2f 100644 --- a/recipes/metaphor/meta.yaml +++ b/recipes/metaphor/meta.yaml @@ -1,5 +1,5 @@ {% set name = "metaphor" %} -{% set version = "1.7.10" %} +{% set version = "1.7.11" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://github.com/vinisalazar/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz - sha256: f8b49aac85fd16b78210cbacc34e615baeb8551e3aa11eed36748385333c9f49 + sha256: 45f01fc8a7c142f3ae26b4880488e77228103a670cffaa986e5377b7efcaff86 build: number: 0 diff --git a/recipes/metdatamodel/meta.yaml b/recipes/metdatamodel/meta.yaml index e83742363e601..a36b4b670c13c 100644 --- a/recipes/metdatamodel/meta.yaml +++ b/recipes/metdatamodel/meta.yaml @@ -1,5 +1,5 @@ {% set name = "metdatamodel" %} -{% set version = "0.5.5" %} +{% set version = "0.6.0" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/metDataModel-{{ version }}.tar.gz - sha256: 8ed0c978ffe4e1a75d169ae58687cb86f15c991d05529748791c554c9f1103a9 + sha256: 58bdbf5099c059d6e481921b017bc667e73623c1a1ba840d8b3f42d79e15b2cc build: noarch: python diff --git a/recipes/meteor/meta.yaml b/recipes/meteor/meta.yaml new file mode 100644 index 0000000000000..154327b4de91c --- /dev/null +++ b/recipes/meteor/meta.yaml @@ -0,0 +1,60 @@ +{% set name = "meteor" %} +{% set version = "2.0.9" %} + +package: + name: {{ name }} + version: {{ version }} + + +source: + url: https://github.com/metagenopolis/meteor/archive/{{ version }}.tar.gz + sha256: e828010c5dd52e04156f6f0263d9d2635831d1253df9a5e0dc47becbd8e45c43 + +build: + noarch: python + number: 0 + script: {{ PYTHON }} -m pip install . --no-deps -vv + run_exports: + - {{ pin_subpackage('meteor', max_pin="x.x") }} + +requirements: + host: + - python >=3.10 + - poetry + run: + - python >=3.10 + - bowtie2 >=2.3.5 + - pysam + - pyarrow + - pandas + - ete3 + - packaging + - cogent3 + - biom-format + - bcftools >=0.1.19 + - raxml-ng >=1.0.1 + - bedtools >=2.18.0 +test: + commands: + - meteor -h + - bowtie2 -h + - bedtools -h + - raxml-ng -h + - bcftools -h + imports: + - pysam + - pandas + - pyarrow + - ete3 + - packaging + - biom + - cogent3 + +about: + home: https://github.com/metagenopolis/meteor + license: GPL-3.0-or-later + license_file: COPYING + summary: 'Meteor is a plateform for quantitative metagenomics profiling of complex ecosystems.' + description: | + Meteor relies on genes catalogue to perform specie level taxonomic assignments, functional and strain diffusion analysis. + license_family: GPL3 diff --git a/recipes/methylartist/meta.yaml b/recipes/methylartist/meta.yaml index 43fa87877feaf..13807dcfdbdd1 100644 --- a/recipes/methylartist/meta.yaml +++ b/recipes/methylartist/meta.yaml @@ -1,5 +1,5 @@ {% set name = "methylartist" %} -{% set version = "1.2.11" %} +{% set version = "1.3.0" %} package: name: "{{ name|lower }}" @@ -7,12 +7,12 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 63c3493e65352471836b54eda82ce5678e676bf7c2557c2bb56ab34ae04cf29e + sha256: 955f2ca5b0ba0d2c28e7421140e90555a8ef867ecedb41788c83132b29410329 build: noarch: python number: 0 - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" run_exports: - {{ pin_subpackage(name, max_pin="x") }} @@ -23,7 +23,7 @@ test: requirements: host: - pip - - python >=3.8 + - python >=3.7 run: - bx-python >=0.8.11 - matplotlib-base >=3.4.3 @@ -35,11 +35,13 @@ requirements: - scikit-bio >=0.5.6 - scipy >=1.7.1 - seaborn >=0.11.2 + - tqdm about: home: "https://github.com/adamewing/methylartist" license: MIT license_family: MIT + license_file: LICENSE summary: "Tools for parsing and plotting nanopore methylation data" extra: @@ -47,3 +49,5 @@ extra: - adamewing container: extended-base: True + identifiers: + - doi:10.1093/bioinformatics/btac292 diff --git a/recipes/mg-toolkit/meta.yaml b/recipes/mg-toolkit/meta.yaml index 52488ee71a435..f0536f69afb05 100644 --- a/recipes/mg-toolkit/meta.yaml +++ b/recipes/mg-toolkit/meta.yaml @@ -1,5 +1,5 @@ {% set name = "mg-toolkit" %} -{% set version = "0.10.1" %} +{% set version = "0.10.4" %} package: name: "{{ name|lower }}" @@ -7,26 +7,29 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: "19550a3ba8033639822c6f878b799fe6394abc216564012285f84f0a6c19086a" + sha256: "087042ccaac9601fecfdc2e121330b650426ec373ce5353fc32cd5337ef823a9" build: number: 0 entry_points: - mg-toolkit=mg_toolkit.__main__:main noarch: python - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv " + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('mg-toolkit', max_pin="x.x") }} requirements: host: - - python >=3.5 + - python >=3.8 - pip - pytest-runner run: - jsonapi-client >=0.9.9 - - pandas >=0.25.3 - - python >=3.5 - - requests >=2.24.0 + - pandas ==2.0.3 + - python >=3.8 + - requests >=2.31.0 - tqdm >=4.49.0 + - urllib3 >=2.2.1 test: imports: @@ -35,8 +38,13 @@ test: - mg-toolkit --help about: - home: "https://github.com/EBI-metagenomics/emg-toolkit" + home: "https://www.ebi.ac.uk/metagenomics" license: Apache-2.0 license_file: LICENSE license_family: "APACHE" summary: "Metagenomics toolkit." + dev_url: "https://github.com/EBI-metagenomics/emg-toolkit" + +extra: + identifiers: + - biotools:MGnify diff --git a/recipes/mgatk/meta.yaml b/recipes/mgatk/meta.yaml new file mode 100644 index 0000000000000..3a641253df822 --- /dev/null +++ b/recipes/mgatk/meta.yaml @@ -0,0 +1,67 @@ +{% set name = "mgatk" %} +{% set version = "0.7.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/mgatk-{{ version }}.tar.gz + sha256: f42f5eb8fcfd38dd6ef3db853764071311cb70d841a73ff2f40f0a0c9e9d7de9 + +build: + number: 1 + noarch: python + entry_points: + - mgatk = mgatk.cli:main + - mgatk-del-find = mgatk.deletioncalling.clifind:main + - mgatk-del = mgatk.deletioncalling.clidel:main + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation --no-cache-dir + run_exports: + - {{ pin_subpackage('mgatk', max_pin="x.x") }} + +requirements: + host: + - python >=3 + - pip + run: + - python >=3 + - click + - pysam + - pytest + - snakemake-minimal <8 + - pulp <2.8 + - biopython + - numpy + - pandas + - optparse-pretty + - regex + - ruamel.yaml + - openjdk + - picard-slim + - r-base + - r-dplyr + - r-data.table + - r-matrix + - bioconductor-genomicranges + - bioconductor-summarizedexperiment + +test: + imports: + - mgatk + commands: + - mgatk --help + - mgatk-del-find --help + - mgatk-del --help + +about: + home: https://github.com/caleblareau/mgatk + summary: Mitochondrial genome analysis toolkit. + license: MIT + license_family: MIT + license_file: LICENSE.txt + doc_url: https://github.com/caleblareau/mgatk/wiki + +extra: + recipe-maintainers: + - mencian diff --git a/recipes/mgnify-pipelines-toolkit/meta.yaml b/recipes/mgnify-pipelines-toolkit/meta.yaml new file mode 100644 index 0000000000000..8f1ded523c165 --- /dev/null +++ b/recipes/mgnify-pipelines-toolkit/meta.yaml @@ -0,0 +1,75 @@ +{% set name = "mgnify-pipelines-toolkit" %} +{% set version = "0.1.2" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/mgnify_pipelines_toolkit-{{ version }}.tar.gz + sha256: d120b42e175468d909c30aeed53c6e7343be57b13cb41a4cd5e7798bfa5e9d78 + +build: + entry_points: + - get_subunits = mgnify_pipelines_toolkit.analysis.shared.get_subunits:main + - get_subunits_coords = mgnify_pipelines_toolkit.analysis.shared.get_subunits_coords:main + - mapseq2biom = mgnify_pipelines_toolkit.analysis.shared.mapseq2biom:main + - are_there_primers = mgnify_pipelines_toolkit.analysis.amplicon.are_there_primers:main + - assess_inflection_point_mcp = mgnify_pipelines_toolkit.analysis.amplicon.assess_inflection_point_mcp:main + - assess_mcp_proportions = mgnify_pipelines_toolkit.analysis.amplicon.assess_mcp_proportions:main + - classify_var_regions = mgnify_pipelines_toolkit.analysis.amplicon.classify_var_regions:main + - find_mcp_inflection_points = mgnify_pipelines_toolkit.analysis.amplicon.find_mcp_inflection_points:main + - make_asv_count_table = mgnify_pipelines_toolkit.analysis.amplicon.make_asv_count_table:main + - remove_ambiguous_reads = mgnify_pipelines_toolkit.analysis.amplicon.remove_ambiguous_reads:main + - rev_comp_se_primers = mgnify_pipelines_toolkit.analysis.amplicon.rev_comp_se_primers:main + - standard_primer_matching = mgnify_pipelines_toolkit.analysis.amplicon.standard_primer_matching:main + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage('mgnify-pipelines-toolkit', max_pin="x.x") }} + +requirements: + host: + - python >=3.9 + - setuptools >=61.0 + - pip + run: + - python >=3.9 + - biopython ==1.82 + - numpy ==1.26.0 + - pandas ==2.0.2 + - regex ==2023.12.25 + +test: + imports: + - mgnify_pipelines_toolkit + commands: + - pip check + - get_subunits --help + - get_subunits_coords --help + - mapseq2biom --help + - are_there_primers --help + - assess_inflection_point_mcp --help + - assess_mcp_proportions --help + - classify_var_regions --help + - find_mcp_inflection_points --help + - make_asv_count_table --help + - remove_ambiguous_reads --help + - rev_comp_se_primers --help + - standard_primer_matching --help + requires: + - pip + +about: + home: https://github.com/EBI-Metagenomics/mgnify-pipelines-toolkit + summary: Collection of scripts and tools for MGnify pipelines + description: | + This package contains a collection of scripts used by MGnify + pipelines + license: Apache-2.0 + license_file: LICENSE + +extra: + recipe-maintainers: + - chrisAta diff --git a/recipes/mhcflurry/meta.yaml b/recipes/mhcflurry/meta.yaml index b69f1d8f20efe..e1fa36f02ca62 100644 --- a/recipes/mhcflurry/meta.yaml +++ b/recipes/mhcflurry/meta.yaml @@ -1,5 +1,5 @@ {% set name = "mhcflurry" %} -{% set version = "2.1.0" %} +{% set version = "2.1.1" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: a4129922db5b662e248e066e73e12be74c3d08c7c0a9f1de4776b7e5aafa42bb + sha256: 5907a489ffe7e459295b08849428677fc738fcb19716628e4e3d06f247131ff8 build: number: 0 diff --git a/recipes/micom/meta.yaml b/recipes/micom/meta.yaml index cd53b1a6dd737..13e69607e3381 100644 --- a/recipes/micom/meta.yaml +++ b/recipes/micom/meta.yaml @@ -1,5 +1,5 @@ {% set name = "micom" %} -{% set version = "0.33.1" %} +{% set version = "0.35.0" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 75e8a1fe8f1535d12a466a028cd4e3caa7c199788b02c18d1bff9f03ae1d92ec + sha256: 0df2fbb3282c10e1de6522bf104e39d9540c1b1a92c63cc6882bee9980e61ae3 build: number: 0 diff --git a/recipes/microview/meta.yaml b/recipes/microview/meta.yaml new file mode 100644 index 0000000000000..592d10aab0fed --- /dev/null +++ b/recipes/microview/meta.yaml @@ -0,0 +1,61 @@ +{% set name = "microview" %} +{% set version = "0.10.1" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/MicroView-{{ version }}.tar.gz + sha256: c031b0c9405a2eae175d98835f4bd4ada63e0d23128b278ab146b0d3a844036a + +build: + entry_points: + - microview = microview.cli:main + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} + +requirements: + build: + - {{ compiler('c') }} + host: + - python >=3.8 + - pip + - cython + run: + - python >=3.8 + - scipy + - cython + - decorator + - scikit-bio + - pandas + - numpy + - plotly + - jinja2 + - rich + - rich-click + - click-option-group + - frictionless >=4.32.0,<5 + +test: + imports: + - microview + commands: + - pip check + - microview --help + requires: + - pip + +about: + home: https://github.com/jvfe/microview + summary: Generate reports from taxonomic classification data + license: BSD-3-Clause + license_file: LICENSE + +extra: + skip-lints: + - cython_must_be_in_host # Cython needs to be in run as well + recipe-maintainers: + - jvfe diff --git a/recipes/miniasm/meta.yaml b/recipes/miniasm/meta.yaml index 2f319afb180cf..1d5f46060d2d0 100644 --- a/recipes/miniasm/meta.yaml +++ b/recipes/miniasm/meta.yaml @@ -5,7 +5,9 @@ package: version: {{ version }} build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage('miniasm', max_pin='x.x') }} source: url: https://github.com/lh3/miniasm/archive/refs/tags/v0.3.tar.gz @@ -29,3 +31,7 @@ about: license: MIT license_file: LICENSE.txt summary: Ultrafast de novo assembly for long noisy reads (though having no consensus step) + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/minigraph/build.sh b/recipes/minigraph/build.sh index 5f145077a6afa..36a34c892d737 100644 --- a/recipes/minigraph/build.sh +++ b/recipes/minigraph/build.sh @@ -2,7 +2,8 @@ mkdir -p $PREFIX/bin -export CPATH=${PREFIX}/include +export C_INCLUDE_PATH="${PREFIX}/include" +export LDFLAGS="${LDFLAGS} -L${PREFIX}/lib" -make CC="${CC} ${CFLAGS} ${CPPFLAGS} ${LDFLAGS}" CXX="${CXX} ${CXXFLAGS} ${CPPFLAGS} ${LDFLAGS}" +make CC="${CC} ${CFLAGS} ${CPPFLAGS} ${LDFLAGS}" CXX="${CXX} ${CXXFLAGS} ${CPPFLAGS} ${LDFLAGS}" cp minigraph $PREFIX/bin diff --git a/recipes/minigraph/meta.yaml b/recipes/minigraph/meta.yaml index 22b50fddd42fd..6a1a93b243c54 100644 --- a/recipes/minigraph/meta.yaml +++ b/recipes/minigraph/meta.yaml @@ -1,15 +1,18 @@ -{% set version = "0.20" %} +{% set name = "minigraph" %} +{% set version = "0.21" %} package: - name: minigraph + name: {{ name }} version: {{ version }} source: url: https://github.com/lh3/minigraph/archive/refs/tags/v{{ version }}.tar.gz - sha256: ef695e69d57bbc34478d7d3007e4153422ee2e3534e4f3fcbb8930cfaa5e1dc0 + sha256: 4272447393f0ae1e656376abe144de96cbafc777414d4c496f735dd4a6d3c06a build: - number: 2 + number: 0 + run_exports: + - {{ pin_subpackage('minigraph', max_pin="x.x") }} requirements: build: @@ -25,8 +28,11 @@ test: about: home: https://github.com/lh3/minigraph license: MIT + license_family: MIT license_file: LICENSE.txt summary: Proof-of-concept seq-to-graph mapper and graph generator + doc_url: https://lh3.github.io/minigraph/minigraph.html + dev_url: https://github.com/lh3/minigraph extra: identifiers: diff --git a/recipes/minimap2/meta.yaml b/recipes/minimap2/meta.yaml index ca802bfd9cb0c..8962090b3324b 100644 --- a/recipes/minimap2/meta.yaml +++ b/recipes/minimap2/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.26" %} +{% set version = "2.28" %} package: name: minimap2 @@ -6,10 +6,10 @@ package: source: url: https://github.com/lh3/minimap2/archive/v{{ version }}.tar.gz - sha256: f4c8c3459c7b87e9de6cbed7de019b48d9337c2e46b87ba81b9f72d889420b3c + sha256: 5ea6683b4184b5c49f6dbaef2bc5b66155e405888a0790d1b21fd3c93e474278 build: - number: 2 + number: 0 run_exports: - {{ pin_subpackage('minimap2', max_pin="x") }} diff --git a/recipes/miniprot/meta.yaml b/recipes/miniprot/meta.yaml index f8142a26a402f..d3ee72d13b2c3 100644 --- a/recipes/miniprot/meta.yaml +++ b/recipes/miniprot/meta.yaml @@ -1,6 +1,6 @@ -{% set version = "0.12" %} +{% set version = "0.13" %} {% set name = "miniprot" %} -{% set sha256 = "869df52d8a3d350e0a5ba6eb0d1685e78bb7087ace9870d196f5fb4761c3a692" %} +{% set sha256 = "be12d98d998beb78e4e06350c03d2f188bcdf3245d6bcaf43e2cc80785a617a4" %} package: name: "{{ name }}" @@ -8,6 +8,8 @@ package: build: number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} source: url: "https://github.com/lh3/miniprot/archive/refs/tags/v{{ version }}.tar.gz" diff --git a/recipes/minute/meta.yaml b/recipes/minute/meta.yaml index ea573baaaef3b..7de1dc0076d35 100644 --- a/recipes/minute/meta.yaml +++ b/recipes/minute/meta.yaml @@ -1,12 +1,12 @@ -{% set version = "0.4.0" %} +{% set version = "0.6.0" %} package: name: minute version: {{ version }} source: - url: https://github.com/NBISweden/minute/archive/v{{ version }}.tar.gz - sha256: 38156262a2d105774c93f2732ded5af866965a57552969540f29cfe5d03ba62a + url: https://github.com/NBISweden/minute/archive/refs/tags/v{{ version }}.tar.gz + sha256: 168077b9bc369d8e4bbda51133d00a344dc33716e2a070311cfacaf792b131d7 build: number: 0 diff --git a/recipes/mira-multiome/meta.yaml b/recipes/mira-multiome/meta.yaml index d897c3b0eddf6..98ec59647c8a5 100644 --- a/recipes/mira-multiome/meta.yaml +++ b/recipes/mira-multiome/meta.yaml @@ -1,5 +1,5 @@ {% set name = "mira-multiome" %} -{% set version = "2.1.0" %} +{% set version = "2.1.1" %} package: name: {{ name|lower }} @@ -7,42 +7,39 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/mira-multiome-{{ version }}.tar.gz - sha256: c28a8fe8388f35c020815e27ad4d046a796680c4e43400decd53952e0502159d + sha256: f981bc40542097c3892cb02efca0c25766dfa0bbafcbd4e94ea18b3e5e27157b build: noarch: python - script: {{ PYTHON }} -m pip install . -vv + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: host: - - python >=3.7 + - python >=3.7,<3.12 - wheel - pip - - setuptools >=35.0 - setuptools_scm run: - - python >=3.7 - - pytorch <2,>=1.8.0 - - pyro-ppl <2,>=1.5.2 - - networkx <3,>=2.3 - - optuna <3,>=2.8 - - anndata <1,>=0.7.6 + - python >=3.7,<3.12 + - pytorch >=1.8.0,<2 + - pyro-ppl >=1.5.2,<2 + - networkx >=2.3,<3 + - optuna >=2.8,<3 + - anndata >=0.7.6,<1 - moods >=1.9.4.1 - - pyfaidx <1,>=0.5 - - matplotlib-base <4,>=3.4 + - pyfaidx >=0.5,<1 + - matplotlib-base >=3.4,<4 - lisa2 >=2.3.0 - - requests <3,>=2 + - requests >=2,<3 - tqdm - tensorboard test: imports: - mira - commands: - - pip check - requires: - - pip about: home: https://mira-multiome.readthedocs.io/en/latest/ diff --git a/recipes/mirmachine/meta.yaml b/recipes/mirmachine/meta.yaml index 0d9b2844285c3..aeb3d30ca4d51 100644 --- a/recipes/mirmachine/meta.yaml +++ b/recipes/mirmachine/meta.yaml @@ -1,5 +1,5 @@ {% set name = "MirMachine" %} -{% set version = "0.2.12" %} +{% set version = "0.2.13" %} package: name: "{{ name|lower }}" @@ -7,12 +7,14 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 5e55e5d4358d44e5f59f610476f1420a565c1bb916d1de1323d984d02313232c + sha256: 0a2d7d466a391b07a358ee543c34814974f8273cd42ce37f5ccb757169649411 build: noarch: python number: 0 script: "{{ PYTHON }} -m pip install . -vv" + run_exports: + - {{ pin_compatible("MirMachine", max_pin="x.x") }} requirements: host: diff --git a/recipes/mitofinder/build.sh b/recipes/mitofinder/build.sh index afce669dfc433..4d994a1a4c6d3 100644 --- a/recipes/mitofinder/build.sh +++ b/recipes/mitofinder/build.sh @@ -1,4 +1,4 @@ -#!/usr/bin/env python +#!/bin/bash ./install.sh diff --git a/recipes/mitofinder/meta.yaml b/recipes/mitofinder/meta.yaml index d7df107b87e67..fed796d0e41aa 100644 --- a/recipes/mitofinder/meta.yaml +++ b/recipes/mitofinder/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.4.1" %} +{% set version = "1.4.2" %} package: name: mitofinder @@ -6,15 +6,21 @@ package: source: url: https://github.com/RemiAllio/MitoFinder/archive/v{{ version }}.tar.gz - sha256: c80a0108c64813dce8c3f653958ed5d6bddc28a0c801fe4d477a173c3a58fe45 + sha256: 2d6d3925fb014777df97f272134143cc518944ae05d000a44ada2862d46ec95a build: - number: 1 - skip: true # [not py2k] + number: 0 + skip: True # [not py2k] + run_exports: + - {{ pin_subpackage('mitofinder', max_pin="x") }} requirements: build: - {{ compiler('c') }} + - make + - autoconf + - automake + - libtool host: - python run: @@ -35,5 +41,7 @@ test: about: home: https://github.com/RemiAllio/MitoFinder license: MIT + license_family: MIT license_file: License/LICENSE summary: Mitofinder is a pipeline to assemble mitochondrial genomes and annotate mitochondrial genes from trimmed read sequencing data. + dev_url: https://github.com/RemiAllio/MitoFinder diff --git a/recipes/mitos/meta.yaml b/recipes/mitos/meta.yaml index 7523ada0fc540..666d07b5d40bf 100644 --- a/recipes/mitos/meta.yaml +++ b/recipes/mitos/meta.yaml @@ -1,5 +1,5 @@ {% set name = "mitos" %} -{% set version = "2.1.6" %} +{% set version = "2.1.9" %} package: name: "{{ name|lower }}" @@ -7,10 +7,10 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 66d6ca1138bdda459d4ed6271a946ff86ea6298dcf7e3bb6f63c283213f77284 + sha256: 88fc8980c815ae8497518ee7ff58ff69e51b1a35c1efe2ae9b0925b7c4f364f5 build: - number: 1 + number: 0 script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv " noarch: python run_exports: @@ -25,7 +25,7 @@ requirements: - python >=3 - blast >=2.9 - hmmer =3.2 - - infernal =1.1 + - infernal >=1.1.5 - viennarna - r-base - r-ggplot2 diff --git a/recipes/mitos/mitos1/meta.yaml b/recipes/mitos/mitos1/meta.yaml index c1a015275ecc6..90b791e4f9731 100644 --- a/recipes/mitos/mitos1/meta.yaml +++ b/recipes/mitos/mitos1/meta.yaml @@ -1,5 +1,5 @@ {% set name = "mitos" %} -{% set version = "1.1.4" %} +{% set version = "1.1.6" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 4f541044977dd3b33628ff780f6435094f1d633a031a88b5bda80342efa05bae + sha256: c86c6e01d409de41619a3b7dce32908b4f568fbbeb67b336a7b99a93a642440c build: number: 0 diff --git a/recipes/mkdesigner/meta.yaml b/recipes/mkdesigner/meta.yaml index 45a3fb5756df4..3585d115b792d 100644 --- a/recipes/mkdesigner/meta.yaml +++ b/recipes/mkdesigner/meta.yaml @@ -1,5 +1,5 @@ {% set name = "mkdesigner" %} -{% set version = "0.3.1" %} +{% set version = "0.3.4" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/mkdesigner-{{ version }}.tar.gz - sha256: db3adaf00bbf6cb906c56ecee29ee233445255c7c7759ae42bd1f0e8262bd7f8 + sha256: 832372167e966e12cc0551cad936ed8049555da474fa3a4ef71574215001bf3a build: entry_points: diff --git a/recipes/mmseqs2/meta.yaml b/recipes/mmseqs2/meta.yaml index e7ecac44899cc..7343528cfb308 100644 --- a/recipes/mmseqs2/meta.yaml +++ b/recipes/mmseqs2/meta.yaml @@ -6,7 +6,7 @@ package: version: {{ version|replace("-", ".") }} build: - number: 0 + number: 2 run_exports: - {{ pin_subpackage('mmseqs2', max_pin=None) }} diff --git a/recipes/mofapy2/meta.yaml b/recipes/mofapy2/meta.yaml new file mode 100644 index 0000000000000..0b73846286177 --- /dev/null +++ b/recipes/mofapy2/meta.yaml @@ -0,0 +1,41 @@ +{% set name = "mofapy2" %} +{% set version = "0.7.1" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: 937c385e07cebcc20039cff4782b7f7d6ebb7b576c4f5a12f5e74364dcec16c3 +build: + noarch: python + number: 0 + script: python -m pip install --no-deps --ignore-installed . + run_exports: + - {{ pin_subpackage('mofapy2', max_pin="x.x") }} + +requirements: + host: + - python + - pip + - poetry-core + run: + - h5py + - numpy + - pandas + - python + - scipy + - scikit-learn + - anndata + +test: + imports: + - mofapy2 + +about: + home: https://github.com/bioFAM/mofapy2 + license: 'LGPL 3.0' + license_family: LGPL + license_file: LICENSE + summary: Multi-Omics Factor Analysis diff --git a/recipes/monopogen/build.sh b/recipes/monopogen/build.sh new file mode 100644 index 0000000000000..77db429cd8ee9 --- /dev/null +++ b/recipes/monopogen/build.sh @@ -0,0 +1,8 @@ +#!/bin/bash -euo + +mkdir -p ${PREFIX}/bin + +${PYTHON} -m pip install . -vvv --no-deps --no-build-isolation + +chmod +rx ${SP_DIR}/Monopogen.py +cp ${SP_DIR}/Monopogen.py ${PREFIX}/bin diff --git a/recipes/monopogen/meta.yaml b/recipes/monopogen/meta.yaml new file mode 100644 index 0000000000000..fee69ee522e3c --- /dev/null +++ b/recipes/monopogen/meta.yaml @@ -0,0 +1,55 @@ +{% set name = "Monopogen" %} +{% set version = "1.6.0" %} +{% set sha256 = "c0783c3296aed13017d337f2d7b9c7e55d72ac7f0397e83ba0d1c14fe38cb91b" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/KChen-lab/Monopogen/archive/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + noarch: python + run_exports: + - {{ pin_subpackage('monopogen', max_pin="x") }} + +requirements: + host: + - python >=3.6 + - pip + run: + - python >=3.6 + - pandas >=1.2.3 + - pysam >=0.16.0.1 + - numpy >=1.19.5 + - scipy >=1.6.3 + - pillow >=8.2.0 + - openjdk + - samtools + - bcftools + - beagle + - tabix + - r-base + - r-data.table + - r-e1071 + - r-ggplot2 + +test: + imports: + - Monopogen + +about: + home: https://github.com/KChen-lab/Monopogen + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE + summary: "Monopogen is an analysis package for SNV calling from single-cell sequencing datasets generated from single cell RNA 10x 5', 10x 3', single ATAC-seq technoloiges, scDNA-seq, etc." + +extra: + recipe-maintainers: + - mencian + identifiers: + - doi:10.1038/s41587-023-01873-x diff --git a/recipes/monsda/meta.yaml b/recipes/monsda/meta.yaml index d923fef7e8211..d0a07177d343b 100644 --- a/recipes/monsda/meta.yaml +++ b/recipes/monsda/meta.yaml @@ -1,6 +1,6 @@ {% set name = "MONSDA" %} -{% set version = "1.2.2" %} -{% set sha256 = "677ce6d6c880f022dfd70b5dddb62d2ffdb21c2816a0930ec2a712e786adc4c3" %} +{% set version = "1.2.4" %} +{% set sha256 = "7a2830bf7ccc90afdb8aa2b3d15985865109f14ac24f12ddfc3a4345031a73fb" %} package: name: "{{ name|lower }}" @@ -22,26 +22,31 @@ build: requirements: host: - - python >=3.11 + - python >=3.12 - pip - pytest-runner - run: - - python >=3.11 - - biopython >=1.78 - - more-itertools >=8.8.0 - - natsort >=7.1.1 - - nextflow >=23.04.1 - - numpy >=1.21.0 - - pandas >=1.4.1 - - perl >=5.32.1 - - scipy >=1.7.0 - - snakemake >=7.32.3 - versioneer >=0.20 - - yaml >=0.2.5 + run: + - python >=3.12 + - biopython >=1.83 - black >=21.5b2 - flake8 >=3.8.3 - - isort >=5.9.2 - - sphinx >=4.1.0 + - natsort >=8.4.0 + - nextflow >=23.10.1 + - numpy >=1.26.4 + - pandas >=2.2.1 + - perl >=5.32.0 + - pyyaml >=6.0.1 + - scipy >=1.12.0 + - snakemake >=8.10.0 + - snakemake-executor-plugin-slurm =0.4.2 + - snakemake-executor-plugin-cluster-generic =1.0.9 + - snakemake-interface-common =1.17.1 + - snakemake-interface-executor-plugins =9.0.2 + - snakemake-interface-report-plugins =1.0.0 + - snakemake-interface-storage-plugins =3.1.1 + - snakemake-storage-plugin-s3 =0.2.10 + - versioneer >=0.20 test: commands: @@ -54,7 +59,7 @@ about: license: GPL-3.0-or-later license_family: GPL3 license_file: LICENSE - summary: MONSDA, Modular Organizer of Nextflow and Snakemake driven hts Data Analysis + summary: MONSDA, Modular Organizer of Nextflow and Snakemake driven HTS Data Analysis doc_url: https://monsda.readthedocs.io/en/latest/ extra: diff --git a/recipes/moods/build.sh b/recipes/moods/build.sh index 9fd7ba71a6699..689926c02722e 100644 --- a/recipes/moods/build.sh +++ b/recipes/moods/build.sh @@ -1,17 +1,17 @@ #!/bin/bash -cat >setup_compile.patch << EOF ---- setup.py 2018-07-18 09:44:45.000000000 -0700 -+++ new_setup.py 2018-07-18 09:46:32.000000000 -0700 -@@ -7,7 +7,7 @@ - from distutils.core import setup, Extension - +cat > setup.py.patch << EOF +--- a/setup.py ++++ b/setup.py +@@ -4,7 +4,7 @@ from setuptools import setup, Extension + from os import path + common_includes = ["core/"] --common_compile_args = ['-march=native', '-O3', '-fPIC', '--std=c++11'] +-common_compile_args = ['-O3', '-fPIC', '--std=c++11'] +common_compile_args = ['-mtune=generic', '-O3', '-fPIC', '--std=c++11'] - - + tools_mod = Extension('MOODS._tools', + sources=['core/tools_wrap.cxx', EOF -patch setup.py setup_compile.patch -rm setup_compile.patch -$PYTHON setup.py install --record=record.txt +patch setup.py setup.py.patch +rm setup.py.patch +${PYTHON} -m pip install . -vvv --no-deps --no-build-isolation diff --git a/recipes/moods/build_failure.osx-64.yaml b/recipes/moods/build_failure.osx-64.yaml deleted file mode 100644 index df0004b00581b..0000000000000 --- a/recipes/moods/build_failure.osx-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: 85b12909a78e1bdae24bdf224f6202087b7343518d4e71f8e94bbb76b3837ca1 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |2- - libcxx: 16.0.4-hd57cbcb_0 conda-forge - libiconv: 1.17-hac89ed1_0 conda-forge - libllvm15: 15.0.7-he4b1e75_2 conda-forge - libxml2: 2.11.4-hd95e348_0 conda-forge - libzlib: 1.2.13-hfd90126_4 conda-forge - llvm-tools: 15.0.7-he4b1e75_2 conda-forge - openssl: 3.1.0-h8a1eda9_3 conda-forge - sigtool: 0.1.3-h88f4db0_0 conda-forge - tapi: 1100.0.11-h9ce4665_0 conda-forge - xz: 5.2.6-h775f41a_0 conda-forge - zstd: 1.5.2-hbc0c0cd_6 conda-forge - - Preparing transaction: ...working... done - Verifying transaction: ...working... done - Executing transaction: ...working... done - Source cache directory is: /opt/mambaforge/envs/bioconda/conda-bld/src_cache - INFO:conda_build.source:Source cache directory is: /opt/mambaforge/envs/bioconda/conda-bld/src_cache - Downloading source to cache: MOODS-python-1.9.4.1_7fd4d634bc.tar.gz - Downloading https://github.com/jhkorhonen/MOODS/releases/download/v1.9.4.1/MOODS-python-1.9.4.1.tar.gz - INFO:conda_build.source:Downloading source to cache: MOODS-python-1.9.4.1_7fd4d634bc.tar.gz - INFO:conda_build.source:Downloading https://github.com/jhkorhonen/MOODS/releases/download/v1.9.4.1/MOODS-python-1.9.4.1.tar.gz - Success - INFO:conda_build.source:Success - Extracting download - source tree in: /opt/mambaforge/envs/bioconda/conda-bld/moods_1685353906262/work - export PREFIX=/opt/mambaforge/envs/bioconda/conda-bld/moods_1685353906262/_h_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehol - export BUILD_PREFIX=/opt/mambaforge/envs/bioconda/conda-bld/moods_1685353906262/_build_env - export SRC_DIR=/opt/mambaforge/envs/bioconda/conda-bld/moods_1685353906262/work - INFO: activate_clang_osx-64.sh made the following environmental changes: - AR=x86_64-apple-darwin13.4.0-ar - AS=x86_64-apple-darwin13.4.0-as - CC=x86_64-apple-darwin13.4.0-clang - CC_FOR_BUILD=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-clang - CFLAGS=-march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/moods-1.9.4.1 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix - CHECKSYMS=x86_64-apple-darwin13.4.0-checksyms - CLANG=x86_64-apple-darwin13.4.0-clang - CMAKE_ARGS=-DCMAKE_AR=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ar -DCMAKE_CXX_COMPILER_AR=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ar -DCMAKE_C_COMPILER_AR=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ar -DCMAKE_RANLIB=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ranlib -DCMAKE_CXX_COMPILER_RANLIB=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ranlib -DCMAKE_C_COMPILER_RANLIB=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ranlib -DCMAKE_LINKER=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ld -DCMAKE_STRIP=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-strip -DCMAKE_INSTALL_NAME_TOOL=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-install_name_tool -DCMAKE_LIBTOOL=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-libtool -DCMAKE_OSX_DEPLOYMENT_TARGET=10.9 -DCMAKE_BUILD_TYPE=Release -DCMAKE_OSX_SYSROOT=/Applications/Xcode_14.2.app/Contents/Developer/Platforms/MacOSX.platform/Developer/SDKs/MacOSX10.9.sdk -DCMAKE_FIND_FRAMEWORK=LAST -DCMAKE_FIND_APPBUNDLE=LAST -DCMAKE_INSTALL_PREFIX=$PREFIX -DCMAKE_INSTALL_LIBDIR=lib -DCMAKE_PROGRAM_PATH=$BUILD_PREFIX/bin;$PREFIX/bin - CMAKE_PREFIX_PATH=:$PREFIX - CONDA_TOOLCHAIN_BUILD=x86_64-apple-darwin13.4.0 - CONDA_TOOLCHAIN_HOST=x86_64-apple-darwin13.4.0 - CPPFLAGS=-D_FORTIFY_SOURCE=2 -isystem $PREFIX/include -mmacosx-version-min=10.9 - DEBUG_CFLAGS=-march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -Og -g -Wall -Wextra -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/moods-1.9.4.1 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix - HOST=x86_64-apple-darwin13.4.0 - INSTALL_NAME_TOOL=x86_64-apple-darwin13.4.0-install_name_tool - LD=x86_64-apple-darwin13.4.0-ld - LDFLAGS=-Wl,-pie -Wl,-headerpad_max_install_names -Wl,-dead_strip_dylibs -Wl,-rpath,$PREFIX/lib -L$PREFIX/lib - LDFLAGS_LD=-pie -headerpad_max_install_names -dead_strip_dylibs -rpath $PREFIX/lib -L$PREFIX/lib - LIBTOOL=x86_64-apple-darwin13.4.0-libtool - LIPO=x86_64-apple-darwin13.4.0-lipo - MESON_ARGS=--buildtype release --prefix=$PREFIX -Dlibdir=lib - NM=x86_64-apple-darwin13.4.0-nm - NMEDIT=x86_64-apple-darwin13.4.0-nmedit - OBJC=x86_64-apple-darwin13.4.0-clang - OBJC_FOR_BUILD=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-clang - OTOOL=x86_64-apple-darwin13.4.0-otool - PAGESTUFF=x86_64-apple-darwin13.4.0-pagestuff - RANLIB=x86_64-apple-darwin13.4.0-ranlib - REDO_PREBINDING=x86_64-apple-darwin13.4.0-redo_prebinding - SDKROOT=/Applications/Xcode_14.2.app/Contents/Developer/Platforms/MacOSX.platform/Developer/SDKs/MacOSX10.9.sdk - SEGEDIT=x86_64-apple-darwin13.4.0-segedit - SEG_ADDR_TABLE=x86_64-apple-darwin13.4.0-seg_addr_table - SEG_HACK=x86_64-apple-darwin13.4.0-seg_hack - SIZE=x86_64-apple-darwin13.4.0-size - STRINGS=x86_64-apple-darwin13.4.0-strings - STRIP=x86_64-apple-darwin13.4.0-strip - _CONDA_PYTHON_SYSCONFIGDATA_NAME=_sysconfigdata_x86_64_apple_darwin13_4_0 - ac_cv_func_malloc_0_nonnull=yes - ac_cv_func_realloc_0_nonnull=yes - build_alias=x86_64-apple-darwin13.4.0 - host_alias=x86_64-apple-darwin13.4.0 - INFO: activate_clangxx_osx-64.sh made the following environmental changes: - CLANGXX=x86_64-apple-darwin13.4.0-clang - CXX=x86_64-apple-darwin13.4.0-clang - CXXFLAGS=-march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -stdlib=libc -fvisibility-inlines-hidden -fmessage-length=0 -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/moods-1.9.4.1 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix - CXX_FOR_BUILD=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-clang - DEBUG_CXXFLAGS=-march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -stdlib=libc -fvisibility-inlines-hidden -fmessage-length=0 -Og -g -Wall -Wextra -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/moods-1.9.4.1 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix - patching file setup.py - Hunk #1 succeeded at 8 with fuzz 2 (offset 1 line). - Traceback (most recent call last): - File "setup.py", line 7, in - from setuptools import setup, Extension - ModuleNotFoundError: No module named 'setuptools' - Traceback (most recent call last): - File "/opt/mambaforge/envs/bioconda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 2198, in build - utils.check_call_env(cmd, env=env, rewrite_stdout_env=rewrite_env, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/utils.py", line 451, in check_call_env - return _func_defaulting_env_to_os_environ("call", *popenargs, **kwargs) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/utils.py", line 427, in _func_defaulting_env_to_os_environ - raise subprocess.CalledProcessError(proc.returncode, _args) - subprocess.CalledProcessError: Command '['/bin/bash', '-o', 'errexit', '/opt/mambaforge/envs/bioconda/conda-bld/moods_1685353906262/work/conda_build.sh']' returned non-zero exit status 1. -# Last 100 lines of the build log. diff --git a/recipes/moods/meta.yaml b/recipes/moods/meta.yaml index d516f94e805d6..01727f6f25eda 100644 --- a/recipes/moods/meta.yaml +++ b/recipes/moods/meta.yaml @@ -1,38 +1,40 @@ -{% set version = "1.9.4.1" %} +{% set name = "moods" %} +{% set version = "1.9.4.2" %} package: - name: moods + name: {{ name|lower }} version: {{ version }} source: - url: https://github.com/jhkorhonen/MOODS/releases/download/v{{ version }}/MOODS-python-{{ version }}.tar.gz - sha256: 7fd4d634bc2258421859d720afb9e38b4015b92d1ffc7aaeeb5422ce8b26d65e + url: https://pypi.io/packages/source/{{ name[0] }}/mira-moods/mira-moods-{{ version }}.tar.gz + sha256: e694e37c7487286801bffcda3e0576157960007919dd5ceb8b5a1626dc2968e1 build: - number: 4 + number: 0 + skip: True # [py < 36] + run_exports: + - {{ pin_subpackage('moods', max_pin="x") }} requirements: build: - - {{ compiler('c') }} - {{ compiler('cxx') }} host: - python - - swig # [py3k] - + - pip run: - python - - swig # [py3k] test: imports: - MOODS.scan about: - home: https://github.com/jhkorhonen/MOODS - license: GPLv3 - license_family: GPL + home: https://www.cs.helsinki.fi/group/pssmfind/ + summary: 'MOODS: Motif Occurrence Detection Suite' + license: GPL-3.0-or-later + license_family: GPL3 license_file: COPYING.GPLv3 - summary: MOODS, Motif Occurrence Detection Suite + dev_url: https://github.com/jhkorhonen/MOODS extra: identifiers: diff --git a/recipes/morpheus/meta.yaml b/recipes/morpheus/meta.yaml index 258c57cd1367e..f4230238a4989 100644 --- a/recipes/morpheus/meta.yaml +++ b/recipes/morpheus/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "287" %} -{% set sha256 = "26757d63e44f8cd3888145edd4ddd7376e1502599672df768f3a448cbee88b5d" %} +{% set version = "288" %} +{% set sha256 = "05f2f502e591d349006eabd23f4c6a3933608d8ad1a2cfa898a46afd3245268a" %} package: name: morpheus @@ -10,9 +10,11 @@ source: sha256: '{{ sha256 }}' build: - number: 1 - skip: true # [osx] + number: 0 + skip: True # [osx] script: mkdir -p $PREFIX/bin && cp * $PREFIX/bin && cd $PREFIX/bin && ln -s ./morpheus_mzml_mono_cl.exe ./morpheus && chmod +x $PREFIX/bin/morpheus* + run_exports: + - {{ pin_subpackage('morpheus', max_pin=None) }} requirements: run: @@ -28,9 +30,12 @@ about: license_family: MIT license_file: MIT_License.CommandLine.txt summary: mass spectrometry–based proteomics database search algorithm - + doc_url: https://cwenger.github.io/Morpheus/ + dev_url: https://github.com/cwenger/Morpheus/ + extra: identifiers: - doi:10.1021/pr301024c + - biotools:morpheus skip-lints: - should_be_noarch_generic diff --git a/recipes/mosca/build.sh b/recipes/mosca/build.sh deleted file mode 100644 index 4582f8c0c8704..0000000000000 --- a/recipes/mosca/build.sh +++ /dev/null @@ -1,5 +0,0 @@ -echo "Storing MOSCA's files in the Conda environment at: ${PREFIX}" -mkdir -p "${PREFIX}/share/MOSCA" "${PREFIX}/bin" -cp -r workflow/* resources/*.json "${PREFIX}/share/MOSCA" -chmod +x "${PREFIX}/share/MOSCA/mosca.py" -ln -s "${PREFIX}/share/MOSCA/mosca.py" "${PREFIX}/bin/mosca" diff --git a/recipes/mosca/meta.yaml b/recipes/mosca/meta.yaml index d4ec74195aabd..d5f6fa74f4ac4 100644 --- a/recipes/mosca/meta.yaml +++ b/recipes/mosca/meta.yaml @@ -1,6 +1,6 @@ {% set name = "mosca" %} -{% set version = "2.2.1" %} -{% set sha256 = "c2b66c9cb0d55edf1c452fd23e31965ce9fb45793007521b372a1229ab5ed254" %} +{% set version = "2.3.0" %} +{% set sha256 = "1eba9c082273dd46badd2d5ff8df56aabdc496214e337331d000f54399893a94" %} package: name: {{ name|lower }} @@ -15,6 +15,11 @@ build: number: 0 run_exports: - {{ pin_subpackage("mosca", max_pin="x.x") }} + script: > + mkdir -p $PREFIX/share/MOSCA $PREFIX/bin && + cp -r workflow/* resources/*.json resources/*.txt $PREFIX/share/MOSCA && + chmod +x $PREFIX/share/MOSCA/mosca.py && + ln -s $PREFIX/share/MOSCA/mosca.py $PREFIX/bin/mosca requirements: run: @@ -28,7 +33,7 @@ test: about: home: https://github.com/iquasere/MOSCA - license: GNU General Public License v3 (GPL-3.0) + license: GPL-3.0-or-later license_family: GPL license_file: LICENSE summary: 'MOSCA - Meta-Omics Software for Community Analysis' diff --git a/recipes/mosdepth/build.sh b/recipes/mosdepth/build.sh index ae5ff06f5f3cb..8d17d6407e85d 100755 --- a/recipes/mosdepth/build.sh +++ b/recipes/mosdepth/build.sh @@ -1,6 +1,11 @@ #!/bin/sh if [[ ${target_platform} == osx-64 ]] ; then + curl -SL https://github.com/nim-lang/nightlies/releases/download/latest-version-1-6/macosx_x64.tar.xz -o macosx_x64.tar.xz + tar -xzf macosx_x64.tar.xz + cd nim-1.6.* + export PATH="$PWD/bin:$PATH" + cd .. curl -SL https://github.com/brentp/mosdepth/archive/refs/tags/v${PKG_VERSION}.tar.gz -o mosdepth-latest.tar.gz tar -xzf mosdepth-latest.tar.gz cd mosdepth-${PKG_VERSION} diff --git a/recipes/mosdepth/meta.yaml b/recipes/mosdepth/meta.yaml index a4a4b1000eeec..a1a2bd00817be 100755 --- a/recipes/mosdepth/meta.yaml +++ b/recipes/mosdepth/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.3.6" %} +{% set version = "0.3.8" %} package: name: mosdepth @@ -13,9 +13,8 @@ requirements: build: - {{ compiler('c') }} - curl - - nim <=1.6.2 host: - - htslib >=1.10 + - htslib >=1.19.1 run: test: diff --git a/recipes/ms2deepscore/meta.yaml b/recipes/ms2deepscore/meta.yaml index ee8f51bf196d1..6389bdadf0716 100644 --- a/recipes/ms2deepscore/meta.yaml +++ b/recipes/ms2deepscore/meta.yaml @@ -1,6 +1,6 @@ {% set name = "ms2deepscore" %} -{% set version = "0.5.0" %} -{% set sha256 = "7adcc18260b37291f525a263cb4d46c68b2e326718c36fde78cbb88d7ddd03a7" %} +{% set version = "2.0.0" %} +{% set sha256 = "50b700319a07461a0ac2be0a6f67c1cf1b23a681cb76b8c4488d948f8976f5b2" %} package: name: {{ name|lower }} @@ -13,19 +13,24 @@ source: build: number: 0 noarch: python - script: {{ PYTHON }} -m pip install . + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv + run_exports: + - {{ pin_subpackage('ms2deepscore', max_pin="x") }} requirements: host: - - python >=3.8 + - python >=3.9 + - pip run: - - python >=3.8 - - matchms >=0.14 + - python >=3.9 + - matchms >=0.18.0 + - matplotlib-base ==3.7.2 - numba - numpy >=1.20.3 - pandas + - pytorch + - scikit-learn - tqdm - - tensorflow test: imports: @@ -34,15 +39,19 @@ test: about: home: https://github.com/matchms/ms2deepscore license: Apache-2.0 + license_family: APACHE license_file: LICENSE + dev_url: https://github.com/matchms/ms2deepscore summary: "Deep learning similarity measure for comparing MS/MS spectra with respect to their chemical similarity" description: | ms2deepscore provides a Siamese neural network that is trained to predict molecular structural similarities (Tanimoto scores) from pairs of mass spectrometry spectra. + extra: identifiers: - - doi:https://doi.org/10.1186/s13321-021-00558-4 + - doi:10.1186/s13321-021-00558-4 + - biotools:ms2deepscore recipe-maintainers: - niekdejonge - hechth diff --git a/recipes/ms2pip/meta.yaml b/recipes/ms2pip/meta.yaml index 975bda9d85d11..910e321977e0d 100644 --- a/recipes/ms2pip/meta.yaml +++ b/recipes/ms2pip/meta.yaml @@ -1,6 +1,6 @@ -{% set version = "4.0.0.dev4" %} +{% set version = "4.0.0.dev8" %} {% set name = "ms2pip" %} -{% set sha256 = "3342bca48d5163a2fc833065ef1fc43bd349eb3ea32239fb8b74bc759b98ea3d" %} +{% set sha256 = "2a464e00135c875c12c98f6853a4487e193a0730b5bd94f82a44e8d5fb21a7bb" %} package: name: "ms2pip" @@ -49,6 +49,7 @@ requirements: - psm-utils - werkzeug >=2 - pyarrow + - pyopenms test: imports: diff --git a/recipes/ms2rescore-rs/build.sh b/recipes/ms2rescore-rs/build.sh new file mode 100644 index 0000000000000..89752b0073526 --- /dev/null +++ b/recipes/ms2rescore-rs/build.sh @@ -0,0 +1,21 @@ +#!/bin/bash + +# -e = exit on first error +# -x = print every executed command +set -ex + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" + +# Use a custom temporary directory as home on macOS. +# (not sure why this is useful, but people use it in bioconda recipes) +if [ `uname` == Darwin ]; then + export HOME=`mktemp -d` +fi + +# Build the package using maturin - should produce *.whl files. +maturin build --interpreter $PYTHON --release + +# Install *.whl files using pip +$PYTHON -m pip install target/wheels/*.whl --no-deps --ignore-installed -vv diff --git a/recipes/ms2rescore-rs/meta.yaml b/recipes/ms2rescore-rs/meta.yaml new file mode 100644 index 0000000000000..bcdfc966cdbb1 --- /dev/null +++ b/recipes/ms2rescore-rs/meta.yaml @@ -0,0 +1,50 @@ +{% set name = "ms2rescore-rs" %} +{% set version = "0.2.0" %} +{% set sha256 = "561ed92f58fd7ecccc78b3e4b1bc91ffa36d0f2e58d54f7ea317898f3ea55560" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/ms2rescore_rs-{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + skip: True # [py < 37] + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x.x") }} + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('rust') }} + - make + - cmake + host: + - zlib + - python + - maturin >=1.5,<2.0 + - pip + run: + - python + +test: + imports: + - ms2rescore_rs + commands: + - pip check + requires: + - pip + +about: + home: https://github.com/compomics/ms2rescore-rs + summary: "Rust functionality for the MS²Rescore package" + license: Apache-2.0 + license_file: LICENSE + +extra: + recipe-maintainers: + - CompOmics + - RalfG diff --git a/recipes/ms2rescore/meta.yaml b/recipes/ms2rescore/meta.yaml index e6dd1106f161f..47c1ca6c892a4 100644 --- a/recipes/ms2rescore/meta.yaml +++ b/recipes/ms2rescore/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ms2rescore" %} -{% set version = "3.0.0" %} +{% set version = "3.0.3" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/ms2rescore-{{ version }}.tar.gz - sha256: d59b82f3e8543ab6456126f07dd09c0455daf36a6d226042b87e63aa5cc6cee0 + sha256: d2ecbe0dd3c23ce598265b265c83c84e515f50fef849c0deac3963c49ba93c77 build: number: 0 @@ -18,7 +18,7 @@ build: - ms2rescore = ms2rescore.__main__:main - ms2rescore-gui = ms2rescore.gui.__main__:main - ms2rescore-report = ms2rescore.report.__main__:main - script: "{{ PYTHON }} -m pip install . --no-deps -vvv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" requirements: host: @@ -30,44 +30,45 @@ requirements: - numpy >=1.16.0 - pandas >=1.0 - rich >=12 - - pyteomics >=4.1.0 + - pyteomics >=4.1.0,<=4.6.3 - pyopenms - lxml >=4.5 - - ms2pip >=4.0.0-dev4 + - ms2pip >=4.0.0-dev8 + - ms2rescore-rs - click >=7 - cascade-config >=0.4.0 - deeplc >=2.2 - - deeplcretrainer ==0.1.17 + - deeplcretrainer >=0.2 - tomli >=2 # [py<311] - psm-utils >=0.4 - customtkinter >=5,<6 - mokapot >=0.9 - pydantic >=1.8.2,<2 - jinja2 >=3 - - plotly + - plotly >=5 - sqlalchemy <2,>=1.3 - mokapot - statsmodels - matplotlib-base - seaborn + - xgboost <2,>=1.3 # from ms2pip test: imports: - ms2rescore commands: - - pip check - ms2rescore --help # - ms2rescore-gui --help - ms2rescore-report --help - requires: - - pip about: home: https://compomics.github.io/projects/ms2rescore/ summary: 'MS²Rescore: Sensitive PSM rescoring with predicted MS² peak intensities and retention times.' dev_url: https://github.com/compomics/ms2rescore license: Apache-2.0 + license_family: APACHE license_file: LICENSE + doc_url: https://ms2rescore.readthedocs.io/en/stable/ extra: container: diff --git a/recipes/msfragger/academic_install.py b/recipes/msfragger/academic_install.py new file mode 100755 index 0000000000000..2f47dc5e87cfa --- /dev/null +++ b/recipes/msfragger/academic_install.py @@ -0,0 +1,74 @@ +#!/usr/bin/env python3 + +# Automates accepting the academic license agreements in order to download MSFragger. A user of this package is then expected to accept the terms themselves when they download a license key from the MSFragger site, which is enforced by the wrapper script and MSFragger jar file. + +import argparse +import hashlib +import os +import re +import sys +import urllib.request +import urllib.parse + +MSFRAGGER_URL = 'http://msfragger-upgrader.nesvilab.org/upgrader/upgrade_download.php' +DOWNLOAD_READ_SIZE = 1000000 + +def download_url(url, post_dict, dest): + data = urllib.parse.urlencode(post_dict).encode('ascii') + with open(dest, 'wb') as wh: + size = 0 + m = hashlib.sha256() + with urllib.request.urlopen(url, data) as f: + while True: + seg = f.read(DOWNLOAD_READ_SIZE) + m.update(seg) + bytes_read = len(seg) + if bytes_read < 1: + break + size += bytes_read + wh.write(seg) + + return m.hexdigest() + +def parse_version(version_string): + version_pattern = '([\\d.]+)' + m = re.search(version_pattern, version_string.strip()) + if m: + return m.groups()[0] + return None + +parser = argparse.ArgumentParser( + description="Download MSFragger zip file." +) +parser.add_argument( + '-n', '--name', help='user name' +) +parser.add_argument( + '-e', '--email', help='email' +) +parser.add_argument( + '-o', '--organization', help='institutional organization' +) +parser.add_argument( + '-m', '--msfragger_version', help='MSFragger version', required=True +) +parser.add_argument( + '-p', '--path', default='.', help='path in which to install' +) +parser.add_argument( + '--hash', default='.', help='SHA256 hash of downloaded zip' +) + +args = parser.parse_args() +fgr_ver = parse_version(args.msfragger_version) +if fgr_ver is None: + print(f'Could not find version: {args.msfragger_version}', file=sys.stderr) + sys.exit(1) + +fgr_zip = 'Release ' + fgr_ver + '$zip' +dest = os.path.join(args.path, 'MSFragger-' + fgr_ver + '.zip') +data = {'transfer': 'academic', 'agreement1': 'true', 'agreement2': 'true','agreement3': 'true', 'name': args.name, 'email' : args.email, 'organization' : args.organization, 'download': fgr_zip} + +if download_url(MSFRAGGER_URL, data, dest) != args.hash: + print('Invalid hash calculated.', file=sys.stderr) + sys.exit(1) diff --git a/recipes/msfragger/build.sh b/recipes/msfragger/build.sh new file mode 100644 index 0000000000000..c2f43d60481cf --- /dev/null +++ b/recipes/msfragger/build.sh @@ -0,0 +1,34 @@ +#!/bin/bash + +# These values are submitted to the MSFragger site when downloading the application zip. +if [[ -z "$NAME" ]]; then + NAME="${USERNAME:-bioconda}"; +fi +if [[ -z "$EMAIL" ]]; then + EMAIL="${NAME}@${HOSTNAME:-bioconda.org}"; +fi +if [[ -z "$INSTITUTION" ]]; then + INSTITUTION="${HOSTNAME:-bioconda.org}"; +fi + +# Create directories +TARGET="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" +mkdir -p "$TARGET" + +# Add wrapper python script and link to unprefixed name. +cp "$RECIPE_DIR/msfragger.py" "$TARGET" +ln -s "$TARGET/msfragger.py" "$PREFIX/bin/msfragger" +chmod 0755 "${PREFIX}/bin/msfragger" + +# This script automates accepting the academic license agreements in order to download MSFragger and build the package. A user of this package is then expected to accept the terms themselves when they download a license key from the MSFragger site, which is enforced by the wrapper script and MSFragger jar file. +"${RECIPE_DIR}/academic_install.py" -n galaxy -e "$EMAIL" -o "$INSTITUTION" -m "$PKG_VERSION" -p "$TARGET" --hash "$SHA256SUM" +if [[ $? -ne 0 ]]; then + echo "Problem downloading jar file." > /dev/stderr + exit 1; +fi + +# Unzip and link jar. +cd "$TARGET" +unzip "MSFragger-$PKG_VERSION.zip" +ln -s "MSFragger-$PKG_VERSION/MSFragger-$PKG_VERSION.jar" "MSFragger.jar" +rm "MSFragger-$PKG_VERSION.zip" diff --git a/recipes/msfragger/meta.yaml b/recipes/msfragger/meta.yaml new file mode 100644 index 0000000000000..5826d1d418714 --- /dev/null +++ b/recipes/msfragger/meta.yaml @@ -0,0 +1,54 @@ +{% set version = "4.0" %} + +# This key was generated ONLY for the testing of this bioconda package. +# Users must generate their own key by agreeing to the terms at https://msfragger.arsci.com/upgrader/MSFragger-LICENSE.pdf. +{% set academic_use_only_key = "f28c4be2-759b0a11-6c1ea652-1240565a" %} +{% set sha256sum = "25bdab705c4ac97729d1da8d7a075e3920d8a447596fa52eff8e564606d1720e" %} + +package: + name: msfragger + version: {{ version }} + +build: + number: 1 + noarch: generic + run_exports: + - {{ pin_subpackage('msfragger', max_pin="x.x") }} + script_env: + - SHA256SUM={{ sha256sum }} + +requirements: + host: + - python >3.9 + - unzip + run: + - openjdk >=11 + - python >=3.9 + - mono >=5, <6 + - zlib >=1.2.13 + +test: + commands: + - msfragger --key {{ academic_use_only_key }} -Xms512m -Xmx1g --help | grep 'License key verified' + +about: + home: https://github.com/Nesvilab/MSFragger + license: Academic License (https://msfragger.arsci.com/upgrader/MSFragger-LICENSE.pdf) + summary: Ultrafast, comprehensive peptide identification for mass spectrometry–based proteomics + description: | + MSFragger is an ultrafast database search tool for peptide identification in mass spectrometry-based proteomics. + It has demonstrated excellent performance across a wide range of datasets and applications. + MSFragger is suitable for standard shotgun proteomics analyses as well as large datasets (including timsTOF PASEF data), + enzyme unconstrained searches (e.g., peptidome), + open database searches (e.g., precursor mass tolerance set to hundreds of Daltons) for identification + of modified peptides, and glycopeptide identification (N-linked and O-linked). + + MSFragger is available freely for academic research and educational purposes only, in accordance with the terms at https://msfragger.arsci.com/upgrader/MSFragger-LICENSE.pdf. + +extra: + notes: | + The "msfragger" command runs the MSFragger java program. + identifiers: + - doi:10.1038/nmeth.4256 + - doi:10.1038/s41467-020-17921-y + - doi:10.1038/s41592-020-0967-9 diff --git a/recipes/msfragger/msfragger.py b/recipes/msfragger/msfragger.py new file mode 100755 index 0000000000000..6484597f30a7e --- /dev/null +++ b/recipes/msfragger/msfragger.py @@ -0,0 +1,86 @@ +#!/usr/bin/env python +# +# Wrapper script for Java Conda packages that ensures that the java runtime +# is invoked with the right options. Adapted from the bash script (http://stackoverflow.com/questions/59895/can-a-bash-script-tell-what-directory-its-stored-in/246128#246128). +# + +import os +import sys +import subprocess +from os import access, getenv, X_OK + +jar_file = os.path.join(os.path.dirname(os.path.realpath(__file__)), "MSFragger.jar") + +default_jvm_mem_opts = ['-Xms512m', '-Xmx1g'] + +license_agreement_text = ''' +Please provide pass a license key with the --key argument. You may obtain a key by agreeing to the terms at msfragger-upgrader.nesvilab.org/upgrader/. +''' + +def real_dirname(path): + """Return the symlink-resolved, canonicalized directory-portion of path.""" + return os.path.dirname(os.path.realpath(path)) + + +def java_executable(): + """Return the executable name of the Java interpreter.""" + java_home = getenv('JAVA_HOME') + java_bin = os.path.join('bin', 'java') + + if java_home and access(os.path.join(java_home, java_bin), X_OK): + return os.path.join(java_home, java_bin) + else: + return 'java' + + +def jvm_opts(argv): + """Construct list of Java arguments based on our argument list. + + The argument list passed in argv must not include the script name. + The return value is a 3-tuple lists of strings of the form: + (memory_options, prop_options, passthrough_options) + """ + mem_opts = [] + prop_opts = [] + pass_args = [] + + for arg in argv: + if arg.startswith('-D'): + prop_opts.append(arg) + elif arg.startswith('-XX'): + prop_opts.append(arg) + elif arg.startswith('-Xm'): + mem_opts.append(arg) + else: + pass_args.append(arg) + + # In the original shell script the test coded below read: + # if [ "$jvm_mem_opts" == "" ] && [ -z ${_JAVA_OPTIONS+x} ] + # To reproduce the behaviour of the above shell code fragment + # it is important to explictly check for equality with None + # in the second condition, so a null envar value counts as True! + + if mem_opts == [] and getenv('_JAVA_OPTIONS') == None: + mem_opts = default_jvm_mem_opts + + return (mem_opts, prop_opts, pass_args) + + +def main(): + java = java_executable() + jar_dir = real_dirname(sys.argv[0]) + jar_path = os.path.join(jar_dir, jar_file) + jar_arg = '-jar' + + (mem_opts, prop_opts, pass_args) = jvm_opts(sys.argv[1:]) + + if '--key' not in sys.argv: + print(license_agreement_text) + sys.exit(1) + + java_args = [java] + mem_opts + prop_opts + [jar_arg] + [jar_path] + pass_args + + sys.exit(subprocess.call(java_args)) + +if __name__ == '__main__': + main() diff --git a/recipes/msgf_plus/meta.yaml b/recipes/msgf_plus/meta.yaml index 7bd4fc1fe9d28..228a710889f02 100644 --- a/recipes/msgf_plus/meta.yaml +++ b/recipes/msgf_plus/meta.yaml @@ -1,14 +1,16 @@ package: name: msgf_plus - version: 2023.01.1202 + version: 2024.03.26 build: noarch: generic - number: 1 + number: 0 + run_exports: + - {{ pin_subpackage('msgf_plus', max_pin=None) }} source: - url: https://github.com/MSGFPlus/msgfplus/releases/download/v2023.01.12/MSGFPlus_v20230112.zip - sha256: ae9eb564b119ce54e5182fa9a9cc9b1d1c3e43489e81ed80279a442b55d5607c + url: https://github.com/MSGFPlus/msgfplus/releases/download/v2024.03.26/MSGFPlus_v20240326.zip + sha256: 01bacb4e74077f84c206f6f91eba67a29433d07d649f438b013a77217b0bfaac requirements: host: @@ -33,7 +35,7 @@ about: spectra, different configurations of MS instruments and different experimental protocols). -extra: +extra: identifiers: - biotools:MSGFplus - doi:10.1038/ncomms6277 diff --git a/recipes/msmetaenhancer/meta.yaml b/recipes/msmetaenhancer/meta.yaml index f3d1f4ad42681..a241ca1e81132 100644 --- a/recipes/msmetaenhancer/meta.yaml +++ b/recipes/msmetaenhancer/meta.yaml @@ -1,22 +1,25 @@ -{% set name = "MSMetaEnhancer" %} -{% set version = "0.3.0" %} +{% set name = "msmetaenhancer" %} +{% set version = "0.4.0" %} package: name: {{ name|lower }} version: {{ version }} source: - url: "https://github.com/RECETOX/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz" - sha256: 7d889be548db18ec1e34c04947b8f8c7d9660241d8142bdc9842052396475ba8 + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/msmetaenhancer-{{ version }}.tar.gz + sha256: e422a3849a486613b08d04801c873fa369b170361b4e27c06c2531023a47823b build: - number: 1 + number: 0 noarch: python - script: "{{ PYTHON }} -m pip install . " + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('msmetaenhancer', max_pin="x.x") }} requirements: host: - python >=3.9 + - poetry-core - pip run: - python >=3.9 @@ -27,12 +30,13 @@ requirements: - aiohttp - asyncstdlib - frozendict + - twine - tabulate - rdkit - multidict - aiocircuitbreaker - openpyxl - + test: imports: - MSMetaEnhancer @@ -40,6 +44,7 @@ test: about: home: https://github.com/RECETOX/MSMetaEnhancer license: MIT + license_family: MIT license_file: LICENSE summary: "MSMetaEnhancer is a Python tool that adds more annotations (e.g. SMILES, InChI, CAS number) to MSP files." dev_url: "https://github.com/RECETOX/MSMetaEnhancer" @@ -49,3 +54,6 @@ extra: recipe-maintainers: - xtrojak - martenson + identifiers: + - biotools:msmetaenhancer + - doi:10.21105/joss.04494 diff --git a/recipes/mtgrasp/build.sh b/recipes/mtgrasp/build.sh new file mode 100644 index 0000000000000..41100de173091 --- /dev/null +++ b/recipes/mtgrasp/build.sh @@ -0,0 +1,7 @@ +#!/bin/bash +set -eu -o pipefail + +mkdir -p ${PREFIX}/bin/ +cp *mtgrasp* ${PREFIX}/bin/ +cp -r data ${PREFIX}/bin/ +cp -r test ${PREFIX}/bin/ diff --git a/recipes/mtgrasp/meta.yaml b/recipes/mtgrasp/meta.yaml new file mode 100644 index 0000000000000..629a1559ffd0b --- /dev/null +++ b/recipes/mtgrasp/meta.yaml @@ -0,0 +1,44 @@ +{% set version = "1.1.3" %} +{% set name = "mtGrasp" %} + +package: + name: {{ name | lower }} + version: {{ version }} + +source: + url: https://github.com/bcgsc/{{ name }}/releases/download/v{{ version }}/{{ name }}-v{{ version }}.tar.gz + sha256: b9a8a250938fee584f73469fc33d04e1100d9af0475fac5f702ae373842b9e86 + +build: + number: 0 + noarch: generic + run_exports: + - {{ pin_subpackage('mtgrasp', max_pin="x") }} + +requirements: + host: + - python + run: + - python + - snakemake + - blast >=2.9.0 + - biopython + - seqtk + - abyss + - ntjoin + - bwa + - samtools + - pilon + - ntcard + - mitos >=2.1.7 + + +test: + commands: + - mtgrasp.py -h + +about: + home: https://github.com/bcgsc/mtGrasp + license: GPL-3.0 + license_file: LICENSE + summary: 'reference-grade de novo animal mitochondrial genome assembly and standardization' diff --git a/recipes/mugsy/meta.yaml b/recipes/mugsy/meta.yaml index d2923a91a8e4f..697b022bb83fd 100644 --- a/recipes/mugsy/meta.yaml +++ b/recipes/mugsy/meta.yaml @@ -10,11 +10,14 @@ source: build: noarch: generic - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage('mugsy', max_pin="x") }} requirements: run: - perl + - sed about: home: http://mugsy.sourceforge.net diff --git a/recipes/multiqc/meta.yaml b/recipes/multiqc/meta.yaml index 2d17086c661b8..822b056cb2126 100644 --- a/recipes/multiqc/meta.yaml +++ b/recipes/multiqc/meta.yaml @@ -1,12 +1,12 @@ -{% set version = "1.19" %} +{% set version = "1.21" %} package: name: multiqc version: {{ version }} source: - url: https://github.com/ewels/MultiQC/archive/v{{ version }}.tar.gz - sha256: 7c1501c8306f69a6f32777fe732fb4a53f71b066512a2252a8b2b4b89f994ca8 + url: https://github.com/MultiQC/MultiQC/archive/v{{ version }}.tar.gz + sha256: c0e4887598628567b8fb1539445cf7b34a7ac6a8db2e52e10cc42cfa8e2202e2 build: number: 0 @@ -33,6 +33,9 @@ requirements: - lzstring - markdown - matplotlib-base >=2.1.1 + - plotly >=5.18 + - python-kaleido + - pillow >=10.2.0 - networkx >=2.5.1 - numpy - packaging diff --git a/recipes/multirnafold/0001-FIX-Makefile.patch b/recipes/multirnafold/0001-FIX-Makefile.patch new file mode 100644 index 0000000000000..ff8e6c124469c --- /dev/null +++ b/recipes/multirnafold/0001-FIX-Makefile.patch @@ -0,0 +1,925 @@ +diff --git a/Makefile b/Makefile +index 6e3f2fe..28bb7e7 100644 +--- a/Makefile ++++ b/Makefile +@@ -1,7 +1,7 @@ + # makefile for the MultiRNAFold package + +-CC = g++ +-CFLAGS = -g -I./include -I./src/common -I./src/simfold -I./src/pairfold -I./src/multifold -w -Wno-deprecated ++CXX = g++ ++CXXFLAGS = -O2 -ggdb -I./include -I./src/common -I./src/simfold -I./src/pairfold -I./src/multifold -Wno-deprecated + # -pg for profiling + #-O3 + # -p is for profiler +@@ -101,7 +101,7 @@ L_C_OBJS = $(L_C_SRCS:.cpp=.o) + L_S_OBJS = $(L_S_SRCS:.cpp=.o) + L_P_OBJS = $(L_P_SRCS:.cpp=.o) + L_M_OBJS = $(L_M_SRCS:.cpp=.o) +- ++ + AR = ar + ARFLAGS = rv + RANLIB = ranlib +@@ -114,78 +114,64 @@ default: $(LIB) $(SIMFOLD) $(SIMFOLD_PF) $(PAIRFOLD) $(PAIRFOLD_WEB) $(MULTIFOL + $(LIB): $(L_C_OBJS) $(L_S_OBJS) $(L_P_OBJS) $(L_M_OBJS) + $(RM) $@ + $(AR) $(ARFLAGS) $@ $(L_C_OBJS) $(L_S_OBJS) $(L_P_OBJS) $(L_M_OBJS) +- $(RANLIB) $@ +- ++ $(RANLIB) $@ ++ + $(SIMFOLD): $(S_OBJS) $(LIB) +- $(CC) -o $@ $@.o $(LFLAGS) +- ++ $(CXX) -o $@ $@.o $(LFLAGS) ++ + $(SIMFOLD_PF): $(S2_OBJS) $(LIB) +- $(CC) -o $@ $@.o $(LFLAGS) +- ++ $(CXX) -o $@ $@.o $(LFLAGS) ++ + $(PAIRFOLD): $(P_OBJS) $(LIB) +- $(CC) -o $@ $@.o $(LFLAGS) +- ++ $(CXX) -o $@ $@.o $(LFLAGS) ++ + $(PAIRFOLD_WEB): $(P2_OBJS) $(LIB) +- $(CC) -o $@ $@.o $(LFLAGS) +- ++ $(CXX) -o $@ $@.o $(LFLAGS) ++ + $(MULTIFOLD): $(M_OBJS) $(LIB) +- $(CC) -o $@ $@.o $(LFLAGS) +- ++ $(CXX) -o $@ $@.o $(LFLAGS) ++ + $(DRIVER): $(D_OBJS) $(LIB) +- $(CC) -o $@ $@.o $(LFLAGS) ++ $(CXX) -o $@ $@.o $(LFLAGS) + + $(PARTITION): $(PARTITION).o $(LIB) +- $(CC) -o $@ $@.o $(LFLAGS) ++ $(CXX) -o $@ $@.o $(LFLAGS) + + $(DRIVER1): $(DRIVER1).o $(LIB) + mpiCC -o $(DRIVER1) $(DRIVER1).o $(LFLAGS) -L$(LAMDIR)/lib + + $(DRIVER1).o: $(DRIVER1).cpp +- mpiCC -c $(DRIVER1).cpp $(CFLAGS) -I$(LAMDIR)/include -o $(DRIVER1).o ++ mpiCC -c $(DRIVER1).cpp $(CXXFLAGS) -I$(LAMDIR)/include -o $(DRIVER1).o + + $(DRIVER2): $(DRIVER2).o $(LIB) +- mpiCC -o $(DRIVER2) $(DRIVER2).o $(LFLAGS) -L$(LAMDIR)/lib ++ mpiCC -o $(DRIVER2) $(DRIVER2).o $(LFLAGS) -L$(LAMDIR)/lib + + $(DRIVER2).o: $(DRIVER2).cpp +- mpiCC -c $(DRIVER2).cpp $(CFLAGS) -I$(LAMDIR)/include -o $(DRIVER2).o ++ mpiCC -c $(DRIVER2).cpp $(CXXFLAGS) -I$(LAMDIR)/include -o $(DRIVER2).o + +- + $(RUNTIMEV): $(RUNTIMEV).o +- $(CC) -o $@ $@.o -L$(VIENNADIR)/lib -lviennapp $(LFLAGS) ++ $(CXX) -o $@ $@.o -L$(VIENNADIR)/lib -lviennapp $(LFLAGS) + + $(RUNTIMEV).o: $(RUNTIMEV).cpp +- $(CC) -c $(RUNTIMEV).cpp -I$(VIENNADIR)/include $(CFLAGS) +- +- ++ $(CXX) -c $(RUNTIMEV).cpp -I$(VIENNADIR)/include $(CXXFLAGS) ++ + .SUFFIXES: .cpp + .cpp.o: +- $(CC) -c $*.cpp $(CFLAGS) -o $*.o ++ $(CXX) -c $*.cpp $(CXXFLAGS) -o $*.o + + clean: + rm -f $(L_C_OBJS) $(L_S_OBJS) $(L_P_OBJS) $(L_M_OBJS) +- rm -f $(S_OBJS) $(S2_OBJS) $(P_OBJS) $(P2_OBJS) $(M_OBJS) $(D_OBJS) ++ rm -f $(S_OBJS) $(S2_OBJS) $(P_OBJS) $(P2_OBJS) $(M_OBJS) $(D_OBJS) + # $(SIMFOLD) $(SIMFOLD_PF) $(PAIRFOLD) $(MULTIFOLD) $(DRIVER) *~ core + rm -f $(SRC_C)/*~ $(SRC_S)/*~ $(SRC_P)/*~ $(SRC_M)/*~ include/*~ *.a *.bak + + depend: +- makedepend -- $(CFLAGS) -- $(L_C_SRCS) $(L_S_SRCS) $(L_P_SRCS) $(L_M_SRCS) $(S_SRCS) $(S2_SRCS) $(P_SRCS) $(M_SRCS) $(D_SRCS) +- +- ++ makedepend -Y $(CXXFLAGS) -- $(L_C_SRCS) $(L_S_SRCS) $(L_P_SRCS) $(L_M_SRCS) $(S_SRCS) $(S2_SRCS) $(P_SRCS) $(M_SRCS) $(D_SRCS) ++ + # end of makefile + + # DO NOT DELETE + +-src/common/common.o: /usr/include/stdio.h /usr/include/features.h +-src/common/common.o: /usr/include/sys/cdefs.h /usr/include/bits/wordsize.h +-src/common/common.o: /usr/include/gnu/stubs.h /usr/include/gnu/stubs-32.h +-src/common/common.o: /usr/include/bits/types.h /usr/include/bits/typesizes.h +-src/common/common.o: /usr/include/libio.h /usr/include/_G_config.h +-src/common/common.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/common/common.o: /usr/include/gconv.h /usr/include/bits/stdio_lim.h +-src/common/common.o: /usr/include/bits/sys_errlist.h /usr/include/stdlib.h +-src/common/common.o: /usr/include/math.h /usr/include/bits/huge_val.h +-src/common/common.o: /usr/include/bits/mathdef.h +-src/common/common.o: /usr/include/bits/mathcalls.h /usr/include/string.h + src/common/common.o: ./include/constants.h ./include/structs.h + src/common/common.o: ./include/externs.h src/common/common.h + src/common/common.o: ./src/simfold/s_partition_function.h +@@ -195,16 +181,6 @@ src/common/common.o: ./src/simfold/s_energy_matrix.h + src/common/common.o: ./src/simfold/s_stacked_pair.h + src/common/common.o: ./src/simfold/s_multi_loop.h + src/common/common.o: ./src/simfold/s_multi_loop_sub.h +-src/common/params.o: /usr/include/stdio.h /usr/include/features.h +-src/common/params.o: /usr/include/sys/cdefs.h /usr/include/bits/wordsize.h +-src/common/params.o: /usr/include/gnu/stubs.h /usr/include/gnu/stubs-32.h +-src/common/params.o: /usr/include/bits/types.h /usr/include/bits/typesizes.h +-src/common/params.o: /usr/include/libio.h /usr/include/_G_config.h +-src/common/params.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/common/params.o: /usr/include/gconv.h /usr/include/bits/stdio_lim.h +-src/common/params.o: /usr/include/bits/sys_errlist.h /usr/include/math.h +-src/common/params.o: /usr/include/bits/huge_val.h /usr/include/bits/mathdef.h +-src/common/params.o: /usr/include/bits/mathcalls.h /usr/include/stdlib.h + src/common/params.o: src/common/params.h ./include/constants.h + src/common/params.o: src/common/common.h ./include/structs.h + src/common/params.o: ./src/simfold/s_partition_function.h +@@ -214,60 +190,20 @@ src/common/params.o: ./src/simfold/s_energy_matrix.h + src/common/params.o: ./src/simfold/s_stacked_pair.h + src/common/params.o: ./src/simfold/s_multi_loop.h + src/common/params.o: ./src/simfold/s_multi_loop_sub.h ./include/externs.h +-src/common/params.o: /usr/include/string.h + src/common/params.o: ./src/simfold/s_specific_functions.h + src/common/params.o: ./src/simfold/s_min_folding.h + src/common/params.o: ./src/simfold/s_sub_folding.h ./include/simfold.h + src/common/params.o: ./include/init.h +-src/common/init.o: /usr/include/stdio.h /usr/include/features.h +-src/common/init.o: /usr/include/sys/cdefs.h /usr/include/bits/wordsize.h +-src/common/init.o: /usr/include/gnu/stubs.h /usr/include/gnu/stubs-32.h +-src/common/init.o: /usr/include/bits/types.h /usr/include/bits/typesizes.h +-src/common/init.o: /usr/include/libio.h /usr/include/_G_config.h +-src/common/init.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/common/init.o: /usr/include/gconv.h /usr/include/bits/stdio_lim.h +-src/common/init.o: /usr/include/bits/sys_errlist.h /usr/include/stdlib.h +-src/common/init.o: /usr/include/string.h /usr/include/math.h +-src/common/init.o: /usr/include/bits/huge_val.h /usr/include/bits/mathdef.h +-src/common/init.o: /usr/include/bits/mathcalls.h ./include/constants.h +-src/common/init.o: ./include/structs.h ./include/globals.h +-src/common/init.o: src/common/common.h ./src/simfold/s_partition_function.h ++src/common/init.o: ./include/constants.h ./include/structs.h ++src/common/init.o: ./include/globals.h src/common/common.h ++src/common/init.o: ./src/simfold/s_partition_function.h + src/common/init.o: ./src/simfold/s_hairpin_loop.h + src/common/init.o: ./src/simfold/s_internal_loop.h + src/common/init.o: ./src/simfold/s_energy_matrix.h + src/common/init.o: ./src/simfold/s_stacked_pair.h + src/common/init.o: ./src/simfold/s_multi_loop.h +-src/common/init.o: ./src/simfold/s_multi_loop_sub.h +-src/common/timer.o: /usr/include/math.h /usr/include/features.h +-src/common/timer.o: /usr/include/sys/cdefs.h /usr/include/bits/wordsize.h +-src/common/timer.o: /usr/include/gnu/stubs.h /usr/include/gnu/stubs-32.h +-src/common/timer.o: /usr/include/bits/huge_val.h /usr/include/bits/mathdef.h +-src/common/timer.o: /usr/include/bits/mathcalls.h /usr/include/ctype.h +-src/common/timer.o: /usr/include/bits/types.h /usr/include/bits/typesizes.h +-src/common/timer.o: /usr/include/endian.h /usr/include/bits/endian.h +-src/common/timer.o: /usr/include/time.h /usr/include/bits/time.h +-src/common/timer.o: /usr/include/string.h /usr/include/sys/times.h +-src/common/timer.o: /usr/include/limits.h src/common/timer.h +-src/simfold/s_specific_functions.o: /usr/include/stdio.h +-src/simfold/s_specific_functions.o: /usr/include/features.h +-src/simfold/s_specific_functions.o: /usr/include/sys/cdefs.h +-src/simfold/s_specific_functions.o: /usr/include/bits/wordsize.h +-src/simfold/s_specific_functions.o: /usr/include/gnu/stubs.h +-src/simfold/s_specific_functions.o: /usr/include/gnu/stubs-32.h +-src/simfold/s_specific_functions.o: /usr/include/bits/types.h +-src/simfold/s_specific_functions.o: /usr/include/bits/typesizes.h +-src/simfold/s_specific_functions.o: /usr/include/libio.h +-src/simfold/s_specific_functions.o: /usr/include/_G_config.h +-src/simfold/s_specific_functions.o: /usr/include/wchar.h +-src/simfold/s_specific_functions.o: /usr/include/bits/wchar.h +-src/simfold/s_specific_functions.o: /usr/include/gconv.h +-src/simfold/s_specific_functions.o: /usr/include/bits/stdio_lim.h +-src/simfold/s_specific_functions.o: /usr/include/bits/sys_errlist.h +-src/simfold/s_specific_functions.o: /usr/include/stdlib.h /usr/include/math.h +-src/simfold/s_specific_functions.o: /usr/include/bits/huge_val.h +-src/simfold/s_specific_functions.o: /usr/include/bits/mathdef.h +-src/simfold/s_specific_functions.o: /usr/include/bits/mathcalls.h +-src/simfold/s_specific_functions.o: /usr/include/string.h ++src/common/init.o: ./src/simfold/s_multi_loop_sub.h src/common/params.h ++src/common/timer.o: src/common/timer.h + src/simfold/s_specific_functions.o: ./include/constants.h ./include/structs.h + src/simfold/s_specific_functions.o: ./include/externs.h src/common/common.h + src/simfold/s_specific_functions.o: ./src/simfold/s_partition_function.h +@@ -281,22 +217,6 @@ src/simfold/s_specific_functions.o: ./include/simfold.h ./include/init.h + src/simfold/s_specific_functions.o: ./src/simfold/s_specific_functions.h + src/simfold/s_specific_functions.o: ./src/simfold/s_min_folding.h + src/simfold/s_specific_functions.o: ./src/simfold/s_sub_folding.h +-src/simfold/s_specific_functions.o: src/simfold/s_partition_function_complex.h +-src/simfold/s_specific_functions.o: /usr/include/complex.h +-src/simfold/s_specific_functions.o: /usr/include/bits/cmathcalls.h +-src/simfold/s_min_folding.o: /usr/include/stdio.h /usr/include/features.h +-src/simfold/s_min_folding.o: /usr/include/sys/cdefs.h +-src/simfold/s_min_folding.o: /usr/include/bits/wordsize.h +-src/simfold/s_min_folding.o: /usr/include/gnu/stubs.h +-src/simfold/s_min_folding.o: /usr/include/gnu/stubs-32.h +-src/simfold/s_min_folding.o: /usr/include/bits/types.h +-src/simfold/s_min_folding.o: /usr/include/bits/typesizes.h +-src/simfold/s_min_folding.o: /usr/include/libio.h /usr/include/_G_config.h +-src/simfold/s_min_folding.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/simfold/s_min_folding.o: /usr/include/gconv.h +-src/simfold/s_min_folding.o: /usr/include/bits/stdio_lim.h +-src/simfold/s_min_folding.o: /usr/include/bits/sys_errlist.h +-src/simfold/s_min_folding.o: /usr/include/string.h /usr/include/stdlib.h + src/simfold/s_min_folding.o: ./include/constants.h ./include/structs.h + src/simfold/s_min_folding.o: ./include/externs.h src/common/common.h + src/simfold/s_min_folding.o: ./src/simfold/s_partition_function.h +@@ -309,22 +229,8 @@ src/simfold/s_min_folding.o: ./src/simfold/s_multi_loop_sub.h + src/simfold/s_min_folding.o: ./include/simfold.h ./include/init.h + src/simfold/s_min_folding.o: ./src/simfold/s_specific_functions.h + src/simfold/s_min_folding.o: ./src/simfold/s_min_folding.h +-src/simfold/s_hairpin_loop.o: /usr/include/string.h /usr/include/features.h +-src/simfold/s_hairpin_loop.o: /usr/include/sys/cdefs.h +-src/simfold/s_hairpin_loop.o: /usr/include/bits/wordsize.h +-src/simfold/s_hairpin_loop.o: /usr/include/gnu/stubs.h +-src/simfold/s_hairpin_loop.o: /usr/include/gnu/stubs-32.h +-src/simfold/s_hairpin_loop.o: /usr/include/ctype.h /usr/include/bits/types.h +-src/simfold/s_hairpin_loop.o: /usr/include/bits/typesizes.h +-src/simfold/s_hairpin_loop.o: /usr/include/endian.h +-src/simfold/s_hairpin_loop.o: /usr/include/bits/endian.h + src/simfold/s_hairpin_loop.o: ./include/constants.h ./include/structs.h + src/simfold/s_hairpin_loop.o: ./include/externs.h src/common/common.h +-src/simfold/s_hairpin_loop.o: /usr/include/stdio.h /usr/include/libio.h +-src/simfold/s_hairpin_loop.o: /usr/include/_G_config.h /usr/include/wchar.h +-src/simfold/s_hairpin_loop.o: /usr/include/bits/wchar.h /usr/include/gconv.h +-src/simfold/s_hairpin_loop.o: /usr/include/bits/stdio_lim.h +-src/simfold/s_hairpin_loop.o: /usr/include/bits/sys_errlist.h + src/simfold/s_hairpin_loop.o: ./src/simfold/s_partition_function.h + src/simfold/s_hairpin_loop.o: ./src/simfold/s_hairpin_loop.h + src/simfold/s_hairpin_loop.o: ./src/simfold/s_internal_loop.h +@@ -334,20 +240,8 @@ src/simfold/s_hairpin_loop.o: ./src/simfold/s_multi_loop.h + src/simfold/s_hairpin_loop.o: ./src/simfold/s_multi_loop_sub.h + src/simfold/s_hairpin_loop.o: ./include/simfold.h ./include/init.h + src/simfold/s_hairpin_loop.o: src/common/params.h +-src/simfold/s_stacked_pair.o: /usr/include/string.h /usr/include/features.h +-src/simfold/s_stacked_pair.o: /usr/include/sys/cdefs.h +-src/simfold/s_stacked_pair.o: /usr/include/bits/wordsize.h +-src/simfold/s_stacked_pair.o: /usr/include/gnu/stubs.h +-src/simfold/s_stacked_pair.o: /usr/include/gnu/stubs-32.h + src/simfold/s_stacked_pair.o: ./include/constants.h ./include/structs.h + src/simfold/s_stacked_pair.o: ./include/externs.h src/common/common.h +-src/simfold/s_stacked_pair.o: /usr/include/stdio.h /usr/include/bits/types.h +-src/simfold/s_stacked_pair.o: /usr/include/bits/typesizes.h +-src/simfold/s_stacked_pair.o: /usr/include/libio.h /usr/include/_G_config.h +-src/simfold/s_stacked_pair.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/simfold/s_stacked_pair.o: /usr/include/gconv.h +-src/simfold/s_stacked_pair.o: /usr/include/bits/stdio_lim.h +-src/simfold/s_stacked_pair.o: /usr/include/bits/sys_errlist.h + src/simfold/s_stacked_pair.o: ./src/simfold/s_partition_function.h + src/simfold/s_stacked_pair.o: ./src/simfold/s_hairpin_loop.h + src/simfold/s_stacked_pair.o: ./src/simfold/s_internal_loop.h +@@ -357,22 +251,8 @@ src/simfold/s_stacked_pair.o: ./src/simfold/s_multi_loop.h + src/simfold/s_stacked_pair.o: ./src/simfold/s_multi_loop_sub.h + src/simfold/s_stacked_pair.o: ./include/simfold.h ./include/init.h + src/simfold/s_stacked_pair.o: src/common/params.h +-src/simfold/s_energy_matrix.o: /usr/include/stdio.h /usr/include/features.h +-src/simfold/s_energy_matrix.o: /usr/include/sys/cdefs.h +-src/simfold/s_energy_matrix.o: /usr/include/bits/wordsize.h +-src/simfold/s_energy_matrix.o: /usr/include/gnu/stubs.h +-src/simfold/s_energy_matrix.o: /usr/include/gnu/stubs-32.h +-src/simfold/s_energy_matrix.o: /usr/include/bits/types.h +-src/simfold/s_energy_matrix.o: /usr/include/bits/typesizes.h +-src/simfold/s_energy_matrix.o: /usr/include/libio.h /usr/include/_G_config.h +-src/simfold/s_energy_matrix.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/simfold/s_energy_matrix.o: /usr/include/gconv.h +-src/simfold/s_energy_matrix.o: /usr/include/bits/stdio_lim.h +-src/simfold/s_energy_matrix.o: /usr/include/bits/sys_errlist.h +-src/simfold/s_energy_matrix.o: /usr/include/string.h /usr/include/stdlib.h +-src/simfold/s_energy_matrix.o: /usr/include/malloc.h ./include/constants.h +-src/simfold/s_energy_matrix.o: ./include/structs.h ./include/externs.h +-src/simfold/s_energy_matrix.o: src/common/common.h ++src/simfold/s_energy_matrix.o: ./include/constants.h ./include/structs.h ++src/simfold/s_energy_matrix.o: ./include/externs.h src/common/common.h + src/simfold/s_energy_matrix.o: ./src/simfold/s_partition_function.h + src/simfold/s_energy_matrix.o: ./src/simfold/s_hairpin_loop.h + src/simfold/s_energy_matrix.o: ./src/simfold/s_internal_loop.h +@@ -381,19 +261,6 @@ src/simfold/s_energy_matrix.o: ./src/simfold/s_stacked_pair.h + src/simfold/s_energy_matrix.o: ./src/simfold/s_multi_loop.h + src/simfold/s_energy_matrix.o: ./src/simfold/s_multi_loop_sub.h + src/simfold/s_energy_matrix.o: ./include/simfold.h ./include/init.h +-src/simfold/s_internal_loop.o: /usr/include/stdio.h /usr/include/features.h +-src/simfold/s_internal_loop.o: /usr/include/sys/cdefs.h +-src/simfold/s_internal_loop.o: /usr/include/bits/wordsize.h +-src/simfold/s_internal_loop.o: /usr/include/gnu/stubs.h +-src/simfold/s_internal_loop.o: /usr/include/gnu/stubs-32.h +-src/simfold/s_internal_loop.o: /usr/include/bits/types.h +-src/simfold/s_internal_loop.o: /usr/include/bits/typesizes.h +-src/simfold/s_internal_loop.o: /usr/include/libio.h /usr/include/_G_config.h +-src/simfold/s_internal_loop.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/simfold/s_internal_loop.o: /usr/include/gconv.h +-src/simfold/s_internal_loop.o: /usr/include/bits/stdio_lim.h +-src/simfold/s_internal_loop.o: /usr/include/bits/sys_errlist.h +-src/simfold/s_internal_loop.o: /usr/include/string.h /usr/include/stdlib.h + src/simfold/s_internal_loop.o: ./src/simfold/s_internal_loop.h + src/simfold/s_internal_loop.o: ./include/constants.h ./include/structs.h + src/simfold/s_internal_loop.o: ./src/simfold/s_energy_matrix.h +@@ -405,21 +272,8 @@ src/simfold/s_internal_loop.o: ./include/externs.h src/common/common.h + src/simfold/s_internal_loop.o: ./src/simfold/s_partition_function.h + src/simfold/s_internal_loop.o: ./include/simfold.h ./include/init.h + src/simfold/s_internal_loop.o: src/common/params.h +-src/simfold/s_multi_loop.o: /usr/include/stdio.h /usr/include/features.h +-src/simfold/s_multi_loop.o: /usr/include/sys/cdefs.h +-src/simfold/s_multi_loop.o: /usr/include/bits/wordsize.h +-src/simfold/s_multi_loop.o: /usr/include/gnu/stubs.h +-src/simfold/s_multi_loop.o: /usr/include/gnu/stubs-32.h +-src/simfold/s_multi_loop.o: /usr/include/bits/types.h +-src/simfold/s_multi_loop.o: /usr/include/bits/typesizes.h +-src/simfold/s_multi_loop.o: /usr/include/libio.h /usr/include/_G_config.h +-src/simfold/s_multi_loop.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/simfold/s_multi_loop.o: /usr/include/gconv.h +-src/simfold/s_multi_loop.o: /usr/include/bits/stdio_lim.h +-src/simfold/s_multi_loop.o: /usr/include/bits/sys_errlist.h +-src/simfold/s_multi_loop.o: /usr/include/malloc.h ./include/externs.h +-src/simfold/s_multi_loop.o: ./include/structs.h ./include/constants.h +-src/simfold/s_multi_loop.o: src/common/common.h ++src/simfold/s_multi_loop.o: ./include/externs.h ./include/structs.h ++src/simfold/s_multi_loop.o: ./include/constants.h src/common/common.h + src/simfold/s_multi_loop.o: ./src/simfold/s_partition_function.h + src/simfold/s_multi_loop.o: ./src/simfold/s_hairpin_loop.h + src/simfold/s_multi_loop.o: ./src/simfold/s_internal_loop.h +@@ -428,22 +282,8 @@ src/simfold/s_multi_loop.o: ./src/simfold/s_stacked_pair.h + src/simfold/s_multi_loop.o: ./src/simfold/s_multi_loop.h + src/simfold/s_multi_loop.o: ./src/simfold/s_multi_loop_sub.h + src/simfold/s_multi_loop.o: ./include/simfold.h ./include/init.h +-src/simfold/s_multi_loop_sub.o: /usr/include/stdio.h /usr/include/features.h +-src/simfold/s_multi_loop_sub.o: /usr/include/sys/cdefs.h +-src/simfold/s_multi_loop_sub.o: /usr/include/bits/wordsize.h +-src/simfold/s_multi_loop_sub.o: /usr/include/gnu/stubs.h +-src/simfold/s_multi_loop_sub.o: /usr/include/gnu/stubs-32.h +-src/simfold/s_multi_loop_sub.o: /usr/include/bits/types.h +-src/simfold/s_multi_loop_sub.o: /usr/include/bits/typesizes.h +-src/simfold/s_multi_loop_sub.o: /usr/include/libio.h /usr/include/_G_config.h +-src/simfold/s_multi_loop_sub.o: /usr/include/wchar.h +-src/simfold/s_multi_loop_sub.o: /usr/include/bits/wchar.h +-src/simfold/s_multi_loop_sub.o: /usr/include/gconv.h +-src/simfold/s_multi_loop_sub.o: /usr/include/bits/stdio_lim.h +-src/simfold/s_multi_loop_sub.o: /usr/include/bits/sys_errlist.h +-src/simfold/s_multi_loop_sub.o: /usr/include/malloc.h ./include/externs.h +-src/simfold/s_multi_loop_sub.o: ./include/structs.h ./include/constants.h +-src/simfold/s_multi_loop_sub.o: src/common/common.h ++src/simfold/s_multi_loop_sub.o: ./include/externs.h ./include/structs.h ++src/simfold/s_multi_loop_sub.o: ./include/constants.h src/common/common.h + src/simfold/s_multi_loop_sub.o: ./src/simfold/s_partition_function.h + src/simfold/s_multi_loop_sub.o: ./src/simfold/s_hairpin_loop.h + src/simfold/s_multi_loop_sub.o: ./src/simfold/s_internal_loop.h +@@ -452,20 +292,7 @@ src/simfold/s_multi_loop_sub.o: ./src/simfold/s_stacked_pair.h + src/simfold/s_multi_loop_sub.o: ./src/simfold/s_multi_loop.h + src/simfold/s_multi_loop_sub.o: ./src/simfold/s_multi_loop_sub.h + src/simfold/s_sub_folding.o: ./src/simfold/s_sub_folding.h +-src/simfold/s_sub_folding.o: /usr/include/stdio.h /usr/include/features.h +-src/simfold/s_sub_folding.o: /usr/include/sys/cdefs.h +-src/simfold/s_sub_folding.o: /usr/include/bits/wordsize.h +-src/simfold/s_sub_folding.o: /usr/include/gnu/stubs.h +-src/simfold/s_sub_folding.o: /usr/include/gnu/stubs-32.h +-src/simfold/s_sub_folding.o: /usr/include/bits/types.h +-src/simfold/s_sub_folding.o: /usr/include/bits/typesizes.h +-src/simfold/s_sub_folding.o: /usr/include/libio.h /usr/include/_G_config.h +-src/simfold/s_sub_folding.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/simfold/s_sub_folding.o: /usr/include/gconv.h +-src/simfold/s_sub_folding.o: /usr/include/bits/stdio_lim.h +-src/simfold/s_sub_folding.o: /usr/include/bits/sys_errlist.h +-src/simfold/s_sub_folding.o: /usr/include/string.h ./include/structs.h +-src/simfold/s_sub_folding.o: ./include/constants.h ++src/simfold/s_sub_folding.o: ./include/structs.h ./include/constants.h + src/simfold/s_sub_folding.o: ./src/simfold/s_energy_matrix.h + src/simfold/s_sub_folding.o: ./src/simfold/s_stacked_pair.h + src/simfold/s_sub_folding.o: ./src/simfold/s_hairpin_loop.h +@@ -475,30 +302,6 @@ src/simfold/s_sub_folding.o: ./src/simfold/s_multi_loop_sub.h + src/simfold/s_sub_folding.o: ./include/externs.h src/common/common.h + src/simfold/s_sub_folding.o: ./src/simfold/s_partition_function.h + src/simfold/s_sub_folding.o: ./include/simfold.h ./include/init.h +-src/simfold/s_partition_function.o: /usr/include/stdio.h +-src/simfold/s_partition_function.o: /usr/include/features.h +-src/simfold/s_partition_function.o: /usr/include/sys/cdefs.h +-src/simfold/s_partition_function.o: /usr/include/bits/wordsize.h +-src/simfold/s_partition_function.o: /usr/include/gnu/stubs.h +-src/simfold/s_partition_function.o: /usr/include/gnu/stubs-32.h +-src/simfold/s_partition_function.o: /usr/include/bits/types.h +-src/simfold/s_partition_function.o: /usr/include/bits/typesizes.h +-src/simfold/s_partition_function.o: /usr/include/libio.h +-src/simfold/s_partition_function.o: /usr/include/_G_config.h +-src/simfold/s_partition_function.o: /usr/include/wchar.h +-src/simfold/s_partition_function.o: /usr/include/bits/wchar.h +-src/simfold/s_partition_function.o: /usr/include/gconv.h +-src/simfold/s_partition_function.o: /usr/include/bits/stdio_lim.h +-src/simfold/s_partition_function.o: /usr/include/bits/sys_errlist.h +-src/simfold/s_partition_function.o: /usr/include/string.h +-src/simfold/s_partition_function.o: /usr/include/stdlib.h +-src/simfold/s_partition_function.o: /usr/include/malloc.h /usr/include/math.h +-src/simfold/s_partition_function.o: /usr/include/bits/huge_val.h +-src/simfold/s_partition_function.o: /usr/include/bits/mathdef.h +-src/simfold/s_partition_function.o: /usr/include/bits/mathcalls.h +-src/simfold/s_partition_function.o: /usr/include/ctype.h +-src/simfold/s_partition_function.o: /usr/include/endian.h +-src/simfold/s_partition_function.o: /usr/include/bits/endian.h + src/simfold/s_partition_function.o: ./include/constants.h ./include/structs.h + src/simfold/s_partition_function.o: ./include/externs.h src/common/common.h + src/simfold/s_partition_function.o: ./src/simfold/s_partition_function.h +@@ -512,31 +315,6 @@ src/simfold/s_partition_function.o: ./include/simfold.h ./include/init.h + src/simfold/s_partition_function.o: ./src/simfold/s_min_folding.h + src/simfold/s_partition_function.o: ./src/simfold/s_sub_folding.h + src/simfold/s_partition_function.o: src/common/params.h +-src/simfold/s_partition_function_complex.o: /usr/include/stdio.h +-src/simfold/s_partition_function_complex.o: /usr/include/features.h +-src/simfold/s_partition_function_complex.o: /usr/include/sys/cdefs.h +-src/simfold/s_partition_function_complex.o: /usr/include/bits/wordsize.h +-src/simfold/s_partition_function_complex.o: /usr/include/gnu/stubs.h +-src/simfold/s_partition_function_complex.o: /usr/include/gnu/stubs-32.h +-src/simfold/s_partition_function_complex.o: /usr/include/bits/types.h +-src/simfold/s_partition_function_complex.o: /usr/include/bits/typesizes.h +-src/simfold/s_partition_function_complex.o: /usr/include/libio.h +-src/simfold/s_partition_function_complex.o: /usr/include/_G_config.h +-src/simfold/s_partition_function_complex.o: /usr/include/wchar.h +-src/simfold/s_partition_function_complex.o: /usr/include/bits/wchar.h +-src/simfold/s_partition_function_complex.o: /usr/include/gconv.h +-src/simfold/s_partition_function_complex.o: /usr/include/bits/stdio_lim.h +-src/simfold/s_partition_function_complex.o: /usr/include/bits/sys_errlist.h +-src/simfold/s_partition_function_complex.o: /usr/include/string.h +-src/simfold/s_partition_function_complex.o: /usr/include/stdlib.h +-src/simfold/s_partition_function_complex.o: /usr/include/malloc.h +-src/simfold/s_partition_function_complex.o: /usr/include/math.h +-src/simfold/s_partition_function_complex.o: /usr/include/bits/huge_val.h +-src/simfold/s_partition_function_complex.o: /usr/include/bits/mathdef.h +-src/simfold/s_partition_function_complex.o: /usr/include/bits/mathcalls.h +-src/simfold/s_partition_function_complex.o: /usr/include/ctype.h +-src/simfold/s_partition_function_complex.o: /usr/include/endian.h +-src/simfold/s_partition_function_complex.o: /usr/include/bits/endian.h + src/simfold/s_partition_function_complex.o: ./include/constants.h + src/simfold/s_partition_function_complex.o: ./include/structs.h + src/simfold/s_partition_function_complex.o: ./include/externs.h +@@ -551,32 +329,9 @@ src/simfold/s_partition_function_complex.o: ./src/simfold/s_multi_loop_sub.h + src/simfold/s_partition_function_complex.o: ./include/simfold.h + src/simfold/s_partition_function_complex.o: ./include/init.h + src/simfold/s_partition_function_complex.o: src/simfold/s_partition_function_complex.h +-src/simfold/s_partition_function_complex.o: /usr/include/complex.h +-src/simfold/s_partition_function_complex.o: /usr/include/bits/cmathcalls.h + src/simfold/s_partition_function_complex.o: ./src/simfold/s_min_folding.h + src/simfold/s_partition_function_complex.o: ./src/simfold/s_sub_folding.h + src/simfold/s_partition_function_complex.o: src/common/params.h +-src/pairfold/p_specific_functions.o: /usr/include/stdio.h +-src/pairfold/p_specific_functions.o: /usr/include/features.h +-src/pairfold/p_specific_functions.o: /usr/include/sys/cdefs.h +-src/pairfold/p_specific_functions.o: /usr/include/bits/wordsize.h +-src/pairfold/p_specific_functions.o: /usr/include/gnu/stubs.h +-src/pairfold/p_specific_functions.o: /usr/include/gnu/stubs-32.h +-src/pairfold/p_specific_functions.o: /usr/include/bits/types.h +-src/pairfold/p_specific_functions.o: /usr/include/bits/typesizes.h +-src/pairfold/p_specific_functions.o: /usr/include/libio.h +-src/pairfold/p_specific_functions.o: /usr/include/_G_config.h +-src/pairfold/p_specific_functions.o: /usr/include/wchar.h +-src/pairfold/p_specific_functions.o: /usr/include/bits/wchar.h +-src/pairfold/p_specific_functions.o: /usr/include/gconv.h +-src/pairfold/p_specific_functions.o: /usr/include/bits/stdio_lim.h +-src/pairfold/p_specific_functions.o: /usr/include/bits/sys_errlist.h +-src/pairfold/p_specific_functions.o: /usr/include/stdlib.h +-src/pairfold/p_specific_functions.o: /usr/include/math.h +-src/pairfold/p_specific_functions.o: /usr/include/bits/huge_val.h +-src/pairfold/p_specific_functions.o: /usr/include/bits/mathdef.h +-src/pairfold/p_specific_functions.o: /usr/include/bits/mathcalls.h +-src/pairfold/p_specific_functions.o: /usr/include/string.h + src/pairfold/p_specific_functions.o: ./include/constants.h + src/pairfold/p_specific_functions.o: ./include/structs.h ./include/externs.h + src/pairfold/p_specific_functions.o: src/common/common.h +@@ -597,19 +352,6 @@ src/pairfold/p_specific_functions.o: src/pairfold/p_multi_loop.h + src/pairfold/p_specific_functions.o: src/pairfold/p_multi_loop_sub.h + src/pairfold/p_specific_functions.o: src/pairfold/p_sub_folding.h + src/pairfold/p_specific_functions.o: src/pairfold/p_specific_functions.h +-src/pairfold/p_min_folding.o: /usr/include/stdio.h /usr/include/features.h +-src/pairfold/p_min_folding.o: /usr/include/sys/cdefs.h +-src/pairfold/p_min_folding.o: /usr/include/bits/wordsize.h +-src/pairfold/p_min_folding.o: /usr/include/gnu/stubs.h +-src/pairfold/p_min_folding.o: /usr/include/gnu/stubs-32.h +-src/pairfold/p_min_folding.o: /usr/include/bits/types.h +-src/pairfold/p_min_folding.o: /usr/include/bits/typesizes.h +-src/pairfold/p_min_folding.o: /usr/include/libio.h /usr/include/_G_config.h +-src/pairfold/p_min_folding.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/pairfold/p_min_folding.o: /usr/include/gconv.h +-src/pairfold/p_min_folding.o: /usr/include/bits/stdio_lim.h +-src/pairfold/p_min_folding.o: /usr/include/bits/sys_errlist.h +-src/pairfold/p_min_folding.o: /usr/include/string.h + src/pairfold/p_min_folding.o: src/pairfold/p_min_folding.h + src/pairfold/p_min_folding.o: ./include/structs.h ./include/constants.h + src/pairfold/p_min_folding.o: src/pairfold/p_energy_matrix.h +@@ -627,20 +369,8 @@ src/pairfold/p_min_folding.o: ./src/simfold/s_stacked_pair.h + src/pairfold/p_min_folding.o: ./src/simfold/s_multi_loop.h + src/pairfold/p_min_folding.o: ./src/simfold/s_multi_loop_sub.h + src/pairfold/p_min_folding.o: ./include/pairfold.h ./include/init.h +-src/pairfold/p_hairpin_loop.o: /usr/include/string.h /usr/include/features.h +-src/pairfold/p_hairpin_loop.o: /usr/include/sys/cdefs.h +-src/pairfold/p_hairpin_loop.o: /usr/include/bits/wordsize.h +-src/pairfold/p_hairpin_loop.o: /usr/include/gnu/stubs.h +-src/pairfold/p_hairpin_loop.o: /usr/include/gnu/stubs-32.h + src/pairfold/p_hairpin_loop.o: ./include/constants.h ./include/structs.h + src/pairfold/p_hairpin_loop.o: ./include/externs.h src/common/common.h +-src/pairfold/p_hairpin_loop.o: /usr/include/stdio.h /usr/include/bits/types.h +-src/pairfold/p_hairpin_loop.o: /usr/include/bits/typesizes.h +-src/pairfold/p_hairpin_loop.o: /usr/include/libio.h /usr/include/_G_config.h +-src/pairfold/p_hairpin_loop.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/pairfold/p_hairpin_loop.o: /usr/include/gconv.h +-src/pairfold/p_hairpin_loop.o: /usr/include/bits/stdio_lim.h +-src/pairfold/p_hairpin_loop.o: /usr/include/bits/sys_errlist.h + src/pairfold/p_hairpin_loop.o: ./src/simfold/s_partition_function.h + src/pairfold/p_hairpin_loop.o: ./src/simfold/s_hairpin_loop.h + src/pairfold/p_hairpin_loop.o: ./src/simfold/s_internal_loop.h +@@ -650,20 +380,8 @@ src/pairfold/p_hairpin_loop.o: ./src/simfold/s_multi_loop.h + src/pairfold/p_hairpin_loop.o: ./src/simfold/s_multi_loop_sub.h + src/pairfold/p_hairpin_loop.o: ./include/pairfold.h ./include/init.h + src/pairfold/p_hairpin_loop.o: src/pairfold/p_hairpin_loop.h +-src/pairfold/p_stacked_pair.o: /usr/include/string.h /usr/include/features.h +-src/pairfold/p_stacked_pair.o: /usr/include/sys/cdefs.h +-src/pairfold/p_stacked_pair.o: /usr/include/bits/wordsize.h +-src/pairfold/p_stacked_pair.o: /usr/include/gnu/stubs.h +-src/pairfold/p_stacked_pair.o: /usr/include/gnu/stubs-32.h + src/pairfold/p_stacked_pair.o: ./include/constants.h ./include/structs.h + src/pairfold/p_stacked_pair.o: ./include/externs.h src/common/common.h +-src/pairfold/p_stacked_pair.o: /usr/include/stdio.h /usr/include/bits/types.h +-src/pairfold/p_stacked_pair.o: /usr/include/bits/typesizes.h +-src/pairfold/p_stacked_pair.o: /usr/include/libio.h /usr/include/_G_config.h +-src/pairfold/p_stacked_pair.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/pairfold/p_stacked_pair.o: /usr/include/gconv.h +-src/pairfold/p_stacked_pair.o: /usr/include/bits/stdio_lim.h +-src/pairfold/p_stacked_pair.o: /usr/include/bits/sys_errlist.h + src/pairfold/p_stacked_pair.o: ./src/simfold/s_partition_function.h + src/pairfold/p_stacked_pair.o: ./src/simfold/s_hairpin_loop.h + src/pairfold/p_stacked_pair.o: ./src/simfold/s_internal_loop.h +@@ -678,23 +396,8 @@ src/pairfold/p_stacked_pair.o: src/pairfold/p_hairpin_loop.h + src/pairfold/p_stacked_pair.o: src/pairfold/p_internal_loop.h + src/pairfold/p_stacked_pair.o: src/pairfold/p_multi_loop.h + src/pairfold/p_stacked_pair.o: src/pairfold/p_multi_loop_sub.h +-src/pairfold/p_energy_matrix.o: /usr/include/stdio.h /usr/include/features.h +-src/pairfold/p_energy_matrix.o: /usr/include/sys/cdefs.h +-src/pairfold/p_energy_matrix.o: /usr/include/bits/wordsize.h +-src/pairfold/p_energy_matrix.o: /usr/include/gnu/stubs.h +-src/pairfold/p_energy_matrix.o: /usr/include/gnu/stubs-32.h +-src/pairfold/p_energy_matrix.o: /usr/include/bits/types.h +-src/pairfold/p_energy_matrix.o: /usr/include/bits/typesizes.h +-src/pairfold/p_energy_matrix.o: /usr/include/libio.h /usr/include/_G_config.h +-src/pairfold/p_energy_matrix.o: /usr/include/wchar.h +-src/pairfold/p_energy_matrix.o: /usr/include/bits/wchar.h +-src/pairfold/p_energy_matrix.o: /usr/include/gconv.h +-src/pairfold/p_energy_matrix.o: /usr/include/bits/stdio_lim.h +-src/pairfold/p_energy_matrix.o: /usr/include/bits/sys_errlist.h +-src/pairfold/p_energy_matrix.o: /usr/include/string.h /usr/include/stdlib.h +-src/pairfold/p_energy_matrix.o: /usr/include/malloc.h ./include/constants.h +-src/pairfold/p_energy_matrix.o: ./include/structs.h ./include/externs.h +-src/pairfold/p_energy_matrix.o: src/common/common.h ++src/pairfold/p_energy_matrix.o: ./include/constants.h ./include/structs.h ++src/pairfold/p_energy_matrix.o: ./include/externs.h src/common/common.h + src/pairfold/p_energy_matrix.o: ./src/simfold/s_partition_function.h + src/pairfold/p_energy_matrix.o: ./src/simfold/s_hairpin_loop.h + src/pairfold/p_energy_matrix.o: ./src/simfold/s_internal_loop.h +@@ -709,20 +412,6 @@ src/pairfold/p_energy_matrix.o: src/pairfold/p_hairpin_loop.h + src/pairfold/p_energy_matrix.o: src/pairfold/p_internal_loop.h + src/pairfold/p_energy_matrix.o: src/pairfold/p_multi_loop.h + src/pairfold/p_energy_matrix.o: src/pairfold/p_multi_loop_sub.h +-src/pairfold/p_internal_loop.o: /usr/include/stdio.h /usr/include/features.h +-src/pairfold/p_internal_loop.o: /usr/include/sys/cdefs.h +-src/pairfold/p_internal_loop.o: /usr/include/bits/wordsize.h +-src/pairfold/p_internal_loop.o: /usr/include/gnu/stubs.h +-src/pairfold/p_internal_loop.o: /usr/include/gnu/stubs-32.h +-src/pairfold/p_internal_loop.o: /usr/include/bits/types.h +-src/pairfold/p_internal_loop.o: /usr/include/bits/typesizes.h +-src/pairfold/p_internal_loop.o: /usr/include/libio.h /usr/include/_G_config.h +-src/pairfold/p_internal_loop.o: /usr/include/wchar.h +-src/pairfold/p_internal_loop.o: /usr/include/bits/wchar.h +-src/pairfold/p_internal_loop.o: /usr/include/gconv.h +-src/pairfold/p_internal_loop.o: /usr/include/bits/stdio_lim.h +-src/pairfold/p_internal_loop.o: /usr/include/bits/sys_errlist.h +-src/pairfold/p_internal_loop.o: /usr/include/string.h /usr/include/stdlib.h + src/pairfold/p_internal_loop.o: src/pairfold/p_internal_loop.h + src/pairfold/p_internal_loop.o: ./include/constants.h ./include/structs.h + src/pairfold/p_internal_loop.o: src/pairfold/p_energy_matrix.h +@@ -740,21 +429,8 @@ src/pairfold/p_internal_loop.o: ./src/simfold/s_multi_loop.h + src/pairfold/p_internal_loop.o: ./src/simfold/s_multi_loop_sub.h + src/pairfold/p_internal_loop.o: ./include/pairfold.h ./include/init.h + src/pairfold/p_internal_loop.o: src/pairfold/p_specific_functions.h +-src/pairfold/p_multi_loop.o: /usr/include/stdio.h /usr/include/features.h +-src/pairfold/p_multi_loop.o: /usr/include/sys/cdefs.h +-src/pairfold/p_multi_loop.o: /usr/include/bits/wordsize.h +-src/pairfold/p_multi_loop.o: /usr/include/gnu/stubs.h +-src/pairfold/p_multi_loop.o: /usr/include/gnu/stubs-32.h +-src/pairfold/p_multi_loop.o: /usr/include/bits/types.h +-src/pairfold/p_multi_loop.o: /usr/include/bits/typesizes.h +-src/pairfold/p_multi_loop.o: /usr/include/libio.h /usr/include/_G_config.h +-src/pairfold/p_multi_loop.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/pairfold/p_multi_loop.o: /usr/include/gconv.h +-src/pairfold/p_multi_loop.o: /usr/include/bits/stdio_lim.h +-src/pairfold/p_multi_loop.o: /usr/include/bits/sys_errlist.h +-src/pairfold/p_multi_loop.o: /usr/include/malloc.h ./include/externs.h +-src/pairfold/p_multi_loop.o: ./include/structs.h ./include/constants.h +-src/pairfold/p_multi_loop.o: src/common/common.h ++src/pairfold/p_multi_loop.o: ./include/externs.h ./include/structs.h ++src/pairfold/p_multi_loop.o: ./include/constants.h src/common/common.h + src/pairfold/p_multi_loop.o: ./src/simfold/s_partition_function.h + src/pairfold/p_multi_loop.o: ./src/simfold/s_hairpin_loop.h + src/pairfold/p_multi_loop.o: ./src/simfold/s_internal_loop.h +@@ -769,23 +445,8 @@ src/pairfold/p_multi_loop.o: src/pairfold/p_hairpin_loop.h + src/pairfold/p_multi_loop.o: src/pairfold/p_internal_loop.h + src/pairfold/p_multi_loop.o: src/pairfold/p_multi_loop_sub.h + src/pairfold/p_multi_loop.o: ./include/pairfold.h ./include/init.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/stdio.h /usr/include/features.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/sys/cdefs.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/bits/wordsize.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/gnu/stubs.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/gnu/stubs-32.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/bits/types.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/bits/typesizes.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/libio.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/_G_config.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/wchar.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/bits/wchar.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/gconv.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/bits/stdio_lim.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/bits/sys_errlist.h +-src/pairfold/p_multi_loop_sub.o: /usr/include/malloc.h ./include/externs.h +-src/pairfold/p_multi_loop_sub.o: ./include/structs.h ./include/constants.h +-src/pairfold/p_multi_loop_sub.o: src/common/common.h ++src/pairfold/p_multi_loop_sub.o: ./include/externs.h ./include/structs.h ++src/pairfold/p_multi_loop_sub.o: ./include/constants.h src/common/common.h + src/pairfold/p_multi_loop_sub.o: ./src/simfold/s_partition_function.h + src/pairfold/p_multi_loop_sub.o: ./src/simfold/s_hairpin_loop.h + src/pairfold/p_multi_loop_sub.o: ./src/simfold/s_internal_loop.h +@@ -801,20 +462,7 @@ src/pairfold/p_multi_loop_sub.o: src/pairfold/p_internal_loop.h + src/pairfold/p_multi_loop_sub.o: src/pairfold/p_multi_loop.h + src/pairfold/p_multi_loop_sub.o: ./include/pairfold.h ./include/init.h + src/pairfold/p_sub_folding.o: src/pairfold/p_sub_folding.h +-src/pairfold/p_sub_folding.o: /usr/include/stdio.h /usr/include/features.h +-src/pairfold/p_sub_folding.o: /usr/include/sys/cdefs.h +-src/pairfold/p_sub_folding.o: /usr/include/bits/wordsize.h +-src/pairfold/p_sub_folding.o: /usr/include/gnu/stubs.h +-src/pairfold/p_sub_folding.o: /usr/include/gnu/stubs-32.h +-src/pairfold/p_sub_folding.o: /usr/include/bits/types.h +-src/pairfold/p_sub_folding.o: /usr/include/bits/typesizes.h +-src/pairfold/p_sub_folding.o: /usr/include/libio.h /usr/include/_G_config.h +-src/pairfold/p_sub_folding.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/pairfold/p_sub_folding.o: /usr/include/gconv.h +-src/pairfold/p_sub_folding.o: /usr/include/bits/stdio_lim.h +-src/pairfold/p_sub_folding.o: /usr/include/bits/sys_errlist.h +-src/pairfold/p_sub_folding.o: /usr/include/string.h ./include/structs.h +-src/pairfold/p_sub_folding.o: ./include/constants.h ++src/pairfold/p_sub_folding.o: ./include/structs.h ./include/constants.h + src/pairfold/p_sub_folding.o: src/pairfold/p_energy_matrix.h + src/pairfold/p_sub_folding.o: src/pairfold/p_stacked_pair.h + src/pairfold/p_sub_folding.o: src/pairfold/p_hairpin_loop.h +@@ -830,27 +478,6 @@ src/pairfold/p_sub_folding.o: ./src/simfold/s_stacked_pair.h + src/pairfold/p_sub_folding.o: ./src/simfold/s_multi_loop.h + src/pairfold/p_sub_folding.o: ./src/simfold/s_multi_loop_sub.h + src/pairfold/p_sub_folding.o: ./include/pairfold.h ./include/init.h +-src/multifold/m_specific_functions.o: /usr/include/stdio.h +-src/multifold/m_specific_functions.o: /usr/include/features.h +-src/multifold/m_specific_functions.o: /usr/include/sys/cdefs.h +-src/multifold/m_specific_functions.o: /usr/include/bits/wordsize.h +-src/multifold/m_specific_functions.o: /usr/include/gnu/stubs.h +-src/multifold/m_specific_functions.o: /usr/include/gnu/stubs-32.h +-src/multifold/m_specific_functions.o: /usr/include/bits/types.h +-src/multifold/m_specific_functions.o: /usr/include/bits/typesizes.h +-src/multifold/m_specific_functions.o: /usr/include/libio.h +-src/multifold/m_specific_functions.o: /usr/include/_G_config.h +-src/multifold/m_specific_functions.o: /usr/include/wchar.h +-src/multifold/m_specific_functions.o: /usr/include/bits/wchar.h +-src/multifold/m_specific_functions.o: /usr/include/gconv.h +-src/multifold/m_specific_functions.o: /usr/include/bits/stdio_lim.h +-src/multifold/m_specific_functions.o: /usr/include/bits/sys_errlist.h +-src/multifold/m_specific_functions.o: /usr/include/stdlib.h +-src/multifold/m_specific_functions.o: /usr/include/math.h +-src/multifold/m_specific_functions.o: /usr/include/bits/huge_val.h +-src/multifold/m_specific_functions.o: /usr/include/bits/mathdef.h +-src/multifold/m_specific_functions.o: /usr/include/bits/mathcalls.h +-src/multifold/m_specific_functions.o: /usr/include/string.h + src/multifold/m_specific_functions.o: ./include/constants.h + src/multifold/m_specific_functions.o: ./include/structs.h ./include/externs.h + src/multifold/m_specific_functions.o: src/common/common.h +@@ -869,19 +496,6 @@ src/multifold/m_specific_functions.o: src/multifold/m_hairpin_loop.h + src/multifold/m_specific_functions.o: src/multifold/m_internal_loop.h + src/multifold/m_specific_functions.o: src/multifold/m_multi_loop.h + src/multifold/m_specific_functions.o: src/multifold/m_specific_functions.h +-src/multifold/m_min_folding.o: /usr/include/stdio.h /usr/include/features.h +-src/multifold/m_min_folding.o: /usr/include/sys/cdefs.h +-src/multifold/m_min_folding.o: /usr/include/bits/wordsize.h +-src/multifold/m_min_folding.o: /usr/include/gnu/stubs.h +-src/multifold/m_min_folding.o: /usr/include/gnu/stubs-32.h +-src/multifold/m_min_folding.o: /usr/include/bits/types.h +-src/multifold/m_min_folding.o: /usr/include/bits/typesizes.h +-src/multifold/m_min_folding.o: /usr/include/libio.h /usr/include/_G_config.h +-src/multifold/m_min_folding.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/multifold/m_min_folding.o: /usr/include/gconv.h +-src/multifold/m_min_folding.o: /usr/include/bits/stdio_lim.h +-src/multifold/m_min_folding.o: /usr/include/bits/sys_errlist.h +-src/multifold/m_min_folding.o: /usr/include/string.h + src/multifold/m_min_folding.o: src/multifold/m_min_folding.h + src/multifold/m_min_folding.o: ./include/structs.h ./include/constants.h + src/multifold/m_min_folding.o: src/multifold/m_energy_matrix.h +@@ -899,22 +513,8 @@ src/multifold/m_min_folding.o: ./src/simfold/s_multi_loop.h + src/multifold/m_min_folding.o: ./src/simfold/s_multi_loop_sub.h + src/multifold/m_min_folding.o: ./include/multifold.h ./include/init.h + src/multifold/m_min_folding.o: src/multifold/m_specific_functions.h +-src/multifold/m_hairpin_loop.o: /usr/include/string.h /usr/include/features.h +-src/multifold/m_hairpin_loop.o: /usr/include/sys/cdefs.h +-src/multifold/m_hairpin_loop.o: /usr/include/bits/wordsize.h +-src/multifold/m_hairpin_loop.o: /usr/include/gnu/stubs.h +-src/multifold/m_hairpin_loop.o: /usr/include/gnu/stubs-32.h + src/multifold/m_hairpin_loop.o: ./include/constants.h ./include/structs.h + src/multifold/m_hairpin_loop.o: ./include/externs.h src/common/common.h +-src/multifold/m_hairpin_loop.o: /usr/include/stdio.h +-src/multifold/m_hairpin_loop.o: /usr/include/bits/types.h +-src/multifold/m_hairpin_loop.o: /usr/include/bits/typesizes.h +-src/multifold/m_hairpin_loop.o: /usr/include/libio.h /usr/include/_G_config.h +-src/multifold/m_hairpin_loop.o: /usr/include/wchar.h +-src/multifold/m_hairpin_loop.o: /usr/include/bits/wchar.h +-src/multifold/m_hairpin_loop.o: /usr/include/gconv.h +-src/multifold/m_hairpin_loop.o: /usr/include/bits/stdio_lim.h +-src/multifold/m_hairpin_loop.o: /usr/include/bits/sys_errlist.h + src/multifold/m_hairpin_loop.o: ./src/simfold/s_partition_function.h + src/multifold/m_hairpin_loop.o: ./src/simfold/s_hairpin_loop.h + src/multifold/m_hairpin_loop.o: ./src/simfold/s_internal_loop.h +@@ -925,22 +525,8 @@ src/multifold/m_hairpin_loop.o: ./src/simfold/s_multi_loop_sub.h + src/multifold/m_hairpin_loop.o: ./include/multifold.h ./include/init.h + src/multifold/m_hairpin_loop.o: src/multifold/m_hairpin_loop.h + src/multifold/m_hairpin_loop.o: src/multifold/m_specific_functions.h +-src/multifold/m_stacked_pair.o: /usr/include/string.h /usr/include/features.h +-src/multifold/m_stacked_pair.o: /usr/include/sys/cdefs.h +-src/multifold/m_stacked_pair.o: /usr/include/bits/wordsize.h +-src/multifold/m_stacked_pair.o: /usr/include/gnu/stubs.h +-src/multifold/m_stacked_pair.o: /usr/include/gnu/stubs-32.h + src/multifold/m_stacked_pair.o: ./include/constants.h ./include/structs.h + src/multifold/m_stacked_pair.o: ./include/externs.h src/common/common.h +-src/multifold/m_stacked_pair.o: /usr/include/stdio.h +-src/multifold/m_stacked_pair.o: /usr/include/bits/types.h +-src/multifold/m_stacked_pair.o: /usr/include/bits/typesizes.h +-src/multifold/m_stacked_pair.o: /usr/include/libio.h /usr/include/_G_config.h +-src/multifold/m_stacked_pair.o: /usr/include/wchar.h +-src/multifold/m_stacked_pair.o: /usr/include/bits/wchar.h +-src/multifold/m_stacked_pair.o: /usr/include/gconv.h +-src/multifold/m_stacked_pair.o: /usr/include/bits/stdio_lim.h +-src/multifold/m_stacked_pair.o: /usr/include/bits/sys_errlist.h + src/multifold/m_stacked_pair.o: ./src/simfold/s_partition_function.h + src/multifold/m_stacked_pair.o: ./src/simfold/s_hairpin_loop.h + src/multifold/m_stacked_pair.o: ./src/simfold/s_internal_loop.h +@@ -955,24 +541,8 @@ src/multifold/m_stacked_pair.o: src/multifold/m_hairpin_loop.h + src/multifold/m_stacked_pair.o: src/multifold/m_internal_loop.h + src/multifold/m_stacked_pair.o: src/multifold/m_multi_loop.h + src/multifold/m_stacked_pair.o: src/multifold/m_specific_functions.h +-src/multifold/m_energy_matrix.o: /usr/include/stdio.h /usr/include/features.h +-src/multifold/m_energy_matrix.o: /usr/include/sys/cdefs.h +-src/multifold/m_energy_matrix.o: /usr/include/bits/wordsize.h +-src/multifold/m_energy_matrix.o: /usr/include/gnu/stubs.h +-src/multifold/m_energy_matrix.o: /usr/include/gnu/stubs-32.h +-src/multifold/m_energy_matrix.o: /usr/include/bits/types.h +-src/multifold/m_energy_matrix.o: /usr/include/bits/typesizes.h +-src/multifold/m_energy_matrix.o: /usr/include/libio.h +-src/multifold/m_energy_matrix.o: /usr/include/_G_config.h +-src/multifold/m_energy_matrix.o: /usr/include/wchar.h +-src/multifold/m_energy_matrix.o: /usr/include/bits/wchar.h +-src/multifold/m_energy_matrix.o: /usr/include/gconv.h +-src/multifold/m_energy_matrix.o: /usr/include/bits/stdio_lim.h +-src/multifold/m_energy_matrix.o: /usr/include/bits/sys_errlist.h +-src/multifold/m_energy_matrix.o: /usr/include/string.h /usr/include/stdlib.h +-src/multifold/m_energy_matrix.o: /usr/include/malloc.h ./include/constants.h +-src/multifold/m_energy_matrix.o: ./include/structs.h ./include/externs.h +-src/multifold/m_energy_matrix.o: src/common/common.h ++src/multifold/m_energy_matrix.o: ./include/constants.h ./include/structs.h ++src/multifold/m_energy_matrix.o: ./include/externs.h src/common/common.h + src/multifold/m_energy_matrix.o: ./src/simfold/s_partition_function.h + src/multifold/m_energy_matrix.o: ./src/simfold/s_hairpin_loop.h + src/multifold/m_energy_matrix.o: ./src/simfold/s_internal_loop.h +@@ -986,21 +556,6 @@ src/multifold/m_energy_matrix.o: src/multifold/m_stacked_pair.h + src/multifold/m_energy_matrix.o: src/multifold/m_hairpin_loop.h + src/multifold/m_energy_matrix.o: src/multifold/m_internal_loop.h + src/multifold/m_energy_matrix.o: src/multifold/m_multi_loop.h +-src/multifold/m_internal_loop.o: /usr/include/stdio.h /usr/include/features.h +-src/multifold/m_internal_loop.o: /usr/include/sys/cdefs.h +-src/multifold/m_internal_loop.o: /usr/include/bits/wordsize.h +-src/multifold/m_internal_loop.o: /usr/include/gnu/stubs.h +-src/multifold/m_internal_loop.o: /usr/include/gnu/stubs-32.h +-src/multifold/m_internal_loop.o: /usr/include/bits/types.h +-src/multifold/m_internal_loop.o: /usr/include/bits/typesizes.h +-src/multifold/m_internal_loop.o: /usr/include/libio.h +-src/multifold/m_internal_loop.o: /usr/include/_G_config.h +-src/multifold/m_internal_loop.o: /usr/include/wchar.h +-src/multifold/m_internal_loop.o: /usr/include/bits/wchar.h +-src/multifold/m_internal_loop.o: /usr/include/gconv.h +-src/multifold/m_internal_loop.o: /usr/include/bits/stdio_lim.h +-src/multifold/m_internal_loop.o: /usr/include/bits/sys_errlist.h +-src/multifold/m_internal_loop.o: /usr/include/string.h /usr/include/stdlib.h + src/multifold/m_internal_loop.o: src/multifold/m_internal_loop.h + src/multifold/m_internal_loop.o: ./include/constants.h ./include/structs.h + src/multifold/m_internal_loop.o: src/multifold/m_energy_matrix.h +@@ -1017,21 +572,8 @@ src/multifold/m_internal_loop.o: ./src/simfold/s_multi_loop.h + src/multifold/m_internal_loop.o: ./src/simfold/s_multi_loop_sub.h + src/multifold/m_internal_loop.o: ./include/multifold.h ./include/init.h + src/multifold/m_internal_loop.o: src/multifold/m_specific_functions.h +-src/multifold/m_multi_loop.o: /usr/include/stdio.h /usr/include/features.h +-src/multifold/m_multi_loop.o: /usr/include/sys/cdefs.h +-src/multifold/m_multi_loop.o: /usr/include/bits/wordsize.h +-src/multifold/m_multi_loop.o: /usr/include/gnu/stubs.h +-src/multifold/m_multi_loop.o: /usr/include/gnu/stubs-32.h +-src/multifold/m_multi_loop.o: /usr/include/bits/types.h +-src/multifold/m_multi_loop.o: /usr/include/bits/typesizes.h +-src/multifold/m_multi_loop.o: /usr/include/libio.h /usr/include/_G_config.h +-src/multifold/m_multi_loop.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-src/multifold/m_multi_loop.o: /usr/include/gconv.h +-src/multifold/m_multi_loop.o: /usr/include/bits/stdio_lim.h +-src/multifold/m_multi_loop.o: /usr/include/bits/sys_errlist.h +-src/multifold/m_multi_loop.o: /usr/include/malloc.h ./include/externs.h +-src/multifold/m_multi_loop.o: ./include/structs.h ./include/constants.h +-src/multifold/m_multi_loop.o: src/common/common.h ++src/multifold/m_multi_loop.o: ./include/externs.h ./include/structs.h ++src/multifold/m_multi_loop.o: ./include/constants.h src/common/common.h + src/multifold/m_multi_loop.o: ./src/simfold/s_partition_function.h + src/multifold/m_multi_loop.o: ./src/simfold/s_hairpin_loop.h + src/multifold/m_multi_loop.o: ./src/simfold/s_internal_loop.h +@@ -1046,68 +588,31 @@ src/multifold/m_multi_loop.o: src/multifold/m_hairpin_loop.h + src/multifold/m_multi_loop.o: src/multifold/m_internal_loop.h + src/multifold/m_multi_loop.o: ./include/multifold.h ./include/init.h + src/multifold/m_multi_loop.o: src/multifold/m_specific_functions.h +-simfold.o: /usr/include/stdio.h /usr/include/features.h +-simfold.o: /usr/include/sys/cdefs.h /usr/include/bits/wordsize.h +-simfold.o: /usr/include/gnu/stubs.h /usr/include/gnu/stubs-32.h +-simfold.o: /usr/include/bits/types.h /usr/include/bits/typesizes.h +-simfold.o: /usr/include/libio.h /usr/include/_G_config.h /usr/include/wchar.h +-simfold.o: /usr/include/bits/wchar.h /usr/include/gconv.h +-simfold.o: /usr/include/bits/stdio_lim.h /usr/include/bits/sys_errlist.h +-simfold.o: /usr/include/string.h /usr/include/stdlib.h /usr/include/time.h +-simfold.o: /usr/include/bits/time.h /usr/include/unistd.h +-simfold.o: /usr/include/bits/posix_opt.h /usr/include/bits/confname.h + simfold.o: ./include/simfold.h ./include/constants.h ./include/init.h + simfold.o: ./include/externs.h ./include/structs.h src/common/params.h +-simfold_pf.o: /usr/include/stdio.h /usr/include/features.h +-simfold_pf.o: /usr/include/sys/cdefs.h /usr/include/bits/wordsize.h +-simfold_pf.o: /usr/include/gnu/stubs.h /usr/include/gnu/stubs-32.h +-simfold_pf.o: /usr/include/bits/types.h /usr/include/bits/typesizes.h +-simfold_pf.o: /usr/include/libio.h /usr/include/_G_config.h +-simfold_pf.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-simfold_pf.o: /usr/include/gconv.h /usr/include/bits/stdio_lim.h +-simfold_pf.o: /usr/include/bits/sys_errlist.h /usr/include/string.h +-simfold_pf.o: /usr/include/stdlib.h /usr/include/time.h +-simfold_pf.o: /usr/include/bits/time.h /usr/include/unistd.h +-simfold_pf.o: /usr/include/bits/posix_opt.h /usr/include/bits/confname.h ++simfold.o: ./src/simfold/s_partition_function.h ++simfold.o: ./src/simfold/s_hairpin_loop.h ./src/simfold/s_internal_loop.h ++simfold.o: ./src/simfold/s_energy_matrix.h ./src/simfold/s_stacked_pair.h ++simfold.o: ./src/simfold/s_multi_loop.h ./src/simfold/s_multi_loop_sub.h ++simfold.o: src/common/common.h + simfold_pf.o: ./include/simfold.h ./include/constants.h ./include/init.h + simfold_pf.o: ./include/externs.h ./include/structs.h src/common/params.h + simfold_pf.o: ./src/simfold/s_partition_function.h + simfold_pf.o: ./src/simfold/s_hairpin_loop.h ./src/simfold/s_internal_loop.h + simfold_pf.o: ./src/simfold/s_energy_matrix.h ./src/simfold/s_stacked_pair.h + simfold_pf.o: ./src/simfold/s_multi_loop.h ./src/simfold/s_multi_loop_sub.h +-pairfold.o: /usr/include/stdio.h /usr/include/features.h +-pairfold.o: /usr/include/sys/cdefs.h /usr/include/bits/wordsize.h +-pairfold.o: /usr/include/gnu/stubs.h /usr/include/gnu/stubs-32.h +-pairfold.o: /usr/include/bits/types.h /usr/include/bits/typesizes.h +-pairfold.o: /usr/include/libio.h /usr/include/_G_config.h +-pairfold.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-pairfold.o: /usr/include/gconv.h /usr/include/bits/stdio_lim.h +-pairfold.o: /usr/include/bits/sys_errlist.h /usr/include/string.h +-pairfold.o: /usr/include/stdlib.h /usr/include/time.h +-pairfold.o: /usr/include/bits/time.h ./include/pairfold.h +-pairfold.o: ./include/constants.h ./include/init.h ./include/externs.h +-pairfold.o: ./include/structs.h src/common/timer.h /usr/include/sys/times.h +-pairfold.o: /usr/include/limits.h +-multifold.o: /usr/include/stdio.h /usr/include/features.h +-multifold.o: /usr/include/sys/cdefs.h /usr/include/bits/wordsize.h +-multifold.o: /usr/include/gnu/stubs.h /usr/include/gnu/stubs-32.h +-multifold.o: /usr/include/bits/types.h /usr/include/bits/typesizes.h +-multifold.o: /usr/include/libio.h /usr/include/_G_config.h +-multifold.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-multifold.o: /usr/include/gconv.h /usr/include/bits/stdio_lim.h +-multifold.o: /usr/include/bits/sys_errlist.h /usr/include/string.h +-multifold.o: /usr/include/stdlib.h ./include/multifold.h +-multifold.o: ./include/constants.h ./include/init.h ./include/externs.h +-multifold.o: ./include/structs.h +-test_get_counts.o: /usr/include/stdio.h /usr/include/features.h +-test_get_counts.o: /usr/include/sys/cdefs.h /usr/include/bits/wordsize.h +-test_get_counts.o: /usr/include/gnu/stubs.h /usr/include/gnu/stubs-32.h +-test_get_counts.o: /usr/include/bits/types.h /usr/include/bits/typesizes.h +-test_get_counts.o: /usr/include/libio.h /usr/include/_G_config.h +-test_get_counts.o: /usr/include/wchar.h /usr/include/bits/wchar.h +-test_get_counts.o: /usr/include/gconv.h /usr/include/bits/stdio_lim.h +-test_get_counts.o: /usr/include/bits/sys_errlist.h /usr/include/string.h +-test_get_counts.o: /usr/include/stdlib.h /usr/include/time.h +-test_get_counts.o: /usr/include/bits/time.h ./include/simfold.h +-test_get_counts.o: ./include/constants.h ./include/init.h ./include/externs.h +-test_get_counts.o: ./include/structs.h src/common/params.h ++pairfold.o: ./include/pairfold.h ./include/constants.h ./include/init.h ++pairfold.o: ./include/externs.h ./include/structs.h src/common/timer.h ++multifold.o: ./include/multifold.h ./include/constants.h ./include/init.h ++multifold.o: ./include/externs.h ./include/structs.h ++feature_description.o: ./include/simfold.h ./include/constants.h ++feature_description.o: ./include/init.h ./include/externs.h ++feature_description.o: ./include/structs.h src/common/params.h ++feature_description.o: src/common/common.h ++feature_description.o: ./src/simfold/s_partition_function.h ++feature_description.o: ./src/simfold/s_hairpin_loop.h ++feature_description.o: ./src/simfold/s_internal_loop.h ++feature_description.o: ./src/simfold/s_energy_matrix.h ++feature_description.o: ./src/simfold/s_stacked_pair.h ++feature_description.o: ./src/simfold/s_multi_loop.h ++feature_description.o: ./src/simfold/s_multi_loop_sub.h diff --git a/recipes/multirnafold/0002-FIX-printf-missing-arg.patch b/recipes/multirnafold/0002-FIX-printf-missing-arg.patch new file mode 100644 index 0000000000000..471631385a018 --- /dev/null +++ b/recipes/multirnafold/0002-FIX-printf-missing-arg.patch @@ -0,0 +1,26 @@ +diff --git a/simfold.cpp b/simfold.cpp +index 08cffe2..0ca03e3 100644 +--- a/simfold.cpp ++++ b/simfold.cpp +@@ -64,7 +64,7 @@ void usage (const char *prog) + printf ("Examples:\n"); + printf ("\t%s -s \"GCAACGAUGACAUACAUCGCUAGUCGACGC\" -n 10 \n", prog); + printf ("\t%s -s \"GCAACGAUGACAUACAUCGCUAGUCGACGC\" -n 10 -r \"(____________________________)\"\n", prog); +- printf ("\t%s -s \"GCAACGAUGACAUACAUCGCUAGUCGACGC\" -p params/CG_best_parameters_ISMB2007.txt\n"); ++ printf ("\t%s -s \"GCAACGAUGACAUACAUCGCUAGUCGACGC\" -p params/CG_best_parameters_ISMB2007.txt\n", prog); + exit (0); + } + +diff --git a/simfold_pf.cpp b/simfold_pf.cpp +index e3ba56e..424ee85 100644 +--- a/simfold_pf.cpp ++++ b/simfold_pf.cpp +@@ -35,7 +35,7 @@ void usage (const char *prog) + printf ("Examples:\n"); + printf ("\t%s -s \"GCAACGAUGACAUACAUCGCUAGUCGACGC\"\n", prog); + printf ("\t%s -s \"GCAACGAUGACAUACAUCGCUAGUCGACGC\" -t 0.5\n", prog); +- printf ("\t%s -s \"GCAACGAUGACAUACAUCGCUAGUCGACGC\" -p params/CG_best_parameters_ISMB2007.txt\n"); ++ printf ("\t%s -s \"GCAACGAUGACAUACAUCGCUAGUCGACGC\" -p params/CG_best_parameters_ISMB2007.txt\n", prog); + exit (0); + } + diff --git a/recipes/multirnafold/0003-FIX-remove-unneeded-include.patch b/recipes/multirnafold/0003-FIX-remove-unneeded-include.patch new file mode 100644 index 0000000000000..51509cbcf874a --- /dev/null +++ b/recipes/multirnafold/0003-FIX-remove-unneeded-include.patch @@ -0,0 +1,126 @@ +commit 625122c01dbf740131c2419a5d2bfd65d8d315d8 +Author: Marco Matthies <71844+marcom@users.noreply.github.com> +Date: Thu Feb 8 16:12:41 2024 +0100 + + Remove unneeded include of malloc.h + +diff --git a/src/multifold/m_energy_matrix.cpp b/src/multifold/m_energy_matrix.cpp +index 4d47d90..4030513 100644 +--- a/src/multifold/m_energy_matrix.cpp ++++ b/src/multifold/m_energy_matrix.cpp +@@ -18,7 +18,6 @@ + #include + #include + #include +-#include + + #include "constants.h" + #include "structs.h" +diff --git a/src/multifold/m_multi_loop.cpp b/src/multifold/m_multi_loop.cpp +index a017da8..382d57a 100644 +--- a/src/multifold/m_multi_loop.cpp ++++ b/src/multifold/m_multi_loop.cpp +@@ -16,7 +16,6 @@ + ***************************************************************************/ + + #include +-#include + + #include "externs.h" + #include "common.h" +diff --git a/src/pairfold/p_energy_matrix.cpp b/src/pairfold/p_energy_matrix.cpp +index 42c15c2..dc23e29 100644 +--- a/src/pairfold/p_energy_matrix.cpp ++++ b/src/pairfold/p_energy_matrix.cpp +@@ -18,7 +18,6 @@ + #include + #include + #include +-#include + + #include "constants.h" + #include "structs.h" +diff --git a/src/pairfold/p_multi_loop.cpp b/src/pairfold/p_multi_loop.cpp +index f562ce0..267035a 100644 +--- a/src/pairfold/p_multi_loop.cpp ++++ b/src/pairfold/p_multi_loop.cpp +@@ -16,7 +16,6 @@ + ***************************************************************************/ + + #include +-#include + + #include "externs.h" + #include "common.h" +diff --git a/src/pairfold/p_multi_loop_sub.cpp b/src/pairfold/p_multi_loop_sub.cpp +index 467fb53..a418218 100644 +--- a/src/pairfold/p_multi_loop_sub.cpp ++++ b/src/pairfold/p_multi_loop_sub.cpp +@@ -16,7 +16,6 @@ + ***************************************************************************/ + + #include +-#include + + #include "externs.h" + #include "common.h" +diff --git a/src/simfold/s_energy_matrix.cpp b/src/simfold/s_energy_matrix.cpp +index cafc1d7..ce09162 100644 +--- a/src/simfold/s_energy_matrix.cpp ++++ b/src/simfold/s_energy_matrix.cpp +@@ -20,7 +20,6 @@ + #include + #include + #include +-#include + + #include "constants.h" + #include "structs.h" +diff --git a/src/simfold/s_multi_loop.cpp b/src/simfold/s_multi_loop.cpp +index 6c5998a..de7991e 100644 +--- a/src/simfold/s_multi_loop.cpp ++++ b/src/simfold/s_multi_loop.cpp +@@ -18,7 +18,6 @@ + // The main class for multi-loop related functions, the mfe case + + #include +-#include + + #include "externs.h" + #include "common.h" +diff --git a/src/simfold/s_multi_loop_sub.cpp b/src/simfold/s_multi_loop_sub.cpp +index e8f5219..bbdeb98 100644 +--- a/src/simfold/s_multi_loop_sub.cpp ++++ b/src/simfold/s_multi_loop_sub.cpp +@@ -18,7 +18,6 @@ + // this class represents multi-loops for suboptimal pairfold, it implements the Wuchty complete suboptimal paper + + #include +-#include + + #include "externs.h" + #include "common.h" +diff --git a/src/simfold/s_partition_function.cpp b/src/simfold/s_partition_function.cpp +index c551b6d..c63e8b4 100644 +--- a/src/simfold/s_partition_function.cpp ++++ b/src/simfold/s_partition_function.cpp +@@ -18,7 +18,6 @@ + #include + #include + #include +-#include + #include + #include + +diff --git a/src/simfold/s_partition_function_complex.cpp b/src/simfold/s_partition_function_complex.cpp +index 2654f25..2fb2a00 100644 +--- a/src/simfold/s_partition_function_complex.cpp ++++ b/src/simfold/s_partition_function_complex.cpp +@@ -18,7 +18,6 @@ + #include + #include + #include +-#include + #include + #include + diff --git a/recipes/multirnafold/build.sh b/recipes/multirnafold/build.sh new file mode 100644 index 0000000000000..1a10377f73b68 --- /dev/null +++ b/recipes/multirnafold/build.sh @@ -0,0 +1,13 @@ +# build +make CC="${CC}" CXX="${CXX}" + +# install +mkdir -p "$PREFIX/bin" +mkdir -p "$PREFIX/shared/${PKG_NAME}/params" +mkdir -p "$PREFIX/include" +mkdir -p "$PREFIX/lib" + +cp feature_description multifold pairfold pairfold-web simfold simfold_pf "$PREFIX/bin/" +cp -r params/* "$PREFIX/shared/${PKG_NAME}/params/" +cp -r include/* "$PREFIX/include/" +cp libMultiRNAFold.a "$PREFIX/lib/" diff --git a/recipes/multirnafold/meta.yaml b/recipes/multirnafold/meta.yaml new file mode 100644 index 0000000000000..ad45a1c49cb85 --- /dev/null +++ b/recipes/multirnafold/meta.yaml @@ -0,0 +1,43 @@ +{% set name = "MultiRNAFold" %} +{% set version = "2.1" %} +{% set sha256 = "cb5462e03c70da24caaa9706f493fa329b1e15f697fbffd5bf460cd873243306" %} + +package: + name: {{ name | lower }} + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage(name | lower, max_pin="x.x") }} + +source: + url: http://www.rnasoft.ca/download/MultiRNAFold-{{ version }}.tar.gz + sha256: {{ sha256 }} + patches: + - 0001-FIX-Makefile.patch + - 0002-FIX-printf-missing-arg.patch + - 0003-FIX-remove-unneeded-include.patch + +requirements: + build: + - make + - {{ compiler('cxx') }} + +test: + commands: + - "test -x $PREFIX/bin/feature_description" + - "test -x $PREFIX/bin/multifold" + - "test -x $PREFIX/bin/pairfold" + - "test -x $PREFIX/bin/pairfold-web" + - "test -x $PREFIX/bin/simfold" + - "test -x $PREFIX/bin/simfold_pf" + - "pairfold -h" + - "simfold -h" + - "simfold_pf -h" + - "multifold -h" + +about: + home: http://www.rnasoft.ca/download/README.html + license: GPL-2.0-or-later + summary: 'RNA/DNA secondary structure prediction for one, two, or many interacting strands' diff --git a/recipes/mummer/meta.yaml b/recipes/mummer/meta.yaml index 2083f64a19486..3d57b44f09bfa 100644 --- a/recipes/mummer/meta.yaml +++ b/recipes/mummer/meta.yaml @@ -13,8 +13,10 @@ source: - patches/gnuplot_mouse_clipboardformat.patch build: - number: 16 + number: 17 skip: True # [osx] + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} requirements: build: @@ -48,5 +50,7 @@ about: summary: "MUMmer is a system for rapidly aligning entire genomes" extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:mummer diff --git a/recipes/muscle/0001-Replace-zero-macro-with-memset_zero.patch b/recipes/muscle/0001-Replace-zero-macro-with-memset_zero.patch deleted file mode 100644 index 95ba295a88c8d..0000000000000 --- a/recipes/muscle/0001-Replace-zero-macro-with-memset_zero.patch +++ /dev/null @@ -1,94 +0,0 @@ -From e2fc2cc23a2acbee4d9c7d0eeae289024432feec Mon Sep 17 00:00:00 2001 -From: Nicola Soranzo -Date: Thu, 10 Feb 2022 01:31:21 +0000 -Subject: [PATCH 1/2] Replace `zero` macro with `memset_zero` - -The `zero` and `memset_zero` macros defined in `myutils.h` are the same, but -`zero` interferes with LLVM's libcxx when compiling on macOS using Clang: - -In file included from addconfseq.cpp:1: -In file included from ./muscle.h:23: -In file included from ./multisequence.h:4: -In file included from ./sequence.h:6: -In file included from /usr/local/miniconda/envs/bioconda/conda-bld/muscle_1644453677064/_build_env/bin/../include/c++/v1/fstream:184: -In file included from /usr/local/miniconda/envs/bioconda/conda-bld/muscle_1644453677064/_build_env/bin/../include/c++/v1/ostream:137: -In file included from /usr/local/miniconda/envs/bioconda/conda-bld/muscle_1644453677064/_build_env/bin/../include/c++/v1/ios:215: -In file included from /usr/local/miniconda/envs/bioconda/conda-bld/muscle_1644453677064/_build_env/bin/../include/c++/v1/__locale:18: -In file included from /usr/local/miniconda/envs/bioconda/conda-bld/muscle_1644453677064/_build_env/bin/../include/c++/v1/mutex:190: -/usr/local/miniconda/envs/bioconda/conda-bld/muscle_1644453677064/_build_env/bin/../include/c++/v1/__mutex_base:447:25: error: too few arguments provided to function-like macro invocation - if (__d <= __d.zero()) - ^ -./myutils.h:361:9: note: macro 'zero' defined here -> #define zero(a, n) memset((a), 0, (n)*sizeof(a[0])) - ^ -1 error generated. -make: *** [Makefile:53: Darwin/addconfseq.o] Error 1 - -This is the call to `zero` in libcxx: - -https://github.com/llvm/llvm-project/blob/b35be6fe98e30b2373e8fdf024ef8c13a32121d7/libcxx/include/__mutex_base#L444 - -which is supposed to call: - -https://en.cppreference.com/w/cpp/chrono/duration/zero ---- - src/countsort.h | 2 +- - src/ensemble.cpp | 2 +- - src/myutils.cpp | 2 +- - src/myutils.h | 1 - - 4 files changed, 3 insertions(+), 4 deletions(-) - -diff --git a/src/countsort.h b/src/countsort.h -index 3f8d3f7..61b76e6 100644 ---- a/src/countsort.h -+++ b/src/countsort.h -@@ -20,7 +20,7 @@ public: - CountSortMem() - { - m_MaxValueCount = 0; -- zero(m_Vecs, NVEC); -+ memset_zero(m_Vecs, NVEC); - } - - void Free() -diff --git a/src/ensemble.cpp b/src/ensemble.cpp -index 7382db2..331f5f7 100644 ---- a/src/ensemble.cpp -+++ b/src/ensemble.cpp -@@ -41,7 +41,7 @@ void Ensemble::SortMSA(MSA &M) - M.GetLabelToSeqIndex(Labels2, LabelToSeqIndex2); - - char **szSeqsSorted = myalloc(char *, SeqCount); -- zero(szSeqsSorted, SeqCount); -+ memset_zero(szSeqsSorted, SeqCount); - for (uint SeqIndex = 0; SeqIndex < SeqCount; ++SeqIndex) - { - const string &Label = Labels2[SeqIndex]; -diff --git a/src/myutils.cpp b/src/myutils.cpp -index 8eca591..9d7d53c 100644 ---- a/src/myutils.cpp -+++ b/src/myutils.cpp -@@ -807,7 +807,7 @@ static char *GetThreadStr() - { - unsigned NewThreadStrCount = ThreadIndex + 4; - char **NewThreadStrs = myalloc(char *, NewThreadStrCount); -- zero(NewThreadStrs, NewThreadStrCount); -+ memset_zero(NewThreadStrs, NewThreadStrCount); - if (g_ThreadStrCount > 0) - memcpy(NewThreadStrs, g_ThreadStrs, g_ThreadStrCount*sizeof(char *)); - g_ThreadStrs = NewThreadStrs; -diff --git a/src/myutils.h b/src/myutils.h -index d242607..49d28ef 100644 ---- a/src/myutils.h -+++ b/src/myutils.h -@@ -358,7 +358,6 @@ inline bool feq(double x, double y) - #define asserteq(x, y) assert(feq(x, y)) - #define assertaeq(x, y) asserta(feq(x, y)) - --#define zero(a, n) memset((a), 0, (n)*sizeof(a[0])) - #define memset_zero(a, n) memset((a), 0, (n)*sizeof(a[0])) - - void ResetRand(unsigned Seed); --- -2.25.1 - diff --git a/recipes/muscle/0002-Move-va_start-va_end-out-of-critical-section.patch b/recipes/muscle/0002-Move-va_start-va_end-out-of-critical-section.patch deleted file mode 100644 index 5f9236c4b0234..0000000000000 --- a/recipes/muscle/0002-Move-va_start-va_end-out-of-critical-section.patch +++ /dev/null @@ -1,57 +0,0 @@ -From 02f38400c37f54d31b9be31aaa25ee11110cb5f6 Mon Sep 17 00:00:00 2001 -From: Nicola Soranzo -Date: Thu, 10 Feb 2022 03:31:26 +0000 -Subject: [PATCH 2/2] Move va_start/va_end out of critical section - -Fix the following error when compiling with Clang++: - -``` -myutils.cpp:912:2: error: 'va_start' cannot be used in a captured statement - va_start(ArgList, Format); - ^ -1 error generated. -make: *** [Makefile:53: Darwin/myutils.o] Error 1 -``` - -Solution inspired by: - -https://github.com/Ultimaker/CuraEngine/pull/1124 ---- - src/myutils.cpp | 6 +++--- - 1 file changed, 3 insertions(+), 3 deletions(-) - -diff --git a/src/myutils.cpp b/src/myutils.cpp -index 9d7d53c..ccc4fa3 100644 ---- a/src/myutils.cpp -+++ b/src/myutils.cpp -@@ -898,6 +898,8 @@ void Log(const char *Format, ...) - - void Die_(const char *Format, ...) - { -+ va_list ArgList; -+ va_start(ArgList, Format); - #pragma omp critical - { - static bool InDie = false; -@@ -908,10 +910,7 @@ void Die_(const char *Format, ...) - - if (g_fLog != 0) - setbuf(g_fLog, 0); -- va_list ArgList; -- va_start(ArgList, Format); - myvstrprintf(Msg, Format, ArgList); -- va_end(ArgList); - - fprintf(stderr, "\n\n"); - Log("\n"); -@@ -944,6 +943,7 @@ void Die_(const char *Format, ...) - - exit(1); - } -+ va_end(ArgList); - } - - void Warning_(const char *Format, ...) --- -2.25.1 - diff --git a/recipes/muscle/meta.yaml b/recipes/muscle/meta.yaml index 6d0cee1af6e6d..16e21de4c8ff2 100644 --- a/recipes/muscle/meta.yaml +++ b/recipes/muscle/meta.yaml @@ -1,19 +1,21 @@ {% set name = "muscle" %} -{% set version = "5.1" %} +{% set version = "5.1.0" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://github.com/rcedgar/muscle/archive/refs/tags/v{{ version }}.tar.gz - sha256: 091d9f8733b92ff106c2a8eb274d1e5a57960d397a2068d8638d6002e8880dab + url: https://github.com/rcedgar/muscle/archive/refs/tags/{{ version }}.tar.gz + sha256: 2bba8b06e3ccabf6465fa26f459763b2029d7e7b9596881063e3aaba60d9e87d patches: - - 0001-Replace-zero-macro-with-memset_zero.patch - - 0002-Move-va_start-va_end-out-of-critical-section.patch + - support-linux-aarch64.patch build: - number: 3 + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} + requirements: build: @@ -31,5 +33,7 @@ about: summary: "MUSCLE: multiple sequence alignment with high accuracy and high throughput" extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:muscle diff --git a/recipes/muscle/support-linux-aarch64.patch b/recipes/muscle/support-linux-aarch64.patch new file mode 100644 index 0000000000000..9308bf3333e2b --- /dev/null +++ b/recipes/muscle/support-linux-aarch64.patch @@ -0,0 +1,13 @@ +diff --git i/src/myutils.h w/src/myutils.h +index 49d28ef..8e8167e 100644 +--- i/src/myutils.h ++++ w/src/myutils.h +@@ -11,7 +11,7 @@ + #define TRACK_ALLOC 0 + #define ALLOC_TOTALS 0 + +-#if defined(__x86_64__) || defined(_M_X64) || defined(__arm64__) ++#if defined(__x86_64__) || defined(_M_X64) || defined(__arm64__) || defined(__aarch64__) + #define BITS 64 + #else + #define BITS 32 diff --git a/recipes/nanocaller/meta.yaml b/recipes/nanocaller/meta.yaml index c0060cef2152f..46a4efde3bf6e 100644 --- a/recipes/nanocaller/meta.yaml +++ b/recipes/nanocaller/meta.yaml @@ -1,5 +1,5 @@ {% set name = "nanocaller" %} -{% set version = "3.4.1" %} +{% set version = "3.6.0" %} package: name: {{ name }} @@ -7,11 +7,13 @@ package: source: url: https://github.com/WGLab/NanoCaller/archive/refs/tags/v{{ version }}.zip - sha256: bce44e9a1c33c929032312e506fab64b3b9186e200be2de58db91913e5728faf + sha256: 63acb2fd97bef760f9fd8a06021dd1a0865e6b9d22b461d3bd58acc4028d9c31 build: number: 0 noarch: generic + run_exports: + - {{ pin_subpackage('nanocaller', max_pin="x") }} requirements: run: @@ -23,8 +25,8 @@ requirements: - tensorflow >=2.4 - pysam - intervaltree - - muscle >=3.8, <4 - - whatshap >=1.4 + - muscle >=3.8,<4 + - whatshap >=2.2 - parasail-python - tqdm - rtg-tools diff --git a/recipes/nanoinsight/LICENSE.txt b/recipes/nanoinsight/LICENSE.txt new file mode 100644 index 0000000000000..f288702d2fa16 --- /dev/null +++ b/recipes/nanoinsight/LICENSE.txt @@ -0,0 +1,674 @@ + GNU GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU General Public License is a free, copyleft license for +software and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. We, the Free Software Foundation, use the +GNU General Public License for most of our software; it applies also to +any other work released this way by its authors. You can apply it to +your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you have +certain responsibilities if you distribute copies of the software, or if +you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the manufacturer +can do so. This is fundamentally incompatible with the aim of +protecting users' freedom to change the software. The systematic +pattern of such abuse occurs in the area of products for individuals to +use, which is precisely where it is most unacceptable. Therefore, we +have designed this version of the GPL to prohibit the practice for those +products. If such problems arise substantially in other domains, we +stand ready to extend this provision to those domains in future versions +of the GPL, as needed to protect the freedom of users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU Affero General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the special requirements of the GNU Affero General Public License, +section 13, concerning interaction through a network will apply to the +combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU General Public License from time to time. Such new versions will +be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + + Copyright (C) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see . + +Also add information on how to contact you by electronic and paper mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + Copyright (C) + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + +The hypothetical commands `show w' and `show c' should show the appropriate +parts of the General Public License. Of course, your program's commands +might be different; for a GUI interface, you would use an "about box". + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU GPL, see +. + + The GNU General Public License does not permit incorporating your program +into proprietary programs. If your program is a subroutine library, you +may consider it more useful to permit linking proprietary applications with +the library. If this is what you want to do, use the GNU Lesser General +Public License instead of this License. But first, please read +. diff --git a/recipes/nanoinsight/meta.yaml b/recipes/nanoinsight/meta.yaml new file mode 100644 index 0000000000000..881ab16d68a82 --- /dev/null +++ b/recipes/nanoinsight/meta.yaml @@ -0,0 +1,44 @@ +{% set name = "nanoinsight" %} +{% set version = "0.0.3" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/nanoinsight-{{ version }}.tar.gz + sha256: a0ca0076fc6cbf11f6460d48ba3a07a97fea01f77282e70da2e992df97afc3c9 + +build: + entry_points: + - nanoinsight=nanoinsight.nanoinsight:main + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage('nanoinsight', max_pin="x.x") }} + +requirements: + host: + - python >=3.8 + - pip + run: + - python >=3.8 + - biopython >=1.82 + - scikit-allel >=1.3.7 + - pandas >=1.5.3 + - mafft + - repeatmasker + +test: + imports: + - nanoinsight + commands: + - nanoinsight --help + +about: + home: https://github.com/AsmaaSamyMohamedMahmoud/nanoinsight + summary: Repeat annotation tool for insertions called by NanoVar + license: GPL-3.0-or-later + license_file: LICENSE.txt + diff --git a/recipes/nanometa-live/meta.yaml b/recipes/nanometa-live/meta.yaml index ab801d6964c57..4ccbcf3cfba8b 100644 --- a/recipes/nanometa-live/meta.yaml +++ b/recipes/nanometa-live/meta.yaml @@ -1,5 +1,5 @@ {% set name = "nanometa-live" %} -{% set version = "0.4.1" %} +{% set version = "0.4.3" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://github.com/FOI-Bioinformatics/nanometa_live/archive/{{ version }}.tar.gz - sha256: bc241b82277b641df9d419cb014a80a223a5f2db47a596925663589d8dbda5c2 + sha256: 9c8e0cb9eddaf8cfde3a752424717447319afd2af357a815e0ba4d4112e58e5c build: number: 0 diff --git a/recipes/nanomotif/meta.yaml b/recipes/nanomotif/meta.yaml new file mode 100644 index 0000000000000..f4e74096df9e9 --- /dev/null +++ b/recipes/nanomotif/meta.yaml @@ -0,0 +1,52 @@ +{% set name = "nanomotif" %} +{% set version = "0.1.20" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/nanomotif-{{ version }}.tar.gz + sha256: 2f8312b90d9bf845a91e9c1a8f86a72420e41fb4f9b04f7558b3e8e72f942d45 + +build: + entry_points: + - nanomotif = nanomotif.main:main + noarch: python + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage('nanomotif', max_pin="x.x") }} + +requirements: + host: + - python + - pip + run: + - python + - wheel + - requests + - numpy ==1.24.4 + - pandas ==2.0.2 + - polars >=0.19 + - seaborn ==0.12.2 + - scipy ==1.10.1 + - networkx ==3.1 + - progressbar2 ==3.53.1 + +test: + imports: + - nanomotif + commands: + - nanomotif --help + +about: + home: https://pypi.org/project/nanomotif/ + summary: Identifying methlyation motifs in nanopore data + license: MIT + license_family: MIT + license_file: LICENSE + +extra: + recipe-maintainers: + - SorenHeidelbach diff --git a/recipes/ncbi-amrfinderplus/meta.yaml b/recipes/ncbi-amrfinderplus/meta.yaml index a1c878034c0f5..1e8066c9c665a 100644 --- a/recipes/ncbi-amrfinderplus/meta.yaml +++ b/recipes/ncbi-amrfinderplus/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "3.11.26" %} -{% set sha256 = "49d98d0f66e121d3ed5a3d9a817089ee69399b0bd06af52f79d796bfe8b2d8b2" %} +{% set version = "3.12.8" %} +{% set sha256 = "a199bc332877bad9033a7620bc5e8e849db1f19a9ba8b7357ec5451a6a283aa0" %} package: name: ncbi-amrfinderplus diff --git a/recipes/ncbi-datasets-pylib/meta.yaml b/recipes/ncbi-datasets-pylib/meta.yaml index 150d6075f3184..9c5c206587b6f 100644 --- a/recipes/ncbi-datasets-pylib/meta.yaml +++ b/recipes/ncbi-datasets-pylib/meta.yaml @@ -1,6 +1,6 @@ {% set name = "ncbi-datasets-pylib" %} -{% set version = "16.3.0" %} -{% set sha256 = "9dafbff2b355d0b28f3621cdab580e5cadc8299d2ceeb845bb474d8413d14b85" %} +{% set version = "16.6.1" %} +{% set sha256 = "06ab4409a00ac4c89465dea774558f8e51bc759f869072332399e5dcca0dded8" %} package: name: {{ name|lower }} diff --git a/recipes/ncbi-ngs-sdk/meta.yaml b/recipes/ncbi-ngs-sdk/meta.yaml index 549f2efd81420..09d85595c29bf 100644 --- a/recipes/ncbi-ngs-sdk/meta.yaml +++ b/recipes/ncbi-ngs-sdk/meta.yaml @@ -6,7 +6,9 @@ package: version: {{ version }} build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage('ncbi-ngs-sdk', max_pin="x") }} source: url: https://github.com/ncbi/ngs/archive/{{ version }}.tar.gz @@ -33,3 +35,7 @@ about: home: https://github.com/ncbi/ngs license: Public Domain summary: NGS is a new, domain-specific API for accessing reads, alignments and pileups produced from Next Generation Sequencing. + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/ncbi-vdb-py/meta.yaml b/recipes/ncbi-vdb-py/meta.yaml index eebd27cd47135..6b8aebde9bebc 100644 --- a/recipes/ncbi-vdb-py/meta.yaml +++ b/recipes/ncbi-vdb-py/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "3.0.10" %} -{% set sha256 = "2e088a8542e6c3bc1aad01a5d2fca2ef5b745c36a3aafd3b0b42cb53b42b345d" %} +{% set version = "3.1.0" %} +{% set sha256 = "eec5a64b8353a201bd4cf2c58cfcbb3622327397c3b11696ae59d827fcfcea9d" %} package: name: ncbi-vdb-py diff --git a/recipes/ncbi-vdb/build.sh b/recipes/ncbi-vdb/build.sh index d8b63767c0d42..9b73fbb271b0e 100644 --- a/recipes/ncbi-vdb/build.sh +++ b/recipes/ncbi-vdb/build.sh @@ -24,13 +24,18 @@ end-of-patch # Execute Make commands from a separate subdirectory. Else: # ERROR: In source builds are not allowed -BUILD_DIR=./build_vdb -mkdir ${BUILD_DIR} -cd ${BUILD_DIR} +#BUILD_DIR="${SRC_DIR}/build_vdb" +#mkdir -p "${BUILD_DIR}" +#cd "${BUILD_DIR}" -export CFLAGS="${CFLAGS} -DH5_USE_110_API" -cmake ../ncbi-vdb/ -DNGS_INCDIR=${PREFIX} \ - -DCMAKE_INSTALL_PREFIX=${PREFIX} \ - -DCMAKE_BUILD_TYPE=Release -cmake --build . -cmake --install . +export CXXFLAGS="${CXXFLAGS} -I${PREFIX}/include -O3 -D_FILE_OFFSET_BITS=64 -DH5_USE_110_API" + +cmake -S ncbi-vdb/ -B build_vdb \ + -DNGS_INCDIR="${PREFIX}" \ + -DCMAKE_INSTALL_PREFIX="${PREFIX}" \ + -DCMAKE_BUILD_TYPE=Release \ + -DCMAKE_CXX_COMPILER="${CXX}" \ + -DCMAKE_CXX_FLAGS="${CXXFLAGS}" \ + -DCMAKE_LIBRARY_PATH="${PREFIX}/lib" + +cmake --build build_vdb/ --target install -j 4 -v diff --git a/recipes/ncbi-vdb/env.cmake.patch b/recipes/ncbi-vdb/env.cmake.patch new file mode 100644 index 0000000000000..1a4b4515c6bc4 --- /dev/null +++ b/recipes/ncbi-vdb/env.cmake.patch @@ -0,0 +1,24 @@ +diff --git a/build/env.cmake b/build/env.cmake +index 9527451..7ab041b 100644 +--- a/build/env.cmake ++++ b/build/env.cmake +@@ -106,12 +106,16 @@ else () + endif () + + # create variables based entirely upon OS +-if ( "mac" STREQUAL ${OS} ) +- add_compile_definitions( MAC BSD UNIX ) ++if ( CMAKE_C_COMPILER_ID STREQUAL "AppleClang" ) + set(CMAKE_C_ARCHIVE_CREATE " Scr ") +- set(CMAKE_CXX_ARCHIVE_CREATE " Scr ") + set(CMAKE_C_ARCHIVE_FINISH " -no_warning_for_no_symbols -c ") ++endif() ++if ( CMAKE_CXX_COMPILER_ID STREQUAL "AppleClang" ) ++ set(CMAKE_CXX_ARCHIVE_CREATE " Scr ") + set(CMAKE_CXX_ARCHIVE_FINISH " -no_warning_for_no_symbols -c ") ++endif() ++if ( "mac" STREQUAL ${OS} ) ++ add_compile_definitions( MAC BSD UNIX ) + elseif( "linux" STREQUAL ${OS} ) + add_compile_definitions( LINUX UNIX ) + set( LMCHECK -lmcheck ) diff --git a/recipes/ncbi-vdb/meta.yaml b/recipes/ncbi-vdb/meta.yaml index 61d789b3e0c6f..2fb4b41232e0e 100644 --- a/recipes/ncbi-vdb/meta.yaml +++ b/recipes/ncbi-vdb/meta.yaml @@ -1,35 +1,29 @@ -{% set version = "3.0.10" %} +{% set name = "ncbi-vdb" %} +{% set version = "3.1.0" %} package: - name: ncbi-vdb + name: {{ name }} version: {{ version }} build: - number: 0 - skip: True # [osx] + number: 2 run_exports: - {{ pin_subpackage('ncbi-vdb', max_pin='x') }} source: url: https://github.com/ncbi/ncbi-vdb/archive/{{ version }}.tar.gz - sha256: 2e088a8542e6c3bc1aad01a5d2fca2ef5b745c36a3aafd3b0b42cb53b42b345d + sha256: eec5a64b8353a201bd4cf2c58cfcbb3622327397c3b11696ae59d827fcfcea9d folder: ncbi-vdb + patches: + - env.cmake.patch # [osx] -requirements: +requirements: build: - - {{ compiler('c') }} - {{ compiler('cxx') }} - bison - cmake - flex - make - run: - - ca-certificates - - curl - - ossuuid - - perl - - perl-xml-libxml - - perl-uri about: home: https://github.com/ncbi/ncbi-vdb @@ -38,9 +32,14 @@ about: description: | VDB is the database engine that all SRA tools use. It is a columnar database system with a number of unique features. All SRA objects are stored in VDB. + dev_url: https://github.com/ncbi/ncbi-vdb + doc_url: https://github.com/ncbi/ncbi-vdb/wiki test: commands: - - test -e ${PREFIX}/lib64/libncbi-vdb.so # [not osx] - - test -e ${PREFIX}/lib64/libncbi-vdb.dylib # [osx] + - test -e ${PREFIX}/lib64/libncbi-vdb.so # [not osx] + - test -e ${PREFIX}/lib64/libncbi-vdb.dylib # [osx] +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/ncls/meta.yaml b/recipes/ncls/meta.yaml index f593d34f8522e..44dbe4ad16faa 100644 --- a/recipes/ncls/meta.yaml +++ b/recipes/ncls/meta.yaml @@ -10,9 +10,11 @@ source: sha256: 81aaa5abb123bb21797ed2f8ef921e20222db14a3ecbc61ccf447532f2b7ba93 build: - number: 1 + number: 2 skip: true # [py2k or osx] script: {{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv + run_exports: + - {{ pin_subpackage(name, max_pin="x.x.x") }} requirements: build: @@ -37,6 +39,8 @@ about: summary: Fast overlap datastructure. extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - endrebak skip-lints: diff --git a/recipes/nda-tools/meta.yaml b/recipes/nda-tools/meta.yaml index 1884495f78db8..12325594827f1 100644 --- a/recipes/nda-tools/meta.yaml +++ b/recipes/nda-tools/meta.yaml @@ -1,6 +1,6 @@ {% set name = "nda-tools" %} -{% set version = "0.2.26" %} -{% set sha256 = "863bbbf6399aa38bcec6cf8159aca90d3afcb1221eb26b20243f4f41e7eec2fe" %} +{% set version = "0.2.27" %} +{% set sha256 = "79cb91fe4265384287a833911b91747265449e1040a3e88c7c8566d0a561d8a4" %} package: name: {{ name }} diff --git a/recipes/ndex2/meta.yaml b/recipes/ndex2/meta.yaml index 223be915ae200..b3b3536e16221 100644 --- a/recipes/ndex2/meta.yaml +++ b/recipes/ndex2/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ndex2" %} -{% set version = "3.7.0" %} +{% set version = "3.8.0" %} package: @@ -8,7 +8,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/ndex2-{{ version }}.tar.gz" - sha256: "5fed3b6c204275fd75724f7d609823f9f6e249b3d468fdd8b0a1f7a9be7a294f" + sha256: "9f4d7f4b9594664191fba5c6512e315ed47b13bc416df5769802f87a7c22d1c8" build: noarch: python diff --git a/recipes/neat/meta.yaml b/recipes/neat/meta.yaml new file mode 100644 index 0000000000000..f02728e585edb --- /dev/null +++ b/recipes/neat/meta.yaml @@ -0,0 +1,49 @@ +{% set name = "NEAT" %} +{% set version = "4.1.1" %} + +package: + name: '{{ name|lower }}' + version: '{{ version }}' + +source: + url: https://github.com/ncsa/{{ name }}/archive/{{ version }}.tar.gz + sha256: 1f6ad3398be7e647f528a23f7d1f6470756620786b0f0331a1e41ddc1074288f + + +build: + run_exports: + - {{ pin_subpackage('neat', max_pin="x") }} + script: "{{ PYTHON }} -m pip install --no-deps --ignore-installed --no-cache-dir -vvv ." + number: 0 + noarch: python + +requirements: + host: + - python >=3.10 + - poetry-core >=1.0.0 + - pip + run: + - python >=3.10 + - biopython =1.79 + - pkginfo + - matplotlib-base + - numpy + - seaborn + - pyyaml + - scipy + - bedtools + - pybedtools >=0.9.0 + - htslib + - pysam + - frozendict + +test: + commands: + - neat -h | grep read-simulator + +about: + home: https://github.com/ncsa/NEAT/ + license: BSD-3-Clause + license_family: BSD + license_file: LICENSE.md + summary: Toolset for generating synthethic FASTQ, VCF and BAM files. diff --git a/recipes/nextalign/meta.yaml b/recipes/nextalign/meta.yaml index f2d7a6d6dc9bf..249e23a402905 100644 --- a/recipes/nextalign/meta.yaml +++ b/recipes/nextalign/meta.yaml @@ -6,16 +6,20 @@ package: version: "{{ version }}" source: - - url: https://github.com/nextstrain/nextclade/releases/download/{{ version }}/{{ name }}-x86_64-unknown-linux-gnu # [linux64] - sha256: 90602c64c89c6921f6713d60f726b890d8892b4c1f4f0334fbd6e4b10fd8db69 # [linux64] + - url: https://github.com/nextstrain/nextclade/releases/download/{{ version }}/{{ name }}-x86_64-unknown-linux-gnu # [linux and x86_64] + sha256: 90602c64c89c6921f6713d60f726b890d8892b4c1f4f0334fbd6e4b10fd8db69 # [linux and x86_64] + - url: https://github.com/nextstrain/nextclade/releases/download/{{ version }}/{{ name }}-aarch64-unknown-linux-gnu # [linux and aarch64] + sha256: b6fddd12cc4767c0316b13ce5f6fe8d6e26097bfb52f5c957615ffc884ce2448 # [linux and aarch64] - url: https://github.com/nextstrain/nextclade/releases/download/{{ version }}/{{ name }}-x86_64-apple-darwin # [osx and x86_64] sha256: 0585a0c4af33ac28a2cb2dd63eb5d5c9b749bf6a1af319b999b8440da9dd35d8 # [osx and x86_64] - - url: https://github.com/nextstrain/nextclade/releases/download/{{ version }}/{{ name }}-aarch64-apple-darwin # [arm64] - sha256: 2d8ec8f379b150c2ac271f3c08ca79ee372b1fb14da3dc8e1b3033a1b65cfc58 # [arm64] + - url: https://github.com/nextstrain/nextclade/releases/download/{{ version }}/{{ name }}-aarch64-apple-darwin # [osx and arm64] + sha256: 2d8ec8f379b150c2ac271f3c08ca79ee372b1fb14da3dc8e1b3033a1b65cfc58 # [osx and arm64] build: - number: 0 + number: 1 binary_relocation: False + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} requirements: @@ -23,7 +27,7 @@ test: files: - test-data commands: - - nextalign --help + - nextalign --help # [not aarch64] about: home: https://github.com/nextstrain/nextclade @@ -34,6 +38,8 @@ about: dev_url: https://github.com/nextstrain/nextclade extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - cjw85 - thanhleviet diff --git a/recipes/nextalign/run_test.sh b/recipes/nextalign/run_test.sh index ca4e450ff02c5..d7affe3faa46c 100644 --- a/recipes/nextalign/run_test.sh +++ b/recipes/nextalign/run_test.sh @@ -2,9 +2,14 @@ set -euxo pipefail +# the binary needs GLIBC 2.18+ on Linux ARM64 while 2.17 is available +if [ $(uname -m) != "aarch64" ]; then + nextalign run \ -test-data/sequences.fasta \ ---reference test-data/reference.fasta \ ---genemap test-data/genemap.gff \ ---output-all output/ \ ---output-basename nextalign + test-data/sequences.fasta \ + --reference test-data/reference.fasta \ + --genemap test-data/genemap.gff \ + --output-all output/ \ + --output-basename nextalign + +fi \ No newline at end of file diff --git a/recipes/nextclade/meta.yaml b/recipes/nextclade/meta.yaml index 1a01d3d0d15c5..f5a4d4ad86804 100644 --- a/recipes/nextclade/meta.yaml +++ b/recipes/nextclade/meta.yaml @@ -1,5 +1,5 @@ {% set name = "nextclade" %} -{% set version = "3.0.0" %} +{% set version = "3.4.0" %} package: name: "{{ name|lower }}" @@ -7,11 +7,13 @@ package: source: - url: https://github.com/nextstrain/nextclade/releases/download/{{ version }}/{{ name }}-x86_64-unknown-linux-gnu # [linux64] - sha256: b5f40f1ef809ad17bdb1fe31661b965c861115325ea2d73beadc86550ffccf16 # [linux64] + sha256: 5c9925fc94281fd83fcaa9a24246ae5bb0a1eee85f07cb506cde7e4fd71a6140 # [linux64] + - url: https://github.com/nextstrain/nextclade/releases/download/{{ version }}/{{ name }}-aarch64-unknown-linux-gnu # [aarch64] + sha256: 3f8dcfcda22d9c7c99f357bcdec962cb884b6ecdd29889ee45699f5a04d14995 # [aarch64] - url: https://github.com/nextstrain/nextclade/releases/download/{{ version }}/{{ name }}-x86_64-apple-darwin # [osx and x86_64] - sha256: a5763a28d4b1da627aac358156923650b3ea21dae1b1c3bbfb5f5e617c2ed3a4 # [osx and x86_64] - - url: https://github.com/nextstrain/nextclade/releases/download/{{ version }}/{{ name }}-aarch64-apple-darwin # [arm64] - sha256: ce156efb5f5a9ead01ac140d6f701f4b780b224cc64c27cb15a4dcfd13dbdc7a # [arm64] + sha256: 8554c739b892ca39c87794155ae70189a2bf0445982e3f1034f6f0ebe6e14b44 # [osx and x86_64] + - url: https://github.com/nextstrain/nextclade/releases/download/{{ version }}/{{ name }}-aarch64-apple-darwin # [osx and arm64] + sha256: e45861111ee1adb3e4239b889ae7b206be8ea0f839a2edb277fc6d3aa8a2359f # [osx and arm64] build: number: 0 @@ -21,9 +23,10 @@ build: requirements: +# Disable test for aarch64, as nextclade requires glibc 2.18 not available on aarch64 test: commands: - - nextclade --help + - nextclade --help # [not aarch64] about: home: https://github.com/nextstrain/nextclade @@ -34,6 +37,8 @@ about: dev_url: https://github.com/nextstrain/nextclade extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - pvanheus - corneliusroemer diff --git a/recipes/nextclade/run_test.sh b/recipes/nextclade/run_test.sh index 7fe8383073ee4..fff9dde423c45 100644 --- a/recipes/nextclade/run_test.sh +++ b/recipes/nextclade/run_test.sh @@ -5,6 +5,13 @@ set -e MAJOR_VERSION=$(echo "$PKG_VERSION" | cut -d. -f1) +# Skip if aarch64 on linux +# Because Nextclade requires glibc >= 2.18 not available yet on aarch64 builder +if [[ $target_platform == linux-aarch64 ]]; then + echo "Skipping test on aarch64" + exit 0 +fi + for BIN in nextclade nextclade$MAJOR_VERSION; do "$BIN" --version diff --git a/recipes/nextdenovo/build.sh b/recipes/nextdenovo/build.sh index adf1e0d4cba9b..2bbd1256310bb 100644 --- a/recipes/nextdenovo/build.sh +++ b/recipes/nextdenovo/build.sh @@ -1,10 +1,10 @@ #!/bin/bash -set -x +set -ex + +OUTDIR="${SP_DIR}/nextdenovo" -PYVER=`python -c 'import sys; print(str(sys.version_info[0])+"."+str(sys.version_info[1]))'` -OUTDIR=${PREFIX}/lib/python${PYVER}/site-packages/nextdenovo mkdir -p ${PREFIX}/bin ${OUTDIR} -cp -r ./* ${OUTDIR} -chmod a+x ${OUTDIR}/nextDenovo -ln -s ${OUTDIR}/nextDenovo ${PREFIX}/bin/nextDenovo +cp -rf ${SRC_DIR}/* ${OUTDIR} +chmod 755 ${OUTDIR}/nextDenovo +ln -sf ${OUTDIR}/nextDenovo ${PREFIX}/bin/nextDenovo diff --git a/recipes/nextdenovo/meta.yaml b/recipes/nextdenovo/meta.yaml index 41813d4ac069a..6ce4c5e6440d4 100644 --- a/recipes/nextdenovo/meta.yaml +++ b/recipes/nextdenovo/meta.yaml @@ -1,8 +1,9 @@ +{% set name = "nextdenovo" %} {% set version = "2.5.2" %} {% set sha256 = "5c7ca4aa3de234f4e0efd8aaf9eaf60ebd79b5e545ad2878a76162b29d815fe0" %} package: - name: nextdenovo + name: {{ name }} version: {{ version }} source: @@ -11,25 +12,22 @@ source: sha256: {{ sha256 }} build: - number: 3 - # repackages binaries - skip: True # [osx or py < 36] + number: 4 + binary_has_prefix_files: + - nextDenovo + run_exports: + - {{ pin_subpackage('nextdenovo', max_pin="x") }} requirements: + build: + - {{ compiler('c') }} + - make host: - python + - pip + - paralleltask - bzip2 - - ca-certificates - zlib - - ncurses - - openssl - - pip - - readline - - setuptools - - tk - - tzdata - - wheel - - xz run: - python - paralleltask @@ -39,13 +37,20 @@ test: - test_data commands: - 'nextDenovo --help' - #- 'nextDenovo test_data/run.cfg' # Partly success: some jobs are submitted, but others are killed before completion + #- 'nextDenovo test_data/run.cfg + # Partly success: some jobs are submitted, but others are killed before completion about: - home: https://github.com/Nextomics/NextDenovo - license: GNU General Public License v3.0 - summary: String graph-based de novo assembler for long reads (CLR, HiFi and ONT) + home: "https://github.com/Nextomics/NextDenovo" + license: "GPL-3.0-or-later" + license_family: GPL3 + license_file: LICENSE + summary: "String graph-based de novo assembler for long reads (CLR, HiFi and ONT)" + dev_url: "https://github.com/Nextomics/NextDenovo" + doc_url: "https://nextdenovo.readthedocs.io/en/latest" extra: - skip-lints: - - should_be_noarch_generic + identifiers: + - doi:10.1101/2023.03.09.531669 + - biotools:nextdenovo + - usegalaxy-eu:nextdenovo diff --git a/recipes/nextpolish/build.sh b/recipes/nextpolish/build.sh index a4aee7c2a3417..2950cd00b8fda 100644 --- a/recipes/nextpolish/build.sh +++ b/recipes/nextpolish/build.sh @@ -1,31 +1,35 @@ #!/usr/bin/env bash +export INCLUDE_PATH="${PREFIX}/include" +export LIBRARY_PATH="${PREFIX}/lib" +export LDFLAGS="${LDFLAGS} -L${PREFIX}/lib" + # Skip copying of bwa, minimap2, and samtools -sed -i.backup \ +sed -i.bak \ -e "s| bwa samtools minimap2||g" \ Makefile # Use conda's gcc and includes, also skip build of bwa, minimap2, and samtools -sed -i.backup \ +sed -i.bak \ -e "s| bwa_ samtools_ minimap2_||g" \ -e "s|gcc|$CC|g" \ -e "s|-lz|-lz -isystem ${PREFIX}/include|g" \ util/Makefile # Add version info (original required internet connection) -sed -i.backup "s=BIOCONDA_SED_REPLACE=$PKG_VERSION=" lib/kit.py +sed -i.bak "s=BIOCONDA_SED_REPLACE=$PKG_VERSION=" lib/kit.py # Create share directory SHARE_DIR="${PREFIX}/share/${PKG_NAME}-${PKG_VERSION}" mkdir -p ${SHARE_DIR}/ -cp -r ./lib ${SHARE_DIR}/ +cp -rf ./lib ${SHARE_DIR}/ # Build -make +make CC="${CC}" CFLAGS="-O3" LDFLAGS="${LDFLAGS}" -j "${CPU_COUNT}" mkdir -p ${PREFIX}/bin -cp bin/* ${PREFIX}/bin +cp -f bin/* ${PREFIX}/bin # fix hardcoded path -sed -i.backup "s=BIOCONDA_SED_REPLACE=$SHARE_DIR=" nextPolish +sed -i.bak "s=BIOCONDA_SED_REPLACE=$SHARE_DIR=" nextPolish chmod 755 nextPolish -cp nextPolish ${PREFIX}/bin +cp -f nextPolish ${PREFIX}/bin diff --git a/recipes/nextpolish/meta.yaml b/recipes/nextpolish/meta.yaml index bee63263c4917..c0220727c74bc 100644 --- a/recipes/nextpolish/meta.yaml +++ b/recipes/nextpolish/meta.yaml @@ -13,20 +13,23 @@ source: - fix_get_version.patch build: - number: 1 + number: 2 + run_exports: + - {{ pin_subpackage('nextpolish', max_pin="x") }} requirements: build: - make - - zlib - {{ compiler('c') }} host: - - zlib + - python + - pip - paralleltask + - bzip2 + - zlib run: - - python >=3.6 + - python - bwa - - bzip2 - minimap2 - paralleltask - samtools @@ -37,16 +40,17 @@ test: - nextPolish --version about: - home: https://github.com/Nextomics/NextPolish - dev_url: https://github.com/Nextomics/NextPolish - doc_url: https://nextpolish.readthedocs.io/en/latest/index.html - summary: Fast and accurately polish the genome generated by long reads - license: GPL-3 - license_family: GPL + home: "https://github.com/Nextomics/NextPolish" + dev_url: "https://github.com/Nextomics/NextPolish" + doc_url: "https://nextpolish.readthedocs.io/en/latest" + summary: "Fast and accurately polish the genome generated by noisy long reads" + license: "GPL-3.0-or-later" + license_family: GPL3 license_file: LICENSE extra: recipe-maintainers: - rpetit3 - container: - extended-base: True + identifiers: + - biotools:NextPolish + - doi:10.1093/bioinformatics/btz891 diff --git a/recipes/nextstrain-cli/meta.yaml b/recipes/nextstrain-cli/meta.yaml index cdd7f714d9895..1cef58d2d3db1 100644 --- a/recipes/nextstrain-cli/meta.yaml +++ b/recipes/nextstrain-cli/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "7.4.0" %} +{% set version = "8.2.0" %} package: name: nextstrain-cli @@ -6,10 +6,10 @@ package: source: url: https://pypi.io/packages/source/n/nextstrain-cli/nextstrain-cli-{{ version }}.tar.gz - sha256: bc678d817dac6351466728122dff1ce37d7e8f3f8b8402fd2cef5822287b7de4 + sha256: 9b48dd8f32416d43b5f7db8a4a5ca045913a41a4967a5ae189240cbd67c285a2 build: - number: 1 + number: 0 noarch: python entry_points: - nextstrain = nextstrain.cli.__main__:main diff --git a/recipes/nf-core/meta.yaml b/recipes/nf-core/meta.yaml index df210d833f8d2..ac60d3bce94fb 100644 --- a/recipes/nf-core/meta.yaml +++ b/recipes/nf-core/meta.yaml @@ -1,6 +1,6 @@ {% set name = "nf-core" %} -{% set version = "2.11.1" %} -{% set sha256 = "f81e411a66a417b9355657eec4337e8d004b166d8690e39f337994763b0ecc63" %} +{% set version = "2.13.1" %} +{% set sha256 = "297bb52144a0651b3b718325726b10a14bef0b1b3a1d65a0eadb4badb47c8a6f" %} package: name: {{ name|lower }} @@ -27,26 +27,28 @@ requirements: run: - python >=3.8 - click + - filetype + - galaxy-tool-util - git - - pyyaml - - requests - - requests-cache - - tabulate - gitpython - - markdown >=3.3 - - jsonschema >=3.0 - jinja2 - - rich >=13.3.1 - - rich-click >=1.6.1 + - jsonschema >=3.0 + - markdown >=3.3 + - packaging + - pillow - pre-commit - prompt_toolkit >=3.0.3 - pytest >=7.0.0 - pytest-workflow >=1.6.0 + - pyyaml - questionary >=1.8.0 - - packaging - - galaxy-tool-util - refgenie - - filetype + - requests + - requests-cache + - rich >=13.3.1 + - rich-click >=1.6.1 + - tabulate + - trogon test: commands: diff --git a/recipes/nf-test/meta.yaml b/recipes/nf-test/meta.yaml index 21bcaf9fe3c08..280a8e4979ddd 100644 --- a/recipes/nf-test/meta.yaml +++ b/recipes/nf-test/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.8.3" %} +{% set version = "0.8.4" %} package: @@ -13,7 +13,7 @@ build: source: url: https://github.com/askimed/nf-test/releases/download/v{{version}}/nf-test-{{version}}.tar.gz - sha256: af48883e8d0cd2d65b0846b3f60a476a5ec28a3799ba9374e0cb307a2a2d634d + sha256: 8023bbe6e354294fba514493f423f80e75869e5daf7e51f4cb808877fdc84381 requirements: host: diff --git a/recipes/ngs-bits/meta.yaml b/recipes/ngs-bits/meta.yaml index 5fa12dddf0aa1..36577f5655986 100755 --- a/recipes/ngs-bits/meta.yaml +++ b/recipes/ngs-bits/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2023_11" %} +{% set version = "2024_02" %} package: name: ngs-bits @@ -11,7 +11,7 @@ build: source: url: https://github.com/imgag/ngs-bits/releases/download/{{ version }}/ngs-bits-{{ version }}.tgz - sha256: bb994eb9a74043fa173a3b0ee6b9eafdf3e7b1aeb1ebcc2ba3e73888e1e61fa4 + sha256: 29f95f6e4e5c1cd57e463730312464bb2b632758c46abd5e1531a1d75a26a782 requirements: build: diff --git a/recipes/ngs-chew/meta.yaml b/recipes/ngs-chew/meta.yaml index 70a556610a8a9..f6df359de7c2e 100644 --- a/recipes/ngs-chew/meta.yaml +++ b/recipes/ngs-chew/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.9.2" %} -{% set sha256 = "5220182a9b2e6d2c2adf8ca6053c5a8ebf917942c6486eeee19aa2ccc6bea561" %} +{% set version = "0.9.4" %} +{% set sha256 = "7ea102e92268d9db07f9361735da6da1ebf433dbd5bff0766f8a9aaf6b93c279" %} package: name: ngs-chew @@ -37,6 +37,7 @@ requirements: - vcfpy - bcftools - samtools + - pyarrow test: commands: diff --git a/recipes/niemagraphgen/build.sh b/recipes/niemagraphgen/build.sh new file mode 100644 index 0000000000000..1fd3513e1fa7d --- /dev/null +++ b/recipes/niemagraphgen/build.sh @@ -0,0 +1,5 @@ +#!/bin/bash + +mkdir -p ${PREFIX}/bin +make CXX="$CXX" INCLUDE="-I${PREFIX}/include" RELEASEFLAGS="-Wall -pedantic -std=c++11 -DOUTFAVITES -DNGG_UINT_32 -O3 $LDFLAGS" +cp ngg_* ${PREFIX}/bin diff --git a/recipes/niemagraphgen/meta.yaml b/recipes/niemagraphgen/meta.yaml new file mode 100644 index 0000000000000..12c498054c879 --- /dev/null +++ b/recipes/niemagraphgen/meta.yaml @@ -0,0 +1,47 @@ +{% set version = "1.0.6" %} + +package: + name: niemagraphgen + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage('niemagraphgen', max_pin="x.x.x") }} + +source: + url: https://github.com/niemasd/NiemaGraphGen/archive/refs/tags/{{ version }}.tar.gz + sha256: 65789a45c126cbeb385e5b36550b3c3ed2588943b2e1ac779d433fd3026974c1 + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('cxx') }} + - make + +about: + home: https://github.com/niemasd/NiemaGraphGen + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE + summary: Niema's C++ implementations of graph generators + dev_url: https://github.com/niemasd/NiemaGraphGen + +test: + commands: + - ngg_barabasi_albert -h 2>&1 | grep "NiemaGraphGen" + - ngg_barbell -h 2>&1 | grep "NiemaGraphGen" + - ngg_complete -h 2>&1 | grep "NiemaGraphGen" + - ngg_cycle -h 2>&1 | grep "NiemaGraphGen" + - ngg_empty -h 2>&1 | grep "NiemaGraphGen" + - ngg_erdos_renyi -h 2>&1 | grep "NiemaGraphGen" + - ngg_newman_watts_strogatz -h 2>&1 | grep "NiemaGraphGen" + - ngg_path -h 2>&1 | grep "NiemaGraphGen" + - ngg_ring_lattice -h 2>&1 | grep "NiemaGraphGen" + +extra: + identifiers: + - biotools:niemagraphgen + - doi:10.46471/gigabyte.37 + maintainers: + - niemasd diff --git a/recipes/novoplasty/meta.yaml b/recipes/novoplasty/meta.yaml index dac1892e5cb5e..ded9b844226cf 100644 --- a/recipes/novoplasty/meta.yaml +++ b/recipes/novoplasty/meta.yaml @@ -1,5 +1,5 @@ {% set name = "NOVOPlasty" %} -{% set version = "4.3.3" %} +{% set version = "4.3.5" %} package: name: {{ name|lower }} @@ -7,17 +7,18 @@ package: source: url: https://github.com/ndierckx/NOVOPlasty/archive/NOVOPlasty{{ version }}.tar.gz - sha256: 305759167b63d08f8f8191c1f735aa29c90b0a9de9e8c67cdca9ab43c8c13490 + sha256: b2555f2c10548a882d397a3c18d59d41905c0693ecf417d63aee24d5ac738d36 build: number: 0 noarch: generic + run_exports: + - {{ pin_subpackage('novoplasty', max_pin="x") }} requirements: host: - perl - perl-module-build - run: - perl @@ -30,10 +31,11 @@ test: about: home: https://github.com/ndierckx/NOVOPlasty summary: "The organelle assembler and heteroplasmy caller" - license: other + license: Other license_file: LICENSE description: | NOVOPlasty is a de novo assembler for short circular genomes. + extra: identifiers: - doi:10.1093/nar/gkw955 diff --git a/recipes/npstructures/meta.yaml b/recipes/npstructures/meta.yaml index aabf2fa368189..b82ae84aed78b 100644 --- a/recipes/npstructures/meta.yaml +++ b/recipes/npstructures/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.2.15" %} +{% set version = "0.2.17" %} {% set name = "npstructures" %} package: name: {{ name }} @@ -6,7 +6,7 @@ package: source: url: https://github.com/bionumpy/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz - sha256: 6266b74fae8f58d1cdc8967e5a85f557610df4956fae28e6b3eb39ddebb46aae + sha256: 403ef65ebafb4a0b34d9571350cdbcf72f3f64a56d3d3e43df421a5f919bef7d build: diff --git a/recipes/ntedit/build.sh b/recipes/ntedit/build.sh index 310cbe6d76b8f..4e5a499abd72a 100644 --- a/recipes/ntedit/build.sh +++ b/recipes/ntedit/build.sh @@ -1,16 +1,9 @@ #!/bin/bash -export CFLAGS="-I$PREFIX/include" -export CPPFLAGS="-I$PREFIX/include" -export CXXFLAGS="-I$PREFIX/include" -export LDFLAGS="-L$PREFIX/lib" -export CPATH=${PREFIX}/include -export C_INCLUDE_PATH=${C_INCLUDE_PATH}:${PREFIX}/include -export LIBRARY_PATH="${PREFIX}/lib" -export LD_LIBRARY_PATH="${PREFIX}/lib" -if [[ "$(uname)" == Darwin ]]; then - export LDFLAGS="$LDFLAGS -headerpad_max_install_names" -fi -make ntedit mkdir -p $PREFIX/bin -mv ntedit $PREFIX/bin + +export CXXFLAGS="${CXXFLAGS} -D_LIBCPP_DISABLE_AVAILABILITY" + +meson setup build --prefix=$PREFIX --strip +cd build +ninja -v install diff --git a/recipes/ntedit/meta.yaml b/recipes/ntedit/meta.yaml index 0c2d71c26f51a..b88758d97416c 100644 --- a/recipes/ntedit/meta.yaml +++ b/recipes/ntedit/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ntedit" %} -{% set version = "1.4.3" %} +{% set version = "2.0.2" %} package: name: {{ name|lower }} @@ -11,31 +11,48 @@ build: - {{ pin_subpackage(name, max_pin="x") }} source: - url: https://github.com/bcgsc/ntEdit/archive/v{{ version }}.tar.gz - sha256: a584a04eb0d6373c4be68b626444600fea8a0bf97931b34fbc4da47c21d7fd27 + url: https://github.com/bcgsc/ntEdit/releases/download/v{{ version }}/ntEdit-{{ version }}.tar.gz + sha256: 314bc1a39c2d382786ee64d83a1b8c4519e5c9feb0203b1b7f4ab0d9087cf6c5 requirements: build: - - make - {{ compiler('cxx') }} - - llvm-openmp # [osx] + - cmake + - make - automake - autoconf - - perl - + - meson + - ninja host: + - perl - zlib + - btllib + - llvm-openmp # [osx] + - boost-cpp + - python >=3.9 run: - - llvm-openmp # [osx] - - zlib - - ntHits ==0.0.1 + - llvm-openmp # [osx] + - nthits >=1.0.0 + - ntcard + - btllib + - snakemake-minimal + - boost-cpp test: commands: - ntedit --help + - run-ntedit --help about: home: https://github.com/bcgsc/ntEdit - license: GPL-3.0 + license: GPL-3.0-or-later + license_family: GPL3 license_file: LICENSE - summary: 'ultra fast, scalable genome assembly polishing and snv detection' + summary: 'Ultrafast, lightweight, scalable genome assembly polishing, and SNV detection & annotation' + doc_url: https://github.com/bcgsc/ntEdit/blob/master/README.md + dev_url: https://github.com/bcgsc/ntEdit + +extra: + identifiers: + - doi:10.1093/bioinformatics/btz400 + - biotools:ntEdit diff --git a/recipes/nthits/meta.yaml b/recipes/nthits/meta.yaml index 7418b9891adb4..ef933a0b68fd5 100644 --- a/recipes/nthits/meta.yaml +++ b/recipes/nthits/meta.yaml @@ -1,5 +1,5 @@ {% set name = "nthits" %} -{% set version = "1.0.2" %} +{% set version = "1.0.3" %} package: name: nthits @@ -7,7 +7,7 @@ package: source: url: https://github.com/bcgsc/ntHits/releases/download/v{{ version }}/{{ name|lower }}-{{ version }}.tar.gz - sha256: f7b18c9d9510a44cc24cec2f24f3e87312330ea70805b559a4989ea47d530e64 + sha256: ee50e825f2c99f859031fa7e5bfe4cbbc71357108c32863e31b40b950cc077b2 build: number: 0 diff --git a/recipes/ntjoin/meta.yaml b/recipes/ntjoin/meta.yaml index 6d7500b02bc9f..d49a1ecaaa371 100644 --- a/recipes/ntjoin/meta.yaml +++ b/recipes/ntjoin/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.1.3" %} +{% set version = "1.1.4" %} package: name: ntjoin @@ -6,16 +6,15 @@ package: source: url: https://github.com/bcgsc/ntJoin/releases/download/v{{ version }}/ntJoin-{{ version }}.tar.gz - sha256: 5c54522841730f454dbdf2ea2ffee01ba647276022d01ecbe74273a1a705265b + sha256: ec24330e11ea63948d1b124273dae79e80088d672f7e536e7d97787f0c2bb644 build: number: 0 - skip: True # [py<38] - run_exports: {{ pin_subpackage("ntjoin", max_pin="x") }} + noarch: generic + run_exports: + - {{ pin_subpackage("ntjoin", max_pin="x") }} requirements: - build: - - {{ compiler('cxx') }} host: - make - python diff --git a/recipes/ntlink/meta.yaml b/recipes/ntlink/meta.yaml index 609bc60ac8087..576cbcab302c5 100644 --- a/recipes/ntlink/meta.yaml +++ b/recipes/ntlink/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.3.9" %} +{% set version = "1.3.10" %} package: name: ntlink @@ -6,23 +6,21 @@ package: source: url: https://github.com/bcgsc/ntLink/releases/download/v{{ version }}/ntLink-{{ version }}.tar.gz - sha256: 3a6fe7ca9c7a0226cf51b7e55804e235ac2b959e82a30f9bce55b9caea5bb03b + sha256: 248ccae217dd7ed2e4664c6b48235f8db2ba24d8896b8315f6e657f19d5f7085 build: - number: 2 - skip: True # [py<38 or py > 39] + number: 0 + noarch: generic run_exports: - {{ pin_subpackage('ntlink', max_pin="x") }} requirements: - build: - - {{ compiler('cxx') }} host: - make - python - pip - zlib - - btllib <=1.4.10 + - btllib <1.7.0 run: - python - zlib @@ -30,7 +28,7 @@ requirements: - numpy - python-igraph - abyss >=2.3.0 - - btllib + - btllib <1.7.0 test: diff --git a/recipes/ntm-profiler/meta.yaml b/recipes/ntm-profiler/meta.yaml index 55ce1e0cf751b..d920b448d61cc 100644 --- a/recipes/ntm-profiler/meta.yaml +++ b/recipes/ntm-profiler/meta.yaml @@ -1,6 +1,6 @@ {% set name = "ntm-profiler" %} -{% set version = "0.3.0" %} -{% set sha256 = "1617d07625cce501980ed93146e520d5eea41c6beae5093da69accac48479f07" %} +{% set version = "0.4.0" %} +{% set sha256 = "6d9625d3b0ad2ee8a757cf6ab69381fd8d63c7d9adde76e56076b616f3039deb" %} package: name: {{name}} @@ -28,7 +28,7 @@ requirements: run: - python >=3.7 - mash =2.3 - - pathogen-profiler =3.1.0 + - pathogen-profiler =4.1.0 - jinja2 - sourmash >=4.8.3 diff --git a/recipes/ntroot/build.sh b/recipes/ntroot/build.sh new file mode 100644 index 0000000000000..65498faa460dd --- /dev/null +++ b/recipes/ntroot/build.sh @@ -0,0 +1,7 @@ +#!/bin/bash + + +mkdir -p ${PREFIX}/bin +cp ntroot ${PREFIX}/bin +cp ntRootAncestryPredictor.pl ${PREFIX}/bin +cp ntroot_run_pipeline.smk ${PREFIX}/bin diff --git a/recipes/ntroot/meta.yaml b/recipes/ntroot/meta.yaml new file mode 100644 index 0000000000000..f862511cee3a8 --- /dev/null +++ b/recipes/ntroot/meta.yaml @@ -0,0 +1,37 @@ +{% set name = "ntRoot" %} +{% set version = "1.0.1" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/bcgsc/ntRoot/releases/download/v{{ version }}/{{ name }}-{{ version }}.tar.gz + sha256: dd7a72cc0a2d92163a7ff7135e99e034d0831a6da16d3d8731039fff275502b5 + +build: + number: 1 + noarch: generic + run_exports: + - {{ pin_subpackage("ntroot", max_pin="x") }} + +requirements: + host: + - python >=3.9 + - perl + run: + - python >=3.9 + - snakemake + - samtools + - ntedit >=2.0.1 + - perl + +test: + commands: + - ntroot -h + +about: + home: https://github.com/bcgsc/ntroot + license: GPL-3.0 + license_file: LICENSE + summary: 'Ancestry inference from genomic data' diff --git a/recipes/ntsynt/build.sh b/recipes/ntsynt/build.sh new file mode 100644 index 0000000000000..c0ea64c9342bc --- /dev/null +++ b/recipes/ntsynt/build.sh @@ -0,0 +1,9 @@ +#!/bin/bash + +export CXXFLAGS="${CXXFLAGS} -D_LIBCPP_DISABLE_AVAILABILITY" + +# Build ntSynt +mkdir -p ${PREFIX}/bin +meson setup build --prefix ${PREFIX} +cd build +ninja install diff --git a/recipes/ntsynt/meta.yaml b/recipes/ntsynt/meta.yaml new file mode 100644 index 0000000000000..2ae5caf0befcf --- /dev/null +++ b/recipes/ntsynt/meta.yaml @@ -0,0 +1,49 @@ +{% set name = "ntSynt" %} +{% set version = "1.0.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/bcgsc/ntSynt/releases/download/v{{ version }}/{{ name }}-{{ version }}.tar.gz + sha256: db3fe491233d93967120d091a19abbef1fa5dfa637814bb617814a1b3e3f1331 + +build: + number: 1 + run_exports: + - {{ pin_subpackage("ntsynt", max_pin="x") }} + +requirements: + build: + - {{ compiler('cxx') }} + - cmake + host: + - python + - meson + - ninja + - llvm-openmp # [osx] + - libgomp # [linux] + - btllib <1.7.0 + run: + - python + - btllib <1.7.0 + - intervaltree + - pybedtools + - ncls + - python-igraph + - snakemake + - samtools + - seqtk + +test: + commands: + - ntSynt -h + imports: + - btllib + +about: + home: https://github.com/bcgsc/ntsynt + license: GPL-3.0 + license_file: LICENSE + summary: 'Detecting multi-genome synteny blocks using minimizer graph mapping' diff --git a/recipes/oakvar/meta.yaml b/recipes/oakvar/meta.yaml index 3980d2f261a57..01269e9630b34 100644 --- a/recipes/oakvar/meta.yaml +++ b/recipes/oakvar/meta.yaml @@ -1,6 +1,6 @@ {% set name = "OakVar" %} -{% set version = "2.9.83" %} -{% set sha256 = "b7157f768ee6b631a202ac50a05a6b69c233320c036437f484ebeb2660422f77" %} +{% set version = "2.9.112" %} +{% set sha256 = "2d913a92591c8de46a2465b265cf685203eed6a4f866c9b47c416080f88e488f" %} package: name: {{ name|lower }} diff --git a/recipes/oarfish/build.sh b/recipes/oarfish/build.sh new file mode 100644 index 0000000000000..3c3929c054e07 --- /dev/null +++ b/recipes/oarfish/build.sh @@ -0,0 +1,7 @@ +#!/bin/bash -euo +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="$(pwd)/.cargo" + +# build statically linked binary with Rust +RUST_BACKTRACE=1 cargo install --verbose --root $PREFIX --path . diff --git a/recipes/oarfish/meta.yaml b/recipes/oarfish/meta.yaml new file mode 100644 index 0000000000000..633bcc960583e --- /dev/null +++ b/recipes/oarfish/meta.yaml @@ -0,0 +1,30 @@ +{% set version = "0.4.0" %} + +package: + name: oarfish + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage("oarfish", max_pin="x.x") }} + +source: + url: https://github.com/COMBINE-lab/oarfish/archive/v{{ version }}.tar.gz + sha256: 97e5d42d7797977a12790d9986a7e28c2ec264ca7a9637916178594e868080c8 + +requirements: + build: + - {{ compiler('rust') }} + host: + run: + +test: + commands: + - oarfish --help + +about: + home: https://github.com/COMBINE-lab/oarfish + license: BSD-3-Clause + license_file: LICENSE + summary: oarfish is a tool for fast, accurate and versatile transcript quantification from long-read RNA-seq data diff --git a/recipes/occultercut/build.sh b/recipes/occultercut/build.sh new file mode 100644 index 0000000000000..9e2e9cc3758cf --- /dev/null +++ b/recipes/occultercut/build.sh @@ -0,0 +1,17 @@ +#!/bin/bash +set -eu -o pipefail +# +# CONDA build script variables +# +# $PREFIX The install prefix +# + +mkdir -p "${PREFIX}/bin" + +export CPLUS_INCLUDE_PATH="${PREFIX}/include" +export LIBRARY_PATH="${PREFIX}/lib" +export LDFLAGS="${LDFLAGS} -L${PREFIX}/lib" + +make CC="${GXX} ${LDFLAGS}" CFLAGS="${CFLAGS}" + +cp OcculterCut "${PREFIX}/bin" diff --git a/recipes/occultercut/meta.yaml b/recipes/occultercut/meta.yaml new file mode 100644 index 0000000000000..9cee221adf90c --- /dev/null +++ b/recipes/occultercut/meta.yaml @@ -0,0 +1,44 @@ +{% set name = "occultercut" %} +{% set version = "1.1" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: "https://downloads.sourceforge.net/project/{{ name }}/OcculterCut_v{{ version }}.tar.gz" + sha256: 34aa8c3ef4c216435b4f722ea25f9dc431ef6937e47cfeb5afa323d451cc06ae + +build: + number: 0 + skip: True # [osx] + run_exports: + - {{ pin_subpackage('occultercut', max_pin="x") }} + +requirements: + build: + - make + - {{ compiler('c') }} + - {{ compiler('cxx') }} + host: + - libgomp # [linux] + - llvm-openmp # [osx] + run: + - gnuplot + +test: + commands: + - OcculterCut | grep "OcculterCut" + +about: + license: GPL-3.0-or-later + license_family: GPL3 + license_file: COPYING + summary: 'A package for measuring the local GC-content bias in genomes and fungal species' + home: https://sourceforge.net/projects/occultercut + +extra: + identifiers: + - doi:10.1093/gbe/evw121 + recipe-maintainers: + - KristinaGagalova diff --git a/recipes/odgi/meta.yaml b/recipes/odgi/meta.yaml index 44d9dfd0ea1b0..155ecb1d55d78 100644 --- a/recipes/odgi/meta.yaml +++ b/recipes/odgi/meta.yaml @@ -1,5 +1,5 @@ {% set name = "odgi" %} -{% set version = "0.8.4" %} +{% set version = "0.8.6" %} package: name: "{{ name }}" @@ -7,7 +7,7 @@ package: source: url: https://github.com/pangenome/{{ name }}/releases/download/v{{ version }}/{{ name }}-v{{ version }}.tar.gz - sha256: bc656e541a42c890f71e748e4420215e1efba5b7b890d8c009bfef114c811f47 + sha256: a6db190b782608082b14b42c660389aa18010791de1e2d07e29f7f61d8787754 build: skip: True # [osx or py27] diff --git a/recipes/olivar/meta.yaml b/recipes/olivar/meta.yaml index 312f353f707f4..cacb4b80f87e8 100644 --- a/recipes/olivar/meta.yaml +++ b/recipes/olivar/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.1.3" %} +{% set version = "1.1.4" %} package: name: olivar @@ -6,7 +6,7 @@ package: source: url: 'https://github.com/treangenlab/Olivar/archive/refs/tags/v{{version}}.tar.gz' - sha256: f7a04661321a33c8c4142fcb65397e13fdbcc3be2e6f429d2a5056e3f16fb567 + sha256: d671e9cc3befd34ccaefc46dbf01d20de7de3bc7a23b66c30c47409509fb18de build: number: 0 diff --git a/recipes/omamer/meta.yaml b/recipes/omamer/meta.yaml index d7a0f90833459..9bbc65251e0ac 100644 --- a/recipes/omamer/meta.yaml +++ b/recipes/omamer/meta.yaml @@ -1,5 +1,5 @@ {% set name = "omamer" %} -{% set version = "2.0.2" %} +{% set version = "2.0.3" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/omamer-{{ version }}.tar.gz - sha256: 2cd75d7771333c9a611b274285eb662c19ea50c38a2ae0a2748a3b821be67dae + sha256: c29fcaf5aa39fc3a3f2ff860159ce4df1832229751a6a623ef9af4eba503b525 build: entry_points: diff --git a/recipes/ont-fast5-api/meta.yaml b/recipes/ont-fast5-api/meta.yaml index f860d6263889c..61dcfc3873f45 100644 --- a/recipes/ont-fast5-api/meta.yaml +++ b/recipes/ont-fast5-api/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ont-fast5-api" %} -{% set version = "4.1.2" %} +{% set version = "4.1.3" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: c7c59c6100e992ef8bc239cdf91f7a8ab46abf57ecd689f94b2b98e72a9e9472 + sha256: 302d10ed87b439f8f22c2c06d45d68d017e47dd8df9bd48f155cad041f464b68 build: number: 0 diff --git a/recipes/ont-modkit/meta.yaml b/recipes/ont-modkit/meta.yaml index 452de044fa9b1..5b5cb534a641b 100644 --- a/recipes/ont-modkit/meta.yaml +++ b/recipes/ont-modkit/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.2.4" %} -{% set sha256 = "fcf01e992a9a8fd1feccf8513370cbcdb630fd0b4c0d14ce76696bfef656fe79" %} +{% set version = "0.2.7" %} +{% set sha256 = "e933e7a69672ad8ac59f99e201010cfdfe23012ecaa7d5b9ba19db59aebe423f" %} package: name: ont-modkit diff --git a/recipes/ontime/meta.yaml b/recipes/ontime/meta.yaml index 84e0131fe612f..b0764d525b178 100644 --- a/recipes/ontime/meta.yaml +++ b/recipes/ontime/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.2.3" %} +{% set version = "0.3.1" %} {% set name = "ontime" %} package: @@ -7,7 +7,7 @@ package: source: url: https://github.com/mbhall88/{{ name }}/archive/{{ version }}.tar.gz - sha256: 6ac4f5e76cb01c16e306661d865a11918604873b5d057afa1a8a37dc4829e682 + sha256: 1caee3197d1032da38c55a47c3b626fe00b07831362e734fb2174747fca17fc4 build: number: 0 diff --git a/recipes/open-cravat/meta.yaml b/recipes/open-cravat/meta.yaml index 18237d9992629..334f0068efb07 100644 --- a/recipes/open-cravat/meta.yaml +++ b/recipes/open-cravat/meta.yaml @@ -1,5 +1,5 @@ {% set name = "open-cravat" %} -{% set version = "2.4.2" %} +{% set version = "2.6.0" %} package: name: "{{ name|lower }}" @@ -7,14 +7,14 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: af069fb71cceb5d687b2dae24cb89c3fd69591a1df9f9aea29ec7c91c581f203 + sha256: c0dee114a1805bc366a2242af8594dd5f2840b77243db9fb36a5ff5a7546ecfa build: number: 0 entry_points: - oc=cravat.oc:main noarch: python - script: {{PYTHON}} -m pip install . -vvv --no-build-isolation --no-deps + script: {{PYTHON}} -m pip install . -vvv --no-build-isolation --no-deps --no-cache-dir run_exports: - {{ pin_subpackage('open-cravat', max_pin="x") }} @@ -23,8 +23,9 @@ requirements: - pip - python >=3.8 run: - - aiohttp + - aiohttp <4.0.0 - aiosqlite + - biopython - chardet >=3.0.4 - intervaltree - markdown @@ -48,7 +49,7 @@ test: - cravat about: - home: "http://www.opencravat.org" + home: "https://www.opencravat.org" license: MIT license_family: MIT license_file: LICENSE diff --git a/recipes/orientationpy/build.sh b/recipes/orientationpy/build.sh new file mode 100644 index 0000000000000..9b117d644a325 --- /dev/null +++ b/recipes/orientationpy/build.sh @@ -0,0 +1,3 @@ +#!/usr/bin/env bash + +"${PYTHON}" -m pip install --no-deps --ignore-installed --no-cache-dir -vvv *.whl diff --git a/recipes/orientationpy/meta.yaml b/recipes/orientationpy/meta.yaml new file mode 100644 index 0000000000000..11b7b6ed31b4b --- /dev/null +++ b/recipes/orientationpy/meta.yaml @@ -0,0 +1,44 @@ +{% set name = "orientationpy" %} +{% set version = "0.2.0.4" %} + +package: + name: "{{ name }}" + version: "{{ version }}" + +source: + url: "https://files.pythonhosted.org/packages/0a/f5/ab88217f2b8a14bf10959de073d0fb2ca631c6ca00a953184cefec66a003/orientationpy-{{ version }}-py3-none-any.whl" + sha256: 918654b71c28824c0b19f67d4a9fb20d45f72f41566dc51d63f835076f7cd744 + +build: + number: 0 + noarch: python + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} + +requirements: + host: + - python >=3.8 + - pip + run: # see https://gitlab.com/epfl-center-for-imaging/orientationpy/-/blob/main/pyproject.toml?ref_type=heads#L32 + - python >=3.8 + - matplotlib-base >=3.1.3 + - numpy + - scipy + - numba + - numba-progress + +test: + commands: + - python -c "import orientationpy" + +about: + home: "https://pypi.org/project/orientationpy" + license: GNU General Public License v3 (GPL-3.0) + license_family: GPL + summary: "OrientationPy is the pythonic successor to the well-loved OrientationJ Fiji Plugin. It is a library that takes in 2D images or 3D volumes and computes the orientation of the greylevels." + dev_url: "https://gitlab.com/epfl-center-for-imaging/orientationpy" + doc_url: "https://epfl-center-for-imaging.gitlab.io/orientationpy/introduction.html" + +extra: + recipe-maintainers: + - kostrykin diff --git a/recipes/orsum/meta.yaml b/recipes/orsum/meta.yaml index 3591a34be072a..914af7c1fb195 100644 --- a/recipes/orsum/meta.yaml +++ b/recipes/orsum/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.6.0" %} -{% set sha256hash = "b44f9d5a68e4983da93c41cf5e4053c77ac550e0482601c1da6a83b039328da9" %} +{% set version = "1.7.0" %} +{% set sha256hash = "ba228a3d1ca6aa6269a624ab109c1a6c41c58dd392abcf46f8edc2e52760c1a8" %} package: name: orsum version: {{ version }} @@ -11,6 +11,8 @@ source: build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage('orsum', max_pin="x.x") }} requirements: run: diff --git a/recipes/orthanq/build.sh b/recipes/orthanq/build.sh new file mode 100644 index 0000000000000..9dca7213beca0 --- /dev/null +++ b/recipes/orthanq/build.sh @@ -0,0 +1,8 @@ +#!/bin/bash -eu + +# Make sure bindgen passes on our compiler flags. +export BINDGEN_EXTRA_CLANG_ARGS="${CPPFLAGS} ${CFLAGS} ${LDFLAGS}" +export HDF5_DIR=${PREFIX} +export RUSTFLAGS="-C link-args=-Wl,-rpath,$HDF5_DIR/lib" + +cargo install --no-track --locked --verbose --root "${PREFIX}" --path . diff --git a/recipes/orthanq/meta.yaml b/recipes/orthanq/meta.yaml new file mode 100644 index 0000000000000..7d7192a893d7d --- /dev/null +++ b/recipes/orthanq/meta.yaml @@ -0,0 +1,58 @@ +{% set version = "1.3.0" %} + +package: + name: orthanq + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage("orthanq", max_pin="x") }} + +source: + url: https://github.com/orthanq/orthanq/archive/v{{ version }}.tar.gz + sha256: 87097f24321bfb21f109a7d995a4318fba8add9389c7e4c4598a0a70a795283a + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('cxx') }} + - {{ compiler('rust') }} + - rust >=1.54 + - pkg-config + - make + - cmake + - perl-findbin + host: + - gsl + - libcblas + - openssl + - zlib + - bzip2 + - xz + - clangdev + - coincbc + - hdf5 =1.10.5 + - fontconfig + run: + - gsl + - libcblas + - openssl + - zlib + - bzip2 + - xz + - clangdev + - coincbc + - hdf5 =1.10.5 + - fontconfig + +test: + commands: + - orthanq -h + +about: + home: https://github.com/orthanq/orthanq + license: MIT + license_family: MIT + license_file: LICENSE + summary: Uncertainty aware HLA typing and general haplotype quantification diff --git a/recipes/orthoflow/meta.yaml b/recipes/orthoflow/meta.yaml index ca8111d636967..be8b066f348c6 100644 --- a/recipes/orthoflow/meta.yaml +++ b/recipes/orthoflow/meta.yaml @@ -1,5 +1,5 @@ {% set name = "orthoflow" %} -{% set version = "0.3.0" %} +{% set version = "0.3.4" %} package: name: {{ name|lower }} @@ -7,25 +7,24 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/orthoflow-{{ version }}.tar.gz - sha256: bdfb03dbdccec636adee9be5c8a5a8eec682c82f3435da90ae7c504a2899f9e6 + sha256: 063bff7c0f5e4a62e637f472ce27b95a6ccd8709fcf381b8b735bfd7df3a55e6 build: entry_points: - orthoflow = orthoflow.main:app noarch: python - script: {{ PYTHON }} -m pip install . -vv + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv number: 0 run_exports: - - {{ pin_subpackage(name, max_pin="x") }} + - {{ pin_subpackage(name, max_pin="x.x") }} requirements: host: - - python - - setuptools + - python >=3.8,<3.12 - poetry-core >=1.0.0 - pip run: - - python + - python >=3.8,<3.12 - snakemake-minimal >=7.0.0 - pandas >=1.2.5,<2.0.0 - typer >=0.4.1 @@ -36,8 +35,9 @@ requirements: - appdirs >=1.4.4 - joblib >=1.2.0 - toml >=0.10.2 - - phytest >=1.2.0 + - phytest >=1.4.1 - rich >=13.3.3 + - pulp 2.7.0 test: imports: @@ -49,6 +49,7 @@ about: home: https://github.com/rbturnbull/orthoflow summary: Orthoflow is a workflow for phylogenetic inference of genome-scale datasets of protein-coding genes. license: Apache-2.0 + license_family: APACHE license_file: LICENSE dev_url: https://github.com/rbturnbull/orthoflow doc_url: https://rbturnbull.github.io/orthoflow/ diff --git a/recipes/ostir/meta.yaml b/recipes/ostir/meta.yaml index d826cf029e5fa..14914da27c56f 100644 --- a/recipes/ostir/meta.yaml +++ b/recipes/ostir/meta.yaml @@ -1,5 +1,5 @@ {% set name = "OSTIR" %} -{% set version = "1.1.0" %} +{% set version = "1.1.2" %} package: name: "{{ name|lower }}" @@ -7,21 +7,23 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 05df18370a371ea1fa5260d1eeeebf015368363b4174ee1005b3047c697489b4 + sha256: 9ca8941245ed0265e87e68c4b09adc599324d8f9e10e19e377262680288c7771 build: number: 0 entry_points: - ostir = ostir.ostir:main - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" noarch: python + run_exports: + - {{ pin_subpackage('ostir', max_pin="x.x.x") }} requirements: host: - pip - - python >=3.7 + - python >=3.8 run: - - python >=3.7 + - python >=3.8 - viennarna >=2.4.18 - numpy >=1.20.1 @@ -34,10 +36,12 @@ test: about: home: "https://github.com/barricklab/ostir" - license: "GNU General Public v3 or later (GPLv3+)" + license: "GPL-3.0-or-later" license_family: GPL3 license_file: "LICENSE" summary: "Open Source Transcription Initiation Rates" + doc_url: "https://github.com/barricklab/ostir/wiki" + dev_url: "https://github.com/barricklab/ostir" extra: recipe-maintainers: diff --git a/recipes/pairix/build.sh b/recipes/pairix/build.sh index d91603e1fb483..478e63e9afca8 100644 --- a/recipes/pairix/build.sh +++ b/recipes/pairix/build.sh @@ -1,20 +1,27 @@ #!/bin/bash +mkdir -p "${PREFIX}/bin" + # Install both the pairix binaries and the Python extension module -export C_INCLUDE_PATH=${PREFIX}/include -export LIBRARY_PATH=${PREFIX}/lib -make -cp bin/pairix $PREFIX/bin/pairix -cp bin/pairs_merger $PREFIX/bin/pairs_merger -cp bin/streamer_1d $PREFIX/bin/streamer_1d -cp util/column_remover.pl $PREFIX/bin/column_remover.pl -cp util/duplicate_header_remover.pl $PREFIX/bin/duplicate_header_remover.pl -cp util/fragment_4dnpairs.pl $PREFIX/bin/fragment_4dnpairs.pl -cp util/juicer_shortform2pairs.pl $PREFIX/bin/juicer_shortform2pairs.pl -cp util/merge-pairs.sh $PREFIX/bin/merge-pairs.sh -cp util/merged_nodup2pairs.pl $PREFIX/bin/merged_nodup2pairs.pl -cp util/old_merged_nodup2pairs.pl $PREFIX/bin/old_merged_nodup2pairs.pl -cp util/process_merged_nodup.sh $PREFIX/bin/process_merged_nodup.sh -cp util/process_old_merged_nodup.sh $PREFIX/bin/process_old_merged_nodup.sh -cp util/bam2pairs/bam2pairs $PREFIX/bin/bam2pairs -$PYTHON setup.py install --single-version-externally-managed --record=record.txt +export C_INCLUDE_PATH="${PREFIX}/include" +export LIBRARY_PATH="${PREFIX}/lib" + +make CC="${CC}" + +cp ${SRC_DIR}/util/*.pl ${PREFIX}/bin/ +cp ${SRC_DIR}/util/*.sh ${PREFIX}/bin/ +cp ${SRC_DIR}/util/bam2pairs/bam2pairs ${PREFIX}/bin/ + +# Fix perl shebang +sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' $PREFIX/bin/column_remover.pl +sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' $PREFIX/bin/duplicate_header_remover.pl +sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' $PREFIX/bin/fragment_4dnpairs.pl +sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' $PREFIX/bin/juicer_shortform2pairs.pl +sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' $PREFIX/bin/merged_nodup2pairs.pl +sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' $PREFIX/bin/old_merged_nodup2pairs.pl + +cp ${SRC_DIR}/bin/pairix ${PREFIX}/bin/ +cp ${SRC_DIR}/bin/pairs_merger ${PREFIX}/bin/ +cp ${SRC_DIR}/bin/streamer_1d ${PREFIX}/bin/ + +${PYTHON} -m pip install . -vvv --no-deps --no-build-isolation --no-cache-dir diff --git a/recipes/pairix/build_failure.osx-64.yaml b/recipes/pairix/build_failure.osx-64.yaml deleted file mode 100644 index 919f523e493c3..0000000000000 --- a/recipes/pairix/build_failure.osx-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: 171fe0735fef1a9e10a803aefb6b400f711ced35e2783b546dd36d6aeae21f7f # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |2- - int dim = ti_get_sc2(idx)1==0?1:2; - ^~~ - ./pairix.h:209:36: note: passing argument to parameter 'idx' here - int ti_get_sc2(ti_index_t *idx); - ^ - index.c:1219:17: warning: initializing 'char **' with an expression of type 'const char **' discards qualifiers in nested pointer types [-Wincompatible-pointer-types-discards-qualifiers] - char **chrpairlist = ti_seqname(t->idx, &n_seqpair_list); - ^ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - index.c:1236:59: warning: passing 'char **' to parameter of type 'const char **' discards qualifiers in nested pointer types [-Wincompatible-pointer-types-discards-qualifiers] - sequential_iter_t *siter = ti_querys_2d_multi(t, regions, n_sub_list); - ^~~~~~~ - ./pairix.h:131:73: note: passing argument to parameter 'regs' here - sequential_iter_t *ti_querys_2d_multi(pairix_t *t, const char **regs, int nRegs); - ^ - index.c:1242:23: warning: initializing 'char *' with an expression of type 'const char *' discards qualifiers [-Wincompatible-pointer-types-discards-qualifiers] - *sp=0; char *chr1 = reg; - ^ ~~~ - index.c:1246:17: warning: initializing 'char **' with an expression of type 'const char **' discards qualifiers in nested pointer types [-Wincompatible-pointer-types-discards-qualifiers] - char **chrpairlist = ti_seqname(t->idx, &n_seqpair_list); - ^ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - index.c:1263:59: warning: passing 'char **' to parameter of type 'const char **' discards qualifiers in nested pointer types [-Wincompatible-pointer-types-discards-qualifiers] - sequential_iter_t *siter = ti_querys_2d_multi(t, regions, n_sub_list); - ^~~~~~~ - ./pairix.h:131:73: note: passing argument to parameter 'regs' here - sequential_iter_t *ti_querys_2d_multi(pairix_t *t, const char **regs, int nRegs); - ^ - index.c:1417:24: error: incompatible pointer to integer conversion returning 'ti_iter_t' (aka 'struct __ti_iter_t *') from a function with result type 'int' [-Wint-conversion] - if (name == 0) return ti_iter_first(); - ^~~~~~~~~~~~~~~ - index.c:1469:20: warning: using the result of an assignment as a condition without parentheses [-Wparentheses] - if( miter->iu = calloc(n,sizeof(iter_unit*))) { - ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - index.c:1469:20: note: place parentheses around the assignment to silence this warning - if( miter->iu = calloc(n,sizeof(iter_unit*))) { - ^ - ( ) - index.c:1469:20: note: use '==' to turn this assignment into an equality comparison - if( miter->iu = calloc(n,sizeof(iter_unit*))) { - ^ - == - index.c:1537:19: warning: assigning to 'char *' from 'const char *' discards qualifiers [-Wincompatible-pointer-types-discards-qualifiers] - miu[i]->s = ti_iter_read(miu[i]->t->fp, miu[i]->iter, miu[i]->len, seqonly); - ^ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - index.c:1543:17: warning: assigning to 'char *' from 'const char *' discards qualifiers [-Wincompatible-pointer-types-discards-qualifiers] - miu[0]->s = ti_iter_read(miu[0]->t->fp, miu[0]->iter, miu[0]->len, seqonly); // get next entry for the flushed iter - ^ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - index.c:1573:11: warning: initializing 'char *' with an expression of type 'const char *' discards qualifiers [-Wincompatible-pointer-types-discards-qualifiers] - char *s = ti_iter_read(siter->t->fp,siter->iter[siter->curr], len, 0); - ^ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - index.c:1576:9: warning: assigning to 'char *' from 'const char *' discards qualifiers [-Wincompatible-pointer-types-discards-qualifiers] - s = ti_iter_read(siter->t->fp,siter->iter[siter->curr], len, 0); - ^ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - index.c:1643:22: warning: assigning to 'char **' from 'const char **' discards qualifiers in nested pointer types [-Wincompatible-pointer-types-discards-qualifiers] - seqnames = ti_seqname(tbs[i]->idx,&len); - ^ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - index.c:1911:34: warning: passing 'const char *' to parameter of type 'char *' discards qualifiers [-Wincompatible-pointer-types-discards-qualifiers] - char *reg2 = flip_region(reg, get_region_split_character(tb)); - ^~~ - index.c:1743:27: note: passing argument to parameter 's' here - char *flip_region ( char* s, char region_split_character) { - ^ - index.c:1971:12: warning: initializing 'char **' with an expression of type 'const char **' discards qualifiers in nested pointer types [-Wincompatible-pointer-types-discards-qualifiers] - char **seqnames = ti_seqname(idx,&len); - ^ ~~~~~~~~~~~~~~~~~~~~ - index.c:1977:64: warning: passing 'const char *' to parameter of type 'void *' discards qualifiers [-Wincompatible-pointer-types-discards-qualifiers] - if(ti_get_tid(idx, reg2)!=-1) { free(seqnames); free(reg2); return(0); } // not a triangle - ^~~~ - /Applications/Xcode_14.2.app/Contents/Developer/Platforms/MacOSX.platform/Developer/SDKs/MacOSX10.9.sdk/usr/include/stdlib.h:143:18: note: passing argument to parameter here - void free(void *); - ^ - index.c:1978:14: warning: passing 'const char *' to parameter of type 'void *' discards qualifiers [-Wincompatible-pointer-types-discards-qualifiers] - free(reg2); - ^~~~ - /Applications/Xcode_14.2.app/Contents/Developer/Platforms/MacOSX.platform/Developer/SDKs/MacOSX10.9.sdk/usr/include/stdlib.h:143:18: note: passing argument to parameter here - void free(void *); - ^ - 18 warnings and 1 error generated. - make[2]: *** [Makefile:15: index.o] Error 1 - make[2]: Leaving directory '$SRC_DIR/src' - make[1]: *** [Makefile:18: all-recur] Error 1 - make[1]: Leaving directory '$SRC_DIR/src' - cp: bin/pairix: No such file or directory - Traceback (most recent call last): - File "/opt/mambaforge/envs/bioconda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 2198, in build - utils.check_call_env(cmd, env=env, rewrite_stdout_env=rewrite_env, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/utils.py", line 451, in check_call_env - return _func_defaulting_env_to_os_environ("call", *popenargs, **kwargs) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/utils.py", line 427, in _func_defaulting_env_to_os_environ - raise subprocess.CalledProcessError(proc.returncode, _args) - subprocess.CalledProcessError: Command '['/bin/bash', '-o', 'errexit', '/opt/mambaforge/envs/bioconda/conda-bld/pairix_1685394139065/work/conda_build.sh']' returned non-zero exit status 1. -# Last 100 lines of the build log. diff --git a/recipes/pairix/conda_build_config.yaml b/recipes/pairix/conda_build_config.yaml new file mode 100644 index 0000000000000..1a582a0844fac --- /dev/null +++ b/recipes/pairix/conda_build_config.yaml @@ -0,0 +1,3 @@ +# current version does not build with newer compilers +c_compiler_version: + - 14 # [osx] diff --git a/recipes/pairix/meta.yaml b/recipes/pairix/meta.yaml index f2d810a4b6cf3..5a39beae8b866 100644 --- a/recipes/pairix/meta.yaml +++ b/recipes/pairix/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.3.7" %} +{% set version = "0.3.8" %} package: name: pairix @@ -6,12 +6,14 @@ package: source: url: https://github.com/4dn-dcic/pairix/archive/{{ version }}.tar.gz - md5: a1f9b3c7b13d904dfe736cf5e66c2385 + sha256: 51e349c034eda3bce21d9f89a8e477471d2db5a3ef4424a39999d1ec316e2726 patches: - src_Makefile.patch build: - number: 5 + number: 1 + run_exports: + - {{ pin_subpackage('pairix', max_pin="x.x") }} requirements: build: @@ -19,21 +21,28 @@ requirements: - {{ compiler('c') }} host: - python - - setuptools + - pip - zlib run: - - htslib - python + - perl + - htslib + - samtools test: - imports: - - pypairix + #imports: + #- pypairix commands: - pairix --help about: home: https://github.com/4dn-dcic/pairix license: MIT + license_family: MIT license_file: "LICENSE.txt" summary: 2D indexing on bgzipped text files of paired genomic coordinates - license_family: MIT + dev_url: https://github.com/4dn-dcic/pairix + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/pairtools/meta.yaml b/recipes/pairtools/meta.yaml index 43d9a7bf44b70..62746b7ac48ad 100644 --- a/recipes/pairtools/meta.yaml +++ b/recipes/pairtools/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pairtools" %} -{% set version = "1.0.3" %} +{% set version = "1.1.0" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 12b482f04d66a01b80ababfb4b6d37959f7995c29f4bb1640f1102d8566d478f + sha256: 3f265ebcd50fb07a36199a99c58f6b17810b48bacf2d5f3096453319c89bd522 build: number: 0 diff --git a/recipes/paml/meta.yaml b/recipes/paml/meta.yaml index 1509d22de4f07..e2eeb810e8291 100644 --- a/recipes/paml/meta.yaml +++ b/recipes/paml/meta.yaml @@ -11,7 +11,7 @@ source: sha256: {{ sha256 }} build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('paml', max_pin="x.x") }} @@ -37,6 +37,8 @@ about: license_file: LICENSE extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:paml - doi:10.1093/bioinformatics/13.5.555 diff --git a/recipes/panaroo/meta.yaml b/recipes/panaroo/meta.yaml index 4a3566f47f25b..1a459568ac0be 100644 --- a/recipes/panaroo/meta.yaml +++ b/recipes/panaroo/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.3.4" %} +{% set version = "1.5.0" %} {% set name = "panaroo" %} package: @@ -7,7 +7,7 @@ package: source: url: https://github.com/gtonkinhill/{{ name|lower }}/archive/v{{ version }}.tar.gz - sha256: 95d9b166b0f554ca9b6b9326d3a85a065edee468e7d469f77d8b5242d7f82b9b + sha256: 0a80f87cde8ee3d59cd62cdae434341979a03dfdeb07142c2f9ff3b54dc0477a build: number: 0 diff --git a/recipes/pango-designation/meta.yaml b/recipes/pango-designation/meta.yaml index 869455a8746fb..5be34f04fd20a 100644 --- a/recipes/pango-designation/meta.yaml +++ b/recipes/pango-designation/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.23" %} +{% set version = "1.27" %} package: name: pango-designation @@ -6,7 +6,7 @@ package: source: url: https://github.com/cov-lineages/pango-designation/archive/refs/tags/v{{ version }}.tar.gz - sha256: 5692d92d4b7ff902464552e81d71fc25dcafd0ada175af3b143246c14fc6d9c1 + sha256: da3e697eabb73fc835490b737a8c88558a8b92fc81601f9363baef50c70b350e build: number: 0 diff --git a/recipes/pangolin-data/meta.yaml b/recipes/pangolin-data/meta.yaml index 99468f431af4a..8f6e62a645bd9 100644 --- a/recipes/pangolin-data/meta.yaml +++ b/recipes/pangolin-data/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.23.1" %} +{% set version = "1.26" %} package: name: pangolin-data @@ -6,7 +6,7 @@ package: source: url: https://github.com/cov-lineages/pangolin-data/archive/refs/tags/v{{ version }}.tar.gz - sha256: 3a845838cf31131d8bc7e0c19cb3e78e2c99a5894ac44452bfa5f86a91dca056 + sha256: 6aed4738a29260d616654d69c79c540de1b547139cb51b54670970b023aba4bd build: number: 0 diff --git a/recipes/pangu/meta.yaml b/recipes/pangu/meta.yaml index cabad42e5e79a..e20eb3c1897c3 100644 --- a/recipes/pangu/meta.yaml +++ b/recipes/pangu/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.2.2" %} -{% set sha256 = "91133019717eb8becc6f9345257891206bea57c5b3706b18440cfe3c393fd07c" %} +{% set version = "0.2.8" %} +{% set sha256 = "4360539dc2a881c3557d43e4c4322326385a7efa929b18f223aabf2e136fdea9" %} package: name: pangu @@ -14,7 +14,9 @@ build: noarch: python entry_points: - pangu = pangu.__main__:main_cli - script: python -m pip install --no-deps -vv . + script: {{ PYTHON }} -m pip install --no-deps --no-build-isolation -vvv . + run_exports: + - {{ pin_subpackage('pangu', max_pin="x.x") }} requirements: host: diff --git a/recipes/panisa/meta.yaml b/recipes/panisa/meta.yaml index c65fdd7f37bab..511cc0e6a3ca8 100644 --- a/recipes/panisa/meta.yaml +++ b/recipes/panisa/meta.yaml @@ -1,5 +1,5 @@ {% set name = "panISa" %} -{% set version = "0.1.6" %} +{% set version = "0.1.7" %} package: name: "{{ name|lower }}" @@ -7,22 +7,22 @@ package: source: url: "https://github.com/bvalot/panISa/archive/refs/tags/{{ version }}.tar.gz" - sha256: 6bb76139cd6e263073f3194ea21712c406e327c273e327c0bb270dcd556cada3 + sha256: 5c9b6c4c30ebe4e43439e2a85ae304b9ed434239165749395232ba06fdbbc44c build: number: 0 noarch: python - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('panisa', max_pin="x.x") }} requirements: host: - pip - - pysam >=0.9 - - python - - requests >=2.12 + - python >=3.7 run: - pysam >=0.9 - - python + - python >=3.7 - requests >=2.12 test: @@ -34,9 +34,11 @@ test: about: home: "https://github.com/bvalot/panISa" - license: "GNU General Public v3 (GPLv3)" + license: "GPL-3.0-or-later" license_family: GPL3 + license_file: LICENSE summary: "panISa is a software to search insertion sequence (IS) on resequencing data (bam file)" + dev_url: "https://github.com/bvalot/panISa" extra: recipe-maintainers: diff --git a/recipes/paraphase/meta.yaml b/recipes/paraphase/meta.yaml index df5ccd7268957..1c59d226f457e 100644 --- a/recipes/paraphase/meta.yaml +++ b/recipes/paraphase/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "3.0.0" %} -{% set sha256 = "d26599b567e7e57003daedc5645cf19fc92789f1a4e88baff2e092723fbc3085" %} +{% set version = "3.1.1" %} +{% set sha256 = "6f43404f35e158de787926811869eb5027e93e74e08c6c8a9db7993a50d89c3c" %} package: name: paraphase diff --git a/recipes/parasail-python/meta.yaml b/recipes/parasail-python/meta.yaml index 9806e254863e3..1694669f24f95 100644 --- a/recipes/parasail-python/meta.yaml +++ b/recipes/parasail-python/meta.yaml @@ -13,9 +13,11 @@ source: - darwin-libtool-name.patch build: - number: 0 + number: 1 skip: True # [py < 37] - script: {{ PYTHON }} -m pip install . --use-pep517 -vv + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation --no-cache-dir -vvv + run_exports: + - {{ pin_subpackage('parasail-python', max_pin="x") }} requirements: build: @@ -29,7 +31,6 @@ requirements: host: - python - pip - - wheel - zlib run: - python @@ -45,8 +46,10 @@ about: license: BSD-3-Clause license_family: BSD license_file: COPYING - dev_url: https://pypi.org/project/parasail/ + dev_url: https://github.com/jeffdaily/parasail-python extra: identifiers: - doi:10.1186/s12859-016-0930-z + additional-platforms: + - linux-aarch64 diff --git a/recipes/parascopy/meta.yaml b/recipes/parascopy/meta.yaml index f83ef261d7f2e..5f8fbfe538d8a 100644 --- a/recipes/parascopy/meta.yaml +++ b/recipes/parascopy/meta.yaml @@ -1,5 +1,5 @@ {% set name = "parascopy" %} -{% set version = "1.14.1" %} +{% set version = "1.15.0" %} package: name: {{ name|lower }} @@ -15,7 +15,7 @@ build: source: url: https://github.com/tprodanov/{{ name }}/archive/v{{ version }}.tar.gz - sha256: a475086faeea706448db866ca8c504b3c17f3988a67fd8c174f1a334bd4bb4f1 + sha256: 4e588ccefb63694f0cc434d92ad45999425dc4dfd168c37155d14d9cf249c4d4 requirements: build: @@ -28,10 +28,12 @@ requirements: - python - pip - bzip2 + - zlib - htslib - tabixpp run: - python + - zlib - numpy >=1.15 - scipy >=1.5 - pysam >=0.17 diff --git a/recipes/parsnp/build.sh b/recipes/parsnp/build.sh index f8fa0b7b71356..8c6ca7f6a253e 100644 --- a/recipes/parsnp/build.sh +++ b/recipes/parsnp/build.sh @@ -34,6 +34,7 @@ rm -R muscle/m4 cp parsnp $PREFIX/bin cp extend.py $PREFIX/bin cp logger.py $PREFIX/bin +cp partition.py $PREFIX/bin cp src/parsnp_core $PREFIX/bin/bin cp template.ini $PREFIX/bin cp -R bin $PREFIX/bin diff --git a/recipes/parsnp/cpu_count.patch b/recipes/parsnp/cpu_count.patch new file mode 100644 index 0000000000000..eac0bdea42d0f --- /dev/null +++ b/recipes/parsnp/cpu_count.patch @@ -0,0 +1,52 @@ +diff --git a/parsnp b/parsnp +index 85fd9c9..9501ab8 100755 +--- a/parsnp ++++ b/parsnp +@@ -8,6 +8,7 @@ + import os, sys, string, random, subprocess, time, operator, math, datetime, numpy #pysam + from collections import defaultdict + import shutil ++import multiprocessing + import shlex + from tempfile import TemporaryDirectory + import re +@@ -1210,8 +1211,13 @@ SETTINGS: + (len(outputDir)+17)*"*")) + + # If we requested more threads than available, give a warning. +- if len(os.sched_getaffinity(0)) < threads: +- logger.warning("You have asked to use more threads than you have available on your machine. This may lead to serious performance degredation with RAxML.") ++ try: ++ if len(os.sched_getaffinity(0)) < threads: ++ logger.warning("You have asked to use more threads than you have available on your machine. This may lead to serious performance degredation with RAxML.") ++ except AttributeError: ++ if multiprocessing.cpu_count() < threads: ++ logger.warning("You have asked to use more threads than you have available on your machine. This may lead to serious performance degredation with RAxML.") ++ + logger.info("<>") + + #1)read fasta files (contigs/scaffolds/finished/DBs/dirs) +@@ -1614,19 +1620,16 @@ SETTINGS: + else: + import partition + +- full_query_list_path = f"{outputDir}/config/input-list.txt" +- with open(full_query_list_path, 'w') as input_list_handle: +- random_seeded.shuffle(finalfiles) +- for qf in finalfiles: +- input_list_handle.write(qf + "\n") +- + if len(finalfiles) % args.partition_size == 1: + logger.warning("Incrementing partition size by 1 to avoid having a remainder partition of size 1") + args.partition_size += 1 + partition_output_dir = f"{outputDir}/partition" + partition_list_dir = f"{partition_output_dir}/input-lists" + os.makedirs(partition_list_dir, exist_ok=True) +- run_command(f"split -l {args.partition_size} -a 5 --additional-suffix '.txt' {full_query_list_path} {partition_list_dir}/{partition.CHUNK_PREFIX}-") ++ for partition_idx in range(math.ceil(len(finalfiles) / args.partition_size)): ++ with open(f"{partition_list_dir}/{partition.CHUNK_PREFIX}-{partition_idx:010}.txt", 'w') as part_out: ++ for qf in finalfiles[partition_idx*args.partition_size : (partition_idx+1)*args.partition_size]: ++ part_out.write(f"{qf}\n") + + chunk_label_parser = re.compile(f'{partition.CHUNK_PREFIX}-(.*).txt') + chunk_labels = [] diff --git a/recipes/parsnp/meta.yaml b/recipes/parsnp/meta.yaml index acc3bfddfea80..d99dc6f3bfb79 100644 --- a/recipes/parsnp/meta.yaml +++ b/recipes/parsnp/meta.yaml @@ -1,16 +1,17 @@ -{% set version = "1.7.4" %} +{% set version = "2.0.5" %} package: name: parsnp version: '{{version}}' source: - url: "https://github.com/marbl/parsnp/archive/refs/tags/v{{version}}.tar.gz" - sha256: c24a1b395b1ddb6ab2a1f1c41e7e575b45da2ffed99581225be05fdad761684f + url: "https://github.com/marbl/parsnp/archive/refs/tags/v{{version}}.tar.gz" + sha256: 1d23695d0d624fa17e02c43b1d730200e526c17a48615593f75ee8fc35402489 build: - skip: True # [osx] - number: 2 + number: 0 + run_exports: + - {{ pin_subpackage('parsnp', max_pin="x") }} requirements: build: @@ -19,31 +20,29 @@ requirements: - autoconf - libtool - make - - llvm-openmp # [osx] - - openmp # [linux] host: - zlib - llvm-openmp # [osx] - - openmp # [linux] + - openmp # [linux] run: - python >=3.7 - llvm-openmp # [osx] - - openmp # [linux] - - harvesttools - - fasttree - - phipack + - openmp # [linux] - biopython - - numpy + - numpy - zlib - phipack - raxml - fasttree - - fastani # [linux] - - mash + - fastani + - mash - harvesttools - - mafft + - pyspoa + - tqdm about: home: https://github.com/marbl/parsnp license: "custom; see https://raw.githubusercontent.com/marbl/parsnp/master/LICENSE" summary: Parsnp is a command-line-tool for efficient microbial core genome alignment and SNP detection. + doc_url: "https://harvest.readthedocs.io/en/latest/content/parsnp/tutorial.html" + dev_url: https://github.com/marbl/parsnp diff --git a/recipes/parsnp/run_test.sh b/recipes/parsnp/run_test.sh index d8e2ab432847e..cb5ae8bb2dba1 100644 --- a/recipes/parsnp/run_test.sh +++ b/recipes/parsnp/run_test.sh @@ -9,3 +9,4 @@ parsnp -r ! -d mers_virus/genomes/*.fna -o test2 --verbose parsnp -g mers_virus/ref/England1.gbk -d mers_virus/genomes/*.fna -p 2 -C 1000 -c -o test --verbose --use-fasttree parsnp -r ! -d mers_virus/genomes/*.fna -o test2 --verbose -p 2 parsnp -r ! -d mers_virus/genomes/*.fna -o test3 --verbose -p 2 --extend-lcbs +parsnp -r ! -d mers_virus/genomes/*.fna -o test4 --verbose -p 2 --min-partition-size 10 diff --git a/recipes/pasa/build.sh b/recipes/pasa/build.sh index 726bc8573d514..788c19f7e9fdf 100644 --- a/recipes/pasa/build.sh +++ b/recipes/pasa/build.sh @@ -31,3 +31,5 @@ echo "export PASAHOME=${PASAHOME}" > ${PREFIX}/etc/conda/activate.d/${PKG_NAME}- mkdir -p ${PREFIX}/etc/conda/deactivate.d/ echo "unset PASAHOME" > ${PREFIX}/etc/conda/deactivate.d/${PKG_NAME}-${PKG_VERSION}.sh + +make clean diff --git a/recipes/pasa/meta.yaml b/recipes/pasa/meta.yaml index 2de53fba67c7e..b86f75dd4dd78 100644 --- a/recipes/pasa/meta.yaml +++ b/recipes/pasa/meta.yaml @@ -7,7 +7,9 @@ package: version: {{ version }} build: - number: 0 + number: 1 + run_exports: + - {{ pin_subpackage('pasa', max_pin="x") }} source: url: https://github.com/PASApipeline/PASApipeline/releases/download/pasa-v{{ version }}/PASApipeline.v{{ version }}.FULL.tar.gz @@ -23,7 +25,7 @@ requirements: - cdbtools - slclust - transdecoder - - gmap >=2021.08.25 + - gmap >=2023.10.10 - lighttpd # [linux] - samtools - perl @@ -48,9 +50,11 @@ test: about: home: "https://github.com/PASApipeline/PASApipeline" license: BSD-3-Clause + license_family: BSD license_file: LICENSE summary: "PASA, acronym for Program to Assemble Spliced Alignments (and pronounced 'pass-uh'), is a eukaryotic genome annotation tool that exploits spliced alignments of expressed transcript sequences to automatically model gene structures, and to maintain gene structure annotation consistent with the most recently available experimental sequence data. PASA also identifies and classifies all splicing variations supported by the transcript alignments." doc_url: "https://github.com/PASApipeline/PASApipeline/wiki" + dev_url: "https://github.com/PASApipeline/PASApipeline" extra: identifiers: diff --git a/recipes/pass/LICENSE b/recipes/pass/LICENSE new file mode 100644 index 0000000000000..8f286b96aa63f --- /dev/null +++ b/recipes/pass/LICENSE @@ -0,0 +1,674 @@ +GNU GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU General Public License is a free, copyleft license for +software and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. We, the Free Software Foundation, use the +GNU General Public License for most of our software; it applies also to +any other work released this way by its authors. You can apply it to +your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you have +certain responsibilities if you distribute copies of the software, or if +you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the manufacturer +can do so. This is fundamentally incompatible with the aim of +protecting users' freedom to change the software. The systematic +pattern of such abuse occurs in the area of products for individuals to +use, which is precisely where it is most unacceptable. Therefore, we +have designed this version of the GPL to prohibit the practice for those +products. If such problems arise substantially in other domains, we +stand ready to extend this provision to those domains in future versions +of the GPL, as needed to protect the freedom of users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU Affero General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the special requirements of the GNU Affero General Public License, +section 13, concerning interaction through a network will apply to the +combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU General Public License from time to time. Such new versions will +be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + ntEdit: scalable genome sequence polishing + Copyright (C) 2018-2019 BC Cancer + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see . + +Also add information on how to contact you by electronic and paper mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + ntEdit Copyright (C) 2018-2019 Rene Warren @ BC Cancer + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + +The hypothetical commands `show w' and `show c' should show the appropriate +parts of the General Public License. Of course, your program's commands +might be different; for a GUI interface, you would use an "about box". + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU GPL, see +. + + The GNU General Public License does not permit incorporating your program +into proprietary programs. If your program is a subroutine library, you +may consider it more useful to permit linking proprietary applications with +the library. If this is what you want to do, use the GNU Lesser General +Public License instead of this License. But first, please read +. diff --git a/recipes/pass/build.sh b/recipes/pass/build.sh new file mode 100755 index 0000000000000..5bf1eeb9bd3a7 --- /dev/null +++ b/recipes/pass/build.sh @@ -0,0 +1,3 @@ +#!/bin/bash +mkdir -p ${PREFIX}/bin +cp PASS ${PREFIX}/bin \ No newline at end of file diff --git a/recipes/pass/meta.yaml b/recipes/pass/meta.yaml new file mode 100644 index 0000000000000..96d7ce28ab436 --- /dev/null +++ b/recipes/pass/meta.yaml @@ -0,0 +1,33 @@ +{% set version = "0.3.1" %} +{% set version_tar = "0-3-1" %} +{% set name = "pass" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/bcgsc/{{ name | upper }}/releases/download/v{{ version }}/pass_v{{ version_tar}}.tar.gz + sha256: 813fab567b1159c6dc32ed8ad537d19c50e70bde347b4e8b1249a4ece1de4383 + +build: + noarch: generic + number: 0 + run_exports: + - {{ pin_subpackage('pass', max_pin="x") }} + +requirements: + run: + - perl + +test: + commands: + - PASS -h | grep "Usage" + +about: + summary: Proteome Assembler with Short Sequence peptides + home: https://github.com/bcgsc/PASS + license: GPL-3.0-only + license_file: LICENSE + doc_url: https://github.com/bcgsc/PASS + diff --git a/recipes/pastml/meta.yaml b/recipes/pastml/meta.yaml index 6a2f5557e6daf..b2a90ab3529f6 100644 --- a/recipes/pastml/meta.yaml +++ b/recipes/pastml/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pastml" %} -{% set version = "1.9.40" %} +{% set version = "1.9.43" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 5334bc8de70a968117240b90d90878ac935be18de6e6e485fb1a8f90cd539fea + sha256: 04307d153b92b7b25b8ddda49ff388884b9e5fd394856b256a459b497af02f82 build: number: 0 @@ -16,12 +16,14 @@ build: - pastml = pastml.acr:main - geomap = pastml.visualisation.generate_geomap:main - transition_counter = pastml.utilities.transition_counter:main - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation" + run_exports: + - {{ pin_subpackage('pastml', max_pin="x") }} requirements: host: - pip - - python >=3.8 + - python >=3.9 run: - biopython >=1.70 - ete3 >=3.1.1 @@ -29,7 +31,7 @@ requirements: - jinja2 >=2.11.0 - numpy >=1.22 - pandas >=1.0.0 - - python >=3.8 + - python >=3.9 - scipy >=1.5.0 test: @@ -53,8 +55,8 @@ about: node states based on the tip states, with a selection of maximum likelihood and parsimonious methods. The result is then visualised as a zoomable html map. - license: GPL-3.0 - license_family: GPL + license: GPL-3.0-or-later + license_family: GPL3 license_file: LICENSE doc_url: https://pastml.pasteur.fr/help dev_url: https://github.com/evolbioinfo/pastml diff --git a/recipes/pathogen-profiler/meta.yaml b/recipes/pathogen-profiler/meta.yaml index a6d852663c109..7f7282124371c 100644 --- a/recipes/pathogen-profiler/meta.yaml +++ b/recipes/pathogen-profiler/meta.yaml @@ -1,6 +1,6 @@ {% set name = "pathogen-profiler" %} -{% set version = "3.1.0" %} -{% set sha256 = "638f27205f20632624b98b4e11e176455f772f5ae35a9d7b09ab79373a324472" %} +{% set version = "4.1.0" %} +{% set sha256 = "ddf7570f46f11ea7dae48dbd2d66811f4ed9c8d1b80a3e62049369ed01f22024" %} package: name: {{name}} @@ -22,7 +22,7 @@ requirements: - python - pip run: - - python >=3.7 + - python >=3.10 - git - trimmomatic - bwa @@ -34,7 +34,7 @@ requirements: - delly >=0.8.7 - gatk4 - bedtools - - freebayes >=1.3.5,<1.3.7 + - freebayes =1.3.6 - samclip - snpeff >=5.1 - requests @@ -43,10 +43,14 @@ requirements: - openjdk >=11.0.8 - kmc >=3.2.1 - dsk >=2.2 - - cryptography >=39.0.1 - rich-argparse - joblib >=1.3.0 - pysam + - pydantic >=2.6 + - tomli + - itol-config + - seqkit + - sourmash test: imports: diff --git a/recipes/pb-falcon/meta.yaml b/recipes/pb-falcon/meta.yaml index 5ea3122f61ee8..dc4734f3db4f2 100644 --- a/recipes/pb-falcon/meta.yaml +++ b/recipes/pb-falcon/meta.yaml @@ -12,8 +12,10 @@ source: folder: pb-falcon build: - number: 4 + number: 5 skip: True # [py27 or py36 or osx] + run_exports: + - {{ pin_subpackage(name, max_pin='x') }} requirements: build: @@ -31,9 +33,9 @@ requirements: - python - networkx >=1.9.1 - future >=0.16.0 - - python-edlib>=1.2.4 + - python-edlib >=1.2.4 - python-intervaltree - - python-msgpack>=0.6.1 + - python-msgpack >=0.6.1 - numpy - pysam @@ -55,3 +57,7 @@ about: - pb-cdunn - isovic - zkronenberg + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/pbfusion/meta.yaml b/recipes/pbfusion/meta.yaml index 8433b41fcd948..b2a63c19e6a0e 100644 --- a/recipes/pbfusion/meta.yaml +++ b/recipes/pbfusion/meta.yaml @@ -1,6 +1,6 @@ {% set name = "pbfusion" %} -{% set version = "0.4.0" %} -{% set pbfusion_sha256 = "bb6c37188288492dbcf5f1e9ddbc02492e86590e5a4567d6ded0d1ab9deb12ec" %} +{% set version = "0.4.1" %} +{% set pbfusion_sha256 = "c6abde2ee1f88355158bf1c655e5ae754f942708f7addbaef8d626fdebfcfe7a" %} package: name: {{ name }} diff --git a/recipes/pbgzip/build.sh b/recipes/pbgzip/build.sh index 23e9ca4d9a87e..af8355c3b5830 100644 --- a/recipes/pbgzip/build.sh +++ b/recipes/pbgzip/build.sh @@ -4,5 +4,5 @@ sh autogen.sh ./configure --prefix ${PREFIX} --enable-igzip export C_INCLUDE_PATH=${PREFIX}/include export LIBRARY_PATH=${PREFIX}/lib -make +make -j${CPU_COUNT} make install diff --git a/recipes/pbgzip/meta.yaml b/recipes/pbgzip/meta.yaml index 9dd7a7132b0cf..dc3cfeeb5b6d3 100644 --- a/recipes/pbgzip/meta.yaml +++ b/recipes/pbgzip/meta.yaml @@ -7,8 +7,9 @@ source: sha256: 544820be0da38f6af7be18792d00d6d3dd2fe3f7f3b08a67c3aa35fb1bbeaeb1 build: - number: 4 - skip: False + number: 5 + run_exports: + - {{ pin_subpackage('pbgzip', max_pin=None) }} requirements: build: @@ -31,3 +32,7 @@ about: home: https://github.com/nh13/pbgzip summary: Parallel Block GZIP license: MIT/Expat + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/pbsim3/meta.yaml b/recipes/pbsim3/meta.yaml index 5a166dcaeb058..c9902c70eb6ef 100644 --- a/recipes/pbsim3/meta.yaml +++ b/recipes/pbsim3/meta.yaml @@ -1,6 +1,6 @@ {% set name = "pbsim3" %} -{% set version = "3.0.1" %} -{% set sha256 = "4d2d0cabc1adfd1ade0cde983fb37f7e8af477c0fd7b09ef3e753742b89cc541" %} +{% set version = "3.0.4" %} +{% set sha256 = "d9dd51d7522d9f2f21d3cab6f5f7ff0131702cba73dd1baa0b7d13f813d3854e" %} package: name: {{ name }} diff --git a/recipes/pbstarphase/meta.yaml b/recipes/pbstarphase/meta.yaml index 9b43d0bc72b8f..ee493c0f2c0c3 100644 --- a/recipes/pbstarphase/meta.yaml +++ b/recipes/pbstarphase/meta.yaml @@ -1,6 +1,6 @@ {% set name = "pbstarphase" %} -{% set version = "0.8.0" %} -{% set sha256 = "df207d5aa29f0e0088dff838403664ca624f71d1f6c176374f2354234b74850e" %} +{% set version = "0.9.1" %} +{% set sha256 = "cfa6696181c54d2aca2e338aec599ba9dc16adc08c6b66d5736e8322a3697823" %} package: name: {{ name }} diff --git a/recipes/pcaone/meta.yaml b/recipes/pcaone/meta.yaml index 3f67d9dbac7c4..a2a1ec298e3f8 100644 --- a/recipes/pcaone/meta.yaml +++ b/recipes/pcaone/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.4.1" %} -{% set sha256 = "03f8afa9870507e03aa90a349a00f70f56bbf202b05a4d3d648148f3c30b6518" %} +{% set version = "0.4.4" %} +{% set sha256 = "39e9b2fb3370ee584fbeed8522260c44bb6053489819057f1a232267a526f72a" %} package: diff --git a/recipes/pcst-fast/meta.yaml b/recipes/pcst-fast/meta.yaml index bf2fc543c6499..579a73edb174d 100644 --- a/recipes/pcst-fast/meta.yaml +++ b/recipes/pcst-fast/meta.yaml @@ -1,18 +1,20 @@ {% set name = "pcst-fast" %} -{% set version = "1.0.8" %} +{% set version = "1.0.10" %} package: name: "{{ name }}" version: "{{ version }}" source: - url: https://github.com/fraenkel-lab/pcst_fast/archive/refs/tags/1.0.8.tar.gz - sha256: fea6672830d539ebcf29e8a2f1a7b7771ced332bea6e66b4e1093931e62ce5df + url: https://files.pythonhosted.org/packages/d4/fd/64b51c867bad63e6622ff97cad6230b94b19b5a61e30424cd69c8353091c/pcst_fast-{{ version }}.tar.gz + sha256: 3b5694110ce2e004471f383267d5e4ab7fe1ba9828954e8c42560ac1e42b25e6 build: - number: 1 - skip: True # [ py!=36 ] - script: {{ PYTHON }} -m pip install . --ignore-installed --no-deps -vv + number: 0 + skip: True # [py < 38] + script: {{ PYTHON }} -m pip install . --no-build-isolation --no-deps --use-pep517 -vvv + run_exports: + - {{ pin_subpackage('pcst-fast', max_pin="x") }} requirements: build: @@ -21,7 +23,7 @@ requirements: - pip - pybind11 >=2.4 - python - - setuptools + - setuptools_scm run: - pybind11 >=2.4 - python @@ -34,7 +36,8 @@ about: home: https://github.com/fraenkel-lab/pcst_fast license: MIT license_family: MIT - summary: Implementation for PCST + license_file: LICENSE.txt + summary: "A fast implementation of the Goemans-Williamson scheme for the PCST (prize-collecting Steiner tree/forest) problem." extra: recipe-maintainers: diff --git a/recipes/peaks2utr/meta.yaml b/recipes/peaks2utr/meta.yaml index b0f5d08d094ca..3d0de3bfbe81d 100644 --- a/recipes/peaks2utr/meta.yaml +++ b/recipes/peaks2utr/meta.yaml @@ -1,5 +1,5 @@ {% set name = "peaks2utr" %} -{% set version = "1.2.4" %} +{% set version = "1.2.6" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/peaks2utr-{{ version }}.tar.gz - sha256: 9fb91c2361e8de95994f1de7bf8414710777ecd52b23d35628270f0bb2e2412e + sha256: ba17dd81b942e6b846804b03154358e331c489d7bc12573711c551faece11fed build: number: 0 diff --git a/recipes/peer/build.sh b/recipes/peer/build.sh new file mode 100644 index 0000000000000..1f1932d3cfc51 --- /dev/null +++ b/recipes/peer/build.sh @@ -0,0 +1,10 @@ +#!/bin/bash + +set -eux + +mkdir build +cd build +cmake ../ -DBUILD_PYTHON_PACKAGE=OFF -DBUILD_PEERTOOL=ON +make -j $CPU_COUNT +mkdir -p "${PREFIX}/bin" +install src/peertool "${PREFIX}/bin" diff --git a/recipes/peer/meta.yaml b/recipes/peer/meta.yaml new file mode 100644 index 0000000000000..b24994dc6127a --- /dev/null +++ b/recipes/peer/meta.yaml @@ -0,0 +1,38 @@ +{% set name = "peer" %} +{% set version = "1.3" %} +# no tags in upstream repository yet +{% set commit = "40bc4b2cd92459ce42f44dfe279717436395f3f6" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/PMBio/peer/archive/{{ commit }}.tar.gz + sha256: 80a549354569ae5ec7d4d92c78e7f8fa72da08fcd11322611f737044c34861ed + patches: + - patches/0001-Comment-out-SWIG-package-search.patch + +build: + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('cxx') }} + - cmake + - make + +test: + commands: + - peertool --help | grep -q USAGE + +about: + home: https://github.com/PMBio/peer + license: GPL-2.0-or-later + license_file: + - LICENSE + - External/yaml-cpp/license.txt + summary: 'A collection of Bayesian approaches to infer hidden determinants and their effects from gene expression profiles using factor analysis methods' diff --git a/recipes/peer/patches/0001-Comment-out-SWIG-package-search.patch b/recipes/peer/patches/0001-Comment-out-SWIG-package-search.patch new file mode 100644 index 0000000000000..6628b8077e44a --- /dev/null +++ b/recipes/peer/patches/0001-Comment-out-SWIG-package-search.patch @@ -0,0 +1,31 @@ +From a66ffa0d4b5e0aca5a1de1ffad387eadef49447f Mon Sep 17 00:00:00 2001 +From: Travis Wrightsman +Date: Mon, 5 Feb 2024 12:21:17 -0500 +Subject: [PATCH] Comment out SWIG package search + +--- + CMakeLists.txt | 6 +++--- + 1 file changed, 3 insertions(+), 3 deletions(-) + +diff --git a/CMakeLists.txt b/CMakeLists.txt +index 80455af..0e0c66c 100644 +--- a/CMakeLists.txt ++++ b/CMakeLists.txt +@@ -71,11 +71,11 @@ endif (BUILD_UNIVERSAL) + #for finding external libraries. + #see /usr/local/share/cmake-2.6/Modules/Find*.cmake for more examples + +-find_package(SWIG REQUIRED) +-include(${SWIG_USE_FILE}) ++#find_package(SWIG REQUIRED) ++#include(${SWIG_USE_FILE}) + + include_directories(${CMAKE_CURRENT_SOURCE_DIR}) +-set(CMAKE_SWIG_FLAGS "") ++#set(CMAKE_SWIG_FLAGS "") + + set(CMAKE_MODULE_PATH "${PEER_SOURCE_DIR}/cmake" ${CMAKE_MODULE_PATH}) + include_directories(./include) +-- +2.39.2 + diff --git a/recipes/pegasusio/meta.yaml b/recipes/pegasusio/meta.yaml index 046eedbbb6559..c217cf33b836f 100644 --- a/recipes/pegasusio/meta.yaml +++ b/recipes/pegasusio/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pegasusio" %} -{% set version = "0.8.1" %} +{% set version = "0.9.0" %} package: name: {{ name|lower }} @@ -7,14 +7,16 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: "ea18b963315726a18819740b91df316f43c50b87f248092be601756b30f49d44" + sha256: "fc7d1b33d46418a216de50426e29af101268e510ea171b36458498293b5dfdcc" build: number: 0 - skip: True # [py<37] + skip: True # [py < 37] entry_points: - pegasusio = pegasusio.__main__:main - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('pegasusio', max_pin="x.x") }} requirements: build: @@ -56,6 +58,7 @@ about: home: https://github.com/lilab-bcb/pegasusio doc_url: https://pegasusio.readthedocs.io license: BSD-3-Clause + license_family: BSD license_file: LICENSE summary: "PegasusIO is the IO package for Pegasus." diff --git a/recipes/pegasuspy/meta.yaml b/recipes/pegasuspy/meta.yaml index 9b3e42df1b209..aa72e4d935028 100644 --- a/recipes/pegasuspy/meta.yaml +++ b/recipes/pegasuspy/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pegasuspy" %} -{% set version = "1.8.1" %} +{% set version = "1.9.1.post1" %} package: name: {{ name|lower }} @@ -7,17 +7,17 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 3897e1048d6ce3547028c0e4220fea7145573e6f62805918c7f7002f683f4105 + sha256: 0b1cfe8c7065ad686fd167f05da5bc246ec95700b04d6f1feae3e7d8595bac89 build: number: 0 - skip: True # [py<37] + skip: True # [py<38] entry_points: - pegasus = pegasus.__main__:main - run_exports: - - {{ pin_subpackage(name, max_pin='x') }} script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv" + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} requirements: build: @@ -35,8 +35,7 @@ requirements: - loompy >=3 - docopt - scipy >=1.7 - - importlib_metadata >=0.7 - - pegasusio >=0.5.1 + - pegasusio >=0.9.0 - psutil - threadpoolctl - adjusttext @@ -54,12 +53,13 @@ requirements: - python-igraph >=0.8.0 - scikit-learn >=0.23.2 - scikit-misc - - seaborn + - seaborn >=0.13.0 - statsmodels - pyfit-sne >=1.1.1 - umap-learn >=0.5.2 - xlsxwriter - wordcloud + - forceatlas2-python # brought in by numba, trying to ensure it comes from conda-forge rather than defaults - tbb diff --git a/recipes/peka/meta.yaml b/recipes/peka/meta.yaml index b4b7a6adf5e1f..7e59f23423422 100644 --- a/recipes/peka/meta.yaml +++ b/recipes/peka/meta.yaml @@ -1,5 +1,5 @@ {% set name = "PEKA" %} -{% set version = "1.0.0" %} +{% set version = "1.0.2" %} package: name: "{{ name|lower }}" @@ -7,30 +7,32 @@ package: source: url: "https://github.com/ulelab/peka/archive/refs/tags/v{{ version }}.tar.gz" - sha256: b6e2dffcbb762cc0806025334fbd31f11fa7183aa5896d0630aa08f1c9b7dba5 + sha256: 1742af7941be04b960e5153ef1eccf40781f72bf9d2a9063a97b54f27b76b01f build: number: 0 entry_points: - peka = peka:main - script: "{{ PYTHON }} -m pip install . -vv --ignore-installed --no-deps" + script: "{{ PYTHON }} -m pip install . -vvv --no-build-isolation --no-deps" noarch: python + run_exports: + - {{ pin_subpackage('peka', max_pin="x") }} requirements: host: - pip - - python==3.7 + - python >=3.7 run: - - python==3.7 - - matplotlib-base==3.1.2 - - numpy==1.17.4 - - pybedtools==0.8.0 - - scipy==1.6.2 - - seaborn==0.9.0 - - plumbum==1.6.8 - - scikit-learn==0.21.3 - - pandas==0.24.2 - - textdistance==4.1.3 + - python >=3.7 + - matplotlib-base + - {{ pin_compatible('numpy') }} + - pybedtools + - scipy + - seaborn + - plumbum + - scikit-learn + - pandas + - textdistance test: commands: @@ -38,12 +40,16 @@ test: about: home: "https://github.com/ulelab/peka" - license: GPL-3.0 + license: GPL-3.0-or-later + license_family: GPL3 license_file: LICENSE summary: "Analysis of kmers located around locations of interest" + dev_url: "https://github.com/ulelab/peka" extra: recipe-maintainers: - marc-jones - codeprimate123 - kkuret + identifiers: + - doi:10.1186/s13059-022-02755-2 diff --git a/recipes/peptide-shaker/meta.yaml b/recipes/peptide-shaker/meta.yaml index 677a59a7abc65..3c16f06cf6d56 100644 --- a/recipes/peptide-shaker/meta.yaml +++ b/recipes/peptide-shaker/meta.yaml @@ -1,7 +1,7 @@ # Do not forget to update the version string in the peptide-shaker.py file {% set name = "PeptideShaker" %} -{% set version = "3.0.4" %} -{% set sha256 = "e1317b51dda3e10348f74e544832169340939f056576d2f01ed13988e56e8214" %} +{% set version = "3.0.6" %} +{% set sha256 = "9356fb98d8d70bde35d3b37b0de24b5b76943ae9103a1af250018c0204062951" %} package: name: peptide-shaker diff --git a/recipes/peptide-shaker/peptide-shaker.py b/recipes/peptide-shaker/peptide-shaker.py index 98a22145a4cda..54aedb2ae0e6f 100755 --- a/recipes/peptide-shaker/peptide-shaker.py +++ b/recipes/peptide-shaker/peptide-shaker.py @@ -14,7 +14,7 @@ from os import getenv from os import X_OK -jar_file = 'PeptideShaker-3.0.4.jar' +jar_file = 'PeptideShaker-3.0.6.jar' default_jvm_mem_opts = ['-Xms2g', '-Xmx4g'] diff --git a/recipes/percolator/build.sh b/recipes/percolator/build.sh index cd53d08f3084b..5dc597f961637 100644 --- a/recipes/percolator/build.sh +++ b/recipes/percolator/build.sh @@ -1,20 +1,30 @@ #!/bin/bash -mkdir percobuild && cd percobuild -cmake -DTARGET_ARCH=x86_64 -DCMAKE_BUILD_TYPE=Release -DCMAKE_INSTALL_PREFIX=$PREFIX -DXML_SUPPORT=ON -DCMAKE_PREFIX_PATH="$PREFIX;$PREFIX/lib" -DCMAKE_CXX_FLAGS="-std=c++14" $SRC_DIR -make && make install -cd .. +export INCLUDES="-I{PREFIX}/include" +export LIBPATH="-L${PREFIX}/lib" +export LDFLAGS="${LDFLAGS} -L${PREFIX}/lib" + +cmake -S . -B percobuild \ + -DTARGET_ARCH=x86_64 -DCMAKE_BUILD_TYPE=Release \ + -DCMAKE_INSTALL_PREFIX="$PREFIX" -DXML_SUPPORT=ON \ + -DCMAKE_PREFIX_PATH="$PREFIX;$PREFIX/lib" -DCMAKE_CXX_COMPILER="${CXX}" \ + -DCMAKE_CXX_FLAGS="-std=c++14 -O3 -I{PREFIX}/include" +cmake --build percobuild/ --target install -j ${CPU_COUNT} -v # First make sure we dont get problems with truncated PREFIX due to null terminators: # see percolator/percolator#251 and conda/conda-build#1674 -sed -i '54s/WRITABLE_DIR/std::string(WRITABLE_DIR).c_str()/' $SRC_DIR/src/Globals.cpp -mkdir converterbuild && cd converterbuild -cmake -DTARGET_ARCH=x86_64 -DCMAKE_BUILD_TYPE=Release -DCMAKE_INSTALL_PREFIX="$PREFIX" -DBOOST_ROOT=$PREFIX -DBOOST_LIBRARYDIR=$PREFIX/lib -DSERIALIZE="Boost" -DCMAKE_CXX_FLAGS="-std=c++11" -DCMAKE_PREFIX_PATH="$PREFIX" $SRC_DIR/src/converters -make install -cd .. +sed -i.bak '54s/WRITABLE_DIR/std::string(WRITABLE_DIR).c_str()/' $SRC_DIR/src/Globals.cpp + +cmake -S ${SRC_DIR}/src/converters -B converterbuild \ + -DTARGET_ARCH=x86_64 -DCMAKE_BUILD_TYPE=Release \ + -DCMAKE_INSTALL_PREFIX="$PREFIX" -DBOOST_ROOT="$PREFIX" \ + -DBOOST_LIBRARYDIR="$PREFIX/lib" -DSERIALIZE="Boost" \ + -DCMAKE_CXX_FLAGS="-std=c++11 -O3 -I{PREFIX}/include" \ + -DCMAKE_PREFIX_PATH="$PREFIX" -DCMAKE_CXX_COMPILER="${CXX}" +cmake --build converterbuild/ --target install -j ${CPU_COUNT} -v -mkdir $PREFIX/testdata -cp $SRC_DIR/src/converters/data/converters/sqt2pin/target.sqt $PREFIX/testdata/target.sqt -cp $SRC_DIR/src/converters/data/converters/msgf2pin/target.mzid $PREFIX/testdata/target.mzid -cp $SRC_DIR/src/converters/data/converters/tandem2pin/target.t.xml $PREFIX/testdata/target.t.xml -cp $SRC_DIR/data/percolator/tab/percolatorTab $PREFIX/testdata/percolatorTab +mkdir -p $PREFIX/testdata +cp -f $SRC_DIR/src/converters/data/converters/sqt2pin/target.sqt $PREFIX/testdata/target.sqt +cp -f $SRC_DIR/src/converters/data/converters/msgf2pin/target.mzid $PREFIX/testdata/target.mzid +cp -f $SRC_DIR/src/converters/data/converters/tandem2pin/target.t.xml $PREFIX/testdata/target.t.xml +cp -f $SRC_DIR/data/percolator/tab/percolatorTab $PREFIX/testdata/percolatorTab diff --git a/recipes/percolator/meta.yaml b/recipes/percolator/meta.yaml index 20731e041f8b0..c3a9540cf1790 100644 --- a/recipes/percolator/meta.yaml +++ b/recipes/percolator/meta.yaml @@ -1,17 +1,19 @@ {% set name = "percolator" %} -{% set version = "3.5" %} +{% set version = "3.6.5" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://github.com/percolator/percolator/archive/rel-3-05.tar.gz - sha256: 5b746bdc0119a40f96bc090e02e27670f91eeb341736911750b170da7e5c06bb + url: https://github.com/percolator/percolator/archive/refs/tags/rel-3-06-05.tar.gz + sha256: e386998046f59c34be01b1b0347709751d92f3a98e9a0079f8e7c5af5e2dcc8f build: - number: 2 - skip: True # [osx] + number: 0 + skip: True # [osx] + run_exports: + - {{ pin_subpackage('percolator', max_pin="x") }} requirements: build: @@ -19,7 +21,7 @@ requirements: - {{ compiler('cxx') }} - cmake host: - - boost + - boost-cpp 1.71 # last version to have static libs - sqlite - bzip2 - xerces-c @@ -38,13 +40,17 @@ test: about: home: https://github.com/percolator/percolator - license: Apache 2.0 + license: Apache-2.0 + license_family: APACHE license_file: license.txt summary: Semi-supervised learning for peptide identification from shotgun proteomics datasets + dev_url: https://github.com/percolator/percolator + doc_url: http://percolator.ms/ extra: container: - extended-base: true # Add UTF-8 for percolator converters + extended-base: True # Add UTF-8 for percolator converters identifiers: - biotools:Percolator - doi:10.1007/s13361-016-1460-7 + - usegalaxy-eu:percolator diff --git a/recipes/perl-algorithm-cluster/meta.yaml b/recipes/perl-algorithm-cluster/meta.yaml index 67a3e26b0738d..b774eb2cfaf6f 100644 --- a/recipes/perl-algorithm-cluster/meta.yaml +++ b/recipes/perl-algorithm-cluster/meta.yaml @@ -10,7 +10,9 @@ source: sha256: {{ sha256 }} build: - number: 3 + number: 4 + run_exports: + - {{ pin_subpackage('perl-algorithm-cluster', max_pin="x") }} requirements: build: @@ -34,3 +36,6 @@ about: license: unknown summary: 'Perl interface to the C Clustering Library' +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/taxonomy/LICENSE b/recipes/perl-bio-kmer/LICENSE similarity index 97% rename from recipes/taxonomy/LICENSE rename to recipes/perl-bio-kmer/LICENSE index 2cdd581feedab..85d11a5a1ccef 100644 --- a/recipes/taxonomy/LICENSE +++ b/recipes/perl-bio-kmer/LICENSE @@ -1,6 +1,6 @@ MIT License -Copyright (c) 2019 One Codex +Copyright (c) 2017 Lee Katz Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal diff --git a/recipes/perl-bio-kmer/meta.yaml b/recipes/perl-bio-kmer/meta.yaml new file mode 100644 index 0000000000000..d894930b001b2 --- /dev/null +++ b/recipes/perl-bio-kmer/meta.yaml @@ -0,0 +1,58 @@ +{% set version = "0.55" %} +{% set sha256 = "268745e0e4e20aad6462c3dd0958ac6a08b3b7eb43c0f326f9bb61e48f6547a0" %} + +# regex to use for Windows build hack +{% set win_patch = "s|C:\\\\strawberry\\\\c|$ENV{LIBRARY_PREFIX}\\\\mingw-w64|g" %} + +package: + name: perl-bio-kmer + version: {{ version }} + +source: + url: https://cpan.metacpan.org/authors/id/L/LS/LSKATZ/Bio-Kmer-{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage("perl-bio-kmer", max_pin="x.x") }} + # needed for linker to find some m2w64 libs + merge_build_host: True # [win] + script: + - >- + perl Makefile.PL INSTALLDIRS=vendor NO_PERLLOCAL=1 NO_PACKLIST=1 MAKE=make + && (for /r . %%f in (*Makefile) do perl -i -pe "{{ win_patch }}" %%f) # [win] + && make + && make test + && make install VERBINST=1 + +requirements: + build: + - {{ compiler('c') }} # [unix] + - m2w64-gcc # [win] + - make + host: + - perl >=5.26 + - perl-file-which + - perl-bioperl + - kmer-jellyfish >=2 + run: + - perl >=5.26 + - perl-file-which + - perl-bioperl + - kmer-jellyfish >=2 + +test: + imports: + - Bio::Kmer + +about: + home: https://metacpan.org/pod/Bio::Kmer + summary: A perl module for helping with kmer analysis. + license: MIT + license_file: LICENSE + +extra: + recipe-maintainers: + - lskatz + #- conda-forge/perl-packagers diff --git a/recipes/perl-biox-seq/meta.yaml b/recipes/perl-biox-seq/meta.yaml index 8abda5e2b51b4..3f0b26b9a0481 100644 --- a/recipes/perl-biox-seq/meta.yaml +++ b/recipes/perl-biox-seq/meta.yaml @@ -1,6 +1,6 @@ {% set name = "perl-biox-seq" %} -{% set version = "0.008008" %} -{% set sha256 = "a301c51f5d58c02ed4d7b1d5e2914666ebb00cc669073242f8d123a8a771a44a" %} +{% set version = "0.008009" %} +{% set sha256 = "93d45421823619317aed195f7f19c486358248d8fe79d3dea7bd91b1fc49e8f5" %} package: name: {{ name }} @@ -13,6 +13,8 @@ source: build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: host: diff --git a/recipes/perl-digest-sha1/meta.yaml b/recipes/perl-digest-sha1/meta.yaml index ecd9d4fc4b247..26ad2a3951131 100644 --- a/recipes/perl-digest-sha1/meta.yaml +++ b/recipes/perl-digest-sha1/meta.yaml @@ -11,7 +11,9 @@ source: sha256: {{ sha256 }} build: - number: 5 + number: 6 + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: build: @@ -33,3 +35,7 @@ about: home: http://metacpan.org/pod/Digest::SHA1 license: perl_5 summary: 'Perl interface to the SHA-1 algorithm' + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/perl-minion/meta.yaml b/recipes/perl-minion/meta.yaml index 87a845511735d..450b3bb30e26a 100644 --- a/recipes/perl-minion/meta.yaml +++ b/recipes/perl-minion/meta.yaml @@ -1,6 +1,6 @@ {% set name = "perl-minion" %} -{% set version = "10.28" %} -{% set sha256 = "0bd774d2f42b36a5e1293cd3d5241ed35f45eb041599498e28d6f00f6ae910d5" %} +{% set version = "10.29" %} +{% set sha256 = "a8cbe9eedc9481e50a82652f8c070ca2a0e366077139c9fa809aa3be6c36bf88" %} package: name: {{ name }} diff --git a/recipes/perl-ms/meta.yaml b/recipes/perl-ms/meta.yaml index 818495bdd9743..8a00985087dc2 100644 --- a/recipes/perl-ms/meta.yaml +++ b/recipes/perl-ms/meta.yaml @@ -1,6 +1,6 @@ {% set name = "perl-ms" %} -{% set version = "0.207002" %} -{% set sha256 = "86676202c44908eee77a7697a8ec73908707f3e5b68ba74932a375196850f1ad" %} +{% set version = "0.207003" %} +{% set sha256 = "29f1eb57200286c9e95b7f7251a3a3c7db9caf63eccdc7450467d8b77362c797" %} package: name: {{ name }} @@ -15,6 +15,8 @@ source: build: number: 0 noarch: generic + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: host: @@ -90,6 +92,6 @@ test: about: home: http://metacpan.org/pod/MS - license: gpl_3 + license: GPL-3.0-or-later license_file: LICENSE summary: 'Namespace for mass spectrometry-related libraries' diff --git a/recipes/perl-parallel-loops/meta.yaml b/recipes/perl-parallel-loops/meta.yaml index 99eb9562f6bb9..d87e272c6e1db 100644 --- a/recipes/perl-parallel-loops/meta.yaml +++ b/recipes/perl-parallel-loops/meta.yaml @@ -1,6 +1,6 @@ {% set name = "perl-parallel-loops" %} -{% set version = "0.10" %} -{% set sha256 = "6f967b46e7a363b16871b9991c359e142dc3b2281cfe9b1af39904704c8bd2aa" %} +{% set version = "0.12" %} +{% set sha256 = "b66c8fe2fd519873c8a7b6ad1d1a04df2026912259b5e28a41e51d9c9b154150" %} package: name: {{ name }} @@ -12,7 +12,11 @@ source: build: noarch: generic - number: 1 + number: 0 + run_exports: + weak: + - {{ name }} ={{ version }} + requirements: build: diff --git a/recipes/perl-uri-db/meta.yaml b/recipes/perl-uri-db/meta.yaml index 08e0ce5867582..db450ccaf3c63 100644 --- a/recipes/perl-uri-db/meta.yaml +++ b/recipes/perl-uri-db/meta.yaml @@ -1,6 +1,6 @@ {% set name = "perl-uri-db" %} -{% set version = "0.21" %} -{% set sha256 = "a6433dc1517a907e189912a4c76b5dfc76332e3fd7fc8b38a137e4019c780b34" %} +{% set version = "0.22" %} +{% set sha256 = "1ff437591022b440716676526cca0a729b465f606bdd9e1d0a60561d6fdd458f" %} package: name: {{ name }} diff --git a/recipes/pgenlib/meta.yaml b/recipes/pgenlib/meta.yaml index e90bef1332072..b573cc847787c 100644 --- a/recipes/pgenlib/meta.yaml +++ b/recipes/pgenlib/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pgenlib" %} -{% set version = "0.90.1" %} +{% set version = "0.90.2" %} package: name: "{{ name|lower }}" @@ -7,11 +7,13 @@ package: source: url: "https://pypi.io/packages/source/P/Pgenlib/Pgenlib-{{ version }}.tar.gz" - sha256: 069db673c1cc5baffcb9b20c2e6e26cc9fdaadd0095f55a188b41502d0511cb9 + sha256: 09825be43ffb25bc68b6e243b98989a5bc35a8aa22cd749fd9f602d778dd6bd0 build: number: 0 - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation" + run_exports: + - {{ pin_subpackage('pgenlib', max_pin="x.x") }} requirements: build: @@ -21,12 +23,10 @@ requirements: - pip - cython - numpy - - setuptools - zlib run: - python - - numpy - - zlib + - {{ pin_compatible('numpy') }} test: imports: @@ -34,7 +34,7 @@ test: about: home: "https://github.com/chrchang/plink-ng" - license: "GNU Lesser General Public v3 (LGPLv3)" + license: "LGPL-3.0-or-later" license_family: LGPL license_file: LICENSE summary: "Python wrapper for pgenlib's basic reader and writer." diff --git a/recipes/pggb/build.sh b/recipes/pggb/build.sh index e4dcc8ffa6c9f..9fd032f7e0aa0 100644 --- a/recipes/pggb/build.sh +++ b/recipes/pggb/build.sh @@ -1,9 +1,9 @@ #!/bin/bash # Write version in the script -n=$(grep '$show_version == true' ./pggb -n | cut -f 1 -d :) +n=$(grep '"$show_version" == true' ./pggb -n | cut -f 1 -d :) n=$((n-1)) -sed -i ${n}'a\if [ $show_version == true ]; then echo "pggb '$PKG_VERSION'"; exit; fi' pggb +sed -i ${n}'a\if [ "$show_version" == true ]; then echo "pggb '$PKG_VERSION'"; exit; fi' ./pggb mkdir -p $PREFIX/bin diff --git a/recipes/pggb/meta.yaml b/recipes/pggb/meta.yaml index 620a05e34db1f..23c511a7bad59 100644 --- a/recipes/pggb/meta.yaml +++ b/recipes/pggb/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pggb" %} -{% set version = "0.5.4" %} +{% set version = "0.6.0" %} package: name: "{{ name }}" @@ -7,28 +7,29 @@ package: source: url: https://github.com/pangenome/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz - sha256: 0f45e710e3a59225ae806db3686ecc32c59859671a8f1b7052259525dc6707f3 + sha256: e201410e5b7ca7c598267797a7fa30b065a1b2b76ee5c309341a93fc489704f3 build: noarch: generic + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} number: 0 requirements: run: - bc - tabix - - gfaffix ==0.1.4 + - gfaffix ==0.1.5b - gsl 2.7.0 - - idna <3,>=2.5 - - multiqc ==1.14 - - odgi ==0.8.3 + - multiqc ==1.19 + - odgi ==0.8.6 - pigz - bcftools - - seqwish ==0.7.9 - - smoothxg ==0.7.0 + - seqwish ==0.7.10 + - smoothxg ==0.7.4 - time - vg 1.40.0 - - wfmash ==0.10.3 + - wfmash ==0.13.0 - python-igraph ==0.10.4 test: diff --git a/recipes/phables/meta.yaml b/recipes/phables/meta.yaml index a021fa80dec1f..06e9839de03da 100644 --- a/recipes/phables/meta.yaml +++ b/recipes/phables/meta.yaml @@ -1,5 +1,5 @@ {% set name = "phables" %} -{% set version = "1.2.2" %} +{% set version = "1.3.2" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://github.com/Vini2/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz" - sha256: 316b6f3c9c2a0267745b0ebbaf2f8e82084f3863695274a4c0c6c58d248b4842 + sha256: 79dad165c2ba314c77d0e4b4aca9b5876b6347c362c7f7c6bd2d9c979d3a7f7d build: number: 0 diff --git a/recipes/phanotate/meta.yaml b/recipes/phanotate/meta.yaml index 00d8dc1cede86..5c4db157f9366 100644 --- a/recipes/phanotate/meta.yaml +++ b/recipes/phanotate/meta.yaml @@ -1,5 +1,5 @@ {% set name = "phanotate" %} -{% set version = "1.5.1" %} +{% set version = "1.6.5" %} package: name: "{{ name|lower }}" @@ -7,12 +7,14 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: "1c3b241d59b801f9023946ef3ba1090e4fc32a4ff5bd06ba0144320ae9693de6" + sha256: "4be12306eeace16d018538499299b1e01f3fc5a904af5836ed0172eacdda3483" build: - number: 1 - skip: True # [py27] - script: "{{ PYTHON }} -m pip install . --no-deps -vv " + number: 0 + skip: True # [py < 36] + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('phanotate', max_pin="x") }} requirements: build: @@ -21,6 +23,7 @@ requirements: - pip - python run: + - python - fastpath - matplotlib-base - scipy @@ -28,8 +31,8 @@ requirements: - statsmodels - backports.tempfile - textwrap3 - - setuptools - trnascan-se + - genbank test: commands: diff --git a/recipes/pharokka/meta.yaml b/recipes/pharokka/meta.yaml index f4cc32edee438..61abbc4f7282e 100644 --- a/recipes/pharokka/meta.yaml +++ b/recipes/pharokka/meta.yaml @@ -1,6 +1,6 @@ -{% set version = "1.6.0" %} +{% set version = "1.7.1" %} {% set name = "pharokka" %} -{% set sha256 = "67a6459e1d7a3e22801a3eba0149056fcf9b3e61ea614d55893fdaa0cca7f5be" %} +{% set sha256 = "54fb44fd3ab9693a7625fffa19f3201651a6cdf04455342e6f4266266f1ac139" %} {% set user = "gbouras13" %} package: @@ -25,8 +25,8 @@ requirements: run: - python >=3.5 - bcbio-gff >=0.7.0 - - biopython >=1.78,<1.82 - - phanotate >=1.5.0 + - biopython >=1.80,<1.82 + - phanotate >=1.5.0,<1.6.4 - mmseqs2 ==13.45111 - trnascan-se >=2.0.9 - minced >=0.4.2 diff --git a/recipes/phava/build.sh b/recipes/phava/build.sh new file mode 100644 index 0000000000000..2364fa6aad2be --- /dev/null +++ b/recipes/phava/build.sh @@ -0,0 +1,6 @@ +#!/usr/bin/env bash + +mkdir -p $PREFIX/bin +cp bin/phava $PREFIX/bin +cp -r PhaVa $PREFIX +cp -r tests $PREFIX diff --git a/recipes/phava/meta.yaml b/recipes/phava/meta.yaml new file mode 100644 index 0000000000000..03c499baa7dc2 --- /dev/null +++ b/recipes/phava/meta.yaml @@ -0,0 +1,42 @@ +{% set version = "0.2.3" %} + +package: + name: phava + version: {{ version }} + +source: + url: https://github.com/patrickwest/PhaVa/archive/refs/tags/v{{version}}.tar.gz + sha256: 1860afecf8d2867f105a7fa00540b7d88c6c6ca21e1bbcba89faeda60d0acbcc + +build: + number: 0 + noarch: python + run_exports: + - {{ pin_subpackage('phava', max_pin="x.x") }} + +requirements: + host: + - python >=3.9 + run: + - python >=3.9 + - emboss >=6.5.7 + - minimap2 >=2.17 + - pysam >=0.17.0 + - biopython >=1.81 + - mmseqs2 + - samtools + +test: + commands: + - phava test + +about: + home: https://github.com/patrickwest/PhaVa + dev_url: https://github.com/patrickwest/PhaVa + license: MIT + license_family: MIT + summary: Detection of invertons from long-read sequencing datasets + +extra: + recipe-maintainers: + - patrickwest diff --git a/recipes/phispy/meta.yaml b/recipes/phispy/meta.yaml index 1c96458f5a46e..0102087cd18f1 100644 --- a/recipes/phispy/meta.yaml +++ b/recipes/phispy/meta.yaml @@ -11,9 +11,11 @@ source: sha256: "1dc3ec45c15328577557908517254d8e4ba152416f0e6bbad39e965b86730e28" build: - number: 2 + number: 3 skip: True # [py27 or py < 37] script: "{{ PYTHON }} -m pip install . --no-deps -vv " + run_exports: + - {{ pin_subpackage('phispy', max_pin="x") }} requirements: build: @@ -22,7 +24,7 @@ requirements: - pip - python run: - - biopython + - biopython <=1.81 - numpy - python - hmmer diff --git a/recipes/phold/meta.yaml b/recipes/phold/meta.yaml new file mode 100644 index 0000000000000..fd6985bdd47e0 --- /dev/null +++ b/recipes/phold/meta.yaml @@ -0,0 +1,62 @@ +{% set name = "phold" %} +{% set version = "0.1.4" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: 660283dae06b866a0b903d098252288a382cb2d72a8adcc1e9a5e38a5547d9b3 + +build: + number: 0 + noarch: python + entry_points: + - phold = phold:main + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('phold', max_pin='x') }} + +requirements: + host: + - python >=3.8,<3.12 + - pip + run: + - foldseek ==8.ef4e960 + - python >=3.8,<3.12 + - biopython >=1.76 + - alive-progress >=3.0.1 + - datasets >=2.15 + - requests >=2.25 + - pyarrow >=14.0.0 + - pandas >=1.4.2 + - loguru >=0.5.3 + - pyyaml >=6.0 + - click >=8.0.0 + - sentencepiece >=0.1.99 + - transformers >=4.34 + - pyrodigal-gv >=0.3.1 + - pytorch >=2.1.2 + - numpy >=1.20 + - pycirclize >=0.3.1 + + + +test: + imports: + - phold + commands: + - phold --help + +about: + home: https://github.com/gbouras13/phold + license: MIT + license_family: MIT + license_file: LICENSE + summary: Phage annotation using protein structures + doc_url: https://phold.readthedocs.io/en/latest/ + +extra: + recipe-maintainers: + - gbouras13 diff --git a/recipes/phykit/meta.yaml b/recipes/phykit/meta.yaml index 65ffccc3794fc..718064f631068 100644 --- a/recipes/phykit/meta.yaml +++ b/recipes/phykit/meta.yaml @@ -1,5 +1,5 @@ {% set name = "phykit" %} -{% set version = "1.12.5" %} +{% set version = "1.19.3" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 1a1b33a683663a6fb8be56e00a41803b7e7d09183fc46d7c3a0e193a79e7584b + sha256: a23386e7913a42051c5b4d8e63abc3da3fe80c5bad1c5ac8834da636610ecc33 build: noarch: python diff --git a/recipes/phyloacc/build.sh b/recipes/phyloacc/build.sh index 4cc5ed20fac25..b2034f66d9414 100644 --- a/recipes/phyloacc/build.sh +++ b/recipes/phyloacc/build.sh @@ -1,7 +1,11 @@ #!/bin/bash -make install CXX=${CXX} -cp src/PhyloAcc-interface/phyloacc.py ${PREFIX}/bin/. -cp src/PhyloAcc-interface/phyloacc_post.py ${PREFIX}/bin/. +mkdir -p ${PREFIX}/bin mkdir -p ${SP_DIR} -cp -R src/PhyloAcc-interface/phyloacc_lib ${SP_DIR}/. + +make install CXX=${CXX} + +cp src/PhyloAcc-interface/phyloacc.py ${PREFIX}/bin/ +ln -s ${PREFIX}/bin/phyloacc.py ${PREFIX}/bin/phyloacc +cp src/PhyloAcc-interface/phyloacc_post.py ${PREFIX}/bin/ +cp -R src/PhyloAcc-interface/phyloacc_lib ${SP_DIR}/ diff --git a/recipes/phyloacc/meta.yaml b/recipes/phyloacc/meta.yaml index 23e0d0afae9ca..9468c7e2c2a16 100644 --- a/recipes/phyloacc/meta.yaml +++ b/recipes/phyloacc/meta.yaml @@ -1,32 +1,34 @@ {% set name = "PhyloAcc" %} -{% set version = "2.2.0" %} -{% set sha256 = "29b13115974545479511bd4074d766c19fd7449412bfa9792721af85f80cbe37" %} +{% set version = "2.3.1" %} +{% set sha256 = "f22dfff721a788b117bb097370402aad0d1a22fb26fec9c6082eb1eb620a553f" %} package: name: {{ name|lower }} version: {{ version }} -source: +source: url: https://github.com/phyloacc/PhyloAcc/archive/refs/tags/v{{ version }}.tar.gz sha256: {{ sha256 }} build: - number: 2 - skip: True # [py < 38] + number: 1 + skip: True # [py < 38] + run_exports: + - {{ pin_subpackage('phyloacc', max_pin="x") }} requirements: build: - {{ compiler('cxx') }} - make - - libgomp # [linux] - - llvm-openmp # [osx] host: + - python - gsl - openblas - blis - liblapack - armadillo - - python + - libgomp # [linux] + - llvm-openmp # [osx] run: - python - blis @@ -34,27 +36,25 @@ requirements: - biopython >=1.79 - numpy >=1.22 - snakemake-minimal >=7.3 + - libgomp # [linux] + - llvm-openmp # [osx] test: commands: - phyloacc.py --version - phyloacc.py --depcheck - phyloacc_post.py -h -# Test commands to run after building and installing about: home: https://phyloacc.github.io/ - license: GNU GPLv3 - license_family: GPL + license: GPL-3.0-or-later + license_family: GPL3 license_file: LICENSE.md summary: 'Bayesian estimation of substitution rate shifts in non-coding regions' description: 'Bayesian estimation of substitution rate shifts in non-coding regions' - doc_url: https://phyloacc.github.io/ + doc_url: https://phyloacc.github.io/readme.html dev_url: https://github.com/phyloacc/PhyloAcc -# Package meta info -# URLs just point to the github page until we update the docs extra: recipe-maintainers: - gwct -# Extra info diff --git a/recipes/phylophlan/meta.yaml b/recipes/phylophlan/meta.yaml index e5e40d9312b5b..87c643c292cb0 100644 --- a/recipes/phylophlan/meta.yaml +++ b/recipes/phylophlan/meta.yaml @@ -1,6 +1,6 @@ {% set name = "phylophlan" %} -{% set version = "3.0.3" %} -{% set sha256 = "d8d0082c95d58d7b11a60c1e2214b35c1a23a65675005f1393e7647d76c6a054" %} +{% set version = "3.1.1" %} +{% set sha256 = "67df67b60b5a361ee9354db031608213d3ecfa2f9ec78104cb3e81903a8cc07a" %} package: name: "{{ name|lower }}" @@ -15,6 +15,8 @@ build: noarch: python number: 0 script: "{{ PYTHON }} -m pip install . --ignore-installed --no-deps -vv" + run_exports: + - {{ pin_subpackage('phylophlan', max_pin='x.x') }} requirements: host: @@ -39,13 +41,14 @@ requirements: - raxml >=8.2.10 - iqtree >=1.6.6 - mash + - requests test: commands: - phylophlan --version - phylophlan_draw_metagenomic --version - phylophlan_get_reference --version - - phylophlan_metagenomic --version + - phylophlan_assign_sgbs --version - phylophlan_setup_database --version - phylophlan_strain_finder --version - phylophlan_write_config_file --version diff --git a/recipes/phynder/build.sh b/recipes/phynder/build.sh new file mode 100644 index 0000000000000..0c5bc4499456d --- /dev/null +++ b/recipes/phynder/build.sh @@ -0,0 +1,37 @@ +#!/bin/bash +set -x +set +e + +export CFLAGS="$CFLAGS -I$PREFIX/include" +export LDFLAGS="$LDFLAGS -L$PREFIX/lib" +export CPATH=${PREFIX}/include + +## Static lib required by phynder, thus following instructions +## rather than trying to take from a conda htslib +git clone https://github.com/samtools/htslib.git +cd htslib +git submodule update --init --recursive + +## from https://github.com/pachterlab/kallisto/issues/303#issuecomment-884612169 +sed '/AC_PROG_CC/a \ +AC_CANONICAL_HOST \ +AC_PROG_INSTALL \ +' configure.ac >configure.ac2 +mv configure.ac2 configure.ac +autoreconf -i +autoheader +autoconf + +./configure --prefix=${PREFIX} --enable-libcurl --with-libdeflate --enable-plugins --enable-gcs --enable-s3 +make lib-static htslib_static.mk +make CC=$CC install + +## Patch phynder Makefile to cloned htslib folder (original assumes alongside, not within) +cd ../ +sed -i 's#HTSDIR=../htslib#HTSDIR=./htslib#g' Makefile +sed -i -e 's#LDLIBS=$(HTSLIB) -lpthread $(HTSLIB_static_LIBS)#LDLIBS=$(HTSLIB) -lpthread $(HTSLIB_static_LIBS) $(LDFLAGS)#g' -e 's#cp phynder ~/bin##g' Makefile + +make CC=$CC CFLAGS="$CFLAGS" LDFLAGS="$LDFLAGS" +make install + +cp phynder $PREFIX/bin/ diff --git a/recipes/phynder/meta.yaml b/recipes/phynder/meta.yaml new file mode 100644 index 0000000000000..e8c861e84d27f --- /dev/null +++ b/recipes/phynder/meta.yaml @@ -0,0 +1,50 @@ +{% set name = "phynder" %} +{% set version = "1.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/richarddurbin/{{ name | lower }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: 94d629d0c2e9085bfe9dbbe2c6302021ad81a00b3696696e103aa31db51d849f + +build: + number: 0 + skip: True # [osx] + run_exports: + - {{ pin_subpackage('phynder', max_pin="x.x") }} + +requirements: + build: + - make + - {{ compiler('c') }} + - autoconf + - automake + host: + - libcurl + - bzip2 + - xz + - zlib + - libdeflate + - openssl # [not osx] + + +test: + commands: + - phynder -h +about: + home: https://github.com/richarddurbin/phynder + dev_url: https://github.com/richarddurbin/phynder + license: MIT + license_file: LICENSE + summary: Efficient likelihood calculations to place samples into a phylogenetic tree. + description: | + Efficient likelihood calculations to place samples into a phylogenetic tree. + In particular, phynder was originally designed for placing male ancient DNA + samples into the Y chromosome phylogeny, when there are arbitrarily high rates + of missing data. It has also been used for assigning ancient samples to whole + mitochondrial genome phylogenies. +extra: + maintainers: + - jfy133 \ No newline at end of file diff --git a/recipes/phynteny/meta.yaml b/recipes/phynteny/meta.yaml index c5e06d161d10e..695e5ad48931a 100644 --- a/recipes/phynteny/meta.yaml +++ b/recipes/phynteny/meta.yaml @@ -1,13 +1,13 @@ {% set name = "Phynteny" %} -{% set version = "0.1.11" %} +{% set version = "0.1.13" %} package: name: "{{ name|lower }}" version: "{{ version }}" source: - url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 750c7a8dc1be5032beec0524d6312b893513d62dbc4cd51a96affb598e461f16 + url: "https://github.com/susiegriggo/Phynteny/archive/refs/tags/{{ version }}.tar.gz" + sha256: b613950a00ebf60714cf053cf846c5bc84da668b2e87dd2fd83361c7856a8e04 build: number: 0 @@ -18,6 +18,8 @@ build: - compute_confidence=train_phynteny.compute_confidence:main - install_models=phynteny_utils.install_models:main script: "{{ PYTHON }} -m pip install . -vv" + run_exports: + - {{ pin_subpackage('phynteny', max_pin='x') }} requirements: host: @@ -27,10 +29,10 @@ requirements: - biopython >=1.79 - click - joblib + - alive-progress - loguru - numpy - pandas - - pickle5 >=0.0.10 - python <3.11 - scikit-learn <=1.2.2 - tensorflow-cpu ==2.9.1 diff --git a/recipes/physher/build.sh b/recipes/physher/build.sh new file mode 100644 index 0000000000000..9e841b22143c6 --- /dev/null +++ b/recipes/physher/build.sh @@ -0,0 +1,5 @@ +#!/bin/bash + +cmake -S . -B build -DBUILD_CPP_WRAPPER=on -DCMAKE_INSTALL_PREFIX=$PREFIX + +cmake --build build/ --target install \ No newline at end of file diff --git a/recipes/physher/meta.yaml b/recipes/physher/meta.yaml new file mode 100644 index 0000000000000..7c864f1e5360d --- /dev/null +++ b/recipes/physher/meta.yaml @@ -0,0 +1,43 @@ +{% set name = "physher" %} +{% set version = "2.0.0" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +build: + number: 0 + run_exports: + - {{ pin_subpackage('physher', max_pin="x") }} + +source: + url: https://github.com/4ment/physher/archive/refs/tags/v{{ version }}.tar.gz + sha256: 89de0789af1136ca9a08f009b1db45d441bcb1d4ea7519103a998916b37c618f + + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('cxx') }} + - cmake + - make + host: + - gsl + +test: + commands: + - physher + +about: + home: https://github.com/4ment/physher + license: GPL-2.0-or-later + license_family: GPL2 + license_file: LICENSE + summary: A multi-algorithmic framework for phylogenetic inference + +extra: + maintainers: + - 4ment + identifiers: + - doi:10.1186/s12862-014-0163-6 + - biotools:physher diff --git a/recipes/physiofit/meta.yaml b/recipes/physiofit/meta.yaml index 097759c293e02..aec1c034ed92d 100644 --- a/recipes/physiofit/meta.yaml +++ b/recipes/physiofit/meta.yaml @@ -1,5 +1,5 @@ {% set name = "physiofit" %} -{% set version = "3.3.2" %} +{% set version = "3.3.6" %} package: name: {{ name|lower }} @@ -7,16 +7,16 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/physiofit-{{ version }}.tar.gz - sha256: 1512c9926e74255034e4b3bdba7fd72a11e297841f62532b8e835957aa6f0e77 + sha256: 6d6aa155ec16ca1da9bb04548b506adfd70b8b1000cd6eb3aa1ee4634a738af1 build: entry_points: - physiofit = physiofit.__main__:main noarch: python - script: {{ PYTHON }} -m pip install . -vv + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv number: 0 run_exports: - - {{ pin_subpackage('physiofit', max_pin="x") }} + - {{ pin_subpackage('physiofit', max_pin="x") }} requirements: host: @@ -30,23 +30,26 @@ requirements: - scipy >=1.10.1 - streamlit >=1.20.0 - matplotlib-base >=3.7.1 + - pyarrow >=14.0.1,<15.0.0 - pyyaml >=6.0.0 test: imports: - physiofit commands: - - pip check - physiofit --help - requires: - - pip about: home: https://github.com/MetaSys-LISBP/PhysioFit summary: Calculate extracellular fluxes from metabolite concentrations and biomass data license: GPL-3.0-only + license_family: GPL3 license_file: LICENSE + doc_url: https://physiofit.readthedocs.io/en/latest/ + dev_url: https://github.com/MetaSys-LISBP/PhysioFit extra: recipe-maintainers: - llegregam + identifiers: + - doi:10.1101/2023.10.12.561695 diff --git a/recipes/pindel/meta.yaml b/recipes/pindel/meta.yaml index 0a5b46a78ad9d..fc5a2aae1e96c 100644 --- a/recipes/pindel/meta.yaml +++ b/recipes/pindel/meta.yaml @@ -6,8 +6,10 @@ package: version: {{ version }} build: - number: 10 + number: 11 skip: True # [osx] + run_exports: + - {{ pin_subpackage('pindel', max_pin='x.x') }} source: url: https://github.com/genome/pindel/archive/{{ revision }}.tar.gz @@ -23,6 +25,7 @@ requirements: - make host: - htslib + - zlib run: - htslib @@ -37,5 +40,7 @@ about: summary: Pindel can detect breakpoints of large deletions, medium sized insertions, inversions, tandem duplications and other structural variants at single-based resolution from next-gen sequence data extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:pindel diff --git a/recipes/piscem-infer/build.sh b/recipes/piscem-infer/build.sh new file mode 100644 index 0000000000000..fd9c0897999fd --- /dev/null +++ b/recipes/piscem-infer/build.sh @@ -0,0 +1,8 @@ +#!/bin/bash -euo +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="$(pwd)/.cargo" + +# build statically linked binary with Rust +RUST_BACKTRACE=1 cargo install --verbose --root $PREFIX --path . + diff --git a/recipes/piscem-infer/meta.yaml b/recipes/piscem-infer/meta.yaml new file mode 100644 index 0000000000000..885cbc257f927 --- /dev/null +++ b/recipes/piscem-infer/meta.yaml @@ -0,0 +1,31 @@ +{% set version = "0.6.0" %} + +package: + name: piscem-infer + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage("piscem-infer", max_pin="x.x") }} + +source: + url: https://github.com/COMBINE-lab/piscem-infer/archive/v{{ version }}.tar.gz + sha256: 6ffaaf9d101f42a983d715857504c99ef60c3449ff14505e4c6b6c521e00d928 + +requirements: + build: + - rust >=1.75 + - {{ compiler('rust') }} + host: + run: + +test: + commands: + - piscem-infer --help + +about: + home: https://github.com/COMBINE-lab/piscem-infer + license: BSD-3-Clause + license_file: LICENSE + summary: piscem-infer is a flexible tool to perform target quantification from bulk-sequencing data diff --git a/recipes/piscem/meta.yaml b/recipes/piscem/meta.yaml index c8a3c44e6338e..2d201ea73f29e 100644 --- a/recipes/piscem/meta.yaml +++ b/recipes/piscem/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.7.0" %} -{% set git_commit = "c2b7489018f5b146d7206b3f080ca949cc6427fc" %} +{% set version = "0.8.0" %} +{% set git_commit = "413dd69008519c5d8157b7985578e767b321109c" %} {% set sha256 = "a72af2ab728e95aa6766a3bb4520af6273a9ea3be44a6a8dc260cd97615877df" %} package: @@ -19,7 +19,7 @@ source: requirements: build: - - rust >=1.74.1 + - rust >=1.75 - cmake - autoconf - make diff --git a/recipes/pixelator/LICENSE.txt b/recipes/pixelator/LICENSE.txt new file mode 100644 index 0000000000000..b8a6b593ecff8 --- /dev/null +++ b/recipes/pixelator/LICENSE.txt @@ -0,0 +1,21 @@ +MIT License + +Copyright © 2023 Pixelgen Technologies AB + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. \ No newline at end of file diff --git a/recipes/pixelator/meta.yaml b/recipes/pixelator/meta.yaml index d92a24e509c76..cb7d3376e7db6 100644 --- a/recipes/pixelator/meta.yaml +++ b/recipes/pixelator/meta.yaml @@ -1,37 +1,35 @@ {% set name = "pixelator" %} -{% set version = "0.15.2" %} +{% set pypi_name = "pixelgen-pixelator" %} +{% set version = "0.16.2" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://github.com/pixelgentechnologies/{{ name }}/archive/v{{ version }}.tar.gz - sha256: 2b41e14fba232691513e4f16eb215deca8e21694ebb9ad676968d320645212d4 + url: https://pypi.io/packages/source/{{ pypi_name[0] }}/{{ pypi_name }}/pixelgen_pixelator-{{ version }}.tar.gz + sha256: 0fcf1c3e88b2b43fe4a330c99aaa73bd68c809641951a2dafc33f7bb8cac8a3e build: + entry_points: + - pixelator = pixelator.cli:main_cli noarch: python - script_env: - - POETRY_DYNAMIC_VERSIONING_BYPASS={{ version }} - script: {{ PYTHON }} -m pip install . -vv + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation number: 0 run_exports: - {{ pin_subpackage('pixelator', max_pin="x.x") }} requirements: host: - - python + - python >=3.10,<3.12 - poetry-core >=1.0.0 - - poetry-dynamic-versioning >=1.1.0 + - poetry-dynamic-versioning >=1.0.1 - pip run: - - python >=3.8,<3.12 - - igraph >=0.10.2,<=0.11.0 - - louvain >=0.8.0,<=0.9.0 + - python >=3.10,<3.12 - click - yapf - cutadapt >=4.2 - - fastp - umi_tools <=1.1.4 - pyfastx - yappi @@ -39,40 +37,46 @@ requirements: - numpy <1.24.0 - python-annoy <=1.17.0 - esda - - libpysal - - xopen + - libpysal >=4.9.2 + # I had to lock xopen < 1.9.0 because zlib-ng which is required by xopen + # does not install as expected + - xopen <1.9.0 - anndata >=0.8.0 - numba >=0.56.4 - scanpy - - leidenalg - lxml - cssselect - typing_extensions - scipy - - pyarrow >=13.0.0 + - pyarrow >=13,<15 - semver >=3.0.0,<4.0.0 - ruamel.yaml >=0.17.21,<0.18.0 - pydantic >=1.10.7,<2.0.0 - - polars >=0.17.12,<0.18.0 + - polars >=0.19.0,<0.20.0 - importlib-resources >=5.12.0,<6.0.0 - - fsspec =>2023.9.0 - - fastparquet =>2023.8.0 + - fsspec >=2023.9.0,<2024.0.0 + - fastparquet >=2023.8.0,<2024.0.0 + - graspologic >=3.3.0,<4.0.0 + - fastp test: imports: - pixelator commands: + - pip check - pixelator --help - - pixelator --version | grep -E "^pixelator, version {{ version }}$" + requires: + - pip about: home: https://github.com/PixelgenTechnologies/pixelator - summary: | - A commandline tool and library to process and analyze sequencing data from Molecular Pixelation (MPX) assays. - license: GPL-2.0 - license_file: LICENSE - license_family: GPL + summary: A command-line tool and library to process and analyze sequencing data from Molecular Pixelation (MPX) assays. + license: MIT + license_family: MIT + license_file: LICENSE.txt extra: - maintainers: - - fbdtemme \ No newline at end of file + recipe-maintainers: + - johandahlberg + - ambarrio + - fbdtemme diff --git a/recipes/planemo/meta.yaml b/recipes/planemo/meta.yaml index 344b78da1932e..4d0b0f2dcb6c6 100644 --- a/recipes/planemo/meta.yaml +++ b/recipes/planemo/meta.yaml @@ -1,6 +1,6 @@ {% set name = "planemo" %} -{% set version = "0.75.19" %} -{% set sha256 = "4e935cc359071c0aea4a65c965eb96cb5330a33e3dcf66e1a7ad937d72a36083" %} +{% set version = "0.75.22" %} +{% set sha256 = "ad6b7b0eeb8d180004963b72bad5ec630d396a3ac0c36f9d1403927413158b8b" %} package: name: {{ name|lower }} @@ -15,7 +15,7 @@ build: noarch: python run_exports: - {{ pin_subpackage('planemo', max_pin='x.x') }} - script: {{ PYTHON }} -m pip install . --no-deps -vvv + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv entry_points: - planemo = planemo.cli:planemo @@ -33,8 +33,8 @@ requirements: - docutils - ephemeris >=0.10.3 - galaxy-containers - - galaxy-tool-util >=23.0,<23.1 - - galaxy-util >=23.0,<23.1 + - galaxy-tool-util >=23.1,<24.0 + - galaxy-util >=23.1,<24.0 - glob2 - gxformat2 >=0.14.0 - h5py diff --git a/recipes/plannotate/meta.yaml b/recipes/plannotate/meta.yaml index 37eeb74fca738..ebb56cfdfd40c 100644 --- a/recipes/plannotate/meta.yaml +++ b/recipes/plannotate/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.2.1" %} +{% set version = "1.2.2" %} package: name: plannotate @@ -7,10 +7,12 @@ package: build: number: 0 noarch: python + run_exports: + - {{ pin_subpackage('plannotate', max_pin="x") }} source: - url: https://github.com/mmcguffi/pLannotate/archive/refs/tags/v{{version}}.tar.gz - sha256: 7525ca5fa0309b4a579e46a6f9e167ed86751f7d3d07aba2c9d0468c53bcbaed + sha256: 423ad78a90d2fa13eed538b2ecdd939342388a5137b75de0c5d50c12974be3d6 - url: https://github.com/mmcguffi/pLannotate/releases/download/v1.2.0/BLAST_dbs.tar.gz sha256: 34c7bacb1c73bd75129e16990653f73b3eba7e3cdb3816a55d3989a7601f2137 folder: BLAST_dbs @@ -26,7 +28,7 @@ requirements: - biopython >=1.78 - blast >=2.10.1 - diamond >=2.0.13 - - pandas >=1.3.5 + - pandas >=1.3.5,<2.0.0 - python >=3.9 - ripgrep >=13.0.0 - tabulate >=0.8.9 diff --git a/recipes/plass/build.sh b/recipes/plass/build.sh index 78b3b14a704a3..b06956020200b 100644 --- a/recipes/plass/build.sh +++ b/recipes/plass/build.sh @@ -1,10 +1,18 @@ #!/bin/bash -git submodule init -git submodule update +ARCH_BUILD="" +case $(uname -m) in + x86_64) ARCH_BUILD="-DHAVE_SSE4_1=1" ;; + arm64|aarch64) ARCH_BUILD="-DHAVE_ARM8=1" ;; +esac + +if [ -z "${ARCH_BUILD}" ]; then + echo "Invalid architecture" + exit 1 +fi mkdir build cd build -cmake -DCMAKE_INSTALL_PREFIX="${PREFIX}" -DHAVE_TESTS=0 -DHAVE_MPI=0 -DHAVE_SSE4_1=1 -DVERSION_OVERRIDE="${PKG_VERSION}" .. -make -j 2 +cmake -DCMAKE_INSTALL_PREFIX="${PREFIX}" -DHAVE_TESTS=0 -DHAVE_MPI=0 ${ARCH_BUILD} -DVERSION_OVERRIDE="${PKG_VERSION}" .. +make -j${CPU_COUNT} ${VERBOSE_CM} make install diff --git a/recipes/plass/meta.yaml b/recipes/plass/meta.yaml index 9625027645199..fe9f348a6774d 100644 --- a/recipes/plass/meta.yaml +++ b/recipes/plass/meta.yaml @@ -1,15 +1,18 @@ -{% set version = "4-687d7" %} +{% set version = "5-cf8933" %} +{% set sha256 = "04f8f695e925fd842667b1839c960afef93deb05131eba478426f622b97ab6a0" %} package: name: plass version: {{ version|replace("-", ".") }} build: - number: 5 + number: 0 + run_exports: + - {{ pin_subpackage('plass', max_pin=None) }} source: - git_url: https://github.com/soedinglab/plass.git - git_rev: {{ version }} + url: https://github.com/soedinglab/plass/archive/{{ version }}.tar.gz + sha256: {{ sha256 }} requirements: build: @@ -32,16 +35,20 @@ requirements: test: commands: - plass > /dev/null + - penguin > /dev/null about: home: https://github.com/soedinglab/plass license: GPLv3 - summary: "Plass (Protein-Level ASSembler) is a software to assemble short read sequencing data on a protein level" + summary: "Plass (Protein-Level ASSembler) and PenguiN (Protein-guided Nucleotide assembler) are methods to assemble short read sequencing data on a protein level to proteins or DNA contigs" extra: - skip-lints: - - uses_vcs_url - - missing_hash identifiers: - doi:10.1038/s41592-019-0437-4 + - doi:10.1101/2024.03.29.587318 - biotools:plass + recipe-maintainers: + - milot-mirdita + - martin-steinegger + additional-platforms: + - linux-aarch64 diff --git a/recipes/plassembler/meta.yaml b/recipes/plassembler/meta.yaml index 85b1484bc031b..7b7683d2378f5 100644 --- a/recipes/plassembler/meta.yaml +++ b/recipes/plassembler/meta.yaml @@ -1,5 +1,5 @@ {% set name = "plassembler" %} -{% set version = "1.5.0" %} +{% set version = "1.6.2" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 35496f09241e9c5eb45e66146e0c24b1e77598c84a61db8bc9fbf0d11c3db5d5 + sha256: 1433253aa9fb9305b8eb55ac3a19b46c4064d01147adbda077bc34da82509e46 build: number: 0 diff --git a/recipes/plink2/meta.yaml b/recipes/plink2/meta.yaml index 2283e9b7d4799..c5f60a7e7a323 100644 --- a/recipes/plink2/meta.yaml +++ b/recipes/plink2/meta.yaml @@ -1,6 +1,6 @@ package: name: plink2 - version: "2.00a5" + version: "2.00a5.10" build: number: 0 @@ -8,10 +8,10 @@ build: - {{ pin_subpackage('plink2', max_pin=None) }} source: - url: https://s3.amazonaws.com/plink2-assets/alpha5/plink2_linux_x86_64_20230923.zip # [linux] - sha256: f0537f5b90315028de0f3c6be3aaa384a2aa7cd74b0d4d5b6f4d2916c262db40 # [linux] - url: https://s3.amazonaws.com/plink2-assets/alpha5/plink2_mac_20230923.zip # [osx] - sha256: 4a4264ff57abe7191a9244617d86069c370336aa726ced9a6369c0d8318e1f7c # [osx] + url: https://s3.amazonaws.com/plink2-assets/alpha5/plink2_linux_x86_64_20240105.zip # [linux] + sha256: d841fe0b3fcc42d76b2b08bcfeb95e315156b0b883b353807014a69b4867dc47 # [linux] + url: https://s3.amazonaws.com/plink2-assets/alpha5/plink2_mac_20240105.zip # [osx] + sha256: 75d78b9a94a570804a9ab130dd0dd29ff8d1c7851c386239505798cd2126c0f9 # [osx] requirements: build: @@ -19,7 +19,7 @@ requirements: test: commands: - - plink2 --help | grep "PLINK v2.00a5" + - plink2 --help | grep "PLINK v2.00a5.10" about: home: https://www.cog-genomics.org/plink2 diff --git a/recipes/pmultiqc/meta.yaml b/recipes/pmultiqc/meta.yaml index bf170ac08f041..b8c4ab6027c61 100644 --- a/recipes/pmultiqc/meta.yaml +++ b/recipes/pmultiqc/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pmultiqc" %} -{% set version = "0.0.23" %} +{% set version = "0.0.24" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: fc66361d1a9da0e2812ef2ca4bf328ed95ecf9ba925d25afa0d045765d9446ab + sha256: e3d617cdfc4eab4fa8905dab1f4e575db038471659840bf1431b535d610ae136 build: number: 0 @@ -24,9 +24,9 @@ requirements: - python >=3.6 - pytest - lxml - - multiqc + - multiqc ==1.19.0 - pandas - - sdrf-pipelines + - sdrf-pipelines >=0.0.18 - pyteomics - pyopenms >2.7 diff --git a/recipes/poly-qtlseq/meta.yaml b/recipes/poly-qtlseq/meta.yaml index b08bcc23379d1..11953504d4dab 100644 --- a/recipes/poly-qtlseq/meta.yaml +++ b/recipes/poly-qtlseq/meta.yaml @@ -1,13 +1,13 @@ {% set name = "polyQtlseq" %} -{% set version = "1.0.0" %} -{% set sha256 = "800b669bdd89c89d2cc2218f842b419ff5aac29747b8f1dfd32ecba5f961543e" %} +{% set version = "1.0.1" %} +{% set sha256 = "bc6a7c3ddac1191b697084a003336aab06d7530538f4a6963d572cd1a6f679bc" %} package: name: poly-qtlseq version: {{ version }} source: - url: https://github.com/TatsumiMizubayashi/PolyploidQtlSeq/releases/download/v1.0.0/polyQtlseq-1.0.0.zip + url: https://github.com/TatsumiMizubayashi/PolyploidQtlSeq/releases/download/v1.0.1/polyQtlseq-1.0.1.zip sha256: {{ sha256 }} build: diff --git a/recipes/popdel/build.sh b/recipes/popdel/build.sh index 883edc14d8a69..64407b7894404 100644 --- a/recipes/popdel/build.sh +++ b/recipes/popdel/build.sh @@ -1,4 +1,4 @@ #!/bin/sh -make CXX=${CXX} +make CXX=${CXX} -j ${CPU_COUNT} mkdir -p ${PREFIX}/bin cp popdel ${PREFIX}/bin diff --git a/recipes/popdel/meta.yaml b/recipes/popdel/meta.yaml index 31750f441b621..b73c3594094cf 100644 --- a/recipes/popdel/meta.yaml +++ b/recipes/popdel/meta.yaml @@ -7,7 +7,9 @@ source: sha256: c4f9dd1838379a9bcb3545da3a8d2d779f85212528a523215df9d2dc505fe515 build: - number: 6 + number: 7 + run_exports: + - {{ pin_subpackage('popdel', max_pin='x') }} requirements: build: @@ -28,3 +30,7 @@ about: license: GPL-3.0 license_file: LICENSE summary: Fast structural deletion calling on population-scale short read paired-end germline WGS data. + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/poppunk/meta.yaml b/recipes/poppunk/meta.yaml index 57b87d23fbd98..e596450103070 100644 --- a/recipes/poppunk/meta.yaml +++ b/recipes/poppunk/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.6.3" %} +{% set version = "2.6.5" %} {% set name = "PopPUNK" %} package: @@ -7,7 +7,7 @@ package: source: url: https://github.com/bacpop/{{ name|lower }}/archive/v{{ version }}.tar.gz - sha256: 4a305da07482a8d500213823b29c48b9be5465194f25beae53ee986f0ae111d0 + sha256: d587b77c6b38e73035f9bd1b5cfcea9a048714112391a77139bb52e0a160b968 build: number: 0 diff --git a/recipes/poseidon-trident/meta.yaml b/recipes/poseidon-trident/meta.yaml index e800846aebcf0..16afdef296300 100644 --- a/recipes/poseidon-trident/meta.yaml +++ b/recipes/poseidon-trident/meta.yaml @@ -1,13 +1,13 @@ -{% set version = "1.3.0.4" %} +{% set version = "1.4.1.0" %} package: name: poseidon-trident version: {{ version }} source: - url: https://github.com/poseidon-framework/poseidon-hs/releases/download/v{{ version }}/trident-conda-linux # [linux] - md5: 1d1d64e3cf84c3b8d51f5e84401006fa # [linux] + md5: 32399ef0bb0f0e0539b8e5de8da7909e # [linux] - url: https://github.com/poseidon-framework/poseidon-hs/releases/download/v{{ version }}/trident-macOS # [osx] - md5: e81fd58708cf617955e16b398a245303 # [osx] + md5: 8e84912883ee531c478a5e34158cfb05 # [osx] build: number: 0 diff --git a/recipes/pourrna/meta.yaml b/recipes/pourrna/meta.yaml index 993b810c88dc6..4313accff6e9c 100644 --- a/recipes/pourrna/meta.yaml +++ b/recipes/pourrna/meta.yaml @@ -11,7 +11,9 @@ source: sha256: {{ sha256 }} build: - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage( name, max_pin="x.x") }} requirements: build: diff --git a/recipes/ppanggolin/meta.yaml b/recipes/ppanggolin/meta.yaml index 4e0712795ef53..8d196cd333118 100644 --- a/recipes/ppanggolin/meta.yaml +++ b/recipes/ppanggolin/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.2.105" %} +{% set version = "2.0.5" %} package: name: ppanggolin @@ -6,36 +6,39 @@ package: source: url: https://github.com/labgem/PPanGGOLiN/archive/{{ version }}.tar.gz - sha256: 410a51029302d9aae534846fc5dde9c01c17aa63ae91c9d48db47e399d2d2a47 + sha256: a0eecbb3f66df8d2df5c2b37c25696c264cd3812386e942314748a8800ecc52f build: - number: 1 + number: 0 skip: True # [py<37] + run_exports: + - {{ pin_subpackage("ppanggolin", max_pin="x") }} requirements: build: - {{ compiler('c') }} + host: - python - pip - - cython + - cython <3 run: - python - tqdm =4 - pytables =3 - - prodigal =2.6 + - pyrodigal =3 - aragorn =1.2 - infernal =1.1 - mmseqs2 - - networkx =2 + - networkx =3 - scipy =1 - - plotly =4 + - plotly =5 - gmpy2 =2 - numpy =1 - - pandas =1 + - pandas =2 - colorlover =0.3 - mafft - - bokeh =2 + - bokeh =3 test: commands: @@ -48,6 +51,7 @@ test: about: license: CeCiLL 2.1 home: https://github.com/labgem/PPanGGOLiN + doc_url: https://ppanggolin.readthedocs.io summary: "PPanGGOLiN: Depicting microbial species diversity via a Partitioned PanGenome Graph" extra: diff --git a/recipes/ppx/meta.yaml b/recipes/ppx/meta.yaml index 645d249430539..468bdacc12df0 100644 --- a/recipes/ppx/meta.yaml +++ b/recipes/ppx/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ppx" %} -{% set version = "1.3.0" %} +{% set version = "1.4.4" %} package: name: "{{ name|lower }}" @@ -7,22 +7,24 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: a94f94071fca29e98fc13e4a306fc0c4c1deee2306dea9680e8a292a5c8b4376 + sha256: 97eacbc9272faf98ab2fa16f0949eb55bd0eab5cecf9e8381321e754808e2cd8 build: number: 0 noarch: python entry_points: - ppx = ppx.ppx:main - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('ppx', max_pin="x") }} requirements: host: - pip - - python >=3.7 + - python >=3.10 - setuptools_scm >=6.4.2 run: - - python >=3.7 + - python >=3.10 - requests >=2.23.0 - tqdm >=4.60.0 - cloudpathlib >=0.7.1 @@ -36,6 +38,7 @@ test: about: home: "https://github.com/wfondrie/ppx" license: MIT + license_family: MIT license_file: LICENSE summary: "A Python interface to proteomics data repositories" doc_url: "https://ppx.readthedocs.io" diff --git a/recipes/prank/LICENSE.md b/recipes/prank/LICENSE.md new file mode 100644 index 0000000000000..51bbbe9e109b1 --- /dev/null +++ b/recipes/prank/LICENSE.md @@ -0,0 +1,619 @@ +### GNU GENERAL PUBLIC LICENSE + +Version 3, 29 June 2007 + +Copyright (C) 2007 Free Software Foundation, Inc. + + +Everyone is permitted to copy and distribute verbatim copies of this +license document, but changing it is not allowed. + +### Preamble + +The GNU General Public License is a free, copyleft license for +software and other kinds of works. + +The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom +to share and change all versions of a program--to make sure it remains +free software for all its users. We, the Free Software Foundation, use +the GNU General Public License for most of our software; it applies +also to any other work released this way by its authors. You can apply +it to your programs, too. + +When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + +To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you +have certain responsibilities if you distribute copies of the +software, or if you modify it: responsibilities to respect the freedom +of others. + +For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + +Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + +For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + +Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the +manufacturer can do so. This is fundamentally incompatible with the +aim of protecting users' freedom to change the software. The +systematic pattern of such abuse occurs in the area of products for +individuals to use, which is precisely where it is most unacceptable. +Therefore, we have designed this version of the GPL to prohibit the +practice for those products. If such problems arise substantially in +other domains, we stand ready to extend this provision to those +domains in future versions of the GPL, as needed to protect the +freedom of users. + +Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish +to avoid the special danger that patents applied to a free program +could make it effectively proprietary. To prevent this, the GPL +assures that patents cannot be used to render the program non-free. + +The precise terms and conditions for copying, distribution and +modification follow. + +### TERMS AND CONDITIONS + +#### 0. Definitions. + +"This License" refers to version 3 of the GNU General Public License. + +"Copyright" also means copyright-like laws that apply to other kinds +of works, such as semiconductor masks. + +"The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + +To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of +an exact copy. The resulting work is called a "modified version" of +the earlier work or a work "based on" the earlier work. + +A "covered work" means either the unmodified Program or a work based +on the Program. + +To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + +To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user +through a computer network, with no transfer of a copy, is not +conveying. + +An interactive user interface displays "Appropriate Legal Notices" to +the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + +#### 1. Source Code. + +The "source code" for a work means the preferred form of the work for +making modifications to it. "Object code" means any non-source form of +a work. + +A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + +The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + +The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + +The Corresponding Source need not include anything that users can +regenerate automatically from other parts of the Corresponding Source. + +The Corresponding Source for a work in source code form is that same +work. + +#### 2. Basic Permissions. + +All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + +You may make, run and propagate covered works that you do not convey, +without conditions so long as your license otherwise remains in force. +You may convey covered works to others for the sole purpose of having +them make modifications exclusively for you, or provide you with +facilities for running those works, provided that you comply with the +terms of this License in conveying all material for which you do not +control copyright. Those thus making or running the covered works for +you must do so exclusively on your behalf, under your direction and +control, on terms that prohibit them from making any copies of your +copyrighted material outside their relationship with you. + +Conveying under any other circumstances is permitted solely under the +conditions stated below. Sublicensing is not allowed; section 10 makes +it unnecessary. + +#### 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + +No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + +When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such +circumvention is effected by exercising rights under this License with +respect to the covered work, and you disclaim any intention to limit +operation or modification of the work as a means of enforcing, against +the work's users, your or third parties' legal rights to forbid +circumvention of technological measures. + +#### 4. Conveying Verbatim Copies. + +You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + +You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + +#### 5. Conveying Modified Source Versions. + +You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these +conditions: + +- a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. +- b) The work must carry prominent notices stating that it is + released under this License and any conditions added under + section 7. This requirement modifies the requirement in section 4 + to "keep intact all notices". +- c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. +- d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + +A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + +#### 6. Conveying Non-Source Forms. + +You may convey a covered work in object code form under the terms of +sections 4 and 5, provided that you also convey the machine-readable +Corresponding Source under the terms of this License, in one of these +ways: + +- a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. +- b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the Corresponding + Source from a network server at no charge. +- c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. +- d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. +- e) Convey the object code using peer-to-peer transmission, + provided you inform other peers where the object code and + Corresponding Source of the work are being offered to the general + public at no charge under subsection 6d. + +A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + +A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, +family, or household purposes, or (2) anything designed or sold for +incorporation into a dwelling. In determining whether a product is a +consumer product, doubtful cases shall be resolved in favor of +coverage. For a particular product received by a particular user, +"normally used" refers to a typical or common use of that class of +product, regardless of the status of the particular user or of the way +in which the particular user actually uses, or expects or is expected +to use, the product. A product is a consumer product regardless of +whether the product has substantial commercial, industrial or +non-consumer uses, unless such uses represent the only significant +mode of use of the product. + +"Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to +install and execute modified versions of a covered work in that User +Product from a modified version of its Corresponding Source. The +information must suffice to ensure that the continued functioning of +the modified object code is in no case prevented or interfered with +solely because modification has been made. + +If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + +The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or +updates for a work that has been modified or installed by the +recipient, or for the User Product in which it has been modified or +installed. Access to a network may be denied when the modification +itself materially and adversely affects the operation of the network +or violates the rules and protocols for communication across the +network. + +Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + +#### 7. Additional Terms. + +"Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + +When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + +Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders +of that material) supplement the terms of this License with terms: + +- a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or +- b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or +- c) Prohibiting misrepresentation of the origin of that material, + or requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or +- d) Limiting the use for publicity purposes of names of licensors + or authors of the material; or +- e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or +- f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions + of it) with contractual assumptions of liability to the recipient, + for any liability that these contractual assumptions directly + impose on those licensors and authors. + +All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + +If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + +Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; the +above requirements apply either way. + +#### 8. Termination. + +You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + +However, if you cease all violation of this License, then your license +from a particular copyright holder is reinstated (a) provisionally, +unless and until the copyright holder explicitly and finally +terminates your license, and (b) permanently, if the copyright holder +fails to notify you of the violation by some reasonable means prior to +60 days after the cessation. + +Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + +Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + +#### 9. Acceptance Not Required for Having Copies. + +You are not required to accept this License in order to receive or run +a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + +#### 10. Automatic Licensing of Downstream Recipients. + +Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + +An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + +You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + +#### 11. Patents. + +A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + +A contributor's "essential patent claims" are all patent claims owned +or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + +Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + +In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + +If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + +If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + +A patent license is "discriminatory" if it does not include within the +scope of its coverage, prohibits the exercise of, or is conditioned on +the non-exercise of one or more of the rights that are specifically +granted under this License. You may not convey a covered work if you +are a party to an arrangement with a third party that is in the +business of distributing software, under which you make payment to the +third party based on the extent of your activity of conveying the +work, and under which the third party grants, to any of the parties +who would receive the covered work from you, a discriminatory patent +license (a) in connection with copies of the covered work conveyed by +you (or copies made from those copies), or (b) primarily for and in +connection with specific products or compilations that contain the +covered work, unless you entered into that arrangement, or that patent +license was granted, prior to 28 March 2007. + +Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + +#### 12. No Surrender of Others' Freedom. + +If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under +this License and any other pertinent obligations, then as a +consequence you may not convey it at all. For example, if you agree to +terms that obligate you to collect a royalty for further conveying +from those to whom you convey the Program, the only way you could +satisfy both those terms and this License would be to refrain entirely +from conveying the Program. + +#### 13. Use with the GNU Affero General Public License. + +Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU Affero General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the special requirements of the GNU Affero General Public License, +section 13, concerning interaction through a network will apply to the +combination as such. + +#### 14. Revised Versions of this License. + +The Free Software Foundation may publish revised and/or new versions +of the GNU General Public License from time to time. Such new versions +will be similar in spirit to the present version, but may differ in +detail to address new problems or concerns. + +Each version is given a distinguishing version number. If the Program +specifies that a certain numbered version of the GNU General Public +License "or any later version" applies to it, you have the option of +following the terms and conditions either of that numbered version or +of any later version published by the Free Software Foundation. If the +Program does not specify a version number of the GNU General Public +License, you may choose any version ever published by the Free +Software Foundation. + +If the Program specifies that a proxy can decide which future versions +of the GNU General Public License can be used, that proxy's public +statement of acceptance of a version permanently authorizes you to +choose that version for the Program. + +Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + +#### 15. Disclaimer of Warranty. + +THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT +WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT +LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR +A PARTICULAR PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND +PERFORMANCE OF THE PROGRAM IS WITH YOU. SHOULD THE PROGRAM PROVE +DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING, REPAIR OR +CORRECTION. + +#### 16. Limitation of Liability. + +IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR +CONVEYS THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, +INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES +ARISING OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT +NOT LIMITED TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR +LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM +TO OPERATE WITH ANY OTHER PROGRAMS), EVEN IF SUCH HOLDER OR OTHER +PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES. + +#### 17. Interpretation of Sections 15 and 16. + +If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + +END OF TERMS AND CONDITIONS diff --git a/recipes/prank/meta.yaml b/recipes/prank/meta.yaml index 5960392c08e83..9e752eaedf3f2 100644 --- a/recipes/prank/meta.yaml +++ b/recipes/prank/meta.yaml @@ -1,19 +1,20 @@ package: name: prank - version: "v.170427" + version: "170427" source: url: http://wasabiapp.org/download/prank/prank.source.170427.tgz sha256: 623eb5e9b5cb0be1f49c3bf715e5fabceb1059b21168437264bdcd5c587a8859 build: - number: 7 + number: 0 + run_exports: + - {{ pin_subpackage('prank', max_pin="x.x") }} requirements: build: - make - {{ compiler('cxx') }} - run: test: commands: @@ -21,10 +22,14 @@ test: about: home: http://wasabiapp.org/software/prank/ - license: GPL-3 + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE.md summary: PRANK is a probabilistic multiple alignment program for DNA, codon and amino-acid sequences. extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:prank - doi:10.1007/978-1-62703-646-7_10 diff --git a/recipes/preseq/meta.yaml b/recipes/preseq/meta.yaml index b6726b24549a3..462b966c1500e 100644 --- a/recipes/preseq/meta.yaml +++ b/recipes/preseq/meta.yaml @@ -5,7 +5,9 @@ package: version: {{ version }} build: - number: 5 + number: 6 + run_exports: + - {{ pin_subpackage("preseq", max_pin="x.x") }} source: url: https://github.com/smithlabcode/preseq/releases/download/v{{ version }}/preseq-{{ version }}.tar.gz @@ -38,5 +40,7 @@ test: - to-mr extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - andrewdavidsmith diff --git a/recipes/presto/build.sh b/recipes/presto/build.sh deleted file mode 100755 index 4899c226c8dd0..0000000000000 --- a/recipes/presto/build.sh +++ /dev/null @@ -1,9 +0,0 @@ -#!/bin/bash - -$PYTHON setup.py install --single-version-externally-managed --record=record.txt - -# Add more build steps here, if they are necessary. - -# See -# http://docs.continuum.io/conda/build.html -# for a list of environment variables that are set during the build process. diff --git a/recipes/presto/meta.yaml b/recipes/presto/meta.yaml index 8db5c41676eea..e3fdd0365f366 100644 --- a/recipes/presto/meta.yaml +++ b/recipes/presto/meta.yaml @@ -1,19 +1,26 @@ +{% set name = "presto" %} +{% set version = "0.7.2" %} +{% set sha256 = "b4f4b34413af4207eb2052316d31d7bc2067b864286498476d89013ad5423dd9" %} + package: - name: presto - version: "0.7.1" + name: {{ name }} + version: {{ version }} source: - url: https://files.pythonhosted.org/packages/ca/12/09123b431758827082924054e03277207067853c6af19803f67d1ad1dea9/presto-0.7.1.tar.gz - sha256: 8b5787b3a3206fda5e5cd0fd1804a6c0ecb8821f9de2b78d9a5e5a5a31ba43e9 + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/presto-{{ version }}.tar.gz + sha256: {{ sha256 }} build: number: 0 noarch: python + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + run_exports: + - {{ pin_subpackage('presto', max_pin="x.x") }} requirements: host: - python >=3 - - setuptools + - pip run: - python >=3 - numpy >=1.8 @@ -23,6 +30,7 @@ requirements: - blast >=2.5 - muscle >=3.8 - vsearch >=2.3.2 + - packaging test: commands: @@ -41,7 +49,12 @@ test: - SplitSeq.py --version about: - home: https://presto.readthedocs.io - license: AGPL-3.0 + home: https://bitbucket.org/kleinstein/presto + license: AGPL-3.0-or-later summary: 'A bioinformatics toolkit for processing high-throughput lymphocyte receptor sequencing data.' license_family: AGPL + doc_url: https://presto.readthedocs.io + +extra: + identifier: + - doi:10.1093/bioinformatics/btu138 diff --git a/recipes/primer3-py/meta.yaml b/recipes/primer3-py/meta.yaml index dd28aab34137d..f9e5b1886a1c9 100644 --- a/recipes/primer3-py/meta.yaml +++ b/recipes/primer3-py/meta.yaml @@ -1,5 +1,5 @@ {% set name = "primer3-py" %} -{% set version = "2.0.1" %} +{% set version = "2.0.3" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/primer3-py-{{ version }}.tar.gz - sha256: 30b549c568ae5712e3e6cde6c1f5b243f328247ec8d6ec89d4b705873a44e772 + sha256: 1ec6ce99ea149b1c82361c654a0eab824e698ce32d5f9ed2dd8f8f37564b3f5f build: number: 1 @@ -40,5 +40,7 @@ about: doc_url: https://libnano.github.io/primer3-py/ extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - bgruening diff --git a/recipes/primerforge/meta.yaml b/recipes/primerforge/meta.yaml new file mode 100644 index 0000000000000..404d73f1ffd56 --- /dev/null +++ b/recipes/primerforge/meta.yaml @@ -0,0 +1,47 @@ +{% set name = "primerForge" %} +{% set version = "1.0.2" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://github.com/dr-joe-wirth/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: b834ad463b39eb68634ef7869881a8aec57181d4e372963f933bf52ddc40b501 + +build: + number: 0 + noarch: python + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + entry_points: + - primerForge=bin.main:main + run_exports: + - {{ pin_subpackage('primerforge', max_pin="x.x") }} + +requirements: + host: + - python >=3.11 + - pip + run: + - python >=3.11 + - biopython ==1.81 + - matplotlib-base >=3.7 + - numpy + - primer3-py >=2.0 + - scipy >=1.10 + +test: + commands: + - primerForge --help + - primerForge --check_install + +about: + home: https://github.com/dr-joe-wirth/{{ name }} + license: Apache-2.0 + license_family: Apache + license_file: LICENSE + summary: "primerForge: software to identify primers that can be used to distinguish genomes" + +extra: + recipe-maintainers: + - dr-joe-wirth diff --git a/recipes/primers/0001-directly-write-requirements-in-setup.py.patch b/recipes/primers/0001-directly-write-requirements-in-setup.py.patch new file mode 100644 index 0000000000000..bdbba3ec8a854 --- /dev/null +++ b/recipes/primers/0001-directly-write-requirements-in-setup.py.patch @@ -0,0 +1,26 @@ +From d1878dbc60b3e4db625f2b3b320c031fe8bfabb6 Mon Sep 17 00:00:00 2001 +From: tpob +Date: Mon, 8 Apr 2024 19:39:30 +0800 +Subject: [PATCH] directly write requirements in setup.py + +--- + setup.py | 3 +-- + 1 file changed, 1 insertion(+), 2 deletions(-) + +diff --git a/setup.py b/setup.py +index 2750b76..94ac0bf 100644 +--- a/setup.py ++++ b/setup.py +@@ -7,8 +7,7 @@ from setuptools import setup, find_packages + with open("README.md", "r") as fh: + long_description = fh.read() + +-with open("requirements.txt") as f: +- requirements = f.read().splitlines() ++requirements = ["seqfold>=0.7.3"] + + try: + require("setuptools>=38.3") +-- +2.31.1 + diff --git a/recipes/primers/meta.yaml b/recipes/primers/meta.yaml new file mode 100644 index 0000000000000..1eec7202a9635 --- /dev/null +++ b/recipes/primers/meta.yaml @@ -0,0 +1,40 @@ +{% set name = "primers" %} +{% set version = "0.5.10" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" + sha256: 3ff2cd4c27a47326faeb8e54f36649752e6905109fdd3b22b90c2c167233f060 + patches: + - 0001-directly-write-requirements-in-setup.py.patch + +build: + number: 0 + noarch: python + script: "{{ PYTHON }} -m pip install . -vv" + run_exports: + - {{ pin_subpackage('primers', max_pin="x.x") }} + +requirements: + host: + - pip + - python =3 + - setuptools + + run: + - python =3 + - seqfold >=0.7.3 + +test: + imports: + - primers + +about: + home: "https://github.com/Lattice-Automation/primers" + license: MIT + license_file: LICENSE + summary: "This is a small, straightforward tool for creating PCR primers. Its target use-case is DNA assembly." + doc_url: "https://github.com/Lattice-Automation/primers" diff --git a/recipes/prodigal/meta.yaml b/recipes/prodigal/meta.yaml index abb4fd87c74b2..70e320ad05502 100644 --- a/recipes/prodigal/meta.yaml +++ b/recipes/prodigal/meta.yaml @@ -13,7 +13,7 @@ source: - sd_motif_B.patch build: - number: 7 + number: 8 run_exports: - {{ pin_subpackage('prodigal', max_pin=None) }} @@ -22,7 +22,6 @@ requirements: - make - {{ compiler('c') }} - unzip - run: test: commands: @@ -33,3 +32,7 @@ about: dev_url: https://github.com/hyattpd/Prodigal license: GPL v3 summary: Prodigal (Prokaryotic Dynamic Programming Genefinding Algorithm) is a microbial (bacterial and archaeal) gene finding program + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/prokbert/meta.yaml b/recipes/prokbert/meta.yaml index aad92e9121840..6fd3153cb17c7 100644 --- a/recipes/prokbert/meta.yaml +++ b/recipes/prokbert/meta.yaml @@ -1,5 +1,5 @@ {% set name = "prokbert" %} -{% set version = "0.0.40" %} +{% set version = "0.0.44" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/prokbert-{{ version }}.tar.gz - sha256: 8705d47d1d22ecd1e9c1b67345661b298f116b7c2ec65b167a01c25645ec4a03 + sha256: 19a6c9890c7689d795a8898061d48e7023b64226388c1c67f2f68a91c42a5012 build: number: 0 diff --git a/recipes/pronto/meta.yaml b/recipes/pronto/meta.yaml index ed42fc4d9781c..d6d9f73830252 100644 --- a/recipes/pronto/meta.yaml +++ b/recipes/pronto/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pronto" %} -{% set version = "2.5.5" %} +{% set version = "2.5.7" %} package: name: "{{ name }}" @@ -7,12 +7,14 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 8f9a0917156248b2cce05d238c5d76a7b49ee07619f2bce3c73796bff82d5b4f + sha256: 014a5b02064781d6edd7ca5b4f63b13342dd9b5322248f5a4740f48a98464629 build: noarch: python number: 0 - script: {{ PYTHON }} -m pip install . --ignore-installed --no-deps -vv + script: {{ PYTHON }} -m pip install . --no-build-isolation --no-deps -vvv + run_exports: + - {{ pin_subpackage('pronto', max_pin="x") }} requirements: host: @@ -35,10 +37,13 @@ test: - pronto.serializers about: - home: http://github.com/althonos/pronto + home: https://github.com/althonos/pronto license: MIT summary: 'Python frontend to ontologies' license_family: MIT + license_file: COPYING + doc_url: https://pronto.readthedocs.io/en/stable/ + dev_url: https://github.com/althonos/pronto extra: recipe-maintainers: diff --git a/recipes/prophyle/meta.yaml b/recipes/prophyle/meta.yaml index 982f843ee47bc..1765b8cd3a11e 100644 --- a/recipes/prophyle/meta.yaml +++ b/recipes/prophyle/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.3.3.1" %} -{% set sha256 = "7007f4858020f4ee2926b8ebe6089a886119d07358f645adfc869b444c52d32c" %} +{% set version = "0.3.3.2" %} +{% set sha256 = "b9476c617bcbc3eea229a1becd7f70133d3d3c59869e90284dfaf4b915757366" %} package: name: prophyle diff --git a/recipes/prosampler/build.sh b/recipes/prosampler/build.sh index 2a751024f5a0b..294eb68008e78 100644 --- a/recipes/prosampler/build.sh +++ b/recipes/prosampler/build.sh @@ -1,4 +1,4 @@ #!/bin/bash -$CXX -o ProSampler ProSampler.cc +$CXX -o ProSampler ProSampler_v1.5.cc mkdir -p $PREFIX/bin cp ProSampler $PREFIX/bin diff --git a/recipes/prosampler/meta.yaml b/recipes/prosampler/meta.yaml index 24f5bee0cd1e9..4433e38f225ef 100644 --- a/recipes/prosampler/meta.yaml +++ b/recipes/prosampler/meta.yaml @@ -1,16 +1,18 @@ -{% set version = "1.0" %} -{% set sha256 = "570671cd5effd50c015515b80e0fdafeb0a353cecb626a050a92bb6658a4b69b" %} +{% set version = "1.5" %} +{% set sha256 = "ae75dad4133a5f2d6da487118a3e8e5bcbfc361821edb72c7c36b966419d6187" %} package: name: prosampler version: {{ version }} source: - url: https://github.com/zhengchangsulab/ProSampler/raw/master/PROSAMPLER_01_22_2019.tar.gz + url: https://github.com/zhengchangsulab/ProSampler/raw/master/PROSMPLER_v1.5.tar.gz sha256: {{ sha256 }} build: - number: 1 + number: 0 + run_exports: + - {{ pin_subpackage('prosampler', max_pin=None) }} requirements: build: @@ -26,5 +28,7 @@ about: summary: An ultra-fast motif finding program in large ChIP-seq datasets. extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:prosampler diff --git a/recipes/protgraph/meta.yaml b/recipes/protgraph/meta.yaml index 1837064bfc1d0..49cc0bb70b774 100644 --- a/recipes/protgraph/meta.yaml +++ b/recipes/protgraph/meta.yaml @@ -1,5 +1,5 @@ {% set name = "protgraph" %} -{% set version = "0.3.9" %} +{% set version = "0.3.10" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: a1e69aed7dc57c8dcde2a70605a7ed0b39e36bcb03800f0dfecad476cbce143d + sha256: 52d0449eea53c8f113d1287fd5f40e837bf3bd6ed13193974fbd0c3bd358f800 build: number: 0 @@ -15,6 +15,8 @@ build: script: {{ PYTHON }} -m pip install . -vv entry_points: - protgraph=protgraph.protgraph:main + run_exports: + - {{ pin_subpackage('protgraph', max_pin="x.x") }} requirements: host: diff --git a/recipes/protmapper/meta.yaml b/recipes/protmapper/meta.yaml index a7fa1af749531..fe4ac6f625278 100644 --- a/recipes/protmapper/meta.yaml +++ b/recipes/protmapper/meta.yaml @@ -1,6 +1,6 @@ {% set name = "protmapper" %} -{% set version = "0.0.28" %} -{% set sha256 = "0cd18592dc6ae67e2ec723395c6adfe5221f8ce73e7185c3ac85348639c29a1e" %} +{% set version = "0.0.29" %} +{% set sha256 = "d0d10198fb000401d03ba6c271869970caf8e1c8b46db686d2eed153fa8c2257" %} package: name: {{ name|lower }} diff --git a/recipes/psm-utils/meta.yaml b/recipes/psm-utils/meta.yaml index e2767e8637fc8..3a2b480bec129 100644 --- a/recipes/psm-utils/meta.yaml +++ b/recipes/psm-utils/meta.yaml @@ -1,6 +1,6 @@ {% set name = "psm-utils" %} -{% set version = "0.7.2" %} -{% set sha256 = "a6b892f3ca6dfb8c2b298e0788c79965d754e84e7049c560b52263b096b82a17" %} +{% set version = "0.8.3" %} +{% set sha256 = "99ce675b551dc76bd82074a5b4a45e18ea40cd7e38ef1e34a7345d7471ae4a80" %} package: name: {{ name|lower }} @@ -13,7 +13,7 @@ source: build: number: 0 entry_points: - - psm-utils=psm-utils.__main__:main + - psm_utils=psm_utils.__main__:main script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" noarch: python run_exports: @@ -23,10 +23,9 @@ requirements: host: - pip - python >=3.7 - - flit-core run: - python >=3.7 - - pyteomics >=4 + - pyteomics >=4,<4.7 - pyopenms - lxml - psims diff --git a/recipes/purge_haplotigs/meta.yaml b/recipes/purge_haplotigs/meta.yaml index c8cde29e6dec1..583dc731bed0f 100644 --- a/recipes/purge_haplotigs/meta.yaml +++ b/recipes/purge_haplotigs/meta.yaml @@ -1,15 +1,18 @@ -{% set version = "1.1.2" %} +{% set name = "purge_haplotigs" %} +{% set version = "1.1.3" %} package: - name: purge_haplotigs - version: '{{ version }}' + name: {{ name }} + version: {{ version }} source: - url: https://bitbucket.org/mroachawri/purge_haplotigs/get/v{{ version }}.tar.gz - sha256: 14daf0454606232c5adbc5ca42cd873a0c4eb8b7f52d22edd434027d5e8fdca0 + url: https://bitbucket.org/mroachawri/{{ name }}/get/v{{ version }}.tar.gz + sha256: 68d9bc8464f6d53281127576eab67068fbc1c45d37a60dffdc344b2c0be4ff84 build: number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} noarch: generic requirements: @@ -40,3 +43,7 @@ about: license_family: MIT license_file: LICENSE summary: Pipeline to help with curating heterozygous diploid genome assemblies. + +extra: + recipe-maintainers: + - beardymcjohnface diff --git a/recipes/pxblat/meta.yaml b/recipes/pxblat/meta.yaml index 2a0c29693aa1f..d3b6b59fc8765 100644 --- a/recipes/pxblat/meta.yaml +++ b/recipes/pxblat/meta.yaml @@ -1,6 +1,6 @@ {% set name = "PxBLAT" %} -{% set version = "1.1.10" %} -{% set sha256 = "d20b48ac4c761ad26c680cd1a10e7fb22f581212d5221cbfc2bc7f522a6b81d2" %} +{% set version = "1.1.20" %} +{% set sha256 = "38820df0fc8ae988446b0d69ab75ff93250e02c603c5a529d23e7b1debc34749" %} package: name: {{ name|lower }} diff --git a/recipes/py2bit/meta.yaml b/recipes/py2bit/meta.yaml index d77824737670b..5938010a14d20 100644 --- a/recipes/py2bit/meta.yaml +++ b/recipes/py2bit/meta.yaml @@ -3,7 +3,9 @@ package: version: "0.3.0" build: - number: 8 + number: 9 + run_exports: + - {{ pin_subpackage('py2bit', max_pin='x.x') }} source: url: https://files.pythonhosted.org/packages/53/bb/547a927bed736ead3dc909e1e552d57c9034bb9493eff80544c0cf6e4828/py2bit-0.3.0.tar.gz @@ -27,3 +29,7 @@ about: home: https://github.com/deeptools/py2bit license: 'MIT' summary: 'A package for accessing 2bit files using lib2bit' + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/pyabpoa/meta.yaml b/recipes/pyabpoa/meta.yaml index 1a1872e3a6f85..b99ebbd5a2c25 100644 --- a/recipes/pyabpoa/meta.yaml +++ b/recipes/pyabpoa/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pyabpoa" %} -{% set version = "1.5.0" %} +{% set version = "1.5.1" %} package: name: {{ name|lower }} @@ -7,13 +7,14 @@ package: source: url: https://github.com/yangao07/abPOA/releases/download/v{{ version }}/abPOA-v{{ version }}.tar.gz - sha256: 221e62c68e4cd728b85ab5f9864f7711f2102ff58c800c1477368cc83fee42d8 + sha256: f0e1b41b1c9e18ecd2096df9b60ad053260ec773d70eecb307b02cca0efab89d build: - number: 0 - script: {{ PYTHON }} -m pip install . -vvv + number: 1 + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation --use-pep517 -vvv run_exports: - - {{ pin_subpackage(name, max_pin="x.x") }} + - {{ pin_subpackage(name, max_pin="x") }} + requirements: build: - {{ compiler('c') }} @@ -35,6 +36,7 @@ about: license: MIT license_family: MIT license_file: LICENSE + dev_url: https://github.com/yangao07/abPOA extra: recipe-maintainers: @@ -42,3 +44,5 @@ extra: identifiers: - doi:10.1093/bioinformatics/btaa963 - biotools:abpoa + additional-platforms: + - linux-aarch64 diff --git a/recipes/pybarrnap/meta.yaml b/recipes/pybarrnap/meta.yaml new file mode 100644 index 0000000000000..1e2657be3e50e --- /dev/null +++ b/recipes/pybarrnap/meta.yaml @@ -0,0 +1,46 @@ +{% set name = "pybarrnap" %} +{% set version = "0.5.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/pybarrnap-{{ version }}.tar.gz + sha256: 9578c1677c60dfe7f12bccfd1613048918068289b0dc04b3d0396e699fd09073 + +build: + number: 0 + noarch: python + entry_points: + - pybarrnap = pybarrnap.scripts.pybarrnap:main + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + run_exports: + - {{ pin_subpackage('pybarrnap', max_pin="x.x") }} + +requirements: + host: + - python >=3.8 + - poetry-core >=1.0.0 + - pip + run: + - python >=3.8 + - biopython >=1.79 + - pyhmmer >=0.10.8 + +test: + imports: + - pybarrnap + commands: + - pybarrnap --help + +about: + home: https://github.com/moshi4/pybarrnap/ + summary: "Python implementation of barrnap (Bacterial ribosomal RNA predictor)" + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE + +extra: + recipe-maintainers: + - moshi4 diff --git a/recipes/pybbi/meta.yaml b/recipes/pybbi/meta.yaml index 398f334dbcfd6..6277bd7c5c715 100644 --- a/recipes/pybbi/meta.yaml +++ b/recipes/pybbi/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pybbi" %} -{% set version = "0.3.6" %} +{% set version = "0.4.0" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: "1733b49a86c56848bbdc286b653da7ecfdeb72164516bfac10e54f0f1d49fc2a" + sha256: "afafbc23f16f789344a454fce619af5556a67a2e11b7c36de8fc6f091e2478fc" build: number: 0 diff --git a/recipes/pybedtools/build.sh b/recipes/pybedtools/build.sh index 9eea3edc58935..c767c7e1d7310 100644 --- a/recipes/pybedtools/build.sh +++ b/recipes/pybedtools/build.sh @@ -1,6 +1,9 @@ #!/bin/bash -export CPATH=${PREFIX}/include -$PYTHON setup.py install --single-version-externally-managed --record=rec.txt + +export C_INCLUDE_PATH="${PREFIX}/include" +export LIBPATH="-L${PREFIX}/lib" + +${PYTHON} -m pip install . --no-deps --no-build-isolation --no-cache-dir -vvv # Add more build steps here, if they are necessary. diff --git a/recipes/pybedtools/meta.yaml b/recipes/pybedtools/meta.yaml index 49e64af7bf5c7..b9fb582b6ecfb 100644 --- a/recipes/pybedtools/meta.yaml +++ b/recipes/pybedtools/meta.yaml @@ -1,31 +1,33 @@ +{% set name = "pybedtools" %} +{% set version = "0.10.0" %} + package: - name: pybedtools - version: '0.9.1' + name: {{ name }} + version: {{ version }} source: - url: https://files.pythonhosted.org/packages/38/00/f07c17e25f9cc8e2d22b30aace73733e275b1804196f744f0178012a0d16/pybedtools-0.9.1.tar.gz - sha256: 586a626895b1b7215aef877e985c03fd8a908fd6c636e5b9ff8a1a1d09a1d514 + url: https://files.pythonhosted.org/packages/cc/90/cea4197772a029e925bd5d414108b5438d621dfbb1b0cc2627529d1ec524/pybedtools-0.10.0.tar.gz + sha256: 1a6fbaad23b013becc741d7d5922a2df03e391bc44ff92772ffb7dd456711161 build: - skip: True # [py2k] + skip: True # [py < 36] number: 0 + run_exports: + - {{ pin_subpackage("pybedtools", max_pin="x.x") }} requirements: build: - {{ compiler('cxx') }} host: - python - - six - #- pysam >=0.16 - - setuptools - #- pandas + - pip + - cython - zlib run: - python - bedtools - - six - - pysam >=0.16 - - pandas + - numpy + - pysam test: imports: @@ -36,8 +38,14 @@ test: about: home: https://github.com/daler/pybedtools license: MIT + license_family: MIT + license_file: LICENSE.txt summary: Wraps BEDTools for use in Python and adds many additional features. + dev_url: https://github.com/daler/pybedtools + doc_url: https://daler.github.io/pybedtools extra: identifiers: - biotools:pybedtools + additional-platforms: + - linux-aarch64 diff --git a/recipes/pybigtools/build.sh b/recipes/pybigtools/build.sh new file mode 100644 index 0000000000000..9bb1e5cebea29 --- /dev/null +++ b/recipes/pybigtools/build.sh @@ -0,0 +1,23 @@ +#!/bin/bash + +# -e = exit on first error +# -x = print every executed command +set -ex + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" + +# Use a custom temporary directory as home on macOS. +# (not sure why this is useful, but people use it in bioconda recipes) +if [ `uname` == Darwin ]; then + export HOME=`mktemp -d` +fi + +# build statically linked binary with Rust +RUST_BACKTRACE=1 +# Build the package using maturin - should produce *.whl files. +maturin build -m pybigtools/Cargo.toml -b pyo3 --interpreter "${PYTHON}" --release --strip + +# Install *.whl files using pip +${PYTHON} -m pip install target/wheels/*.whl --no-deps --no-build-isolation --no-cache-dir -vvv diff --git a/recipes/pybigtools/meta.yaml b/recipes/pybigtools/meta.yaml new file mode 100644 index 0000000000000..50743e489df2e --- /dev/null +++ b/recipes/pybigtools/meta.yaml @@ -0,0 +1,45 @@ +{% set name = "pybigtools" %} +{% set version = "0.1.2" %} +{% set sha256 = "ecc46cbfac71a4c10b7c14b4b280742db9d6ef6cecd5e595bb361027c47ea670" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: "https://github.com/jackh726/bigtools/archive/refs/tags/{{ name }}@v{{ version }}.tar.gz" + sha256: {{ sha256 }} + +build: + number: 2 + run_exports: + - {{ pin_subpackage('pybigtools', max_pin="x.x") }} + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('rust') }} + host: + - pip + - python + - maturin + run: + - python + - numpy + +test: + imports: + - pybigtools + +about: + home: https://github.com/jackh726/bigtools/ + license: MIT + summary: 'pybigtools: Python bindings to the Bigtools Rust library for high-performance BigWig and BigBed I/O' + license_family: MIT + license_file: LICENSE + doc_url: https://bigtools.readthedocs.io + dev_url: https://github.com/jackh726/bigtools/ + +extra: + identifiers: + - doi:10.5281/zenodo.10606493 diff --git a/recipes/pybigwig/build.sh b/recipes/pybigwig/build.sh index 24412f55aa1c3..241c28a9c0951 100644 --- a/recipes/pybigwig/build.sh +++ b/recipes/pybigwig/build.sh @@ -1,4 +1,4 @@ #!/bin/bash export C_INCLUDE_PATH=$PREFIX/include -$PYTHON setup.py install --single-version-externally-managed --record=record.txt +$PYTHON -m pip install --no-deps --no-build-isolation . -vvv diff --git a/recipes/pybigwig/meta.yaml b/recipes/pybigwig/meta.yaml index 426ae16d1509d..be5c68cf5d54e 100644 --- a/recipes/pybigwig/meta.yaml +++ b/recipes/pybigwig/meta.yaml @@ -9,15 +9,17 @@ source: sha256: 5d4426f754bd7b7f6dc21d6c3f93b58a96a65b6eb2e578ae03b31a71272d2243 build: - skip: true # [py2k] - number: 1 + skip: True # [py < 37] + number: 2 + run_exports: + - {{ pin_subpackage('pybigwig', max_pin="x.x") }} requirements: build: - {{ compiler('c') }} host: - python - - setuptools + - pip - curl - libcurl - zlib @@ -37,5 +39,11 @@ test: about: home: https://github.com/dpryan79/pyBigWig license: MIT + license_family: MIT license_file: LICENSE.txt summary: A python extension written in C for quick access to bigWig files. + dev_url: https://github.com/dpryan79/pyBigWig + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/pybiolib/meta.yaml b/recipes/pybiolib/meta.yaml index b4b1f16fe1b7d..d120e0ac38eba 100644 --- a/recipes/pybiolib/meta.yaml +++ b/recipes/pybiolib/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pybiolib" %} -{% set version = "1.1.1689" %} +{% set version = "1.1.2017" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/pybiolib-{{ version }}.tar.gz - sha256: f33b444bdbde72a8b93f236777544de8d2a5fc0633f7cdb4c1e73f392eae0040 + sha256: 97d0a1b00973038dd7d29cccaec6dbf4d711137c4d6fb8073291596ce5f91490 build: noarch: python diff --git a/recipes/pychopper/meta.yaml b/recipes/pychopper/meta.yaml index 107b6f615ed90..d747c663fb446 100644 --- a/recipes/pychopper/meta.yaml +++ b/recipes/pychopper/meta.yaml @@ -1,18 +1,20 @@ {% set name = "pychopper" %} -{% set version = "2.5.0" %} +{% set version = "2.7.9" %} package: name: "{{ name|lower }}" version: "{{ version }}" source: - url: https://github.com/nanoporetech/pychopper/archive/v{{ version }}.tar.gz - sha256: 1800a2c5e19f2a025da579608e87ec1a802cf5196fc9e8fed936cb09e2e5e465 + url: https://github.com/epi2me-labs/pychopper/archive/v{{ version }}.tar.gz + sha256: 630d644fbafc3199609e111c1522dc47864c1bfde5cc9682d796974acb97ac70 build: noarch: python number: 0 script: {{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv + run_exports: + - {{ pin_subpackage('pychopper', max_pin="x") }} requirements: host: @@ -28,13 +30,15 @@ requirements: - seaborn - six - pandas + - numpy + - pysam test: commands: - - cdna_classifier.py --help + - pychopper --help about: - home: https://github.com/nanoporetech/pychopper - license: MPL2 + home: https://github.com/epi2me-labs/pychopper + license: Mozilla Public License 2.0 summary: A tool to identify, orient and rescue full length cDNA reads from nanopore data. license_file: LICENSE.md diff --git a/recipes/pycomo/meta.yaml b/recipes/pycomo/meta.yaml new file mode 100644 index 0000000000000..a92c2b57fa40f --- /dev/null +++ b/recipes/pycomo/meta.yaml @@ -0,0 +1,50 @@ +{% set name = "pycomo" %} +{% set version = "0.1.3" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/pycomo-{{ version }}.tar.gz + sha256: be95b8610a3b40ca69dd5ed055356c6bdb838059c66afa796343ea624b07be6c + +build: + entry_points: + - pycomo = pycomo.pycomo_models:main + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage('pycomo', max_pin="x.x") }} + +requirements: + host: + - python >=3.9 + - setuptools + - pip + run: + - python >=3.9 + - cobra >=0.23.0 + - pandas >=1.5.3 + - python-libsbml >=5.20.1 + - numpy >=1.22.4 + +test: + imports: + - pycomo + commands: + - pip check + - pycomo --help + requires: + - pip + +about: + home: https://github.com/univieCUBE/PyCoMo + summary: PyCoMo is a software package for generating and analysing compartmentalized community metabolic models + license: MIT + license_file: LICENSE + +extra: + recipe-maintainers: + - mpredl diff --git a/recipes/pycov3/meta.yaml b/recipes/pycov3/meta.yaml new file mode 100644 index 0000000000000..f5ac7f49a1a19 --- /dev/null +++ b/recipes/pycov3/meta.yaml @@ -0,0 +1,45 @@ +{% set name = "pycov3" %} +{% set version = "2.1.0" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" + sha256: 7fcd34f840fb93b0e951eca51f23b4df7548412577d9bc4a6e1fbf855b97329a + +build: + number: 0 + noarch: python + entry_points: + - pycov3 = pycov3.cli:main + script: "{{ PYTHON }} -m pip install . -vv" + run_exports: + - {{ pin_subpackage('pycov3', max_pin="x") }} + +requirements: + host: + - pip + - python + run: + - python + +test: + imports: + - pycov3 + commands: + - pycov3 --help + +about: + home: https://github.com/Ulthran/pycov3 + license: MIT + license_family: MIT + license_file: + summary: "Generate cov3 files used in DEMIC" + doc_url: + dev_url: https://github.com/Ulthran/pycov3 + +extra: + recipe-maintainers: + - Ulthran diff --git a/recipes/pydeseq2/meta.yaml b/recipes/pydeseq2/meta.yaml index 5086ace06d91f..245e1501865d3 100644 --- a/recipes/pydeseq2/meta.yaml +++ b/recipes/pydeseq2/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pydeseq2" %} -{% set version = "0.4.4" %} +{% set version = "0.4.9" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/pydeseq2-{{ version }}.tar.gz - sha256: ebd978d51d4d66b40e6dce8826029d9551fec9946c2a75793e75eb748cc3b207 + sha256: 0375207775953f43f84ed4279fcb9f11a430d79d038e158bbe74acbc58326d31 build: noarch: python @@ -18,18 +18,17 @@ build: requirements: host: - - python >=3.8 + - python >=3.9 - pip run: - - python >=3.8 + - python >=3.9 - anndata >=0.8.0 - jupyter - ipython - numpy >=1.23.0 - pandas >=1.4.0 - scikit-learn >=1.1.0 - - scipy >=1.8.0 - - statsmodels + - scipy >=1.11.0 - matplotlib-base >=3.6.2 test: diff --git a/recipes/pyega3/meta.yaml b/recipes/pyega3/meta.yaml index b2560c1d2c903..5e8ff430248aa 100644 --- a/recipes/pyega3/meta.yaml +++ b/recipes/pyega3/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pyega3" %} -{% set version = "5.1.0" %} +{% set version = "5.2.0" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: f8ffa8558da52ad17b83bda2c94a289cd51f24e86e3230b8eff3aaba3f7db3ce + sha256: 95539b8e153f2311d89a6905723598013fd12a9d0784a911ed1b550a4094bad1 build: number: 0 diff --git a/recipes/pyensembl/meta.yaml b/recipes/pyensembl/meta.yaml index 9693ad2d94240..fedc72c441759 100644 --- a/recipes/pyensembl/meta.yaml +++ b/recipes/pyensembl/meta.yaml @@ -1,6 +1,6 @@ {% set name = "PyEnsembl" %} -{% set version = "2.3.6" %} -{% set sha256 = "206981651d926d455ee85fa813fefb0d6e8bd29983821aef1136df28337b8597" %} +{% set version = "2.3.13" %} +{% set sha256 = "c70ce760f68fe2a6be871db44e53ce1d4d1227f2ce0578c6b291d5a89f5d1832" %} package: name: {{ name|lower }} diff --git a/recipes/pyfaidx/meta.yaml b/recipes/pyfaidx/meta.yaml index 9209e777f8e00..eb721ce14f0d7 100644 --- a/recipes/pyfaidx/meta.yaml +++ b/recipes/pyfaidx/meta.yaml @@ -1,12 +1,12 @@ -{% set version = "0.8.0" %} +{% set version = "0.8.1.1" %} package: name: pyfaidx version: {{ version }} source: - url: https://files.pythonhosted.org/packages/ef/95/aa7e6d1c1b68e64234d5ed985a761edbbce124baea17c2056935626958d2/pyfaidx-0.8.0.tar.gz - sha256: 1eed70f4eafb4ba9c4cf7022cd748947b8ebe0f4c86cb56f42f587ab7f2da027 + url: https://files.pythonhosted.org/packages/0e/32/a89e956d4f27bd8ab4d92f6b27e46386975add4ad13e54504012afa3d025/pyfaidx-0.8.1.1.tar.gz + sha256: 6f0482352619f2cc56003ca22321bdb0d0764b656795bc1e4062b1fa9b08686b build: number: 0 diff --git a/recipes/pyfamsa/meta.yaml b/recipes/pyfamsa/meta.yaml index 14d799d24909a..86a093edaab7e 100644 --- a/recipes/pyfamsa/meta.yaml +++ b/recipes/pyfamsa/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pyfamsa" %} -{% set version = "0.3.1" %} +{% set version = "0.3.2" %} package: name: "{{ name|lower }}" @@ -7,10 +7,10 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 1122a8b06bbbe1045a185d7671e87be0030e3db8e2dd0cb885ff21744c9d24a6 + sha256: c926d6fe00029d712dd277a1544e632c2b20546da322e13bd92780ea3f756dae build: - number: 0 + number: 1 skip: True # [py2k] script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation --use-pep517 -vvv" run_exports: @@ -46,3 +46,5 @@ about: extra: recipe-maintainers: - althonos + additional-platforms: + - linux-aarch64 diff --git a/recipes/pyfastani/meta.yaml b/recipes/pyfastani/meta.yaml index 7f8c1496bd166..d85b7057c9ad7 100644 --- a/recipes/pyfastani/meta.yaml +++ b/recipes/pyfastani/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pyfastani" %} -{% set version = "0.4.1" %} +{% set version = "0.5.1" %} package: name: "{{ name|lower }}" @@ -7,12 +7,14 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 44d86cbe8581d4891748ebe9851ae0a0c27489bb9f77728131415ed6b90cc35a + sha256: ad6c28303290a2389c29ed20db8266bbc4bf89a5b1bf64a7514d1bc9c6ba2d92 build: - number: 3 + number: 0 skip: True #[py2k] script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vvv " + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} requirements: build: diff --git a/recipes/pyfastx/meta.yaml b/recipes/pyfastx/meta.yaml index 9006bae819474..0dfaf051f3fb7 100644 --- a/recipes/pyfastx/meta.yaml +++ b/recipes/pyfastx/meta.yaml @@ -1,6 +1,6 @@ {% set name = "pyfastx" %} -{% set version = "2.0.2" %} -{% set sha256 = "763bb59f58d7884cad8a15ff8b0f0bbc5e29f867a4260d1e5ed9ecb2035ac70b" %} +{% set version = "2.1.0" %} +{% set sha256 = "a3458bba4fa19a637d9ec8bdf9bfdd6e7321a916aeca674d02aa0fe5aeee1c95" %} package: name: {{ name|lower }} @@ -11,7 +11,7 @@ source: sha256: {{ sha256 }} build: - number: 0 + number: 1 script: {{ PYTHON }} -m pip install . --no-deps -vvv skip: True # [py < 36] entry_points: @@ -44,3 +44,7 @@ about: pyfastx is a python module for fast random access to sequences from plain and gzipped FASTA/Q file + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/pyhmmer/meta.yaml b/recipes/pyhmmer/meta.yaml index 65622ccd0e60d..ea675212bdbe2 100644 --- a/recipes/pyhmmer/meta.yaml +++ b/recipes/pyhmmer/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pyhmmer" %} -{% set version = "0.10.4" %} +{% set version = "0.10.12" %} package: name: "{{ name|lower }}" @@ -7,14 +7,14 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 08bc02aadf0f113df2b2912478bb02be9daf5d322df9c72bcd07fa01fe53a87b + sha256: 8457547adaa5f570f9a360a015a968b52709634540f95c17f687916640a075d1 build: number: 0 - skip: True #[py2k or win] - script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation --use-pep517 -vvv" + skip: True # [py2k or win] + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation --no-cache-dir --use-pep517 -vvv" run_exports: - - {{ pin_subpackage('pyhmmer', max_pin="x") }} + - {{ pin_subpackage('pyhmmer', max_pin="x.x") }} requirements: build: @@ -23,15 +23,18 @@ requirements: - python - pip - cython - - setuptools >=46.4 - psutil >=5.8 run: - python - psutil >=5.8 test: + requires: + - importlib_resources #[py36 or py37 or py38] imports: - {{ name }} + commands: + - python -m unittest -vv {{ name }}.tests about: home: https://github.com/althonos/pyhmmer @@ -40,9 +43,12 @@ about: license_file: COPYING summary: Cython bindings and Python interface to HMMER3. doc_url: https://pyhmmer.readthedocs.io + dev_url: https://github.com/althonos/pyhmmer extra: recipe-maintainers: - althonos identifiers: - DOI:10.1093/bioinformatics/btad214 + additional-platforms: + - linux-aarch64 diff --git a/recipes/pymlst/meta.yaml b/recipes/pymlst/meta.yaml index e4ecec72d61bb..8f481b91a588a 100644 --- a/recipes/pymlst/meta.yaml +++ b/recipes/pymlst/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pymlst" %} -{% set version = "2.1.5" %} +{% set version = "2.1.6" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://github.com/bvalot/pyMLST/archive/refs/tags/{{ version }}.tar.gz" - sha256: 505a0a0e79645f385e13e33e8ecd054fa436cb60e6bbec6f25a513e21903faf6 + sha256: 4387893638d2bcee02d91ca82fee3875f81247a4db6b8bdf86b98f445b8a4d61 build: noarch: python diff --git a/recipes/pymochi/meta.yaml b/recipes/pymochi/meta.yaml index 6d20abd0c7781..7ce09a732e24f 100644 --- a/recipes/pymochi/meta.yaml +++ b/recipes/pymochi/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.9" %} +{% set version = "1.0" %} {% set github = "https://github.com/lehner-lab/MoCHI" %} package: @@ -7,7 +7,7 @@ package: source: url: {{ github }}/archive/v{{ version }}.tar.gz - sha256: cec741cc8cda6affc9f4c2fd470afd28ee7c5ec9282bd59a4d4102a6e3afe005 + sha256: 93bd3c32b5a686d5bacecf3d48678497eeed3bf799198ab453e21accefecbae7 build: noarch: python diff --git a/recipes/pymzml/meta.yaml b/recipes/pymzml/meta.yaml index a0256bea1be73..a50f7ac2305cb 100644 --- a/recipes/pymzml/meta.yaml +++ b/recipes/pymzml/meta.yaml @@ -1,10 +1,10 @@ package: name: pymzml - version: "2.5.3" + version: "2.5.9" source: - url: https://github.com/pymzml/pymzML/archive/refs/tags/v2.5.3.tar.gz - sha256: 3578da1962670ef90027cb2944ad64dc39a4457cd93a637bbd2655a7f074a2ee + url: https://github.com/pymzml/pymzML/archive/refs/tags/v2.5.9.tar.gz + sha256: a064aa48bcab79510e564f4d3d93e3546cc2939ceaa89726206ca95c74fccda2 build: number: 0 diff --git a/recipes/pyopal/meta.yaml b/recipes/pyopal/meta.yaml index 300e327a6f612..12f3680ab55a1 100644 --- a/recipes/pyopal/meta.yaml +++ b/recipes/pyopal/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pyopal" %} -{% set version = "0.4.1" %} +{% set version = "0.5.2" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: abfc3cb741eaaaf0185af6efb44b56f458f54fe7b1d4d5b9c54bf60da73e245a + sha256: c58b573890a13197caea03d25b7db1de6fd8f8ece91b1337ab96c7b1668616c9 build: number: 0 diff --git a/recipes/pypgatk/meta.yaml b/recipes/pypgatk/meta.yaml index 870dcf9978182..d116777b91bb4 100644 --- a/recipes/pypgatk/meta.yaml +++ b/recipes/pypgatk/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pypgatk" %} -{% set version = "0.0.23" %} +{% set version = "0.0.24" %} package: name: "{{ name|lower }}" @@ -7,11 +7,13 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: "b99906a05cacb9c4bd5c58ba65b9ef71c4582bc788fd7684002d12832f280c2d" + sha256: "4505e80adf38fb27b80fa0c8ccdc956dcd72a58c839d7d93c42c1b73c9ca8b45" build: number: 0 noarch: python + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv " requirements: @@ -35,6 +37,9 @@ requirements: - pandas # should be removed as soon as we patch the other packages - pysam >=0.16 + - pyahocorasick + - tqdm + - pathos test: imports: diff --git a/recipes/pypgx/meta.yaml b/recipes/pypgx/meta.yaml index 85fe340272681..97ff4a6509b4a 100644 --- a/recipes/pypgx/meta.yaml +++ b/recipes/pypgx/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pypgx" %} -{% set version = "0.23.0" %} +{% set version = "0.24.0" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: f38c23085b0102182cabc8cc0fc32eff05bc668bf68b6a751ad249c70b18242c + sha256: ba93afe9ec0d0dab31e25e7f21db5363c3cf46609403efdd0cc83c656d2744d8 build: number: 0 diff --git a/recipes/pypolca/meta.yaml b/recipes/pypolca/meta.yaml index 6981ef124abde..05b761f65d25c 100644 --- a/recipes/pypolca/meta.yaml +++ b/recipes/pypolca/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pypolca" %} -{% set version = "0.2.1" %} +{% set version = "0.3.1" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 104f9a794d21f36454eb8e89ef317bd086d452a7fc1d4e2433b1afaa8d649c5c + sha256: bb48e81a8a3a11979a3edc8091dbfac4b14ec3a57f0952075ae44c8638bac620 build: number: 0 diff --git a/recipes/pyrle/meta.yaml b/recipes/pyrle/meta.yaml index 5dc32645ae5d5..22700d4dda1c5 100644 --- a/recipes/pyrle/meta.yaml +++ b/recipes/pyrle/meta.yaml @@ -10,7 +10,7 @@ source: sha256: 1be4be7814d3941db907aaf19f311bd46a407244316cadbf4b73109685c055c5 build: - number: 0 + number: 1 skip: True # [py2k] script: python setup.py install --single-version-externally-managed --record=record.txt run_exports: @@ -43,5 +43,7 @@ about: summary: Genomic Rle-objects for Python extra: + additional-platforms: + - linux-aarch64 skip-lints: - uses_setuptools diff --git a/recipes/pyrodigal/build_failure.osx-64.yaml b/recipes/pyrodigal/build_failure.osx-64.yaml deleted file mode 100644 index 4f9f326f71367..0000000000000 --- a/recipes/pyrodigal/build_failure.osx-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: a0eea3e712441dfcfc57db816b9d49d5e2eb5ea661ee696199d496549d6919c2 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |- - {} is not a Mach-O file - Can't parse the binary at the index #1 - {} is not a Mach-O file - Can't parse the binary at the index #0 - {} is not a Mach-O file - Can't parse the binary at the index #1 - {} is not a Mach-O file - Can't parse the binary at the index #0 - {} is not a Mach-O file - Can't parse the binary at the index #1 - {} is not a Mach-O file - Can't parse the binary at the index #0 - {} is not a Mach-O file - Can't parse the binary at the index #1 - {} is not a Mach-O file - Can't parse the binary at the index #0 - {} is not a Mach-O file - Can't parse the binary at the index #1 - {} is not a Mach-O file - Can't parse the binary at the index #0 - {} is not a Mach-O file - Can't parse the binary at the index #1 - {} is not a Mach-O file - Can't parse the binary at the index #2 - {} is not a Mach-O file - Can't parse the binary at the index #3 - {} is not a Mach-O file - Can't parse the binary at the index #4 - {} is not a Mach-O file - Can't parse the binary at the index #0 - {} is not a Mach-O file - Can't parse the binary at the index #1 - {} is not a Mach-O file - Can't parse the binary at the index #2 - {} is not a Mach-O file - Can't parse the binary at the index #3 - {} is not a Mach-O file - Can't parse the binary at the index #4 - {} is not a Mach-O file - Can't parse the binary at the index #0 - {} is not a Mach-O file - Can't parse the binary at the index #1 - INFO: sysroot: '/System/Library/Frameworks/' files: '['vmnet.framework/Versions/A/_CodeSignature/CodeResources', 'vmnet.framework/Versions/A/Resources/version.plist', 'vmnet.framework/Versions/A/Resources/en.lproj/InfoPlist.strings', 'vmnet.framework/Versions/A/Resources/Info.plist']' - INFO: sysroot: '/usr/lib/' files: '['zsh/5.8.1/zsh/zselect.so', 'zsh/5.8.1/zsh/zpty.so', 'zsh/5.8.1/zsh/zprof.so', 'zsh/5.8.1/zsh/zleparameter.so']' - INFO: sysroot: '/opt/X11/' files: '[]' - INFO (pyrodigal,lib/python3.10/site-packages/pyrodigal/_pyrodigal.cpython-310-darwin.so): Needed DSO /System/Library/Frameworks/libSystem.B.dylib found in $SYSROOT - WARNING (pyrodigal): interpreter (Python) package conda-forge::python-3.10.11-he7542f4_0_cpython in requirements/run but it is not used (i.e. it is overdepending or perhaps statically linked? If that is what you want then add it to build/ignore_run_exports) - WARNING (pyrodigal): interpreted library (Python) package conda-forge::setuptools-67.7.2-pyhd8ed1ab_0 in requirements/run but it is not used (i.e. it is overdepending or perhaps statically linked? If that is what you want then add it to build/ignore_run_exports) - Fixing permissions - Packaged license file/s. - INFO :: Time taken to mark (prefix) - 0 replacements in 0 files was 0.10 seconds - Files containing CONDA_PREFIX - ----------------------------- - bin/pyrodigal (text): Patching - TEST START: /opt/mambaforge/envs/bioconda/conda-bld/osx-64/pyrodigal-2.1.0-py310he07d9a1_3.tar.bz2 - Renaming work directory '/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/work' to '/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/work_moved_pyrodigal-2.1.0-py310he07d9a1_3_osx-64' - shutil.move(work)=/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/work, dest=/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/work_moved_pyrodigal-2.1.0-py310he07d9a1_3_osx-64) - INFO:conda_build.utils:Renaming work directory '/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/work' to '/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/work_moved_pyrodigal-2.1.0-py310he07d9a1_3_osx-64' - INFO:conda_build.utils:shutil.move(work)=/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/work, dest=/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/work_moved_pyrodigal-2.1.0-py310he07d9a1_3_osx-64) - Reloading output folder: /opt/mambaforge/envs/bioconda/conda-bld - - ## Package Plan ## - - environment location: /opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/_test_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold - - - The following NEW packages will be INSTALLED: - - bzip2: 1.0.8-h0d85af4_4 conda-forge - ca-certificates: 2023.5.7-h8857fd0_0 conda-forge - libffi: 3.4.2-h0d85af4_5 conda-forge - libsqlite: 3.42.0-h58db7d2_0 conda-forge - libzlib: 1.2.13-hfd90126_4 conda-forge - ncurses: 6.3-h96cf925_1 conda-forge - openssl: 3.1.0-h8a1eda9_3 conda-forge - pyrodigal: 2.1.0-py310he07d9a1_3 local - python: 3.10.11-he7542f4_0_cpython conda-forge - python_abi: 3.10-3_cp310 conda-forge - readline: 8.2-h9e318b2_1 conda-forge - setuptools: 67.7.2-pyhd8ed1ab_0 conda-forge - tk: 8.6.12-h5dbffcc_0 conda-forge - tzdata: 2023c-h71feb2d_0 conda-forge - xz: 5.2.6-h775f41a_0 conda-forge - - Preparing transaction: ...working... done - Verifying transaction: ...working... done - Executing transaction: ...working... done - export PREFIX=/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/_test_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold - export SRC_DIR=/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/test_tmp - import: 'pyrodigal' - Traceback (most recent call last): - File "/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/test_tmp/run_test.py", line 2, in - import pyrodigal - File "/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/_test_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold/lib/python3.10/site-packages/pyrodigal/__init__.py", line 8, in - from . import _pyrodigal - ImportError: dlopen(/opt/mambaforge/envs/bioconda/conda-bld/pyrodigal_1685394321921/_test_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold/lib/python3.10/site-packages/pyrodigal/_pyrodigal.cpython-310-darwin.so, 0x0002): symbol not found in flat namespace (_GetX86Info) - Tests failed for pyrodigal-2.1.0-py310he07d9a1_3.tar.bz2 - moving package to /opt/mambaforge/envs/bioconda/conda-bld/broken - WARNING:conda_build.build:Tests failed for pyrodigal-2.1.0-py310he07d9a1_3.tar.bz2 - moving package to /opt/mambaforge/envs/bioconda/conda-bld/broken - TESTS FAILED: pyrodigal-2.1.0-py310he07d9a1_3.tar.bz2 -# Last 100 lines of the build log. diff --git a/recipes/pyrodigal/meta.yaml b/recipes/pyrodigal/meta.yaml index 79aae4b1a1021..437c6da734fc4 100644 --- a/recipes/pyrodigal/meta.yaml +++ b/recipes/pyrodigal/meta.yaml @@ -1,5 +1,5 @@ {% set name = "pyrodigal" %} -{% set version = "3.2.1" %} +{% set version = "3.3.0" %} package: name: "{{ name|lower }}" @@ -7,16 +7,16 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 7c0bb83eafa888bdc5d931fb3a1f6abc35247f96abc3f9e557a0109e85cbdd35 + sha256: 68f92cd83f9cd2883b99433847a827dd84ccb27edc51cb3f415664f0f08b0325 build: - number: 0 + number: 1 skip: True # [py < 36] - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed --use-pep517 -vvv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation --no-cache-dir --use-pep517 -vvv" entry_points: - pyrodigal = pyrodigal.cli:main run_exports: - - {{ pin_subpackage("pyrodigal", max_pin="x.x") }} + - {{ pin_subpackage("pyrodigal", max_pin="x") }} requirements: build: @@ -25,7 +25,6 @@ requirements: - python - pip - cython - - setuptools run: - python - archspec >=0.2.0 @@ -39,14 +38,17 @@ test: about: home: https://github.com/althonos/pyrodigal - license: GPL-3 - license_family: GPL + license: GPL-3.0-or-later + license_family: GPL3 license_file: COPYING summary: Python bindings to Prodigal, an ORF finder for microbial sequences. doc_url: https://pyrodigal.readthedocs.org/ + dev_url: https://github.com/althonos/pyrodigal extra: recipe-maintainers: - althonos identifiers: - doi:10.21105/joss.04296 # JOSS paper + additional-platforms: + - linux-aarch64 diff --git a/recipes/pysam/arm_hwcap.patch b/recipes/pysam/arm_hwcap.patch new file mode 100644 index 0000000000000..d7f908ab3d6b4 --- /dev/null +++ b/recipes/pysam/arm_hwcap.patch @@ -0,0 +1,15 @@ +Conda-forge's build environment on ARM uses sysroot_linux-aarch64 2.17, which +is based on glibc 2.17 so does not define HWCAP_* values on ARM. +Work around this by including the kernel header to get the desired values. + +--- a/htslib/htscodecs/htscodecs/rANS_static4x16pr.c 2023-10-10 02:54:16 ++++ b/htslib/htscodecs/htscodecs/rANS_static4x16pr.c 2024-03-06 00:01:14 +@@ -1011,6 +1011,8 @@ + + #if defined(__linux__) || defined(__FreeBSD__) + #include ++// Ensure ARM HWCAP_* values are defined even on old glibc ++#include + #elif defined(_WIN32) + #include + #endif diff --git a/recipes/pysam/meta.yaml b/recipes/pysam/meta.yaml index cb8678b99147c..ac9c338d92f61 100644 --- a/recipes/pysam/meta.yaml +++ b/recipes/pysam/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.22.0" %} +{% set version = "0.22.1" %} package: name: pysam @@ -6,7 +6,9 @@ package: source: url: https://github.com/pysam-developers/pysam/archive/v{{ version }}.tar.gz - sha256: 61b3377c5f889ddc6f6979912c3bb960d7e08407dada9cb38f13955564ea036f + sha256: e4981524d7627c53fa0d3f8cbec2bd65c2ea7520092f25e1029af12cb7b82ff6 + patches: + - arm_hwcap.patch build: number: 0 @@ -31,12 +33,6 @@ requirements: - openssl # [not osx] run: - python - - zlib - - xz - - bzip2 - - libdeflate - - libcurl - - openssl # [not osx] about: home: https://github.com/pysam-developers/pysam @@ -44,6 +40,8 @@ about: summary: "Pysam is a Python module for reading and manipulating SAM/BAM/VCF/BCF files. It's a lightweight wrapper of the htslib C-API, the same one that powers samtools, bcftools, and tabix." extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:pysam - doi:10.1093/bioinformatics/btp352 diff --git a/recipes/pysamstats/meta.yaml b/recipes/pysamstats/meta.yaml index f6f765ba811b1..e0e59504cd7e9 100644 --- a/recipes/pysamstats/meta.yaml +++ b/recipes/pysamstats/meta.yaml @@ -7,7 +7,9 @@ source: md5: 050294fe9fe99aae3b07ea28f6cbe449 build: - number: 10 + number: 11 + run_exports: + - {{ pin_subpackage('pysamstats', max_pin="x") }} requirements: build: @@ -41,5 +43,7 @@ about: on sequence alignments from a SAM, BAM or CRAM file. extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:pysamstats diff --git a/recipes/pyspoa/meta.yaml b/recipes/pyspoa/meta.yaml index 94deab4fe5d7f..4e1d12c9e6cac 100644 --- a/recipes/pyspoa/meta.yaml +++ b/recipes/pyspoa/meta.yaml @@ -11,11 +11,11 @@ source: sha256: {{ sha256 }} build: - number: 0 + number: 1 skip: True # [py < 38] script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation run_exports: - - {{ pin_subpackage('pyspoa', max_pin="x") }} + - {{ pin_subpackage('pyspoa', max_pin="x.x") }} requirements: build: @@ -25,8 +25,6 @@ requirements: host: - python - pip - - setuptools - - wheel - pybind11 - scikit-build - zlib @@ -50,3 +48,5 @@ extra: recipe-maintainers: - cjw85 - iiSeymour + additional-platforms: + - linux-aarch64 diff --git a/recipes/pytabix/meta.yaml b/recipes/pytabix/meta.yaml index b1261eec08bf5..32f31a6178bde 100644 --- a/recipes/pytabix/meta.yaml +++ b/recipes/pytabix/meta.yaml @@ -6,8 +6,10 @@ package: version: {{ version }} build: - number: 4 + number: 5 script: '{{ PYTHON }} -m pip install . --no-deps -vv' + run_exports: + - {{ pin_subpackage('pytabix', max_pin='x.x') }} source: url: https://pypi.io/packages/source/p/pytabix/pytabix-{{ version }}.tar.gz @@ -35,3 +37,7 @@ about: license: MIT license_file: LICENSE summary: Fast random access to sorted files compressed with bgzip and indexed by tabix. + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/pytaxonkit/meta.yaml b/recipes/pytaxonkit/meta.yaml index 2f82b3f837c92..8da2b003b8ae3 100644 --- a/recipes/pytaxonkit/meta.yaml +++ b/recipes/pytaxonkit/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.8" %} -{% set sha256 = "414793a8ddc40c03c8c63512114c613153b31ff4c7da1feb015c2f3191f4d8d0" %} +{% set version = "0.9" %} +{% set sha256 = "539ae750fef3d213b669645359dbd4758e28950981a72a35755a852cd8f50358" %} package: name: pytaxonkit @@ -10,19 +10,21 @@ source: sha256: '{{sha256}}' build: + run_exports: + - {{ pin_subpackage("pytaxonkit", max_pin="x.x") }} noarch: python - script: python -m pip install --no-deps --ignore-installed . + script: {{ PYTHON }} -m pip install --no-deps --no-build-isolation . -vvv number: 0 requirements: host: - - python >=3 + - python >=3,<3.12 - pip run: - - python >=3 + - python >=3,<3.12 - pandas >=1.0 - pytest >=5.4 - - taxonkit >=0.8 + - taxonkit >=0.16 test: imports: @@ -33,11 +35,13 @@ test: about: home: https://github.com/bioforensics/pytaxonkit/ - license: BSD License + license: BSD-3-Clause license_family: BSD + license_file: LICENSE summary: Python bindings for the TaxonKit library. dev_url: https://github.com/bioforensics/pytaxonkit/ extra: recipe-maintainers: - standage + - RyanBerger98 diff --git a/recipes/pyteomics/meta.yaml b/recipes/pyteomics/meta.yaml index 1f42dfe14a83d..cdc52d031adeb 100644 --- a/recipes/pyteomics/meta.yaml +++ b/recipes/pyteomics/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "4.6.3" %} +{% set version = "4.7.2" %} package: name: pyteomics @@ -6,7 +6,7 @@ package: source: url: https://pypi.io/packages/source/p/pyteomics/pyteomics-{{ version }}.tar.gz - sha256: e3bb11e57da3e52ca768d94fed12c9f66d7300fd58bccbc6736dfc0707fd9546 + sha256: 9c2cc22f0e45574c62a8e8628a8412d7b5688ccdd679b2f6ddc6fbbee2abb26d build: noarch: python diff --git a/recipes/python-edlib/LICENSE b/recipes/python-edlib/LICENSE new file mode 100644 index 0000000000000..d8f3fefba092a --- /dev/null +++ b/recipes/python-edlib/LICENSE @@ -0,0 +1,20 @@ +The MIT License (MIT) + +Copyright (c) 2014 Martin Šošić + +Permission is hereby granted, free of charge, to any person obtaining a copy of +this software and associated documentation files (the "Software"), to deal in +the Software without restriction, including without limitation the rights to +use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of +the Software, and to permit persons to whom the Software is furnished to do so, +subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS +FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR +COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER +IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN +CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. diff --git a/recipes/python-edlib/build.sh b/recipes/python-edlib/build.sh deleted file mode 100644 index 3786386a73c83..0000000000000 --- a/recipes/python-edlib/build.sh +++ /dev/null @@ -1,3 +0,0 @@ -#!/bin/bash - -$PYTHON setup.py install --single-version-externally-managed --record=record.txt diff --git a/recipes/python-edlib/meta.yaml b/recipes/python-edlib/meta.yaml index 620f2a4a05d0f..54fe7588ea123 100644 --- a/recipes/python-edlib/meta.yaml +++ b/recipes/python-edlib/meta.yaml @@ -9,14 +9,18 @@ source: sha256: 64c3dfab3ebe3e759565a0cc71eb4df23cf3ce1713fd558af3c473dddc2a3766 build: - number: 4 + number: 6 + script: "EDLIB_USE_CYTHON=1 {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage("python-edlib", max_pin="x") }} requirements: build: - {{ compiler('cxx') }} host: - python - - setuptools + - pip + - cython run: - python @@ -26,6 +30,15 @@ test: about: home: https://github.com/Martinsos/edlib - license: MIT License + license: MIT summary: 'Lightweight, super fast C/C++ (& Python) library for sequence alignment using edit (Levenshtein) distance.' license_family: MIT + license_file: LICENSE + dev_url: https://github.com/Martinsos/edlib + doc_url: https://martinsos.github.io/edlib/ + +extra: + additional-platforms: + - linux-aarch64 + identifiers: + - doi:10.1093/bioinformatics/btw753 diff --git a/recipes/python-msgpack/meta.yaml b/recipes/python-msgpack/meta.yaml index 7813176a17dcd..3df723ced1e0e 100644 --- a/recipes/python-msgpack/meta.yaml +++ b/recipes/python-msgpack/meta.yaml @@ -7,7 +7,9 @@ source: url: https://files.pythonhosted.org/packages/81/9c/0036c66234482044070836cc622266839e2412f8108849ab0bfdeaab8578/msgpack-{{ version }}.tar.gz sha256: 4008c72f5ef2b7936447dcb83db41d97e9791c83221be13d5e19db0796df1972 build: - number: 8 + number: 9 + run_exports: + - {{ pin_subpackage('python-msgpack', max_pin='x.x') }} requirements: build: - {{ compiler('cxx') }} @@ -24,4 +26,6 @@ about: license: Apache 2.0 summary: "It's like JSON. But fast and small." extra: + additional-platforms: + - linux-aarch64 web: http://msgpack.org/ diff --git a/recipes/pytransaln/meta.yaml b/recipes/pytransaln/meta.yaml new file mode 100644 index 0000000000000..d3c02cd1a111b --- /dev/null +++ b/recipes/pytransaln/meta.yaml @@ -0,0 +1,50 @@ +{% set name = "pytransaln" %} +{% set version = "0.2.1" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/pytransaln-{{ version }}.tar.gz + sha256: 280a035573dc2e709d226b628fbee41d1ee6afcff5f7a7185aac05135314a2e2 + +build: + entry_points: + - pytransaln = pytransaln.pytransaln:main + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage('pytransaln', max_pin="x.x") }} + +requirements: + host: + - python + - setuptools >=61.0.0 + - pip + run: + - python + - biopython >=1.80,<2 + - pandas >=1.3,<3 + - matplotlib-base >=3.6,<4 + - pyhmmer ==0.10 + +test: + imports: + - pytransaln + commands: + - pip check + - pytransaln --help + requires: + - pip + +about: + home: https://github.com/monagrland/pytransaln + summary: Translation-guided nucleotide alignment for coding sequences + license: MIT + license_file: LICENSE + +extra: + recipe-maintainers: + - kbseah diff --git a/recipes/pytrf/meta.yaml b/recipes/pytrf/meta.yaml index 14cbbf40ed6d3..209d0d802eb4b 100644 --- a/recipes/pytrf/meta.yaml +++ b/recipes/pytrf/meta.yaml @@ -1,6 +1,6 @@ {% set name = "pytrf" %} -{% set version = "1.2.1" %} -{% set sha256 = "47d201d0cb2dad705f9a4e6030d374878c4b6e30762eefd08f159c28db7402df" %} +{% set version = "1.3.0" %} +{% set sha256 = "624497536b4e9a5cb8bbddb7ead7a2253a89b27ccf872178e9a8d975e21695f6" %} package: name: "{{ name|lower }}" @@ -11,7 +11,7 @@ source: sha256: "{{ sha256 }}" build: - number: 1 + number: 0 skip: True # [py < 36] script: "{{ PYTHON }} -m pip install . --ignore-installed --no-deps -vv" run_exports: diff --git a/recipes/quast/build_failure.osx-64.yaml b/recipes/quast/build_failure.osx-64.yaml deleted file mode 100644 index a7c6bce3f464b..0000000000000 --- a/recipes/quast/build_failure.osx-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: 8237e906909f841e6f9591915ec9d3c10a947f897db59de841e5405f1d688b92 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |2- - adding 'quast_libs/minimap2/python/cmappy.h' - INFO adding 'quast_libs/minimap2/python/cmappy.pxd' - adding 'quast_libs/minimap2/python/cmappy.pxd' - INFO adding 'quast_libs/minimap2/python/mappy.pyx' - adding 'quast_libs/minimap2/python/mappy.pyx' - INFO adding 'quast_libs/minimap2/python/minimap2.py' - adding 'quast_libs/minimap2/python/minimap2.py' - INFO adding 'quast_libs/minimap2/sse2neon/emmintrin.h' - adding 'quast_libs/minimap2/sse2neon/emmintrin.h' - INFO adding 'quast_libs/ra_utils/__init__.py' - adding 'quast_libs/ra_utils/__init__.py' - INFO adding 'quast_libs/ra_utils/argparse.py' - adding 'quast_libs/ra_utils/argparse.py' - INFO adding 'quast_libs/ra_utils/misc.py' - adding 'quast_libs/ra_utils/misc.py' - INFO adding 'quast_libs/ra_utils/vcfToBedpe.py' - adding 'quast_libs/ra_utils/vcfToBedpe.py' - INFO adding 'quast_libs/sambamba/sambamba_linux' - adding 'quast_libs/sambamba/sambamba_linux' - INFO adding 'quast_libs/sambamba/sambamba_osx' - adding 'quast_libs/sambamba/sambamba_osx' - INFO adding 'quast_libs/site_packages/__init__.py' - adding 'quast_libs/site_packages/__init__.py' - INFO adding 'quast_libs/site_packages/_bz2.py' - adding 'quast_libs/site_packages/_bz2.py' - INFO adding 'quast_libs/site_packages/_compression.py' - adding 'quast_libs/site_packages/_compression.py' - INFO adding 'quast_libs/site_packages/bz2.py' - adding 'quast_libs/site_packages/bz2.py' - INFO adding 'quast_libs/site_packages/ordered_dict.py' - adding 'quast_libs/site_packages/ordered_dict.py' - INFO adding 'quast_libs/site_packages/jsontemplate/__init__.py' - adding 'quast_libs/site_packages/jsontemplate/__init__.py' - INFO adding 'quast_libs/site_packages/jsontemplate/jsontemplate.py' - adding 'quast_libs/site_packages/jsontemplate/jsontemplate.py' - INFO adding 'quast-5.2.0.dist-info/LICENSE.txt' - adding 'quast-5.2.0.dist-info/LICENSE.txt' - INFO adding 'quast-5.2.0.dist-info/METADATA' - adding 'quast-5.2.0.dist-info/METADATA' - INFO adding 'quast-5.2.0.dist-info/WHEEL' - adding 'quast-5.2.0.dist-info/WHEEL' - INFO adding 'quast-5.2.0.dist-info/top_level.txt' - adding 'quast-5.2.0.dist-info/top_level.txt' - INFO adding 'quast-5.2.0.dist-info/RECORD' - adding 'quast-5.2.0.dist-info/RECORD' - INFO removing build/bdist.macosx-10.9-x86_64/wheel - removing build/bdist.macosx-10.9-x86_64/wheel - Building wheel for quast (setup.py): finished with status 'done' - Created wheel for quast: filename=quast-5.2.0-py3-none-any.whl size=12996553 sha256=95ee42f38e8b80a8659a77f57f83ff38db5e44342ae493a3b085160b7df6396f - Stored in directory: /private/tmp/pip-ephem-wheel-cache-2t0etpfr/wheels/5f/48/0f/e9fc35a974c2af5e84beac3740c829770b288236193c061309 - Successfully built quast - Installing collected packages: quast - - Successfully installed quast-5.2.0 - Removed build tracker: '/private/tmp/pip-build-tracker-gi2wl7cm' - tail: /opt/mambaforge/envs/bioconda/conda-bld/quast_1685395312261/work/quast_libs/*/make.*: No such file or directory - - Resource usage statistics from building quast: - Process count: 4 - CPU time: Sys=0:00:02.5, User=0:00:05.3 - Memory: 97.0M - Disk usage: 452.0K - Time elapsed: 0:00:17.0 - - - compiling .pyc files... - number of files: 929 - Making absolute symlink relative (bin/quast -> /opt/mambaforge/envs/bioconda/conda-bld/quast_1685395312261/_h_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehol/opt/quast-5.2.0/quast.py :-> ../opt/quast-5.2.0/quast.py) - Making absolute symlink relative (bin/metaquast -> /opt/mambaforge/envs/bioconda/conda-bld/quast_1685395312261/_h_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehol/opt/quast-5.2.0/metaquast.py :-> ../opt/quast-5.2.0/metaquast.py) - Making absolute symlink relative (opt/quast-5.2.0/quast_libs -> /opt/mambaforge/envs/bioconda/conda-bld/quast_1685395312261/_h_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehol/lib/python3.8/site-packages/quast_libs :-> ../../lib/python3.8/site-packages/quast_libs) - Traceback (most recent call last): - File "/opt/mambaforge/envs/bioconda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 2358, in build - newly_built_packages = bundlers[pkg_type](output_d, m, env, stats) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 1659, in bundle_conda - files = post_process_files(metadata, initial_files) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 1505, in post_process_files - post_build(m, new_files, build_python=python) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/post.py", line 1318, in post_build - post_process_shared_lib(m, f, prefix_files, host_prefix) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/post.py", line 1266, in post_process_shared_lib - mk_relative_osx(path, host_prefix, m, files=files, rpaths=rpaths) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/post.py", line 397, in mk_relative_osx - names = macho.otool(path, prefix) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/os_utils/macho.py", line 194, in otool - lines = check_output([otool, '-l', path], - File "/opt/mambaforge/envs/bioconda/lib/python3.8/subprocess.py", line 415, in check_output - return run(*popenargs, stdout=PIPE, timeout=timeout, check=True, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/subprocess.py", line 516, in run - raise CalledProcessError(retcode, process.args, - subprocess.CalledProcessError: Command '['/opt/mambaforge/envs/bioconda/conda-bld/quast_1685395312261/_build_env/bin/llvm-otool', '-l', '/opt/mambaforge/envs/bioconda/conda-bld/quast_1685395312261/_h_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehol/lib/python3.8/site-packages/quast_libs/sambamba/sambamba_osx']' died with . -# Last 100 lines of the build log. diff --git a/recipes/quatradis/meta.yaml b/recipes/quatradis/meta.yaml index 3696f0501a2d7..a91fb4a8cd361 100644 --- a/recipes/quatradis/meta.yaml +++ b/recipes/quatradis/meta.yaml @@ -1,4 +1,4 @@ -{% set version="1.1.0" %} +{% set version="1.3.0" %} package: name: quatradis @@ -6,7 +6,7 @@ package: source: url: https://github.com/quadram-institute-bioscience/QuaTradis/archive/refs/tags/{{ version }}.tar.gz - sha256: 10a49ec364f8ca9d86fd882f6186679fc9ce5932b4552381cc6d5a8a9b525be2 + sha256: 8634c61c93073028fc35df46b3d1337e7716924051c336a12172c65e1adb2e74 build: number: 0 diff --git a/recipes/querynator/meta.yaml b/recipes/querynator/meta.yaml index fdbddc2f8f2f8..137289ca06a6d 100644 --- a/recipes/querynator/meta.yaml +++ b/recipes/querynator/meta.yaml @@ -1,5 +1,5 @@ {% set name = "querynator" %} -{% set version = "0.4.1" %} +{% set version = "0.4.2" %} package: name: "{{ name|lower }}" @@ -7,11 +7,13 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 394a48c700ce6c8940cf134ffe0cf1f58f2418fcc8fffef4509a9a08567bda1c + sha256: 869fec02e402428e68c522d0b906a6baaaa6cdecdcd83195f8d775e58ef635a4 build: number: 0 noarch: python + run_exports: + - {{ pin_subpackage('querynator', max_pin="x") }} entry_points: - querynator=querynator.__main__:run_querynator script: "{{ PYTHON }} -m pip install . -vv" diff --git a/recipes/quicktree/build.sh b/recipes/quicktree/build.sh index 6796b7efd05b6..7d776e66d9e68 100644 --- a/recipes/quicktree/build.sh +++ b/recipes/quicktree/build.sh @@ -1,5 +1,12 @@ #!/bin/bash -mkdir -p $PREFIX/bin +set -eux + +mkdir -p "$PREFIX"/{bin,lib,include/quicktree} + make CC=$CC + cp quicktree $PREFIX/bin +cp libquicktree.so "${PREFIX}/lib/" +# some header files are named generic enough to warrant namespacing +cp include/*.h "${PREFIX}/include/quicktree/" diff --git a/recipes/quicktree/meta.yaml b/recipes/quicktree/meta.yaml index b663ce6822c58..8e9fe92a91c7a 100644 --- a/recipes/quicktree/meta.yaml +++ b/recipes/quicktree/meta.yaml @@ -1,21 +1,26 @@ +{% set name = "quicktree" %} {% set version = "2.5" %} package: - name: quicktree + name: {{ name }} version: {{ version }} source: url: https://github.com/khowe/quicktree/archive/v{{ version }}.tar.gz sha256: 731aa845ce3f1f0645bd0df2b54df75f78fce065d6a3ddc47fedf4bdcb11c248 + patches: + - patches/0001-Add-rule-to-build-shared-library.patch + - patches/0002-Fix-segfault-in-sonLib-phylogeny-tests.patch build: - number: 4 + number: 6 + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: build: - make - {{ compiler('c') }} - run: test: commands: diff --git a/recipes/quicktree/patches/0001-Add-rule-to-build-shared-library.patch b/recipes/quicktree/patches/0001-Add-rule-to-build-shared-library.patch new file mode 100644 index 0000000000000..37c17acd29c9b --- /dev/null +++ b/recipes/quicktree/patches/0001-Add-rule-to-build-shared-library.patch @@ -0,0 +1,43 @@ +From 6c92fb5efd973d1fa6a7ae05515ba54302be95c5 Mon Sep 17 00:00:00 2001 +From: Travis Wrightsman +Date: Tue, 23 Jan 2024 23:01:04 -0500 +Subject: [PATCH] Add rule to build shared library + +--- + Makefile | 9 ++++++--- + 1 file changed, 6 insertions(+), 3 deletions(-) + +diff --git a/Makefile b/Makefile +index 14e42a4..7fe8385 100644 +--- a/Makefile ++++ b/Makefile +@@ -15,15 +15,18 @@ QUICKTREEOBJ = $(COMMON) $(OBJ)/quicktree.o $(OBJ)/buildtree.o $(OBJ)/tree.o + + + CC = gcc +-CFLAGS = -c -I$(INC) -O2 -Wunused-result ++CFLAGS = -c -I$(INC) -O2 -Wunused-result -fPIC + + LFLAGS = -g + +-all: quicktree ++all: quicktree libquicktree.so + + quicktree : $(QUICKTREEOBJ) + $(CC) $(LFLAGS) -o $@ $(QUICKTREEOBJ) -lm + ++libquicktree.so: $(QUICKTREEOBJ) ++ $(CC) -shared $(LFLAGS) -o $@ $(QUICKTREEOBJ) -lm ++ + $(OBJ)/quicktree.o : $(SRC)/quicktree.c $(INC)/version.h + $(CC) $(CFLAGS) -o $(OBJ)/quicktree.o $(SRC)/quicktree.c + +@@ -52,4 +55,4 @@ $(OBJ)/options.o : $(SRC)/options.c $(INC)/options.h + $(CC) $(CFLAGS) -o $(OBJ)/options.o $(SRC)/options.c + + clean: +- rm $(OBJ)/*.o quicktree ++ rm $(OBJ)/*.o quicktree libquicktree.so +-- +2.39.2 + diff --git a/recipes/quicktree/patches/0002-Fix-segfault-in-sonLib-phylogeny-tests.patch b/recipes/quicktree/patches/0002-Fix-segfault-in-sonLib-phylogeny-tests.patch new file mode 100644 index 0000000000000..0e3f87c7aac7e --- /dev/null +++ b/recipes/quicktree/patches/0002-Fix-segfault-in-sonLib-phylogeny-tests.patch @@ -0,0 +1,34 @@ +From c4470daeed25f720de4376a5f43820ba32c2cf61 Mon Sep 17 00:00:00 2001 +From: Travis Wrightsman +Date: Tue, 23 Jan 2024 23:02:51 -0500 +Subject: [PATCH] Fix segfault in sonLib phylogeny tests + +--- + src/tree.c | 4 ++-- + 1 file changed, 2 insertions(+), 2 deletions(-) + +diff --git a/src/tree.c b/src/tree.c +index 5b5187f..3bd8626 100644 +--- a/src/tree.c ++++ b/src/tree.c +@@ -60,7 +60,7 @@ struct Tnode *clone_Tnode( struct Tnode *source) { + struct Tnode *dest = NULL; + + if (source != NULL) { +- dest = (struct Tnode *) malloc_util( sizeof( struct Tnode ) ); ++ dest = (struct Tnode *) calloc_util(1, sizeof( struct Tnode ) ); + + dest->distance = source->distance; + dest->nodenumber = source->nodenumber; +@@ -334,7 +334,7 @@ struct Tree *get_root_Tnode( struct Tree *source ) { + struct Tnode *new_interior_Tnode( unsigned int label ) { + struct Tnode *newNode; + +- newNode = (struct Tnode *) malloc_util(sizeof(struct Tnode)); ++ newNode = (struct Tnode *) calloc_util(1, sizeof(struct Tnode)); + newNode->left = NULL; + newNode->right = NULL; + newNode->parent = NULL; +-- +2.39.2 + diff --git a/recipes/r-acidgenerics/meta.yaml b/recipes/r-acidgenerics/meta.yaml index 98a2c9a3d8e1f..e3a427c3792d3 100644 --- a/recipes/r-acidgenerics/meta.yaml +++ b/recipes/r-acidgenerics/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.7.6" %} +{% set version = "0.7.8" %} {% set github = "https://github.com/acidgenomics/r-acidgenerics" %} package: @@ -7,7 +7,7 @@ package: source: url: "{{ github }}/archive/v{{ version }}.tar.gz" - sha256: 4769b11a73bc1d159772a6caf9fb2887dc4f6a1147c7e782b68c3fbfd125136b + sha256: baa0346b8cd0ebcdbef2d15028eb2d0c425731acfea718f057c6faef1606ff3b build: number: 0 diff --git a/recipes/r-acidplots/meta.yaml b/recipes/r-acidplots/meta.yaml index c34dc6a9b5aa5..491f5b79bb3d1 100644 --- a/recipes/r-acidplots/meta.yaml +++ b/recipes/r-acidplots/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.7.2" %} +{% set version = "0.7.3" %} {% set github = "https://github.com/acidgenomics/r-acidplots" %} package: @@ -7,7 +7,7 @@ package: source: url: "{{ github }}/archive/v{{ version }}.tar.gz" - sha256: 29edee3a481384cb4b3593e07f87cde2c7313f6d3318c7747ec3bfa1c933376a + sha256: d329072ba00d062ccef15a510aac73fc918b6f9db2d47dbfd5ffd82afc70c548 build: noarch: generic diff --git a/recipes/r-acidplyr/meta.yaml b/recipes/r-acidplyr/meta.yaml index 39281769fbecc..e3ef97b68da93 100644 --- a/recipes/r-acidplyr/meta.yaml +++ b/recipes/r-acidplyr/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.5.3" %} +{% set version = "0.5.4" %} {% set github = "https://github.com/acidgenomics/r-acidplyr" %} package: @@ -7,7 +7,7 @@ package: source: url: "{{ github }}/archive/v{{ version }}.tar.gz" - sha256: d7667aa3ec534fbe13667a30ede0fc2f7bc25f0ea63a7b4708a28e1ed999ebf5 + sha256: 6fd487f33b1ed9ccc1c2580003c8ea9907efd0fcf2b3875f27efa3ccf7d62e45 build: number: 0 diff --git a/recipes/r-acidsinglecell/meta.yaml b/recipes/r-acidsinglecell/meta.yaml index ad35a25f806b7..962ac75f917b7 100644 --- a/recipes/r-acidsinglecell/meta.yaml +++ b/recipes/r-acidsinglecell/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.4.1" %} +{% set version = "0.4.2" %} {% set github = "https://github.com/acidgenomics/r-acidsinglecell" %} package: @@ -7,7 +7,7 @@ package: source: url: "{{ github }}/archive/v{{ version }}.tar.gz" - sha256: 69b81a103280720ac91f05056b81c8a485e5a70cc5802cfb39a23db7ebdc2487 + sha256: cc3068a1653e99a218607a9a994d8ee13490ebe162c403a6a7805ba10bfc50b0 build: number: 0 diff --git a/recipes/r-ampvis2/meta.yaml b/recipes/r-ampvis2/meta.yaml index fc5c07195db77..57c01fefc9001 100644 --- a/recipes/r-ampvis2/meta.yaml +++ b/recipes/r-ampvis2/meta.yaml @@ -1,20 +1,22 @@ {% set name = "r-ampvis2" %} -{% set version = "2.7.32" %} +{% set version = "2.8.6" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://github.com/MadsAlbertsen/ampvis2/archive/refs/tags/v{{ version }}.tar.gz - sha256: b75f2e92e3d8999e47b8004824b7d1e0a9bb7b0c5fb116296e11a0d87ec0ac4a + url: https://github.com/KasperSkytte/ampvis2/archive/refs/tags/v{{ version }}.tar.gz + sha256: 98ef7a7f899b5d866552f10ae9a005c1c4bd41667e88cb771006811f8d6f50d7 build: - number: 2 + number: 0 noarch: generic rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage('r-ampvis2', max_pin="x.x") }} requirements: host: diff --git a/recipes/r-aroma.affymetrix/meta.yaml b/recipes/r-aroma.affymetrix/meta.yaml index b28a7de9263f0..c8237d9eb4f99 100644 --- a/recipes/r-aroma.affymetrix/meta.yaml +++ b/recipes/r-aroma.affymetrix/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '3.2.1' %} +{% set version = '3.2.2' %} package: name: r-aroma.affymetrix @@ -8,14 +8,16 @@ source: url: - {{ cran_mirror }}/src/contrib/aroma.affymetrix_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/aroma.affymetrix/aroma.affymetrix_{{ version }}.tar.gz - sha256: 7aefbbddf94f6fc0ee2dec261f0caa6ca28d5f36aa7f7534ffb5f4e10ec4f5fb + sha256: 18e1c9479e3e41bdfff06769d0ff2d85fcae16042cfd0eefa4dbcd0c4f3c9c40 build: noarch: generic - number: 3 + number: 0 rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage('r-aroma.affymetrix', max_pin="x.x") }} requirements: host: @@ -60,3 +62,5 @@ about: Aroma Framework has successfully been used in studies to process tens of thousands of arrays. This package has actively been used since 2006. license_family: LGPL + license_file: + - '{{ environ["PREFIX"] }}/lib/R/share/licenses/LGPL-2.1' diff --git a/recipes/r-aroma.core/meta.yaml b/recipes/r-aroma.core/meta.yaml index c2ec781553729..5d9c36cd653b2 100644 --- a/recipes/r-aroma.core/meta.yaml +++ b/recipes/r-aroma.core/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '3.3.0' %} +{% set version = '3.3.1' %} package: name: r-aroma.core @@ -8,14 +8,16 @@ source: url: - {{ cran_mirror }}/src/contrib/aroma.core_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/aroma.core/aroma.core_{{ version }}.tar.gz - sha256: 7b6ab7cc6079f6783b0eaa2c10a29492e53cfb3f05b7a298588491b35a472188 + sha256: fa26bca509750eb44e85cae2d78b03870c003d4f7e0360977e924a7838805e44 build: noarch: generic - number: 1 + number: 0 rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage('r-aroma.core', max_pin="x") }} requirements: host: @@ -54,10 +56,11 @@ test: - $R -e "library('aroma.core')" about: - home: https://github.com/HenrikBengtsson/aroma.core, http://www.aroma-project.org/ + home: https://www.aroma-project.org/ license: LGPL-2.1-or-later summary: Core methods and classes used by higher-level 'aroma.*' packages part of the Aroma Project, e.g. 'aroma.affymetrix' and 'aroma.cn'. + dev_url: https://github.com/HenrikBengtsson/aroma.core license_family: LGPL license_file: - '{{ environ["PREFIX"] }}/lib/R/share/licenses/LGPL-2.1' diff --git a/recipes/r-azimuth/meta.yaml b/recipes/r-azimuth/meta.yaml new file mode 100644 index 0000000000000..ece8b017733ac --- /dev/null +++ b/recipes/r-azimuth/meta.yaml @@ -0,0 +1,100 @@ +{% set version = '0.5.0' %} + +package: + name: r-azimuth + version: {{ version|replace("-", "_") }} + +source: + url: https://github.com/satijalab/azimuth/archive/refs/tags/v{{ version }}.tar.gz + sha256: 0001e425d48a6f4ed71b99239d414285a09d06a138c393ad2227e186ef34c38f + +build: + script: $R CMD INSTALL --build . + run_exports: + - {{ pin_subpackage("r-azimuth", max_pin="x.x.x") }} + number: 0 + rpaths: + - lib/R/lib/ + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('cxx') }} + host: + - r-base + - 'bioconductor-bsgenome.hsapiens.ucsc.hg38 >=1.4.0,<1.5.0' + - 'r-dt >=0.15' + - 'bioconductor-ensdb.hsapiens.v86' + - 'r-matrix >=1.2.18' + - 'r-rcpp >=1.0.7' + - 'r-seurat >=5.0.0' + - 'r-seurat-data ==0.2.1' + - 'r-seurat-disk ==0.0.0.9021' + - 'r-seuratobject >=5.0.0' + - 'r-future >=1.19.1' + - 'r-ggplot2 >=3.3.2' + - 'bioconductor-glmgampoi >=1.0.0' + - 'r-googlesheets4 >=0.2.0' + - 'r-hdf5r >=1.3.2' + - 'r-htmltools >=0.5.0' + - 'r-httr >=1.4.2' + - 'bioconductor-jaspar2020' + - 'r-jsonlite >=1.7.0' + - 'r-patchwork >=1.0.1' + - 'r-plotly' + - 'r-presto ==1.0.0' + - 'r-rlang >=0.4.8' + - 'r-scales >=1.1.1' + - 'r-shiny >=1.5.0' + - 'r-shinybs >=0.61' + - 'r-shinydashboard >=0.7.1' + - 'r-shinyjs >=2.0.0' + - 'r-signac >=1.12.0' + - 'r-stringr >=1.4.0' + - 'bioconductor-tfbstools' + - 'r-withr >=2.3.0' + run: + - r-base + - 'r-dt >=0.15' + - 'bioconductor-ensdb.hsapiens.v86' + - 'r-matrix >=1.2.18' + - 'r-rcpp >=1.0.7' + - 'r-seurat >=5.0.0' + - 'r-seurat-data ==0.2.1' + - 'r-seurat-disk ==0.0.0.9021' + - 'r-seuratobject >=5.0.0' + - 'r-future >=1.19.1' + - 'r-ggplot2 >=3.3.2' + - 'bioconductor-glmgampoi >=1.0.0' + - 'r-googlesheets4 >=0.2.0' + - 'r-hdf5r >=1.3.2' + - 'r-htmltools >=0.5.0' + - 'r-httr >=1.4.2' + - 'bioconductor-jaspar2020' + - 'r-jsonlite >=1.7.0' + - 'r-patchwork >=1.0.1' + - 'r-plotly' + - 'r-presto ==1.0.0' + - 'r-rlang >=0.4.8' + - 'r-scales >=1.1.1' + - 'r-shiny >=1.5.0' + - 'r-shinybs >=0.61' + - 'r-shinydashboard >=0.7.1' + - 'r-shinyjs >=2.0.0' + - 'r-signac >=1.12.0' + - 'r-stringr >=1.4.0' + - 'bioconductor-tfbstools' + - 'r-withr >=2.3.0' + +test: + commands: + - '$R -e "library(''Azimuth'')"' + +about: + home: https://github.com/satijalab/azimuth + license: GPL-3.0-only + summary: Azimuth is a Shiny app demonstrating a query-reference mapping algorithm for single-cell data. + license_family: GPL3 + license_file: + - '{{ environ["PREFIX"] }}/lib/R/share/licenses/GPL-3' + - LICENSE diff --git a/recipes/r-bcbiornaseq/meta.yaml b/recipes/r-bcbiornaseq/meta.yaml index bcf9df357c9d3..5438c656df52d 100644 --- a/recipes/r-bcbiornaseq/meta.yaml +++ b/recipes/r-bcbiornaseq/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.6.1" %} +{% set version = "0.6.2" %} {% set github = "https://github.com/hbc/bcbioRNASeq" %} package: @@ -7,7 +7,7 @@ package: source: url: "{{ github }}/archive/v{{ version }}.tar.gz" - sha256: 75399d753cd0fbef5f644e43fc1e30b7ccd3a56b754b999b5ce9086de0259596 + sha256: 01c7848a13e5eb5bb043725fbdcec2de9e545dd37c2995bcbbfde73a8632ede8 build: number: 0 diff --git a/recipes/r-cellosaurus/meta.yaml b/recipes/r-cellosaurus/meta.yaml index 0a6c31bd625d5..303e14d510275 100644 --- a/recipes/r-cellosaurus/meta.yaml +++ b/recipes/r-cellosaurus/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.8.1" %} +{% set version = "0.8.2" %} {% set github = "https://github.com/acidgenomics/r-cellosaurus" %} package: @@ -7,7 +7,7 @@ package: source: url: "{{ github }}/archive/v{{ version }}.tar.gz" - sha256: c18ed889a603e15332afdc71cd7fb1ab13701fe892e5247c55ba6fbb630c2677 + sha256: 83d730b19dfe21ca7447d8eaf674b991010300918bb17dad70f25458617b33a3 build: noarch: generic diff --git a/recipes/r-harmony/build.sh b/recipes/r-chord/build.sh similarity index 67% rename from recipes/r-harmony/build.sh rename to recipes/r-chord/build.sh index 5bf492ab9fc06..af6547bf3c22e 100644 --- a/recipes/r-harmony/build.sh +++ b/recipes/r-chord/build.sh @@ -1 +1,2 @@ +#!/bin/bash $R CMD INSTALL --build . diff --git a/recipes/r-chord/meta.yaml b/recipes/r-chord/meta.yaml new file mode 100644 index 0000000000000..112ef12290bf6 --- /dev/null +++ b/recipes/r-chord/meta.yaml @@ -0,0 +1,42 @@ +{% set version = "2.03" %} +{% set sha256 = "def578e8e3764231d0711d0fb2542862c064fe9e355fbc6c5b61da153f50e7bc" %} + +package: + name: r-chord + version: '{{ version }}' + +source: + url: https://github.com/UMCUGenetics/CHORD/archive/refs/tags/{{ version }}.tar.gz + sha256: '{{ sha256 }}' + +build: + noarch: generic + number: 0 + run_exports: + - {{ pin_subpackage("r-chord", max_pin="x.x") }} + +requirements: + host: + - r-base + - r-mutsigextractor ==1.14 + - r-randomforest + - bioconductor-bsgenome + - bioconductor-bsgenome.hsapiens.ucsc.hg19 + - bioconductor-bsgenome.hsapiens.ucsc.hg38 + run: + - r-base + - r-mutsigextractor ==1.14 + - r-randomforest + - bioconductor-bsgenome + - bioconductor-bsgenome.hsapiens.ucsc.hg19 + - bioconductor-bsgenome.hsapiens.ucsc.hg38 + +test: + commands: + - $R -e "library('CHORD')" + +about: + home: https://github.com/UMCUGenetics/CHORD + license: GPL-3.0-only + license_family: GPL3 + summary: Predict HRD using somatic mutations contexts diff --git a/recipes/r-classdiscovery/meta.yaml b/recipes/r-classdiscovery/meta.yaml index 4993bba3a183f..031a2df080c26 100644 --- a/recipes/r-classdiscovery/meta.yaml +++ b/recipes/r-classdiscovery/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '3.4.0' %} +{% set version = '3.4.5' %} package: name: r-classdiscovery @@ -8,16 +8,17 @@ source: url: - {{ cran_mirror }}/src/contrib/ClassDiscovery_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/ClassDiscovery/ClassDiscovery_{{ version }}.tar.gz - sha256: 5a18e607ba5753bb8026a27ff73df6ad9f77ff186a82050b90d1fac6ee96871a + sha256: 61bcee1d18cb213f4fbe4ca5f6e3051192823a9e919c4010efd5f74aedd1e04c build: noarch: generic - number: 2 + number: 0 rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage("r-classdiscovery", max_pin="x") }} -# Suggests: xtable requirements: host: - r-base @@ -36,39 +37,12 @@ requirements: test: commands: - # You can put additional test commands to be run here. - - $R -e "library('ClassDiscovery')" # [not win] - - "\"%R%\" -e \"library('ClassDiscovery')\"" # [win] + - $R -e "library('ClassDiscovery')" about: home: http://oompa.r-forge.r-project.org/ - license: Apache (== 2.0) + license: Apache-2.0 summary: 'Defines the classes used for "class discovery" problems in the OOMPA project (). Class discovery primarily consists of unsupervised clustering methods with attempts to assess their statistical significance. ' license_family: APACHE - -# The original CRAN metadata for this package was: - -# Package: ClassDiscovery -# Version: 3.3.9 -# Date: 2018-09-27 -# Title: Classes and Methods for "Class Discovery" with Microarrays or Proteomics -# Author: Kevin R. Coombes -# Maintainer: Kevin R. Coombes -# Depends: R (>= 3.0), cluster, oompaBase (>= 3.0.1) -# Imports: methods, stats, graphics, grDevices, mclust, oompaData, Biobase -# Suggests: xtable -# Description: Defines the classes used for "class discovery" problems in the OOMPA project (). Class discovery primarily consists of unsupervised clustering methods with attempts to assess their statistical significance. -# License: Apache License (== 2.0) -# LazyLoad: yes -# biocViews: Microarray, Clustering -# URL: http://oompa.r-forge.r-project.org/ -# NeedsCompilation: no -# Packaged: 2018-10-03 11:25:11 UTC; Kevin -# Repository: CRAN -# Date/Publication: 2018-10-03 22:02:55 UTC - -# See -# http://docs.continuum.io/conda/build.html for -# more information about meta.yaml diff --git a/recipes/r-codedepends/meta.yaml b/recipes/r-codedepends/meta.yaml index f19f17e98709a..321e8713df784 100644 --- a/recipes/r-codedepends/meta.yaml +++ b/recipes/r-codedepends/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '0.6.5' %} +{% set version = '0.6.6' %} {% set posix = 'm2-' if win else '' %} {% set native = 'm2w64-' if win else '' %} @@ -10,15 +10,17 @@ source: url: - {{ cran_mirror }}/src/contrib/CodeDepends_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/CodeDepends/CodeDepends_{{ version }}.tar.gz - sha256: 18067d49d67c3f8f0cca1f3890680dcee9ffc90a0469561c7da074aec68ef350 + sha256: 7f815b03abe573b95ac9ed2e20caa7c5b5370aff710767e897575c2cf52c5857 build: merge_build_host: True # [win] - number: 4 + number: 0 noarch: generic rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage('r-codedepends', max_pin="x.x") }} requirements: build: diff --git a/recipes/r-conos/meta.yaml b/recipes/r-conos/meta.yaml index 78c4f6043b388..764a6f992dd1a 100644 --- a/recipes/r-conos/meta.yaml +++ b/recipes/r-conos/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '1.5.0' %} +{% set version = '1.5.2' %} package: name: r-conos @@ -8,13 +8,15 @@ source: url: - {{ cran_mirror }}/src/contrib/conos_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/conos/conos_{{ version }}.tar.gz - sha256: dcf4afbbf3c744e8e4f1bd4472bb4c8f18a1d18d9f2bf854372d12d8e558b0f1 + sha256: 736a00a2574fd39d063d70038ae1ff738cfcb6de61827aaf765f7004c67ac65c build: - number: 3 + number: 0 rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage('r-conos', max_pin="x") }} requirements: build: diff --git a/recipes/r-crbhits/meta.yaml b/recipes/r-crbhits/meta.yaml index 4afc84a3c4e5e..290bc8fe95bf1 100644 --- a/recipes/r-crbhits/meta.yaml +++ b/recipes/r-crbhits/meta.yaml @@ -1,5 +1,5 @@ {% set name = "r-crbhits" %} -{% set version = "0.0.4" %} +{% set version = "0.0.5" %} package: name: "{{ name }}" @@ -7,22 +7,21 @@ package: source: url: https://github.com/kullrich/CRBHits/archive/refs/tags/v{{ version }}.tar.gz - sha256: a44ae1f6f16bf321adf9a0342e3f577ea8322e0f49e507908254f2229c55cc00 + sha256: 2b16cebb11acb1460c7c99c3455f7570cd2b1e485e986bb02a609a956849a43f build: - number: 1 + number: 0 rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage('r-crbhits', max_pin="x.x") }} requirements: build: - {{ compiler('c') }} - {{ compiler('cxx') }} - make - - last - - kakscalculator2 - - dagchainer host: - r-base - bioconductor-biostrings @@ -45,6 +44,9 @@ requirements: - r-stringi - r-testthat - r-tibble + - last + - kakscalculator2 + - dagchainer run: - r-base - bioconductor-biostrings @@ -52,7 +54,7 @@ requirements: - r-curl - r-doParallel - r-dplyr - - r-foreach + - r-foreach - r-ggplot2 - r-gridExtra - r-readr @@ -79,6 +81,7 @@ about: summary: "CRBHits: From Conditional Reciprocal Best Hits to Codon Alignments and Ka/Ks in R." description: "CRBHits is a reimplementation of the Conditional Reciprocal Best Hit (CRBH) algorithm crb-blast in R. It covers all necessary steps from CRBHit pair calculation to Codon Alignments and Ka/Ks. (see [Ullrich (2020) ])" license_family: MIT + extra: identifiers: - doi:10.21105/joss.02424 diff --git a/recipes/r-deconcell/build.sh b/recipes/r-deconcell/build.sh new file mode 100644 index 0000000000000..6d23e7f876394 --- /dev/null +++ b/recipes/r-deconcell/build.sh @@ -0,0 +1,4 @@ +#!/bin/bash + +pushd Decon2/DeconCell +$R CMD INSTALL --build . diff --git a/recipes/r-deconcell/meta.yaml b/recipes/r-deconcell/meta.yaml new file mode 100644 index 0000000000000..211669e1ffeda --- /dev/null +++ b/recipes/r-deconcell/meta.yaml @@ -0,0 +1,53 @@ +{% set name = "r-deconcell" %} +{% set version = "0.1.0" %} +{% set vcommit = "335bf320df9c7dd15f636cff2c089d89ba6b786e" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/molgenis/systemsgenetics/archive/{{ vcommit }}.tar.gz + sha256: 9dadbe65cdbe72ca6f7bb6869770f40dc4fcea45945fbfb76ace61e41feb5b14 + + +build: + number: 0 + noarch: generic + rpaths: + - lib/R/lib/ + - lib/ + run_exports: + - {{ pin_subpackage('r-deconcell', max_pin="x") }} + +requirements: + host: + - bioconductor-deconrnaseq + - bioconductor-edger + - r-base + - r-data.table + - r-devtools + - r-glmnet + run: + - bioconductor-deconrnaseq + - bioconductor-edger + - r-base + - r-data.table + - r-glmnet + +test: + commands: + - $R -e "library(\"DeconCell\")" + +about: + home: https://github.com/molgenis/systemsgenetics/tree/master/Decon2/DeconCell + license: GPL-3.0-or-later + license_family: GPL3 + summary: DeconCell is an statitsical framework for generating cell proportions predictive models using bulk expresion data. It currently has pre-calculated models + description: | + DeconCell is an statitsical framework for generating cell proportions predictive models using bulk expresion data. It currently has pre-calculated models + dev_url: https://github.com/molgenis/systemsgenetics/tree/master/Decon2/DeconCell + +extra: + recipe-maintainers: + - pettyalex diff --git a/recipes/r-deseqanalysis/meta.yaml b/recipes/r-deseqanalysis/meta.yaml index 4f0912b12277e..c946b43612c5b 100644 --- a/recipes/r-deseqanalysis/meta.yaml +++ b/recipes/r-deseqanalysis/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.7.0" %} +{% set version = "0.7.1" %} {% set github = "https://github.com/acidgenomics/r-deseqanalysis" %} package: @@ -7,7 +7,7 @@ package: source: url: "{{ github }}/archive/v{{ version }}.tar.gz" - sha256: cf5b1cae6fa44e0db16cba3aab8de0d738ab26af7326f9ff24ee42ffb05574d6 + sha256: b5e77ddd1d2109069c6ad5ed01f073c904e5cf164c1c5a418853c554263b0e97 build: noarch: generic diff --git a/recipes/r-dimsum/meta.yaml b/recipes/r-dimsum/meta.yaml index 561f9c65df523..e31cf6dc73e8e 100644 --- a/recipes/r-dimsum/meta.yaml +++ b/recipes/r-dimsum/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '1.3' %} +{% set version = '1.3.1' %} {% set github = "https://github.com/lehner-lab/DiMSum" %} package: @@ -7,22 +7,24 @@ package: source: url: "{{ github }}/archive/v{{ version }}.tar.gz" - sha256: 5f4181a8f4790f7a995db3f1d19408ebeb0fe00ed0cf520d28b1e37dc53a01ea + sha256: 068b490a8a38601298ea98f32b1e81ba98ecfaa8102e312d8c419d8ef7d3c9de build: - number: 2 + number: 0 noarch: generic rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage('r-dimsum', max_pin="x") }} requirements: build: - r-base host: - - r-base + - r-base =4.0 - pandoc >=1.17.2 - - fastqc >=0.11.3 + - fastqc =0.11 - cutadapt =2.4 - vsearch >=2.17 - starcode >=1.3 @@ -43,9 +45,9 @@ requirements: - r-seqinr - r-stringr run: - - r-base + - r-base =4.0 - pandoc >=1.17.2 - - fastqc >=0.11.3 + - fastqc =0.11 - cutadapt =2.4 - vsearch >=2.17 - starcode >=1.3 diff --git a/recipes/r-dsb/build.sh b/recipes/r-dsb/build.sh new file mode 100644 index 0000000000000..df943f40e3e3d --- /dev/null +++ b/recipes/r-dsb/build.sh @@ -0,0 +1,22 @@ +#!/bin/bash + +# 'Autobrew' is being used by more and more packages these days +# to grab static libraries from Homebrew bottles. These bottles +# are fetched via Homebrew's --force-bottle option which grabs +# a bottle for the build machine which may not be macOS 10.9. +# Also, we want to use conda packages (and shared libraries) for +# these 'system' dependencies. See: +# https://github.com/jeroen/autobrew/issues/3 +export DISABLE_AUTOBREW=1 + +# R refuses to build packages that mark themselves as Priority: Recommended +mv DESCRIPTION DESCRIPTION.old +grep -va '^Priority: ' DESCRIPTION.old > DESCRIPTION +# shellcheck disable=SC2086 +${R} CMD INSTALL --build . ${R_ARGS} + +# Add more build steps here, if they are necessary. + +# See +# https://docs.conda.io/projects/conda-build +# for a list of environment variables that are set during the build process. diff --git a/recipes/r-dsb/meta.yaml b/recipes/r-dsb/meta.yaml new file mode 100644 index 0000000000000..953d980c21491 --- /dev/null +++ b/recipes/r-dsb/meta.yaml @@ -0,0 +1,110 @@ +{% set version = '1.0.3' %} + +{% set posix = 'm2-' if win else '' %} +{% set native = 'm2w64-' if win else '' %} + +package: + name: r-dsb + version: {{ version|replace("-", "_") }} + +source: + url: + - {{ cran_mirror }}/src/contrib/dsb_{{ version }}.tar.gz + - {{ cran_mirror }}/src/contrib/Archive/dsb/dsb_{{ version }}.tar.gz + sha256: 6287a25d1f67f5a5dfc8af5558e884c59d7ea7fea49a9c08c53b30023069f0f7 + +build: + merge_build_host: True # [win] + # If this is a new build for the same version, increment the build number. + number: 0 + # no skip + noarch: generic + # This is required to make R link correctly on Linux. + rpaths: + - lib/R/lib/ + - lib/ + run_exports: + - {{ pin_subpackage('r-dsb', max_pin="x") }} + +# Suggests: testthat, knitr, rmarkdown, ggplot2, cowplot, spelling +requirements: + build: + - {{ posix }}zip # [win] + + host: + - r-base + - bioconductor-limma + - r-magrittr + - r-mclust + + run: + - r-base + - bioconductor-limma + - r-magrittr + - r-mclust + +test: + commands: + # You can put additional test commands to be run here. + - $R -e "library('dsb')" # [not win] + - "\"%R%\" -e \"library('dsb')\"" # [win] + + # You can also put a file called run_test.py, run_test.sh, or run_test.bat + # in the recipe that will be run at test time. + + # requires: + # Put any additional test requirements here. + +about: + home: https://github.com/niaid/dsb + license: CC0 | file LICENSE + summary: "Normalizing and denoising protein expression data from droplet-based single cell profiling" + description: "This lightweight R package provides a method for normalizing and denoising protein + expression data from droplet based single cell experiments. Raw protein Unique Molecular + Index (UMI) counts from sequencing DNA-conjugated antibody derived tags (ADT) in + droplets (e.g. 'CITE-seq') have substantial measurement noise. Our experiments and + computational modeling revealed two major components of this noise: 1) protein-specific + noise originating from ambient, unbound antibody encapsulated in droplets that can + be accurately inferred via the expected protein counts detected in empty droplets, + and 2) droplet/cell-specific noise revealed via the shared variance component associated + with isotype antibody controls and background protein counts in each cell. This + package normalizes and removes both of these sources of noise from raw protein data + derived from methods such as 'CITE-seq', 'REAP-seq', 'ASAP-seq', 'TEA-seq', 'proteogenomic' + data from the Mission Bio platform, etc. See the vignette for tutorials on how to + integrate dsb with 'Seurat' and 'Bioconductor' and how to use dsb in 'Python'. Please + see our paper Mul\xE8 M.P., Martins A.J., and Tsang J.S. Nature Communications 2022 + for more details on the method." + license_family: CC + license_file: + - LICENSE + +# The original CRAN metadata for this package was: + +# Package: dsb +# Type: Package +# Title: Normalize & Denoise Droplet Single Cell Protein Data (CITE-Seq) +# Version: 1.0.3 +# Authors@R: c(person(given = "Matthew", family = "Mule", role = c("aut", "cre"), email = "mattmule@gmail.com", comment = c(ORCID = "0000-0001-8457-2716")), person(given = "Andrew", family = "Martins", role = "aut", email = "andrew.martins@nih.gov", comment = c(ORCID = "0000-0002-1832-1924")), person(given = "John", family = "Tsang", role = "pdr", email = "john.tsang@nih.gov", comment = c(ORCID = "0000-0003-3186-3047"))) +# Description: This lightweight R package provides a method for normalizing and denoising protein expression data from droplet based single cell experiments. Raw protein Unique Molecular Index (UMI) counts from sequencing DNA-conjugated antibody derived tags (ADT) in droplets (e.g. 'CITE-seq') have substantial measurement noise. Our experiments and computational modeling revealed two major components of this noise: 1) protein-specific noise originating from ambient, unbound antibody encapsulated in droplets that can be accurately inferred via the expected protein counts detected in empty droplets, and 2) droplet/cell-specific noise revealed via the shared variance component associated with isotype antibody controls and background protein counts in each cell. This package normalizes and removes both of these sources of noise from raw protein data derived from methods such as 'CITE-seq', 'REAP-seq', 'ASAP-seq', 'TEA-seq', 'proteogenomic' data from the Mission Bio platform, etc. See the vignette for tutorials on how to integrate dsb with 'Seurat' and 'Bioconductor' and how to use dsb in 'Python'. Please see our paper Mule M.P., Martins A.J., and Tsang J.S. Nature Communications 2022 for more details on the method. +# License: CC0 | file LICENSE +# Encoding: UTF-8 +# LazyData: true +# RoxygenNote: 7.1.1 +# Depends: R (>= 2.10) +# biocViews: +# Imports: magrittr, limma, mclust, stats +# Suggests: testthat, knitr, rmarkdown, ggplot2, cowplot, spelling +# URL: https://github.com/niaid/dsb +# BugReports: https://github.com/niaid/dsb/issues +# VignetteBuilder: knitr, rmarkdown +# Language: en-US +# NeedsCompilation: no +# Packaged: 2023-03-17 16:55:52 UTC; matthewmule +# Author: Matthew Mule [aut, cre] (), Andrew Martins [aut] (), John Tsang [pdr] () +# Maintainer: Matthew Mule +# Repository: CRAN +# Date/Publication: 2023-03-17 23:20:02 UTC + +# See +# https://docs.conda.io/projects/conda-build for +# more information about meta.yaml diff --git a/recipes/r-easydifferentialgenecoexpression/meta.yaml b/recipes/r-easydifferentialgenecoexpression/meta.yaml index 3ca98180e3570..da710a321155f 100644 --- a/recipes/r-easydifferentialgenecoexpression/meta.yaml +++ b/recipes/r-easydifferentialgenecoexpression/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '1.0' %} +{% set version = '1.4' %} package: name: r-easydifferentialgenecoexpression @@ -8,41 +8,39 @@ source: url: - {{ cran_mirror }}/src/contrib/easyDifferentialGeneCoexpression_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/easyDifferentialGeneCoexpression/easyDifferentialGeneCoexpression_{{ version }}.tar.gz - sha256: 19156037a2fa498dc28d8db8d53797d74007135c43e53bc5f20d61a66100f5b7 + sha256: d0e1653a311d5e5834ef4b9c333ae3fe5aee8333c1201517ee5f6cb556b054c7 build: - number: 2 + number: 0 noarch: generic rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage('r-easydifferentialgenecoexpression', max_pin='x') }} requirements: host: - r-base - bioconductor-biobase - bioconductor-geoquery - - r-r.utils - bioconductor-annotate - bioconductor-diffcoexp - r-geneexpressionfromgeo - r-jetset - bioconductor-limma - r-magrittr - - r-stringi - r-xml2 run: - r-base - bioconductor-biobase - bioconductor-geoquery - - r-r.utils - bioconductor-annotate - bioconductor-diffcoexp - r-geneexpressionfromgeo - r-jetset - bioconductor-limma - r-magrittr - - r-stringi - r-xml2 test: diff --git a/recipes/r-harmony/meta.yaml b/recipes/r-harmony/meta.yaml deleted file mode 100644 index 2fde7c768fbde..0000000000000 --- a/recipes/r-harmony/meta.yaml +++ /dev/null @@ -1,59 +0,0 @@ -{% set version = '0.1' %} - -package: - name: r-harmony - version: {{ version }} - -source: - url: https://github.com/immunogenomics/harmony/archive/{{ version }}.tar.gz - sha256: 1243bec2c9cd96d32ee48cafc74795bf18c3b50789e388ef8d80e4440940ae2b - -build: - # https://github.com/immunogenomics/harmony/issues/180 - skip: True # [osx] - number: 6 - rpaths: - - lib/R/lib/ - - lib/ - -requirements: - build: - - {{ compiler('cxx') }} - host: - - r-base - - r-rcpp - - r-dplyr - - r-cowplot - - r-tidyr - - r-ggplot2 - - r-irlba - - r-matrix - - r-tibble - - bioconductor-singlecellexperiment - - r-rlang - - r-rcpparmadillo - - r-rcppprogress - run: - - r-base - - r-dplyr - - r-cowplot - - r-tidyr - - r-ggplot2 - - r-irlba - - r-matrix - - r-tibble - - bioconductor-singlecellexperiment - - r-rlang - - r-rcpparmadillo - - r-rcppprogress - -test: - commands: - - $R -e "library('harmony')" - -about: - home: https://github.com/immunogenomics/harmony - dev_url: https://github.com/immunogenomics/harmony - license: GPL-3.0-only - license_file: LICENSE - summary: Fast, sensitive and accurate integration of single-cell data with Harmony diff --git a/recipes/r-jackstraw/meta.yaml b/recipes/r-jackstraw/meta.yaml index 5bb00456a1c3e..87c8d069725c3 100644 --- a/recipes/r-jackstraw/meta.yaml +++ b/recipes/r-jackstraw/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '1.3.8' %} +{% set version = '1.3.9' %} package: name: r-jackstraw @@ -8,14 +8,16 @@ source: url: - {{ cran_mirror }}/src/contrib/jackstraw_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/jackstraw/jackstraw_{{ version }}.tar.gz - sha256: 897146888be7f7962a038939fa88005de729f4fcbf4291f6577d59f456cca011 + sha256: 6a599ec3803c64884973eeab44aaf5a78ec44406ef4f536993406e4b6c90f871 build: - number: 1 + number: 0 noarch: generic rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage('r-jackstraw', max_pin="x") }} requirements: host: diff --git a/recipes/r-ldweaver/meta.yaml b/recipes/r-ldweaver/meta.yaml index 26d05b5b7316e..9d1ef8ded260c 100644 --- a/recipes/r-ldweaver/meta.yaml +++ b/recipes/r-ldweaver/meta.yaml @@ -1,6 +1,6 @@ {% set name = "r-ldweaver" %} -{% set version = "1.4" %} -{% set sha256 = "8fca169dbf073a280cb47d1352fbb1a49b7f0b4daeba146928705def61650608" %} +{% set version = "1.5" %} +{% set sha256 = "4952b30c4e50850d6ed119469b377ecd49047f4802c5c1b84564cad60d972676" %} package: name: {{ name }} diff --git a/recipes/r-liger/meta.yaml b/recipes/r-liger/meta.yaml index 47619e1464082..bef57845d132b 100644 --- a/recipes/r-liger/meta.yaml +++ b/recipes/r-liger/meta.yaml @@ -1,14 +1,15 @@ -{% set version = '1.0.1' %} +{% set name = "liger" %} +{% set version = '2.0.1' %} package: - name: r-liger + name: r-{{ name }} version: {{ version|replace("-", "_") }} source: url: - {{ cran_mirror }}/src/contrib/rliger_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/rliger/rliger_{{ version }}.tar.gz - sha256: 5a48c8c18c66c3b692d99ff7eb1595acd4659595cc633c09c55e3f4f44094b74 + sha256: e1163722608ba2c2424e87f44b4d62c36dacca429dfb4fee41eb9a0da99703a4 build: number: 0 @@ -17,7 +18,7 @@ build: - lib/R/lib/ - lib/ run_exports: - - {{ pin_subpackage("r-liger", max_pin="x.x") }} + - {{ pin_subpackage("r-liger", max_pin="x") }} requirements: build: @@ -25,71 +26,65 @@ requirements: - make host: - r-base - - r-fnn - - r-hmisc - - r-rann.l1 - r-rcpp >=0.12.10 - r-rcpparmadillo - r-rcppprogress - r-rtsne - r-cowplot - - r-dosnow - r-dplyr - - r-foreach - r-ggplot2 - - r-ggrepel - r-ica - r-irlba - r-mclust - - r-patchwork - - r-doparallel - r-uwot - r-hdf5r - - r-plyr - - r-snow - - r-psych - - r-rcppeigen - r-rann - - r-scattermore >=0.7 + - r-circlize + - bioconductor-complexheatmap + - r-leidenalg >=1.1.1 + - bioconductor-s4vectors + - r-cli + - r-rlang + - r-matrix + - r-lifecycle + - r-magrittr + - r-scales + - r-rcolorbrewer + - r-viridis run: - r-base - - r-fnn - - r-hmisc - - r-rann.l1 - r-rcpp >=0.12.10 - r-rcpparmadillo - r-rcppprogress - r-rtsne - r-cowplot - - r-doparallel - - r-uwot - - r-hdf5r - - r-dosnow - r-dplyr - - r-foreach - r-ggplot2 - - r-ggrepel - r-ica - r-irlba - r-mclust - - r-patchwork - - r-plyr - - r-snow - - r-psych - - r-rcppeigen + - r-uwot + - r-hdf5r - r-rann - - r-reticulate - - r-scattermore >=0.7 - - openjdk >=6 - - umap-learn - + - r-circlize + - bioconductor-complexheatmap + - r-leidenalg >=1.1.1 + - bioconductor-s4vectors + - r-cli + - r-rlang + - r-matrix + - r-lifecycle + - r-magrittr + - r-scales + - r-rcolorbrewer + - r-viridis test: commands: - $R -e "library('rliger')" about: home: https://github.com/MacoskoLab/liger - license: GPL-3 + license: GPL-3.0-or-later summary: Uses an extension of nonnegative matrix factorization to identify shared and dataset-specific factors. See Welch J, Kozareva V, et al (2019) , and Liu J, Gao C, Sodicoff J, et al (2020) for more @@ -97,7 +92,12 @@ about: license_family: GPL3 license_file: - '{{ environ["PREFIX"] }}/lib/R/share/licenses/GPL-3' + doc_url: https://welch-lab.github.io/liger/index.html + dev_url: https://github.com/MacoskoLab/liger extra: recipe-maintainers: + - theAeon - raivivek + identifiers: + - doi:10.1016/j.cell.2019.05.006 diff --git a/recipes/r-linxreport/build.sh b/recipes/r-linxreport/build.sh new file mode 100644 index 0000000000000..6fd1541af9a34 --- /dev/null +++ b/recipes/r-linxreport/build.sh @@ -0,0 +1,6 @@ +#!/bin/bash +$R CMD INSTALL --build . + +mkdir -p ${PREFIX}/bin +cp ${SRC_DIR}/inst/cli/linxreport.R ${PREFIX}/bin +chmod +x ${PREFIX}/bin/linxreport.R diff --git a/recipes/r-linxreport/meta.yaml b/recipes/r-linxreport/meta.yaml new file mode 100644 index 0000000000000..a7ac9a43641e4 --- /dev/null +++ b/recipes/r-linxreport/meta.yaml @@ -0,0 +1,56 @@ +{% set version = "1.0.0" %} +{% set sha256 = "447658b9ac5974f696c6b2c0fce59fc846d7419da8fc79aa81109630701cef55" %} + +package: + name: r-linxreport + version: '{{ version }}' + +source: + url: https://github.com/umccr/linxreport/archive/refs/tags/v{{ version }}.tar.gz + sha256: '{{ sha256 }}' + +build: + noarch: generic + number: 0 + run_exports: + - {{ pin_subpackage("r-linxreport", max_pin="x.x") }} + +requirements: + host: + - r-base >=4 + - r-assertthat + - r-details + - r-dplyr + - r-dt + - r-fs + - r-gtools + - r-optparse + - r-readr + - r-rlang + - r-rmarkdown + - r-sessioninfo + - r-stringr + run: + - r-base >=4 + - r-assertthat + - r-details + - r-dplyr + - r-dt + - r-fs + - r-gtools + - r-optparse + - r-readr + - r-rlang + - r-rmarkdown + - r-sessioninfo + - r-stringr + +test: + commands: + - $R -e "library('linxreport')" + +about: + home: https://github.com/umccr/linxreport + license: MIT + file LICENSE + license_family: MIT + summary: LINX Result Reporter diff --git a/recipes/r-metacoder/meta.yaml b/recipes/r-metacoder/meta.yaml index d4dcb0e8b2ae0..82b9450e80aaf 100644 --- a/recipes/r-metacoder/meta.yaml +++ b/recipes/r-metacoder/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '0.3.6' %} +{% set version = '0.3.7' %} package: name: r-metacoder @@ -8,10 +8,12 @@ source: url: - {{ cran_mirror }}/src/contrib/metacoder_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/metacoder/metacoder_{{ version }}.tar.gz - sha256: a2ab9675e1b08f4bf7027a74c4e7a1777e71850420e0a901784da0ddbdc5f896 + sha256: a48bf05b526cc3125605fcb221e96f55c74fd18d535c1a0e55982e3cbf3ffe38 build: - number: 3 + number: 0 + run_exports: + - {{ pin_subpackage('r-metacoder', max_pin="x.x") }} rpaths: - lib/R/lib/ - lib/ @@ -73,7 +75,8 @@ test: - $R -e "library('metacoder')" about: - home: https://grunwaldlab.github.io/metacoder_documentation/ + home: https://github.com/grunwaldlab/metacoder + doc_url: https://grunwaldlab.github.io/metacoder_documentation/ license: GPL-2 | GPL-3 summary: A set of tools for parsing, manipulating, and graphing data classified by a hierarchy (e.g. a taxonomy). diff --git a/recipes/r-mutsigextractor/build.sh b/recipes/r-mutsigextractor/build.sh new file mode 100644 index 0000000000000..af6547bf3c22e --- /dev/null +++ b/recipes/r-mutsigextractor/build.sh @@ -0,0 +1,2 @@ +#!/bin/bash +$R CMD INSTALL --build . diff --git a/recipes/r-mutsigextractor/meta.yaml b/recipes/r-mutsigextractor/meta.yaml new file mode 100644 index 0000000000000..43ca06abbf2c8 --- /dev/null +++ b/recipes/r-mutsigextractor/meta.yaml @@ -0,0 +1,40 @@ +{% set version = "1.28" %} +{% set sha256 = "395d89050444f87babf22e3341d4898e3b0d283462ffb1f161da3b8bdc975aee" %} + +package: + name: r-mutsigextractor + version: '{{ version }}' + +source: + url: https://github.com/UMCUGenetics/mutSigExtractor/archive/refs/tags/{{ version }}.tar.gz + sha256: '{{ sha256 }}' + +build: + noarch: generic + number: 0 + run_exports: + - {{ pin_subpackage("r-mutsigextractor", max_pin="x.x") }} + +requirements: + host: + - r-base + - bioconductor-genomeinfodb + - bioconductor-bsgenome + - bioconductor-bsgenome.hsapiens.ucsc.hg19 + - bioconductor-bsgenome.hsapiens.ucsc.hg38 + run: + - r-base + - bioconductor-genomeinfodb + - bioconductor-bsgenome + - bioconductor-bsgenome.hsapiens.ucsc.hg19 + - bioconductor-bsgenome.hsapiens.ucsc.hg38 + +test: + commands: + - $R -e "library('mutSigExtractor')" + +about: + home: https://github.com/UMCUGenetics/mutSigExtractor + license: GPL-3.0-only + license_family: GPL3 + summary: Extract mutational signatures from VCF files diff --git a/recipes/r-oncopharmadb/meta.yaml b/recipes/r-oncopharmadb/meta.yaml index 58e8fc471ae38..bbfbdc7933bbf 100644 --- a/recipes/r-oncopharmadb/meta.yaml +++ b/recipes/r-oncopharmadb/meta.yaml @@ -1,5 +1,5 @@ {% set name = "r-oncopharmadb" %} -{% set version = "1.4.6" %} +{% set version = "1.5.1" %} {% set github = "https://github.com/sigven/oncoPharmaDB" %} package: @@ -8,7 +8,7 @@ package: source: url: https://github.com/sigven/pharmOncoX/archive/refs/tags/{{ version }}.tar.gz - sha256: 5c0c708828cc91f032018e5ff2c42a391a9f98bb411038b1fa431ef6992d3095 + sha256: 7765b9122063aeacd96db0c536141ab2e23a116a84e313b7264d707a09c92316 build: number: 0 @@ -24,6 +24,7 @@ requirements: - r-stringr - r-lgr - r-tidyr + - r-ggplot2 - r-googledrive - r-rlang - r-assertthat @@ -35,6 +36,7 @@ requirements: - r-stringr - r-lgr - r-tidyr + - r-ggplot2 - r-googledrive - r-rlang - r-assertthat diff --git a/recipes/r-ontologyplot/meta.yaml b/recipes/r-ontologyplot/meta.yaml index 8b6b1b81d83ed..94c88333bac20 100644 --- a/recipes/r-ontologyplot/meta.yaml +++ b/recipes/r-ontologyplot/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '1.6' %} +{% set version = '1.7' %} package: name: r-ontologyplot @@ -8,14 +8,16 @@ source: url: - {{ cran_mirror }}/src/contrib/ontologyPlot_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/ontologyPlot/ontologyPlot_{{ version }}.tar.gz - sha256: 41a601e2201f32673c6830adc770a877be1ba4003b7352d4c09c8c50a3e8a158 + sha256: d508b861cfd596555f1b7bea681de71c9674fa7b708bb00b7a55744fb2cfd61b build: - number: 4 + number: 0 noarch: generic rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage('r-ontologyplot', max_pin="x") }} requirements: host: @@ -35,7 +37,8 @@ test: about: home: https://CRAN.R-project.org/package=ontologyPlot - license: GPL (>= 2) + license: GPL-2.0-or-later summary: Functions for visualising sets of ontological terms using the 'graphviz' layout system. license_family: GPL3 - license_file: '{{ environ["PREFIX"] }}/lib/R/share/licenses/GPL-2' + license_file: + - '{{ environ["PREFIX"] }}/lib/R/share/licenses/GPL-2' diff --git a/recipes/r-pathfindr/build.sh b/recipes/r-pathfindr/build.sh index dadf215407d10..e19c0e9e0c900 100644 --- a/recipes/r-pathfindr/build.sh +++ b/recipes/r-pathfindr/build.sh @@ -1,6 +1,6 @@ #!/bin/bash +export LC_ALL=en_US.UTF-8 export DISABLE_AUTOBREW=1 ${R} CMD INSTALL --build . ${R_ARGS} - diff --git a/recipes/r-pathfindr/meta.yaml b/recipes/r-pathfindr/meta.yaml index 7b75c815daaee..9cb3d79495a58 100644 --- a/recipes/r-pathfindr/meta.yaml +++ b/recipes/r-pathfindr/meta.yaml @@ -1,22 +1,20 @@ -{% set version = '2.3.0' %} - -{% set posix = 'm2-' if win else '' %} -{% set native = 'm2w64-' if win else '' %} +{% set name = "r-pathfindr" %} +{% set version = "2.4.0" %} package: - name: r-pathfindr - version: {{ version|replace("-", "_") }} + name: {{ name }} + version: {{ version }} source: url: - {{ cran_mirror }}/src/contrib/pathfindR_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/pathfindR/pathfindR_{{ version }}.tar.gz - sha256: e7fc4f10859890af5ab17cc7870efac64614f234059f5734ddd7af705f67281b + sha256: 9e03c7c189857097c0f6645599d9c8ed0738b6e68b077baa481ef17a068dfef6 build: - merge_build_host: True # [win] number: 0 noarch: generic + merge_build_host: True # [win] rpaths: - lib/R/lib/ - lib/ @@ -24,11 +22,6 @@ build: - {{ pin_subpackage("r-pathfindr", max_pin="x") }} requirements: - build: - - {{ posix }}zip # [win] - - cross-r-base {{ r_base }} # [build_platform != target_platform] - - openjdk 8.* - host: - r-base - openjdk 8.* @@ -36,6 +29,8 @@ requirements: - r-dbi - bioconductor-keggrest - bioconductor-kegggraph + - bioconductor-ggkegg + - r-httr - r-r.utils - r-doparallel - r-foreach @@ -50,7 +45,6 @@ requirements: - bioconductor-org.hs.eg.db - r-pathfindr.data >=2.0 - r-rmarkdown - run: - r-base - openjdk 8.* @@ -58,6 +52,8 @@ requirements: - r-dbi - bioconductor-keggrest - bioconductor-kegggraph + - bioconductor-ggkegg + - r-httr - r-r.utils - r-doparallel - r-foreach @@ -75,11 +71,10 @@ requirements: test: commands: - - $R -e "library('pathfindR')" # [not win] - - "\"%R%\" -e \"library('pathfindR')\"" # [win] + - $R -e "library('pathfindR')" about: - home: https://egeulgen.github.io/pathfindR/, https://github.com/egeulgen/pathfindR + home: "https://github.com/egeulgen/pathfindR" license: MIT summary: 'Enrichment analysis enables researchers to uncover mechanisms underlying a phenotype. However, conventional methods for enrichment analysis do not take into account protein-protein @@ -99,6 +94,9 @@ about: license_file: - '{{ environ["PREFIX"] }}/lib/R/share/licenses/MIT' - LICENSE + doc_url: "https://egeulgen.github.io/pathfindR/" + dev_url: "https://github.com/egeulgen/pathfindR" + extra: recipe-maintainers: - egeulgen diff --git a/recipes/r-presto/meta.yaml b/recipes/r-presto/meta.yaml new file mode 100644 index 0000000000000..5cf1e0652e250 --- /dev/null +++ b/recipes/r-presto/meta.yaml @@ -0,0 +1,54 @@ +{% set version = '1.0.0' %} +package: + name: r-presto + version: {{ version|replace("-", "_") }} +source: + url: https://github.com/immunogenomics/presto/archive/31dc97fed5e2e7fc323ae4af62f72181cc51d9a3.tar.gz + sha256: 720ef58aba219af03344e0ae0408fc48feda50e6b7f7f4af2251eb24ce1bfb88 +build: + script: $R CMD INSTALL --build . + run_exports: + - {{ pin_subpackage("r-presto", max_pin="x.x.x") }} + number: 0 + rpaths: + - lib/R/lib/ + - lib/ +# Suggests: knitr, rmarkdown, testthat, Seurat, SingleCellExperiment, SummarizedExperiment, broom, BiocStyle, DESeq2 +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('cxx') }} + host: + - r-base + - r-matrix + - r-rcpp + - r-rcpparmadillo + - r-data.table + - r-dplyr + - r-purrr + - r-rlang + - r-tibble + - r-tidyr + run: + - r-base + - r-matrix + - r-rcpp + - r-rcpparmadillo + - r-data.table + - r-dplyr + - r-purrr + - r-rlang + - r-tibble + - r-tidyr +test: + commands: + - $R -e "library('presto')" +about: + home: https://github.com/immunogenomics/presto + license: GPL-3.0-only + summary: Scalable implementation of the Wilcoxon rank sum test and auROC statistic. Interfaces + to dense and sparse matrices, as well as genomics analysis frameworks Seurat and + SingleCellExperiment. + license_family: GPL3 + license_file: + - '{{ environ["PREFIX"] }}/lib/R/share/licenses/GPL-3' diff --git a/recipes/r-pscbs/meta.yaml b/recipes/r-pscbs/meta.yaml index dba0c9851e2ea..6b9486d7121bf 100644 --- a/recipes/r-pscbs/meta.yaml +++ b/recipes/r-pscbs/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '0.66.0' %} +{% set version = '0.67.0' %} package: name: r-pscbs @@ -8,48 +8,51 @@ source: url: - {{ cran_mirror }}/src/contrib/PSCBS_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/PSCBS/PSCBS_{{ version }}.tar.gz - sha256: 58805636e55e0fd3f57bd4a0e296a8bb3d57a7bdd0fdd5868a73ddc83d173a93 + sha256: 2695d18d197a3bd729cca0940248ddc1880e4f54da95b9ecc5eda002a715cdbe build: noarch: generic - number: 2 + number: 0 rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage('r-pscbs', max_pin="x") }} requirements: host: - r-base - - bioconductor-dnacopy - - r-r.cache >=0.13.0 - - r-r.methodss3 >=1.7.1 - - r-r.oo >=1.22.0 - - r-r.utils >=2.8.0 - - bioconductor-aroma.light - - r-future >=1.12.0 - - r-listenv >=0.7.0 - - r-matrixstats >=0.54.0 + - bioconductor-dnacopy >=1.42.0 + - r-r.cache >=0.16.0 + - r-r.methodss3 >=1.8.2 + - r-r.oo >=1.25.0 + - r-r.utils >=2.12.0 + - bioconductor-aroma.light >=2.4.0 + - r-future >=1.28.0 + - r-listenv >=0.8.0 + - r-matrixstats >=0.62.0 run: - r-base - - bioconductor-dnacopy - - r-r.cache >=0.13.0 - - r-r.methodss3 >=1.7.1 - - r-r.oo >=1.22.0 - - r-r.utils >=2.8.0 - - bioconductor-aroma.light - - r-future >=1.12.0 - - r-listenv >=0.7.0 - - r-matrixstats >=0.54.0 + - bioconductor-dnacopy >=1.42.0 + - r-r.cache >=0.16.0 + - r-r.methodss3 >=1.8.2 + - r-r.oo >=1.25.0 + - r-r.utils >=2.12.0 + - bioconductor-aroma.light >=2.4.0 + - r-future >=1.28.0 + - r-listenv >=0.8.0 + - r-matrixstats >=0.62.0 test: commands: - - $R -e "library('PSCBS')" # [not win] - - "\"%R%\" -e \"library('PSCBS')\"" # [win] + - $R -e "library('PSCBS')" about: home: https://github.com/HenrikBengtsson/PSCBS - license: GPL (>= 2) + license: GPL-2.0-or-later summary: Segmentation of allele-specific DNA copy number data and detection of regions with abnormal copy number within each parental chromosome. Both tumor-normal paired and tumor-only analyses are supported. license_family: GPL3 + license_file: + - '{{ environ["PREFIX"] }}/lib/R/share/licenses/GPL-2' diff --git a/recipes/r-scevan/build.sh b/recipes/r-scevan/build.sh new file mode 100644 index 0000000000000..c3ea0d7102a89 --- /dev/null +++ b/recipes/r-scevan/build.sh @@ -0,0 +1,4 @@ +#!/bin/bash +R -e "library(devtools)" +R -e "devtools::install_github('miccec/yaGST')" +R CMD INSTALL --build . diff --git a/recipes/r-scevan/meta.yaml b/recipes/r-scevan/meta.yaml new file mode 100644 index 0000000000000..bb1703e201397 --- /dev/null +++ b/recipes/r-scevan/meta.yaml @@ -0,0 +1,64 @@ +package: + name: r-scevan + version: 1.0.1 + +source: + url: https://github.com/AntonioDeFalco/SCEVAN/archive/refs/tags/v1.0.1.tar.gz + sha256: 7558d31282c36418db3960b3edb9cb9815db14b0a48d8882287e11f752dfeab1 + +build: + number: 0 + noarch: generic # Specify that the package is noarch + run_exports: '{{ pin_compatible("r-scevan", max_pin="x.x") }}' + rpaths: + - lib/R/lib + - lib + +requirements: + host: + - r-base + - r-remotes + - r-devtools + - r-rcpp + - r-paralleldist + - r-pheatmap + - r-forcats + - r-dplyr + - bioconductor-fgsea + - r-cluster + - r-ggplot2 + - r-Rtsne + - bioconductor-scran + - r-ape + - bioconductor-ggtree + - r-tidytree + - r-ggrepel + - r-optparse + run: + - r-base + - r-devtools + - r-paralleldist + - r-pheatmap + - r-forcats + - r-dplyr + - bioconductor-fgsea + - r-cluster + - r-ggplot2 + - r-Rtsne + - bioconductor-scran + - r-ape + - bioconductor-ggtree + - r-tidytree + - r-ggrepel + - r-optparse + +test: + commands: + - $R -e "library(SCEVAN)" + +about: + home: https://github.com/AntonioDeFalco/SCEVAN/ + license: GPL-3.0-only + license_family: GPL3 + license_file: '{{ environ["PREFIX"] }}/lib/R/share/licenses/GPL-3' + summary: Single CEll Variational Aneuploidy aNalysis diff --git a/recipes/r-seurat-data/meta.yaml b/recipes/r-seurat-data/meta.yaml new file mode 100644 index 0000000000000..da945540fea2a --- /dev/null +++ b/recipes/r-seurat-data/meta.yaml @@ -0,0 +1,42 @@ +{% set version = '0.2.1' %} +package: + name: r-seurat-data + version: {{ version|replace("-", "_") }} +source: + url: https://github.com/satijalab/seurat-data/archive/refs/tags/v{{ version }}.tar.gz + sha256: 134b0dbc113e3533494461646c8362189b2bdf8940050de3561bcd488d905438 +build: + script: $R CMD INSTALL --build . + run_exports: + - {{ pin_subpackage("r-seurat-data", max_pin="x.x.x") }} + number: 0 + rpaths: + - lib/R/lib/ + - lib/ +requirements: + build: + host: + - r-base + - r-cli + - r-crayon + - r-rappdirs + run: + - r-base + - r-cli + - r-crayon + - r-rappdirs +test: + commands: + - $R -e "library('SeuratData')" +about: + home: http://www.satijalab.org/seurat + dev_url: https://github.com/satijalab/seurat-data + license: GPL-3.0-only + summary: Single cell RNA sequencing datasets can be large, consisting of matrices that contain + expression data for several thousand features across several thousand cells. This + package is designed to easily install, manage, and learn about various single-cell + datasets, provided Seurat objects and distributed as independent packages. + license_family: GPL3 + license_file: + - '{{ environ["PREFIX"] }}/lib/R/share/licenses/GPL-3' + - LICENSE diff --git a/recipes/r-seurat-disk/meta.yaml b/recipes/r-seurat-disk/meta.yaml new file mode 100644 index 0000000000000..6cda8484ac46d --- /dev/null +++ b/recipes/r-seurat-disk/meta.yaml @@ -0,0 +1,59 @@ +{% set version = '0.0.0.9021' %} +package: + name: r-seurat-disk + version: {{ version|replace("-", "_") }} +source: + url: https://github.com/mojaveazure/seurat-disk/archive/877d4e18ab38c686f5db54f8cd290274ccdbe295.tar.gz + sha256: d2d6b6604e8a1f6de90956d0401d34b51b07b30671a445d0e06876f2dec999ac +build: + script: $R CMD INSTALL --build . + run_exports: + - {{ pin_subpackage("r-seurat-disk", max_pin="x.x.x.x") }} + number: 0 + rpaths: + - lib/R/lib/ + - lib/ +requirements: + build: + host: + - r-base + - r-matrix >=1.2.18 + - r-r6 >=2.4.1 + - r-seurat >=3.2.0 + - r-seuratobject >=4.0.0 + - r-cli >=2.0.1 + - r-crayon >=1.3.4 + - r-hdf5r >=1.3.0 + - r-rlang >=0.4.4 + - r-stringi >=1.4.6 + - r-withr >=2.1.2 + run: + - r-base + - r-matrix >=1.2.18 + - r-r6 >=2.4.1 + - r-seurat >=3.2.0 + - r-seuratobject >=4.0.0 + - r-cli >=2.0.1 + - r-crayon >=1.3.4 + - r-hdf5r >=1.3.0 + - r-rlang >=0.4.4 + - r-stringi >=1.4.6 + - r-withr >=2.1.2 +test: + commands: + - '$R -e "library(''SeuratDisk'')"' +about: + home: https://mojaveazure.github.io/seurat-disk/ + dev_url: https://github.com/mojaveazure/seurat-disk + license: GPL-3.0-only + summary: The h5Seurat file format is specifically designed for the storage and analysis of + multi-modal single-cell and spatially-resolved expression experiments, for example, + from CITE-seq or 10X Visium technologies. It holds all molecular information and + associated metadata, including (for example) nearest-neighbor graphs, dimensional + reduction information, spatial coordinates and image data, and cluster labels. We + also support rapid and on-disk conversion between h5Seurat and AnnData objects, + with the goal of enhancing interoperability between Seurat and Scanpy. + license_family: GPL3 + license_file: + - '{{ environ["PREFIX"] }}/lib/R/share/licenses/GPL-3' + - LICENSE diff --git a/recipes/r-shinyngs/meta.yaml b/recipes/r-shinyngs/meta.yaml index 2c7fd3512a809..eacf45100bbe9 100644 --- a/recipes/r-shinyngs/meta.yaml +++ b/recipes/r-shinyngs/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '1.8.5' %} +{% set version = '1.8.6' %} {% set d3heatmap_version = '0.6.1.2' %} package: @@ -7,7 +7,7 @@ package: source: - url: https://github.com/pinin4fjords/shinyngs/archive/refs/tags/v{{ version }}.tar.gz - sha256: "79d5da8cb976c3752e925da34d475ab1dac5837e83544bbced4486b10e165909" + sha256: "97b7bb4439c16c7f2c0d8fc521e13b7797a8e1ec6641ba1006aedb95fefe7c58" folder: shinyngs - url: https://github.com/cran/d3heatmap/archive/refs/tags/{{ d3heatmap_version }}.tar.gz sha256: "bda213c4d335b199c38a48cb8e60027c929a8ba8ef6e14dc7de692967777c25a" diff --git a/recipes/r-signac/meta.yaml b/recipes/r-signac/meta.yaml index a3a41ca45a8f0..ed619910d09f3 100644 --- a/recipes/r-signac/meta.yaml +++ b/recipes/r-signac/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '1.12.0' %} +{% set version = '1.13.0' %} package: name: r-signac @@ -8,7 +8,7 @@ source: url: - {{ cran_mirror }}/src/contrib/Signac_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/Signac/Signac_{{ version }}.tar.gz - sha256: 0a4f1e53bcb6c3ba1e3a8e0800d6c4e65983560ff1147a643b7109452374c937 + sha256: d9b4103c6437391834b2d9e2aab8829f186b6e09d070dfe2a66cc12583241b2a build: number: 0 diff --git a/recipes/r-tinyarray/meta.yaml b/recipes/r-tinyarray/meta.yaml index 1a61d8ba0282c..2c082b48c3bfe 100644 --- a/recipes/r-tinyarray/meta.yaml +++ b/recipes/r-tinyarray/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '2.3.1' %} +{% set version = '2.3.3' %} package: name: r-tinyarray @@ -8,14 +8,16 @@ source: url: - {{ cran_mirror }}/src/contrib/tinyarray_{{ version }}.tar.gz - {{ cran_mirror }}/src/contrib/Archive/tinyarray/tinyarray_{{ version }}.tar.gz - sha256: 68ea15eb8d726368919faa54c89e2d18806b94e73e21fdee365c350b7ee79eb3 + sha256: 85388351a5811cb6df37a20f3233ed9e1f391800d16a4d56257f1094af44eb00 build: - number: 1 + number: 0 noarch: generic rpaths: - lib/R/lib/ - lib/ + run_exports: + - {{ pin_subpackage('r-tinyarray', max_pin="x") }} requirements: host: diff --git a/recipes/rabbitqcplus/build.sh b/recipes/rabbitqcplus/build.sh new file mode 100644 index 0000000000000..008b8deee4fb0 --- /dev/null +++ b/recipes/rabbitqcplus/build.sh @@ -0,0 +1,10 @@ +#!/bin/bash + +export CC=${CC:-gcc} +export CXX=${CXX:-g++} + +export LIBRARY_DIRS="$LIBRARY_DIRS $PREFIX/lib" + +make BIOCONDA=1 +make install + diff --git a/recipes/rabbitqcplus/meta.yaml b/recipes/rabbitqcplus/meta.yaml new file mode 100644 index 0000000000000..d85b61e5b355c --- /dev/null +++ b/recipes/rabbitqcplus/meta.yaml @@ -0,0 +1,35 @@ +{% set version = "2.2.9" %} + +package: + name: rabbitqcplus + version: {{ version }} + +source: + url: https://github.com/RabbitBio/RabbitQCPlus/archive/refs/tags/{{ version }}.tar.gz + sha256: 076cb1e11046d5a41464f74d7df363e2ea337e2cf3ad8e8b0712c5c7df746466 + +build: + number: 1 + skip: True # [osx] + run_exports: + - {{ pin_subpackage("rabbitqcplus", max_pin="x.x") }} + +requirements: + build: + - {{ compiler('cxx') }} + - {{ compiler('c') }} + - make + host: + - zlib + run: + - zlib + +test: + commands: + - rabbitqcplus --help + +about: + home: https://github.com/RabbitBio/RabbitQCPlus + license: MIT + license_file: LICENSE + summary: RabbitQCPlus is an efficient quality control tool for sequencing data diff --git a/recipes/racon/build.sh b/recipes/racon/build.sh index 468703346513e..5bca68065ae90 100644 --- a/recipes/racon/build.sh +++ b/recipes/racon/build.sh @@ -1,9 +1,20 @@ #!/bin/bash +case $(uname -m) in + x86_64) + SPOA_OPTS="-Dspoa_optimize_for_portability=ON" + ;; + aarch64) + SPOA_OPTS="-Dspoa_use_simde=ON -Dspoa_use_simde_nonvec=ON -Dspoa_use_simde_openmp=ON -DBUILD_TESTING=OFF" + ;; + *) + ;; +esac + mkdir -p $PREFIX/bin mkdir build cd build -cmake -DCMAKE_BUILD_TYPE=Release -DCMAKE_INSTALL_PREFIX=${PREFIX} -Dracon_build_wrapper=ON -Dspoa_optimize_for_portability=ON .. +cmake -DCMAKE_BUILD_TYPE=Release -DCMAKE_INSTALL_PREFIX=${PREFIX} -Dracon_build_wrapper=ON ${SPOA_OPTS} .. make chmod +w bin/racon_wrapper make install diff --git a/recipes/racon/meta.yaml b/recipes/racon/meta.yaml index 3a6b3fb266c94..f2f1e5d7e4e16 100644 --- a/recipes/racon/meta.yaml +++ b/recipes/racon/meta.yaml @@ -6,7 +6,9 @@ package: version: {{ version }} build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x") }} source: url: https://github.com/lbcb-sci/racon/archive/refs/tags/{{ version }}.tar.gz @@ -37,3 +39,7 @@ about: license: MIT license_file: LICENSE summary: Ultrafast consensus module for raw de novo genome assembly of long uncorrected reads. + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/radiant/build.sh b/recipes/radiant/build.sh new file mode 100644 index 0000000000000..9223f1a6f8a8a --- /dev/null +++ b/recipes/radiant/build.sh @@ -0,0 +1,6 @@ + +export CXXFLAGS="${CXXFLAGS} -D_LIBCPP_DISABLE_AVAILABILITY" +cmake -DCMAKE_INSTALL_PREFIX=$PREFIX -S . -B build +cmake --build build +cmake --install build + diff --git a/recipes/radiant/meta.yaml b/recipes/radiant/meta.yaml new file mode 100644 index 0000000000000..d79fe4d62761d --- /dev/null +++ b/recipes/radiant/meta.yaml @@ -0,0 +1,44 @@ +{% set name = "radiant" %} +{% set version = "1.1.5" %} +{% set sha256 = "e3c37d15cdaf227f88ebd23e7ed55eee6d12c549a3521212f5e0d2655aa4dcad" %} + + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://zivgitlab.uni-muenster.de/domain-world/RADIANT/-/archive/{{ version }}/RADIANT-{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage('radiant', max_pin="x") }} + +requirements: + build: + - cmake >=3.15 + - make + - {{ compiler('cxx') }} + host: + - sqlite + - bzip2 + - zlib + - openmp + - boost-cpp >=1.77 + run: + - sqlite + - openmp + - boost-cpp >=1.77 +test: + commands: + - radiant -h + +about: + home: https://domainworld.uni-muenster.de/data/radiant-db/index.html + license: GPL-3.0-or-later + license_file: LICENSE + summary: Annotate proteomes with protein domains + description: | + This program rapidly annotates protein sequences with Pfam domains diff --git a/recipes/raiss/meta.yaml b/recipes/raiss/meta.yaml index 07f2b3b1215de..6ba190e766b4d 100644 --- a/recipes/raiss/meta.yaml +++ b/recipes/raiss/meta.yaml @@ -1,5 +1,6 @@ {% set name = "raiss" %} -{% set version = "4.0" %} + +{% set version = "4.0.1" %} package: name: {{ name }} @@ -7,7 +8,8 @@ package: source: url: https://gitlab.pasteur.fr/statistical-genetics/{{ name }}/-/archive/{{ version }}/{{ name }}-{{ version }}.tar.gz - sha256: 771a4ec126967daa367daa599178909cd182ed5d564c169b64e0491f1bb19714 + sha256: eb5cc6b67b395fbf5c2678a253dd7fd2c30c5f62a7358253778b1c6c1161a89f + build: noarch: python @@ -29,7 +31,7 @@ requirements: - pandas - python-dateutil - pytz - - scipy + - scipy >=1.7.0 - six - tzdata diff --git a/recipes/raptor/meta.yaml b/recipes/raptor/meta.yaml index 0b38ef4ed151c..cf815b6a65db9 100644 --- a/recipes/raptor/meta.yaml +++ b/recipes/raptor/meta.yaml @@ -10,7 +10,7 @@ source: sha256: be44e7b2635e110c940cf40ff132956200551a2e25765d9f057e844f7a3ccebb build: - number: 1 + number: 2 skip: True # [osx] run_exports: - {{ pin_subpackage(name, max_pin='x') }} diff --git a/recipes/raptor/raptor b/recipes/raptor/raptor index 180b5b084c99f..107b82cc749f2 100644 --- a/recipes/raptor/raptor +++ b/recipes/raptor/raptor @@ -6,11 +6,12 @@ set -eu # -m 1 : stop after first match, i.e. count is either 0 or 1 # -E : use extended regular expressions # \b : matches any non alphanumeric character, i.e. space, tab, newline, etc. -HAS_SSE2=$(grep -c -m 1 -E '\bsse2\b' /proc/cpuinfo) -HAS_SSE4_2=$(grep -c -m 1 -E '\bsse4_2\b' /proc/cpuinfo) -HAS_AVX2=$(grep -c -m 1 -E '\bavx2\b' /proc/cpuinfo) -HAS_AVX512F=$(grep -c -m 1 -E '\bavx512f\b' /proc/cpuinfo) -HAS_AVX512BW=$(grep -c -m 1 -E '\bavx512bw\b' /proc/cpuinfo) +# || true: ignore `grep -c` returning a non-zero exit code (behavior depends on OS) +HAS_SSE2=$(grep -c -m 1 -E '\bsse2\b' /proc/cpuinfo || true) +HAS_SSE4_2=$(grep -c -m 1 -E '\bsse4_2\b' /proc/cpuinfo || true) +HAS_AVX2=$(grep -c -m 1 -E '\bavx2\b' /proc/cpuinfo || true) +HAS_AVX512F=$(grep -c -m 1 -E '\bavx512f\b' /proc/cpuinfo || true) +HAS_AVX512BW=$(grep -c -m 1 -E '\bavx512bw\b' /proc/cpuinfo || true) if [ ${HAS_AVX512F} -eq 1 ] && [ ${HAS_AVX512BW} -eq 1 ]; then HAS_AVX512=1 else diff --git a/recipes/rasusa/meta.yaml b/recipes/rasusa/meta.yaml index b61dc1feb6422..202169f0e6dba 100644 --- a/recipes/rasusa/meta.yaml +++ b/recipes/rasusa/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.8.0" %} +{% set version = "1.0.0" %} {% set name = "rasusa" %} package: @@ -7,7 +7,7 @@ package: source: url: https://github.com/mbhall88/{{ name }}/archive/{{ version }}.tar.gz - sha256: 903fa09fd7f7cc92880953131487186c3fbf539a127dc82f502559f9c1e9c11a + sha256: 7dba1d0cd6776031b13f5ef1e18212c9b37e9fb1fa4c81a1235f2e0460f6d89d build: number: 0 @@ -16,17 +16,20 @@ build: requirements: build: - - rust >=1.70 + - rust >=1.74.1 - {{ compiler('c') }} # [not win] test: commands: - rasusa --help + - rasusa reads --help + - rasusa aln --help + - rasusa cite about: home: https://github.com/mbhall88/rasusa license: MIT - summary: Randomly subsample sequencing reads to a specified coverage + summary: Randomly subsample sequencing reads or alignments license_file: LICENSE extra: diff --git a/recipes/raxml-ng/build.sh b/recipes/raxml-ng/build.sh index 6209021d02b11..1ad4779811365 100644 --- a/recipes/raxml-ng/build.sh +++ b/recipes/raxml-ng/build.sh @@ -4,7 +4,7 @@ mkdir build_pthreads pushd build_pthreads cmake .. - make + make -j ${CPU_COUNT} install -d ${PREFIX}/bin install ../bin/raxml-ng ${PREFIX}/bin popd @@ -15,7 +15,7 @@ then mkdir build_mpi pushd build_mpi CXX=mpicxx cmake -DUSE_MPI=ON .. - make + make -j ${CPU_COUNT} install -d ${PREFIX}/bin install ../bin/raxml-ng-mpi ${PREFIX}/bin popd diff --git a/recipes/raxml-ng/meta.yaml b/recipes/raxml-ng/meta.yaml index 0da1caa7dbbc0..a662b76ebaf8e 100644 --- a/recipes/raxml-ng/meta.yaml +++ b/recipes/raxml-ng/meta.yaml @@ -10,7 +10,7 @@ source: sha256: e14ec2233f0c9d9f497eab8f77c73512c8c787e44ed3839bd25fd35658ef89e3 build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('raxml-ng', max_pin="x") }} @@ -40,8 +40,10 @@ about: summary: "RAxML Next Generation: faster, easier-to-use and more flexible" extra: - container: - # openmpi needs ssh client - extended-base: true - identifiers: - - doi:10.1093/bioinformatics/btz305 + additional-platforms: + - linux-aarch64 + container: + # openmpi needs ssh client + extended-base: true + identifiers: + - doi:10.1093/bioinformatics/btz305 diff --git a/recipes/raxml/build.sh b/recipes/raxml/build.sh index 7a51b016595ca..6dd8706245751 100644 --- a/recipes/raxml/build.sh +++ b/recipes/raxml/build.sh @@ -6,10 +6,17 @@ Linux) SUF=.gcc;; *) echo "Unknown architecture"; exit 1;; esac +ARCH=$(uname -m) + mkdir -p $PREFIX/bin for PTHREADS in "" .PTHREADS; do for OPT in "" .SSE3 .AVX2; do + + if [ "${ARCH}" == "aarch64" -a "${OPT}" == ".AVX2" ]; then + continue + fi + echo "######## Building Flags opt=$OPT pthread=$PTHREADS os=$SUF ######" MAKEFILE=Makefile${OPT}${PTHREADS} if [ -e ${MAKEFILE}${SUF} ]; then diff --git a/recipes/raxml/meta.yaml b/recipes/raxml/meta.yaml index 87550af90f582..b98b2551cc414 100644 --- a/recipes/raxml/meta.yaml +++ b/recipes/raxml/meta.yaml @@ -3,7 +3,7 @@ package: version: "8.2.13" build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('raxml', max_pin="x") }} @@ -22,8 +22,8 @@ test: - raxmlHPC-PTHREADS -h > /dev/null - raxmlHPC-SSE3 -h > /dev/null - raxmlHPC-PTHREADS-SSE3 -h > /dev/null - - raxmlHPC-AVX2 -h > /dev/null - - raxmlHPC-PTHREADS-AVX2 -h > /dev/null + - 'raxmlHPC-AVX2 -h > /dev/null' # [not aarch64] + - 'raxmlHPC-PTHREADS-AVX2 -h > /dev/null' # [not aarch64] about: home: http://sco.h-its.org/exelixis/web/software/raxml/index.html @@ -31,6 +31,8 @@ about: summary: Phylogenetics - Randomized Axelerated Maximum Likelihood. extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:raxml - doi:10.1093/bioinformatics/btu033 diff --git a/recipes/rcorrector/build.sh b/recipes/rcorrector/build.sh index aca8c80b5e330..d856a68c52db5 100644 --- a/recipes/rcorrector/build.sh +++ b/recipes/rcorrector/build.sh @@ -2,7 +2,7 @@ export C_INCLUDE_PATH=$PREFIX/include export OBJC_INCLUDE_PATH=$PREFIX/include -export CPLUS_INCLUDE_PATH=$PREFIX/include +export CPLUS_INCLUDE_PATH=$PREFIX/include export LD_LIBRARY_PATH=$PATH/lib:$LD_LIBRARY_PATH export CFLAGS="-I$PREFIX/include" export CXXFLAGS="-Wall -O3 -std=c++0x -L$PREFIX/lib" diff --git a/recipes/rcorrector/meta.yaml b/recipes/rcorrector/meta.yaml index 9d532152a0e8e..5d667d2952db5 100644 --- a/recipes/rcorrector/meta.yaml +++ b/recipes/rcorrector/meta.yaml @@ -1,5 +1,5 @@ {% set name = "rcorrector" %} -{% set version = "1.0.6" %} +{% set version = "1.0.7" %} package: name: {{ name }} @@ -7,10 +7,12 @@ package: source: url: https://github.com/mourisl/Rcorrector/archive/refs/tags/v{{ version }}.tar.gz - sha256: 581a7028c68cca20ee045084adabde9f3f896485427c1b7f1c6253fb198cf38a + sha256: cc1a9e82056bdc717b7ac40729c90573caad371899f9a1c61c25b50f019fbedb build: number: 0 + run_exports: + - {{ pin_subpackage('rcorrector', max_pin="x") }} requirements: build: @@ -33,6 +35,11 @@ test: about: home: https://github.com/mourisl/Rcorrector/ license: GPL-3.0-only - license_family: GPL + license_family: GPL3 license_file: LICENSE summary: Rcorrector (RNA-seq error CORRECTOR) is a kmer-based error correction method for RNA-seq data. Rcorrector can also be applied to other type of sequencing data where the read coverage is non-uniform, such as single-cell sequencing. + +extra: + identifiers: + - doi:10.1186/s13742-015-0089-y + - biotools:rcorrector diff --git a/recipes/rdp_classifier/meta.yaml b/recipes/rdp_classifier/meta.yaml index 2f1fc33e086f3..5341085f3b312 100644 --- a/recipes/rdp_classifier/meta.yaml +++ b/recipes/rdp_classifier/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.13" %} +{% set version = "2.14" %} package: name: rdp_classifier @@ -6,11 +6,13 @@ package: source: url: https://sourceforge.net/projects/rdp-classifier/files/rdp-classifier/rdp_classifier_{{ version }}.zip - sha256: d2eb9a989d7e31ff824de6876bc1d8ab70d97112ece167afe8d87a3cd412086a + sha256: 2aac7ba2bf602eb025e1791f356c0c437200486ece6905f93219d51395504b2b build: noarch: generic - number: 1 + number: 0 + run_exports: + - {{ pin_subpackage('rdp_classifier', max_pin='x.x') }} requirements: run: @@ -21,6 +23,6 @@ test: - rdp_classifier about: - home: 'http://rdp.cme.msu.edu/classifier/' + home: 'https://sourceforge.net/projects/rdp-classifier/' license: GPL-2.0-only summary: "Naive Bayesian classifier that can rapidly and accurately provide taxonomic assignments from domain to genus" diff --git a/recipes/rdp_classifier/rdp_classifier.sh b/recipes/rdp_classifier/rdp_classifier.sh index 1bbc9b3f9e0bb..1596d5df830e7 100644 --- a/recipes/rdp_classifier/rdp_classifier.sh +++ b/recipes/rdp_classifier/rdp_classifier.sh @@ -36,10 +36,10 @@ for arg in "$@"; do '-XX'*) jvm_prop_opts="$jvm_prop_opts $arg" ;; - '-Xm'*) + '-Xm'*) jvm_mem_opts="$jvm_mem_opts $arg" ;; - *) + *) pass_args="$pass_args $arg" ;; esac diff --git a/recipes/recentrifuge/meta.yaml b/recipes/recentrifuge/meta.yaml index 2490ce7708084..792c16374b7da 100644 --- a/recipes/recentrifuge/meta.yaml +++ b/recipes/recentrifuge/meta.yaml @@ -1,5 +1,5 @@ {% set name = "recentrifuge" %} -{% set version = "1.13.1" %} +{% set version = "1.14.0" %} package: name: {{ name }} @@ -14,7 +14,7 @@ build: source: url: https://github.com/khyox/{{ name }}/archive/v{{ version }}.tar.gz - sha256: a8c3826302c7a39fe0735176b49fc635964b83d5cc110fc3139c83783c27984d + sha256: 8151fe3f7d6581f487eb10fab61ef211b132b0774128ed7d060b5fe389d69674 requirements: host: diff --git a/recipes/recgraph/build.sh b/recipes/recgraph/build.sh new file mode 100644 index 0000000000000..049babcc91015 --- /dev/null +++ b/recipes/recgraph/build.sh @@ -0,0 +1,6 @@ +#!/bin/bash -euo + +RUST_BACKTRACE=1 CARGO_HOME="${BUILD_PREFIX}/.cargo" cargo build --release + +mkdir -p $PREFIX/bin +cp target/release/recgraph $PREFIX/bin diff --git a/recipes/recgraph/meta.yaml b/recipes/recgraph/meta.yaml new file mode 100644 index 0000000000000..227ff06ebd53e --- /dev/null +++ b/recipes/recgraph/meta.yaml @@ -0,0 +1,37 @@ +{% set name = "RecGraph" %} +{% set version = "1.0.0" %} +{% set sha256 = "a68a49ecc457f4070604244a21abde60c76b12dba03e8d4136c3fe20abae7ffc" %} + + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/AlgoLab/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x") }} + +requirements: + build: + - make + - {{ compiler('c') }} + - rust =1.74 + +test: + commands: + - recgraph --help + +about: + home: https://github.com/AlgoLab/{{ name }} + license: MIT + license_file: LICENSE + summary: Optimal sequence-to-graph alignment with recombinations + +extra: + recipe-maintainers: + - yp diff --git a/recipes/reframed/LICENSE.txt b/recipes/reframed/LICENSE.txt new file mode 100644 index 0000000000000..ea167eefc7532 --- /dev/null +++ b/recipes/reframed/LICENSE.txt @@ -0,0 +1,15 @@ +Apache Software License 2.0 + +Copyright (c) 2019, Daniel Machado + +Licensed under the Apache License, Version 2.0 (the "License"); +you may not use this file except in compliance with the License. +You may obtain a copy of the License at + +http://www.apache.org/licenses/LICENSE-2.0 + +Unless required by applicable law or agreed to in writing, software +distributed under the License is distributed on an "AS IS" BASIS, +WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +See the License for the specific language governing permissions and +limitations under the License. diff --git a/recipes/reframed/meta.yaml b/recipes/reframed/meta.yaml index 5bc8f8eec8325..9121cbd0ac6ee 100644 --- a/recipes/reframed/meta.yaml +++ b/recipes/reframed/meta.yaml @@ -1,5 +1,5 @@ {% set name = "reframed" %} -{% set version = "1.5.0" %} +{% set version = "1.5.1" %} package: name: {{ name|lower }} @@ -7,14 +7,14 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/reframed-{{ version }}.tar.gz - sha256: 2f40e631080be7aa8f2ea1c1f4b1ffa5cf52e87e4279978b6c72c7bb690dc1c1 + sha256: cded8ba31fa1dcddb358f79122cbe5d1f4562a538a4058045d462b50d7fc71c8 build: noarch: python - script: {{ PYTHON }} -m pip install . -vv - number: 0 + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 1 run_exports: - - {{ pin_subpackage('reframed', max_pin="x") }} + - {{ pin_subpackage('reframed', max_pin="x.x.x") }} requirements: host: @@ -26,6 +26,8 @@ requirements: - scipy - sympy - python-libsbml + - pyscipopt + - scip test: imports: @@ -43,6 +45,8 @@ about: extra: recipe-maintainers: + - lhtxa + - cdanielmachado - acaprez identifiers: - biotools:reframed diff --git a/recipes/regenie/meta.yaml b/recipes/regenie/meta.yaml index 3cdfe87d4c7b0..0ee50bfab1262 100644 --- a/recipes/regenie/meta.yaml +++ b/recipes/regenie/meta.yaml @@ -1,6 +1,6 @@ {% set name = "regenie" %} -{% set version = "3.4" %} -{% set sha256 = "c4c87f86ac42dc0ebc57f701e24cc88acd5fbf6cb9e6e3dac8c1b1c9ba4e6922" %} +{% set version = "3.4.1" %} +{% set sha256 = "e2683cd4078015ece44cfbea28957695155dbad3b6a5ef6017654b1d8254f214" %} package: name: {{ name|lower }} @@ -22,7 +22,8 @@ source: # - patches/0009-update-cmake-file-for-conda.patch # - patches/0010-update-cmakelist-file-for-v3.2.7.patch # - patches/0011-update-cmakelist-file-for-v3.2.9.patch - - patches/0012-update-cmakelist-file-for-v3.4.patch + # - patches/0012-update-cmakelist-file-for-v3.4.patch + - patches/0013-update-cmakelist-file-for-v3.4.1.patch build: number: 0 diff --git a/recipes/regenie/patches/0013-update-cmakelist-file-for-v3.4.1.patch b/recipes/regenie/patches/0013-update-cmakelist-file-for-v3.4.1.patch new file mode 100644 index 0000000000000..a3072766dad91 --- /dev/null +++ b/recipes/regenie/patches/0013-update-cmakelist-file-for-v3.4.1.patch @@ -0,0 +1,343 @@ +From 40a095edbac9478fe818b43ae49c0d5e958d632f Mon Sep 17 00:00:00 2001 +From: Joelle Mbatchou +Date: Thu, 1 Feb 2024 17:14:05 -0500 +Subject: [PATCH] update cmakelist file for v3.4.1 + +--- + CMakeLists.txt | 228 +++++++++++++++++++++---------------------------- + 1 file changed, 95 insertions(+), 133 deletions(-) + mode change 100755 => 100644 CMakeLists.txt + +diff --git a/CMakeLists.txt b/CMakeLists.txt +old mode 100755 +new mode 100644 +index 4368ce0..2dc15fd +--- a/CMakeLists.txt ++++ b/CMakeLists.txt +@@ -1,11 +1,3 @@ +-# For Intel MKL, set MKLROOT= when running cmake +-# e.g. MKLROOT=/opt/mkl/ cmake -S regenie_dir/ -B regenie_dir/build/ +-# For OpenBLAS, set OPENBLAS_ROOT= when running cmake +-# note: it also requires lapacke library +-# For static compilation on Linux systems, set STATIC=1 when running cmake +-# -> this excludes GLIBC +- +- + cmake_minimum_required(VERSION 3.13) + + # detect OS architecture +@@ -33,57 +25,16 @@ set(CMAKE_CXX_EXTENSIONS OFF) # Ensures -std=c++11 + ###################################### + ######## check input variables + +-# check BGEN_PATH +-if("$ENV{BGEN_PATH}" STREQUAL "") +- message( FATAL_ERROR "Must specify path to BGEN library in 'BGEN_PATH'") +-else() +- set(BGEN_PATH "$ENV{BGEN_PATH}" CACHE INTERNAL "Set BGEN library path") +- if (NOT EXISTS ${BGEN_PATH}) +- message( FATAL_ERROR "Specified BGEN library directory '${BGEN_PATH}' does not exist") +- endif() +-endif() +- + # check for static compilation +-if($ENV{STATIC}) ++if(BUILD_SHARED_LIBS) ++ set(BUILD_STATIC OFF CACHE INTERNAL "Dynamic compilation") ++ set(Boost_USE_STATIC_LIBS OFF) ++else() + set(BUILD_STATIC ON CACHE INTERNAL "Static compilation") ++ set(Boost_USE_STATIC_LIBS ON) + message( STATUS "Static compilation mode") + endif() + +-# check Boost IOStreams +-if($ENV{HAS_BOOST_IOSTREAM}) +- set(HAS_BOOST_IOSTREAM 1 CACHE INTERNAL "Add Boost IO") +- set(RG_VERSION "${RG_VERSION}.gz" CACHE INTERNAL "Update version") +-else() +- set(HAS_BOOST_IOSTREAM 0 CACHE INTERNAL "Skip Boost IO") +-endif() +- +-# check MKL +-if(NOT "$ENV{MKLROOT}" STREQUAL "") +- set(MKLROOT "$ENV{MKLROOT}" CACHE INTERNAL "Set MKL library path") +- if (NOT EXISTS ${MKLROOT}) +- message( FATAL_ERROR "Specified MKL library directory '${MKLROOT}' does not exist") +- endif() +- message( STATUS "Will compile with Intel MKL library") +-endif() +- +-# check HTSlib +-if(NOT "$ENV{HTSLIB_PATH}" STREQUAL "") +- set(HTSLIB_PATH "$ENV{HTSLIB_PATH}" CACHE INTERNAL "Set HTSlib library path") +- if (NOT EXISTS ${HTSLIB_PATH}) +- message( FATAL_ERROR "Specified HTSlib library directory '${HTSLIB_PATH}' does not exist") +- endif() +- message( STATUS "Will compile with HTSlib") +-endif() +- +-# check OpenBLAS +-if(NOT "$ENV{OPENBLAS_ROOT}" STREQUAL "") +- set(OPENBLAS_ROOT "$ENV{OPENBLAS_ROOT}" CACHE INTERNAL "Set OpenBLAS library path") +- if (NOT EXISTS ${OPENBLAS_ROOT}) +- message( FATAL_ERROR "Specified OpenBLAS library directory '${OPENBLAS_ROOT}' does not exist") +- endif() +- message( STATUS "Will compile with OpenBLAS library") +-endif() +- + ###################################### + ######## set flags and required libraries + +@@ -92,9 +43,10 @@ set(Boost_USE_STATIC_LIBS ${BUILD_STATIC}) + set(Boost_USE_DEBUG_LIBS OFF) + set(Boost_USE_MULTITHREADED ON) + set(Boost_USE_STATIC_RUNTIME OFF) ++set(MKLROOT "${CMAKE_PREFIX_PATH}") + +-# list each file specifically +-add_executable(regenie ++# list each file specifically ++add_executable(regenie + ${CMAKE_SOURCE_DIR}/src/Data.cpp + ${CMAKE_SOURCE_DIR}/src/Files.cpp + ${CMAKE_SOURCE_DIR}/src/Geno.cpp +@@ -112,32 +64,54 @@ add_executable(regenie + ${CMAKE_SOURCE_DIR}/src/MCC.cpp + ${CMAKE_SOURCE_DIR}/src/Ordinal.cpp + ) +-target_include_directories(regenie PRIVATE ${CMAKE_SOURCE_DIR}/src) ++target_include_directories(regenie PUBLIC ${CMAKE_CURRENT_SOURCE_DIR}/src ${CMAKE_PREFIX_PATH}/include) + + set(CMAKE_CXX_FLAGS "-O3 -Wall -pedantic -ffast-math -Wno-unused-local-typedefs -Wno-deprecated-declarations -Wno-long-long -Wno-c11-extensions -fPIC") +-add_definitions(-DVERSION_NUMBER="${RG_VERSION}") + ++find_package(OpenMP REQUIRED) ++target_link_libraries(regenie OpenMP::OpenMP_CXX) + if("${UNAME_S}" STREQUAL "Linux") +- find_package(OpenMP REQUIRED) +- target_link_libraries(regenie PRIVATE OpenMP::OpenMP_CXX) + if(${BUILD_STATIC}) +- target_link_options(regenie BEFORE PRIVATE -static-libgcc PRIVATE -static-libstdc++) ++ target_link_options(regenie BEFORE -static-libgcc -static-libstdc++) + endif() + elseif("${UNAME_S}" STREQUAL "Darwin") +- set(CMAKE_CXX_FLAGS "${CMAKE_CXX_FLAGS} -stdlib=libc++") ++ set(CMAKE_CXX_FLAGS "${CMAKE_CXX_FLAGS} -stdlib=libc++") + endif() + +-set(EXTERN_LIBS_PATH "${CMAKE_SOURCE_DIR}/external_libs") +-target_include_directories(regenie PRIVATE ${EXTERN_LIBS_PATH}/) ++set(EXTERN_LIBS_PATH "${CMAKE_CURRENT_SOURCE_DIR}/external_libs") ++target_include_directories(regenie PUBLIC ${EXTERN_LIBS_PATH}/) ++ ++# for BGEN (choose static if present first) ++find_library(ZSTD_LIBRARY zstd REQUIRED) ++find_library(DB_LIBRARY ++ NAMES libdb.a db ++ REQUIRED ++ ) ++find_library(SQLITE3_LIBRARY sqlite3 REQUIRED) ++find_package(Boost ++ REQUIRED COMPONENTS system filesystem thread ++ OPTIONAL_COMPONENTS iostreams ++ ) ++find_library(BGEN_LIBRARY ++ NAMES libbgen.a ++ REQUIRED ++ ) ++target_link_libraries(regenie ${ZSTD_LIBRARY} ${BGEN_LIBRARY} ${DB_LIBRARY} ${SQLITE3_LIBRARY} ${Boost_LIBRARIES}) ++target_include_directories(regenie ++ PUBLIC ++ $ ++ $ ++ $ ++ $ ++ ) ++add_definitions(${Boost_DEFINITIONS}) + +-# BGEN library and its dependencies +-find_library(ZSTD_LIBRARY libzstd.a HINTS "${BGEN_PATH}/build/3rd_party/zstd-1.1.0" REQUIRED) +-find_library(DB_LIBRARY libdb.a HINTS "${BGEN_PATH}/build/db" REQUIRED) +-find_library(SQLITE3_LIBRARY libsqlite3.a HINTS "${BGEN_PATH}/build/3rd_party/sqlite3" REQUIRED) +-find_library(Boost_LIBRARY libboost.a HINTS "${BGEN_PATH}/build/3rd_party/boost_1_55_0" REQUIRED) +-find_library(BGEN_LIBRARY libbgen.a HINTS "${BGEN_PATH}/build" REQUIRED) +-target_link_libraries(regenie PRIVATE ${ZSTD_LIBRARY} ${BGEN_LIBRARY} ${DB_LIBRARY} ${SQLITE3_LIBRARY} ${Boost_LIBRARY}) +-target_include_directories(regenie PRIVATE ${BGEN_PATH} ${BGEN_PATH}/genfile/include/ ${BGEN_PATH}/3rd_party/boost_1_55_0/ ${BGEN_PATH}/3rd_party/zstd-1.1.0/lib ${BGEN_PATH}/db/include/ ${BGEN_PATH}/3rd_party/sqlite3) ++# Boost IO ++if(Boost_iostreams_FOUND) ++ add_definitions(-DHAS_BOOST_IOSTREAM) ++ set(RG_VERSION "${RG_VERSION}.gz" CACHE INTERNAL "Update version") ++ message( STATUS "Will compile with Boost Iostreams library") ++endif() + + # MVTNorm library + set(MVTN_PATH "${EXTERN_LIBS_PATH}/mvtnorm") +@@ -146,7 +120,7 @@ add_custom_target( + COMMAND make + WORKING_DIRECTORY ${MVTN_PATH} + ) +-target_link_libraries(regenie PRIVATE ${MVTN_PATH}/libMvtnorm.a) ++target_link_libraries(regenie ${MVTN_PATH}/libMvtnorm.a) + add_dependencies(regenie libMvtnorm) + + # QF library +@@ -156,7 +130,7 @@ add_custom_target( + COMMAND make + WORKING_DIRECTORY ${QF_PATH} + ) +-target_link_libraries(regenie PRIVATE ${QF_PATH}/qf.a) ++target_link_libraries(regenie ${QF_PATH}/qf.a) + add_dependencies(regenie libqf) + + # Quadpack library +@@ -166,7 +140,7 @@ add_custom_target( + COMMAND make + WORKING_DIRECTORY ${QUAD_PATH} + ) +-target_link_libraries(regenie PRIVATE ${QUAD_PATH}/libquad.a) ++target_link_libraries(regenie ${QUAD_PATH}/libquad.a) + add_dependencies(regenie libquad) + + # PGEN library +@@ -176,12 +150,12 @@ add_custom_target( + COMMAND make + WORKING_DIRECTORY ${PGEN_PATH} + ) +-target_link_libraries(regenie PRIVATE ${PGEN_PATH}/pgenlib.a) +-target_include_directories(regenie PRIVATE ${PGEN_PATH} ${PGEN_PATH}/simde/ ${PGEN_PATH}/include/) ++target_link_libraries(regenie ${PGEN_PATH}/pgenlib.a) ++target_include_directories(regenie PUBLIC ${PGEN_PATH} ${PGEN_PATH}/simde/ ${PGEN_PATH}/include/) + add_dependencies(regenie pgenlib) + + # REMETA library +-if(EXISTS ${HTSLIB_PATH}) ++if(DEFINED HTSLIB_PATH) + set(REMETA_PATH "${EXTERN_LIBS_PATH}/remeta") + add_custom_target( + remeta +@@ -198,78 +172,66 @@ if(EXISTS ${HTSLIB_PATH}) + endif() + + # Intel MKL +-if(EXISTS ${MKLROOT}) ++if(DEFINED MKLROOT) + add_definitions(-DWITH_MKL -DEIGEN_USE_BLAS -DEIGEN_USE_LAPACKE) +- target_include_directories(regenie PRIVATE ${MKLROOT}/include/) +- if(${BUILD_STATIC}) # specify static libs +- find_library(MKL_LP64_LIB libmkl_intel_lp64.a HINTS "${MKLROOT}/lib/intel64" REQUIRED) +- find_library(MKL_THREAD_LIB libmkl_gnu_thread.a HINTS "${MKLROOT}/lib/intel64" REQUIRED) +- find_library(MKL_CORE_LIB libmkl_core.a HINTS "${MKLROOT}/lib/intel64" REQUIRED) +- target_link_libraries(regenie PRIVATE "-Wl,--start-group" ${MKL_LP64_LIB} ${MKL_THREAD_LIB} ${MKL_CORE_LIB} "-Wl,--end-group" -lgomp) ++ target_include_directories(regenie PUBLIC ${MKLROOT}/include/) ++ find_library(MKL_LP64_LIB mkl_intel_lp64 ++ HINTS "${MKLROOT}/lib/" ++ REQUIRED ++ ) ++ if("${UNAME_S}" STREQUAL "Linux") ++ find_library(MKL_THREAD_LIB mkl_gnu_thread ++ HINTS "${MKLROOT}/lib/" ++ REQUIRED ++ ) ++ elseif("${UNAME_S}" STREQUAL "Darwin") ++ find_library(MKL_THREAD_LIB mkl_intel_thread ++ HINTS "${MKLROOT}/lib/" ++ REQUIRED ++ ) ++ endif() ++ find_library(MKL_CORE_LIB mkl_core ++ HINTS "${MKLROOT}/lib/" ++ REQUIRED ++ ) ++ if("${UNAME_S}" STREQUAL "Darwin") ++ target_link_libraries(regenie ${MKL_LP64_LIB} ${MKL_THREAD_LIB} ${MKL_CORE_LIB}) ++ elseif(${BUILD_STATIC}) ++ target_link_libraries(regenie "-Wl,--start-group" ${MKL_LP64_LIB} ${MKL_THREAD_LIB} ${MKL_CORE_LIB} "-Wl,--end-group" -lgomp) + else() # use dynamic libs +- find_library(MKL_LP64_LIB mkl_intel_lp64 PATHS "${MKLROOT}/lib/intel64" REQUIRED) +- find_library(MKL_THREAD_LIB mkl_gnu_thread PATHS "${MKLROOT}/lib/intel64" REQUIRED) +- find_library(MKL_CORE_LIB mkl_core PATHS "${MKLROOT}/lib/intel64" REQUIRED) +- target_link_libraries(regenie PRIVATE "-Wl,--no-as-needed" ${MKL_LP64_LIB} ${MKL_THREAD_LIB} ${MKL_CORE_LIB} -lgomp) ++ target_link_libraries(regenie "-Wl,--no-as-needed" ${MKL_LP64_LIB} ${MKL_THREAD_LIB} ${MKL_CORE_LIB} -lgomp) + endif() +-elseif(EXISTS ${OPENBLAS_ROOT}) # OpenBLAS +- add_definitions(-DWITH_OPENBLAS -DEIGEN_USE_BLAS -DEIGEN_USE_LAPACKE) +- target_include_directories(regenie PRIVATE ${OPENBLAS_ROOT}/include/) +- find_library(LAPACK_LIB lapack REQUIRED) +- find_library(BLAS_LIB openblas HINTS "${OPENBLAS_ROOT}/lib/" REQUIRED) +- target_link_libraries(regenie PRIVATE ${LAPACK_LIB} -llapacke ${BLAS_LIB}) ++ message( STATUS "Will compile with Intel MKL library") + endif() + + # cxxopts (header-only) +-target_include_directories(regenie PRIVATE ${EXTERN_LIBS_PATH}/cxxopts/include/) ++target_include_directories(regenie PUBLIC ${CMAKE_SOURCE_DIR}/external_libs/cxxopts/include/) + + # LBFGS (header-only) +-target_include_directories(regenie PRIVATE ${EXTERN_LIBS_PATH}/LBFGSpp/include/) ++target_include_directories(regenie PUBLIC ${CMAKE_SOURCE_DIR}/external_libs/LBFGSpp/include/) + + # Eigen (header-only) +-target_include_directories(regenie PRIVATE ${EXTERN_LIBS_PATH}/eigen-3.4.0/) +- +-# Boost IO +-if(${HAS_BOOST_IOSTREAM}) +- if("${UNAME_S}" STREQUAL "Darwin") +- find_library(BOOST_LIB_IO libboost_iostreams libboost_iostreams.a REQUIRED) +- target_link_libraries(regenie PRIVATE ${BOOST_LIB_IO}) +- elseif(${BUILD_STATIC}) +- find_library(BOOST_LIB_IO libboost_iostreams.a REQUIRED) +- target_link_libraries(regenie PRIVATE ${BOOST_LIB_IO}) +- else() +- target_link_libraries(regenie PRIVATE -lboost_iostreams) +- endif() +- add_definitions(-DHAS_BOOST_IOSTREAM) +- message( STATUS "Will compile with Boost Iostreams library") +-endif() ++target_include_directories(regenie PUBLIC ${CMAKE_SOURCE_DIR}/external_libs/eigen-3.4.0/) + + # Other libraries +-find_library(ZLIB_LIBRARY libz.a z REQUIRED) +-find_library(M_LIB m REQUIRED) +-find_library(DL_LIB dl REQUIRED) +-find_library(BZ2_LIB bz2) +-find_library(LZMA_LIB lzma) +-find_library(CURL_LIB curl) +-find_library(CRYPTO_LIB crypto) ++find_library(ZLIB_LIBRARY z REQUIRED) ++find_library(M_LIB m REQUIRED) ++find_library(DL_LIB dl REQUIRED) + if("${UNAME_S}" STREQUAL "Linux") + set(GFORTRAN_LIBRARY "-lgfortran") + elseif("${UNAME_S}" STREQUAL "Darwin") + find_library(GFORTRAN_LIBRARY gfortran REQUIRED) + endif() +-target_link_libraries( +- regenie PRIVATE +- ${ZLIB_LIBRARY} ${M_LIB} ${DL_LIB} ${PTHREAD_LIB} +- ${BZ2_LIB} ${LZMA_LIB} +- ${CURL_LIB} ${CRYPTO_LIB} ${GFORTRAN_LIBRARY} +-) ++target_link_libraries(regenie ${ZLIB_LIBRARY} ${M_LIB} ${DL_LIB} ${PTHREAD_LIB} ${GFORTRAN_LIBRARY}) + +-install(TARGETS regenie RUNTIME DESTINATION ${CMAKE_INSTALL_BINDIR}) ++add_definitions(-DVERSION_NUMBER="${RG_VERSION}") ++install(TARGETS regenie RUNTIME DESTINATION ${CMAKE_INSTALL_BINDIR} OPTIONAL) + message( STATUS "REGENIE v" ${RG_VERSION}) + +-add_custom_target(full-clean +- COMMAND cd "${MVTN_PATH}" && make clean +- COMMAND cd "${QF_PATH}" && make clean +- COMMAND cd "${QUAD_PATH}" && make clean +- COMMAND cd "${PGEN_PATH}" && make clean +- ) ++write_basic_package_version_file(${CMAKE_CURRENT_BINARY_DIR}/${PROJECT_NAME}-config-version.cmake COMPATIBILITY SameMajorVersion) ++install(FILES ${CMAKE_CURRENT_BINARY_DIR}/${PROJECT_NAME}-config-version.cmake DESTINATION share/${PROJECT_NAME}) ++ ++set(CPACK_PACKAGE_VERSION_MAJOR ${PROJECT_VERSION_MAJOR}) ++set(CPACK_PACKAGE_VERSION_MINOR ${PROJECT_VERSION_MINOR}) ++set(CPACK_PACKAGE_VERSION_PATCH ${PROJECT_VERSION_PATCH}) ++include(CPack) +-- +2.34.1 + diff --git a/recipes/resfinder/build.sh b/recipes/resfinder/build.sh index 9cecba2f5985c..3c65803ffd5ac 100644 --- a/recipes/resfinder/build.sh +++ b/recipes/resfinder/build.sh @@ -1,10 +1,6 @@ #!/bin/bash -mkdir -p ${PREFIX}/bin - -cp *.py ${PREFIX}/bin -chmod +x ${PREFIX}/bin/*.py -cp -r cge/ ${PREFIX}/bin/ +${PYTHON} -m pip install . -vvv --no-deps --no-build-isolation # create folder for database download target=${PREFIX}/share/${PKG_NAME}-${PKG_VERSION} diff --git a/recipes/resfinder/meta.yaml b/recipes/resfinder/meta.yaml index a4795a5d6cf2c..6614f72cec293 100644 --- a/recipes/resfinder/meta.yaml +++ b/recipes/resfinder/meta.yaml @@ -1,47 +1,54 @@ -{% set name = "ResFinder" %} -{% set version = "4.1.11" %} -{% set sha256 = "e312ff8dc23f329baf8b0a4dc3c41f0006778772e8f736086cf12d03bc76c9c8" %} +{% set name = "resfinder" %} +{% set version = "4.5.0" %} package: - name: '{{ name|lower }}' - version: '{{ version }}' + name: {{ name|lower }} + version: {{ version }} source: - url: https://bitbucket.org/genomicepidemiology/{{ name|lower }}/get/{{ version }}.tar.gz - sha256: '{{ sha256 }}' + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/resfinder-{{ version }}.tar.gz + sha256: 7c2ad096c2f5f746607c4433d327f890776aba996f86112dc4527fc3c2bc0ec4 patches: - python_path.patch - - remove_version_git_tag.patch build: number: 0 - noarch: generic + noarch: python + run_exports: + - {{ pin_subpackage('resfinder', max_pin="x") }} requirements: host: - - git - - kma + - python >=3.8 + - pip + - pdm-pep517 >=0.12.0 run: - - python >=3 + - python >=3.8 + # Needs cgelib in conda-forge/bioconda + - cgelib >=0.7.3 + - cgecore ==1.5.6 + - tabulate >=0.8.9 + - pandas >=1.4.2 + - biopython >=1.79 + - python-dateutil - kma - - biopython - blast >=2.8.1 - - cgecore 1.5.5 - - tabulate 0.7.7 - - gitpython - - python-dateutil - git test: + imports: + - resfinder commands: - - run_resfinder.py --help + - python -m resfinder --help about: home: https://bitbucket.org/genomicepidemiology/resfinder - license: APACHE-2.0 + summary: "ResFinder identifies acquired antimicrobial resistance genes in total or partial sequenced isolates of bacteria." + license: Apache-2.0 license_family: APACHE - license_file: LICENSE-2.0.txt - summary: ResFinder identifies acquired antimicrobial resistance genes in total or partial sequenced isolates of bacteria. + license_file: LICENSE extra: notes: "ResFinder requires databases that can be downloaded with download-db.sh." + identifiers: + - doi:10.1093/jac/dkaa345 diff --git a/recipes/resfinder/python_path.patch b/recipes/resfinder/python_path.patch index a6b2bea47370b..59543ff0ea533 100644 --- a/recipes/resfinder/python_path.patch +++ b/recipes/resfinder/python_path.patch @@ -1,8 +1,8 @@ ---- run_resfinder.py.old 2022-03-24 02:00:31.990686268 -0500 -+++ run_resfinder.py 2022-03-24 02:01:00.924797159 -0500 +--- a/src/resfinder/run_resfinder.py ++++ b/src/resfinder/run_resfinder.py @@ -1,4 +1,4 @@ -#!/usr/bin/env python3 +#!/opt/anaconda1anaconda2anaconda3/bin/python + import io import sys import os - import re diff --git a/recipes/resfinder/remove_version_git_tag.patch b/recipes/resfinder/remove_version_git_tag.patch deleted file mode 100644 index f1b80390791fe..0000000000000 --- a/recipes/resfinder/remove_version_git_tag.patch +++ /dev/null @@ -1,36 +0,0 @@ ---- run_resfinder.py.old 2022-03-24 02:18:37.191844209 -0500 -+++ run_resfinder.py 2022-03-24 02:19:40.497086660 -0500 -@@ -27,24 +27,6 @@ - # ######### FUNCTIONS ######### # - # ########################################################################### # - --def get_git_tag(): -- git_folders_path = os.path.dirname(os.path.realpath(__file__)) -- try: -- git_tag = str( -- subprocess.check_output( -- ['git', 'describe', '--tags', '--abbrev=0'], -- stderr=subprocess.STDOUT, cwd=git_folders_path, -- )).strip('\'b\\n') -- except subprocess.CalledProcessError as exc_info: -- match = re.search( -- 'fatal: no tag exactly matches \'(?P[a-z0-9]+)\'', str(exc_info.output)) -- if match: -- raise Exception( -- 'Bailing: there is no git tag for the current commit, {commit}'.format( -- commit=match.group('commit'))) -- raise Exception(str(exc_info.output)) -- return git_tag -- - def eprint(*args, **kwargs): - print(*args, file=sys.stderr, **kwargs) - -@@ -178,7 +160,7 @@ - ResFinder will be used.", - type=float, - default=None) --parser.add_argument("-v", "--version", action="version", version=get_git_tag(), -+parser.add_argument("-v", "--version", action="version", version="4.1.11", - help="Show program's version number and exit") - # Temporary option only available temporary - parser.add_argument("--pickle", diff --git a/recipes/resistify/meta.yaml b/recipes/resistify/meta.yaml index ad45a542f97be..47d20d694a4aa 100644 --- a/recipes/resistify/meta.yaml +++ b/recipes/resistify/meta.yaml @@ -1,5 +1,5 @@ {% set name = "resistify" %} -{% set version = "0.1.0" %} +{% set version = "0.1.1" %} package: name: "{{ name }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 4fb7a11d524bf740c0832368ca8f5724e29e94f945b81c50062f85c6c719612e + sha256: e4c0714e266d95626e9fcd55db4f2315bc0c2c2e6d953f31aeafe5df4e7ab678 build: noarch: python diff --git a/recipes/reviewer/LICENSE.txt b/recipes/reviewer/LICENSE.txt new file mode 100644 index 0000000000000..f288702d2fa16 --- /dev/null +++ b/recipes/reviewer/LICENSE.txt @@ -0,0 +1,674 @@ + GNU GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU General Public License is a free, copyleft license for +software and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. We, the Free Software Foundation, use the +GNU General Public License for most of our software; it applies also to +any other work released this way by its authors. You can apply it to +your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you have +certain responsibilities if you distribute copies of the software, or if +you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the manufacturer +can do so. This is fundamentally incompatible with the aim of +protecting users' freedom to change the software. The systematic +pattern of such abuse occurs in the area of products for individuals to +use, which is precisely where it is most unacceptable. Therefore, we +have designed this version of the GPL to prohibit the practice for those +products. If such problems arise substantially in other domains, we +stand ready to extend this provision to those domains in future versions +of the GPL, as needed to protect the freedom of users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU Affero General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the special requirements of the GNU Affero General Public License, +section 13, concerning interaction through a network will apply to the +combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU General Public License from time to time. Such new versions will +be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + + Copyright (C) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see . + +Also add information on how to contact you by electronic and paper mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + Copyright (C) + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + +The hypothetical commands `show w' and `show c' should show the appropriate +parts of the General Public License. Of course, your program's commands +might be different; for a GUI interface, you would use an "about box". + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU GPL, see +. + + The GNU General Public License does not permit incorporating your program +into proprietary programs. If your program is a subroutine library, you +may consider it more useful to permit linking proprietary applications with +the library. If this is what you want to do, use the GNU Lesser General +Public License instead of this License. But first, please read +. diff --git a/recipes/reviewer/build.sh b/recipes/reviewer/build.sh new file mode 100644 index 0000000000000..bddd1b6140eae --- /dev/null +++ b/recipes/reviewer/build.sh @@ -0,0 +1,8 @@ +#!/bin/sh + +mkdir build +cd build +cmake -DCMAKE_INSTALL_PREFIX="$PREFIX" -DCMAKE_BUILD_TYPE=Release .. +cmake --build . +mkdir -p $PREFIX/bin +install -m 755 install/bin/REViewer $PREFIX/bin diff --git a/recipes/reviewer/cpp-fixes.patch b/recipes/reviewer/cpp-fixes.patch new file mode 100644 index 0000000000000..db3341103708e --- /dev/null +++ b/recipes/reviewer/cpp-fixes.patch @@ -0,0 +1,25 @@ +diff --git a/reviewer/app/Workflow.cpp b/reviewer/app/Workflow.cpp +index 3954aca71..badd1b2e8 100644 +--- a/reviewer/app/Workflow.cpp ++++ b/reviewer/app/Workflow.cpp +@@ -21,6 +21,7 @@ + #include "Workflow.hh" + + #include ++#include + + #include + +diff --git a/reviewer/thirdparty/graph-tools/src/graphcore/GraphCoordinates.cpp b/reviewer/thirdparty/graph-tools/src/graphcore/GraphCoordinates.cpp +index 2550eda8b..622243c4e 100644 +--- a/reviewer/thirdparty/graph-tools/src/graphcore/GraphCoordinates.cpp ++++ b/reviewer/thirdparty/graph-tools/src/graphcore/GraphCoordinates.cpp +@@ -22,6 +22,8 @@ + #include "graphutils/PairHashing.hh" + + #include ++#include ++#include + + namespace graphtools + { diff --git a/recipes/reviewer/external-libs.patch b/recipes/reviewer/external-libs.patch new file mode 100644 index 0000000000000..bfd12a58d692a --- /dev/null +++ b/recipes/reviewer/external-libs.patch @@ -0,0 +1,115 @@ +diff --git a/CMakeLists.txt b/CMakeLists.txt +index 022aa4d90..a2da3de32 100644 +--- a/CMakeLists.txt ++++ b/CMakeLists.txt +@@ -5,67 +5,12 @@ set(CMAKE_CXX_STANDARD 11) + set(CMAKE_CXX_STANDARD_REQUIRED ON) + + # Check for required packages: +-find_package(ZLIB REQUIRED) +-find_package(BZip2 REQUIRED) +-find_package(LibLZMA REQUIRED) + + include(ExternalProject) + + set(installDir ${CMAKE_CURRENT_BINARY_DIR}/install) + + +-ExternalProject_Add(htslib +- BUILD_IN_SOURCE YES +- URL https://github.com/samtools/htslib/releases/download/1.10.2/htslib-1.10.2.tar.bz2 +- CONFIGURE_COMMAND ./configure --prefix=${installDir} --disable-libcurl +- BUILD_COMMAND $(MAKE) lib-static +-) +- +- +-# Setup boost user config so that it uses the same c++ compiler as other components: +-if(CMAKE_CXX_COMPILER_ID STREQUAL "GNU") +- set (BOOST_COMPILER_TAG "gcc") +-elseif(CMAKE_CXX_COMPILER_ID STREQUAL "Clang") +- set (BOOST_COMPILER_TAG "clang") +- set(B2_OPTIONS ${B2_OPTIONS} "toolset=clang") +-elseif(CMAKE_CXX_COMPILER_ID STREQUAL "AppleClang") +- set (BOOST_COMPILER_TAG "darwin") +- set(B2_OPTIONS ${B2_OPTIONS} "toolset=clang") +-endif() +- +-if (BOOST_COMPILER_TAG) +- set(BOOST_UCONFIG "${CMAKE_BINARY_DIR}/user-config.jam") +- file(WRITE "${BOOST_UCONFIG}" "using ${BOOST_COMPILER_TAG} : : \"${CMAKE_CXX_COMPILER}\" ;\n") +- set(BOOST_PATCH_COMMAND ${CMAKE_COMMAND} -E copy ${BOOST_UCONFIG} tools/build/src/user-config.jam) +-endif() +- +-ExternalProject_Add(Boost +- BUILD_IN_SOURCE YES +- URL https://boostorg.jfrog.io/artifactory/main/release/1.73.0/source/boost_1_73_0.tar.bz2 +- PATCH_COMMAND ${BOOST_PATCH_COMMAND} +- CONFIGURE_COMMAND ./bootstrap.sh --prefix=${installDir} +- BUILD_COMMAND ./b2 install -j8 --with-filesystem --with-system --with-program_options link=static ${B2_OPTIONS} +- INSTALL_COMMAND "" +-) +- +- +-ExternalProject_Add(spdlog +- URL https://github.com/gabime/spdlog/archive/refs/tags/v1.6.1.tar.gz +- CMAKE_ARGS -DCMAKE_INSTALL_PREFIX:PATH=${installDir} +- -DCMAKE_C_COMPILER=${CMAKE_C_COMPILER} +- -DCMAKE_CXX_COMPILER=${CMAKE_CXX_COMPILER} +-) +- +- +-ExternalProject_Add(catch2 +- URL https://github.com/catchorg/Catch2/archive/refs/tags/v2.12.4.tar.gz +- CMAKE_ARGS -DCMAKE_INSTALL_PREFIX:PATH=${installDir} +- -DCMAKE_C_COMPILER=${CMAKE_C_COMPILER} +- -DCMAKE_CXX_COMPILER=${CMAKE_CXX_COMPILER} +- -DBUILD_TESTING=OFF +-) +- +- + ExternalProject_Add(reviewer + SOURCE_DIR ${CMAKE_SOURCE_DIR}/reviewer + BUILD_ALWAYS YES +@@ -78,5 +23,5 @@ ExternalProject_Add(reviewer + + + ExternalProject_Add_StepDependencies(reviewer configure +- Boost spdlog htslib catch2) ++ ) + +diff --git a/reviewer/CMakeLists.txt b/reviewer/CMakeLists.txt +index c7602afa0..b7fa22539 100644 +--- a/reviewer/CMakeLists.txt ++++ b/reviewer/CMakeLists.txt +@@ -10,16 +10,12 @@ if (NOT CMAKE_BUILD_TYPE) + "Choose the type of build (default: ${DEFAULT_CMAKE_BUILD_TYPE})" FORCE) + endif () + +-set(Boost_USE_STATIC_LIBS ON) + find_package(Boost 1.73 REQUIRED COMPONENTS program_options filesystem system) + + find_package(spdlog REQUIRED) +-find_package(ZLIB REQUIRED) +-find_package(BZip2 REQUIRED) +-find_package(LibLZMA REQUIRED) +-find_package(CURL REQUIRED) + find_package(Catch2 REQUIRED) + find_package(Threads REQUIRED) ++find_package(fmt) + find_library(htslib libhts.a) + find_library(htslib hts) + +@@ -82,11 +78,8 @@ target_link_libraries(REViewer PUBLIC + Core + Metrics + ${STATIC_FLAGS} +- ${htslib} +- ${LIBLZMA_LIBRARIES} +- ${CURL_LIBRARIES} +- ZLIB::ZLIB +- BZip2::BZip2 ++ hts ++ fmt::fmt + Threads::Threads) + + diff --git a/recipes/reviewer/meta.yaml b/recipes/reviewer/meta.yaml new file mode 100644 index 0000000000000..52ae1ed20bb7f --- /dev/null +++ b/recipes/reviewer/meta.yaml @@ -0,0 +1,51 @@ +{% set version = "0.2.7" %} +{% set sha256 = "8411c40028907b0294b1899cd20af6934325796da160511b649044ecf9a5169f" %} + +package: + name: reviewer + version: '{{ version }}' + +source: + url: https://github.com/Illumina/REViewer/archive/refs/tags/v{{ version }}.tar.gz + sha256: '{{ sha256 }}' + patches: + - cpp-fixes.patch + - external-libs.patch + +build: + number: 0 + run_exports: + - {{ pin_compatible('reviewer', max_pin="x.x") }} + ignore_run_exports: + - spdlog # This library is header-only + +requirements: + build: + - {{ compiler('cxx') }} + - make + - cmake + host: + - boost-cpp + - catch2 <3 + - fmt + - htslib + - spdlog + run: + - boost-cpp + +test: + commands: + - REViewer --help + +about: + home: https://github.com/Illumina/REViewer + license: GPL-3.0 + license_family: GPL + license_file: LICENSE.txt + summary: A tool for visualizing alignments of reads in regions containing tandem repeats + +extra: + additional-platforms: + - linux-aarch64 + identifiers: + - doi:10.1186/s13073-022-01085-z diff --git a/recipes/revoluzer/build.sh b/recipes/revoluzer/build.sh new file mode 100644 index 0000000000000..175ed562969c8 --- /dev/null +++ b/recipes/revoluzer/build.sh @@ -0,0 +1,9 @@ +#!/bin/bash +CXXFLAGS="-I${BUILD_PREFIX}/include $CXXFLAGS" + + +cmake -DCMAKE_VERBOSE_MAKEFILE:BOOL=ON -H. -Bbuild -DCMAKE_BUILD_TYPE=Generic -DEXTRA_FLAGS='-march=sandybridge -Ofast' +cmake --build build +mkdir -p $PREFIX/bin +echo "installing: $(find build/src -type f -executable)" +mv $(find build/src -type f -executable) $PREFIX/bin diff --git a/recipes/revoluzer/meta.yaml b/recipes/revoluzer/meta.yaml new file mode 100644 index 0000000000000..cd6b24a8f9070 --- /dev/null +++ b/recipes/revoluzer/meta.yaml @@ -0,0 +1,44 @@ +{% set name = "revoluzer" %} +{% set version = "0.1.6" %} + +package: + name: "{{ name }}" + version: "{{ version }}" + +source: + url: https://gitlab.com/Bernt/{{ name }}/-/archive/{{ version }}/{{ name }}-{{ version }}.tar.gz + sha256: a3c73aa21c1f1d63e40939568bd963690a0df24ccfe7ba6df28ca7ef49dd3b94 + +build: + number: 0 + skip: True # [osx] + run_exports: + - {{ pin_subpackage('revoluzer', max_pin="x") }} + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('cxx') }} + - cmake + - make + - boost-cpp + - glpk + host: + run: + - boost-cpp + - glpk + +test: + commands: + - crex --help + - trex -h + +about: + home: https://gitlab.com/Bernt/revoluzer/ + license: GPL-3.0-or-later + license_file: LICENSE + summary: Genome rearrangement analysis tools + +extra: + recipe-maintainers: + - bernt-matthias diff --git a/recipes/rgi/meta.yaml b/recipes/rgi/meta.yaml index 8bf0c27c66e61..abfe223b51225 100644 --- a/recipes/rgi/meta.yaml +++ b/recipes/rgi/meta.yaml @@ -16,7 +16,7 @@ source: build: noarch: python - number: 0 + number: 1 run_exports: - {{ pin_subpackage(name, max_pin="x.x") }} @@ -50,7 +50,8 @@ requirements: - lxml ==4.6.5 - wget - dask - - pyrodigal >=2.0.0 + # pyrodigal v3 renamed OrfFinder to GeneFinder, please review on future RGI releases + - pyrodigal >=2.0.0,<3 run: # RGI requires these exact versions of blast prodigal and diamond, or else --alignment_mode DIAMOND fails # - python >=3.5,<3.7 @@ -80,7 +81,8 @@ requirements: - lxml ==4.6.5 - wget - dask - - pyrodigal >=2.0.0 + # pyrodigal v3 renamed OrfFinder to GeneFinder, please review on future RGI releases + - pyrodigal >=2.0.0,<3 test: commands: diff --git a/recipes/riassigner/meta.yaml b/recipes/riassigner/meta.yaml index ee61afd653b1c..deaa6d07bf1c6 100644 --- a/recipes/riassigner/meta.yaml +++ b/recipes/riassigner/meta.yaml @@ -1,32 +1,35 @@ -{% set version = "0.3.4" %} +{% set name = "riassigner" %} +{% set version = "0.4.1" %} package: - name: riassigner - version: "{{ version }}" + name: {{ name }} + version: {{ version }} source: - url: "https://github.com/RECETOX/RIAssigner/archive/refs/tags/v{{ version }}.tar.gz" - sha256: 7a8977603e659b76e87a558add2ae7960eb7e352365c289a7a193d4d8f68da3a + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/riassigner-{{ version }}.tar.gz + sha256: 316bc4399f0de586a8ba31e3d38b834307277bf84b7dcc2b51dfe2cead807299 build: noarch: python - preserve_egg_dir: True - number: 4 - script: {{ PYTHON }} -m pip install --no-deps --ignore-installed . -vv + number: 0 + script: {{ PYTHON }} -m pip install --no-deps --no-build-isolation . -vvv + run_exports: + - {{ pin_subpackage('riassigner', max_pin="x.x") }} requirements: host: - - python >=3.7,<3.9 + - python >=3.10,<3.13 - pip - - pytest-runner - - setuptools + - poetry-core run: - - numpy <=1.23 - - matchms >=0.14.0,<0.18.0 - - pint >=0.17,<0.20 + - numpy + - matchms >=0.24.1,<0.25.0 + - pint >=0.23.0,<0.24.0 - pandas - - python >=3.7,<3.9 + - python >=3.10,<3.13 - scipy + - urllib3 1.26.15 + - fastparquet >=2023.10.1,<2024.0.0 test: imports: @@ -35,6 +38,7 @@ test: about: home: https://github.com/RECETOX/RIAssigner license: MIT + license_family: MIT license_file: LICENSE summary: 'GC-MS retention index calculation' description: | diff --git a/recipes/ribotin/build.sh b/recipes/ribotin/build.sh index 3b102e3f455cb..19adc930d88f8 100644 --- a/recipes/ribotin/build.sh +++ b/recipes/ribotin/build.sh @@ -4,6 +4,7 @@ cd $SRC_DIR make all cp bin/ribotin-ref $PREFIX/bin cp bin/ribotin-verkko $PREFIX/bin +cp bin/ribotin-hifiasm $PREFIX/bin mkdir -p $PREFIX/share/${PKG_NAME}-${PKG_VERSION} cp template_seqs/rDNA_one_unit.fasta $PREFIX/share/${PKG_NAME}-${PKG_VERSION}/rDNA_one_unit.fasta diff --git a/recipes/ribotin/makefile.patch b/recipes/ribotin/makefile.patch index c01ea1f0fbf7d..8f9192ef79578 100644 --- a/recipes/ribotin/makefile.patch +++ b/recipes/ribotin/makefile.patch @@ -1,5 +1,5 @@ diff --git a/makefile b/makefile -index 40a23f7..b35510c 100644 +index 5166dd0..83ff306 100644 --- a/makefile +++ b/makefile @@ -15,8 +15,8 @@ OBJ = $(patsubst %, $(ODIR)/%, $(_OBJ)) @@ -13,11 +13,15 @@ index 40a23f7..b35510c 100644 $(shell mkdir -p bin) $(shell mkdir -p obj) -@@ -30,10 +30,10 @@ $(BINDIR)/ribotin-ref: $(OBJ) $(ODIR)/ribotin-ref.o +@@ -33,13 +33,13 @@ $(BINDIR)/ribotin-ref: $(OBJ) $(ODIR)/ribotin-ref.o $(GPP) -o $@ $^ $(LINKFLAGS) $(ODIR)/ribotin-verkko.o: $(SRCDIR)/ribotin-verkko.cpp $(DEPS) $(OBJ) - $(GPP) -c -o $@ $< $(CPPFLAGS) -DVERSION="\"$(VERSION)\"" -DRIBOTIN_TEMPLATE_PATH="\"$(TEMPLATEPATH)\"" ++ $(GPP) -c -o $@ $< $(CPPFLAGS) -DVERSION="\"$(VERSION)\"" -DRIBOTIN_TEMPLATE_PATH="$(TEMPLATEPATH)" + + $(ODIR)/ribotin-hifiasm.o: $(SRCDIR)/ribotin-hifiasm.cpp $(DEPS) $(OBJ) +- $(GPP) -c -o $@ $< $(CPPFLAGS) -DVERSION="\"$(VERSION)\"" -DRIBOTIN_TEMPLATE_PATH="\"$(TEMPLATEPATH)\"" + $(GPP) -c -o $@ $< $(CPPFLAGS) -DVERSION="\"$(VERSION)\"" -DRIBOTIN_TEMPLATE_PATH="$(TEMPLATEPATH)" $(ODIR)/ribotin-ref.o: $(SRCDIR)/ribotin-ref.cpp $(DEPS) $(OBJ) diff --git a/recipes/ribotin/meta.yaml b/recipes/ribotin/meta.yaml index a362932854381..1acdf0e771f91 100644 --- a/recipes/ribotin/meta.yaml +++ b/recipes/ribotin/meta.yaml @@ -1,18 +1,18 @@ {% set name = "ribotin" %} -{% set version = "1.2" %} +{% set version = "1.3" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://github.com/maickrau/{{ name }}/files/13435950/{{ name }}.tar.gz - sha256: 88d7be40dc641b96ef6f36cd2e464e8d65395ab50158efa1d2d49203b42ffa79 + url: https://github.com/maickrau/{{ name }}/files/14571457/{{ name }}.tar.gz + sha256: 7eda750e4fd1064eedf3016f5a49d6b6994e336619fc3b5e4afe4655b2873b70 patches: - makefile.patch build: - number: 1 + number: 0 skip: True # [osx] run_exports: - {{ pin_subpackage('ribotin', max_pin="x.x") }} diff --git a/recipes/ribotools/meta.yaml b/recipes/ribotools/meta.yaml new file mode 100644 index 0000000000000..c1f71e3bceeb1 --- /dev/null +++ b/recipes/ribotools/meta.yaml @@ -0,0 +1,73 @@ +{% set name = "ribotools" %} +{% set version = "1.0.4" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/ribotools-{{ version }}.tar.gz + sha256: b40767cc80894566708025d5223c2c0dff475ef7d9a4332dc852b4c04388fea4 + +build: + script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vvv" + noarch: python + number: 0 + entry_points: + - get-all-bam-periodic = ribotools.pgrms.get_all_bam_periodic:main + - get-gtf-from-predictions = ribotools.pgrms.get_gtf_from_predictions:main + - run-htseq-workflow = ribotools.htseq_wf.run_htseq_workflow:main + - alignment-workflow = ribotools.htseq_wf.alignment_workflow:main + - get-ribo-periodic = ribotools.htseq_wf.get_ribo_periodic:main + - keep-ribo-periodic = ribotools.htseq_wf.keep_ribo_periodic:main + - call-htseq-count = ribotools.htseq_wf.call_htseq_count:main + - get-sample-table = ribotools.scripts.__main__:get_sample_table + - run-tea = ribotools.scripts.__main__:run_tea + - run-dea = ribotools.scripts.__main__:run_dea + run_exports: + - {{ pin_subpackage('ribotools', max_pin='x') }} + +requirements: + host: + - python >=3.7,<3.11 + - pip + run: + - python >=3.7,<3.11 + - rpbp >=3.0.1 + - htseq >=2.0.2 + - r-base >=4.2.3 + - r-r.utils + - r-devtools + - r-tidyverse + - r-openxlsx + - r-yaml + - r-ashr + - bioconductor-ihw + - bioconductor-apeglm + - bioconductor-deseq2 + +test: + imports: + - ribotools + - ribotools.utils + - ribotools.htseq_wf + - ribotools.pgrms + commands: + - get-all-bam-periodic --help + - get-gtf-from-predictions --help + - run-htseq-workflow --help + - alignment-workflow --help + - get-ribo-periodic --help + - keep-ribo-periodic --help + - call-htseq-count --help + +about: + home: https://github.com/eboileau/ribotools + summary: Ribo-seq analysis tools associated with the Rp-Bp package and more + doc_url: https://ribotools.readthedocs.io/en/latest/ + license: MIT + license_file: LICENSE + +extra: + recipe-maintainers: + - eboileau diff --git a/recipes/ribotricer/meta.yaml b/recipes/ribotricer/meta.yaml index 5c4100c7a633f..d3195bd2c29fe 100644 --- a/recipes/ribotricer/meta.yaml +++ b/recipes/ribotricer/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ribotricer" %} -{% set version = "1.3.3" %} +{% set version = "1.4.0" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 0724fd0acea601a15078e8e3b51e2df5f6b735c276dd978b139619a159f51f75 + sha256: f0f612796f65460f58639cafe297afb1350d6fe7f50d06ea38f372447bdbc63b build: number: 0 @@ -15,6 +15,9 @@ build: entry_points: - ribotricer=ribotricer.cli:cli script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv " + run_exports: + - {{ pin_subpackage('ribotricer', max_pin="x.x") }} + requirements: host: diff --git a/recipes/ostir/LICENSE b/recipes/ripcal/LICENSE similarity index 99% rename from recipes/ostir/LICENSE rename to recipes/ripcal/LICENSE index 02fefceb563f1..f288702d2fa16 100644 --- a/recipes/ostir/LICENSE +++ b/recipes/ripcal/LICENSE @@ -631,8 +631,8 @@ to attach them to the start of each source file to most effectively state the exclusion of warranty; and each file should have at least the "copyright" line and a pointer to where the full notice is found. - OSTIR: Open Source Translation Initiation Rates - Copyright (C) 2021 Cameron Roots, Jeffrey Barrick + + Copyright (C) This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by diff --git a/recipes/ripcal/build.sh b/recipes/ripcal/build.sh new file mode 100644 index 0000000000000..b1d42ef3349f2 --- /dev/null +++ b/recipes/ripcal/build.sh @@ -0,0 +1,26 @@ +#!/bin/bash + +export LANGUAGE=en_US.UTF-8 +export LC_ALL=en_US.UTF-8 + +# Creating necessary directories +mkdir -p "${PREFIX}/bin" + +# Copying executable files to bin directory +cp "${SRC_DIR}/perl/"* "${PREFIX}/bin/" + +# Fixing permissions +chmod +x "${PREFIX}/bin/deripcal" +chmod +x "${PREFIX}/bin/ripcal" +chmod +x "${PREFIX}/bin/ripcal_summarise" + +sed -i "s:/usr/bin/perl:/usr/bin/env perl:" "${PREFIX}/bin/ripcal" +sed -i "s/use Bio::Perl;/use BioPerl;/" "${PREFIX}/bin/ripcal" + +sed -i "s:/usr/bin/perl:/usr/bin/env perl:" "${PREFIX}/bin/deripcal" +sed -i "s:/usr/bin/perl:/usr/bin/env perl:" "${PREFIX}/bin/ripcal_summarise" + +export "PERL5LIB=${PREFIX}/lib/perl5/site_perl/5.32.1/:${PERL5LIB}" + +sed -i.bak '/^use Tk/ s/^/# /' "${PREFIX}/bin/ripcal" + diff --git a/recipes/ripcal/meta.yaml b/recipes/ripcal/meta.yaml new file mode 100644 index 0000000000000..47583a3f8627d --- /dev/null +++ b/recipes/ripcal/meta.yaml @@ -0,0 +1,45 @@ +{% set name = "ripcal" %} +{% set version = "2.0" %} +{% set sha256 = "6f18af1c6fedde17430e023e3a5c1ab56f14910694d83ba90ee738d8d48188bd" %} + +package: + name: '{{ name }}' + version: '{{ version }}' + +source: + url: "https://sourceforge.net/projects/ripcal/files/RIPCAL/RIPCAL_{{ version }}/{{ name }}2_install.zip" + sha256: '{{ sha256 }}' + +build: + number: 0 + noarch: generic + run_exports: + - {{ pin_subpackage('ripcal', max_pin="x") }} + +requirements: + run: + - perl >=5.32.1 + - perl-math-round + - perl-bioperl >=1.7.2 + - perl-bioperl-core >=1.7.2 + - perl-getopt-long + - perl-mime-base64 + - perl-gd + +test: + commands: + - 'ripcal --help' + - 'deripcal --help' + +about: + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE + summary: 'RIPCAL is used for the bioinformatic analysis of repeat-induced point mutation (RIP) in fungal genome sequences' + home: https://sourceforge.net/projects/ripcal + +extra: + identifiers: + - https://doi.org/10.1186/1471-2105-9-478 + recipe-maintainers: + - KristinaGagalova diff --git a/recipes/rmats/meta.yaml b/recipes/rmats/meta.yaml index fb7233b0e8977..7e19cc620dc0d 100644 --- a/recipes/rmats/meta.yaml +++ b/recipes/rmats/meta.yaml @@ -1,12 +1,12 @@ {% set name = "rmats" %} -{% set version = "4.2.0" %} +{% set version = "4.3.0" %} package: name: {{ name }} version: {{ version }} source: - sha256: 7d5b56623e684c460a33b1709e0e2dc3ad13288d7db2be6c55c61f4fef880444 + sha256: c78e6411b7c6634cc31511b69d37a6a3da2e2e076e87609679818debd513aa7a url: https://github.com/Xinglab/rmats-turbo/releases/download/v{{ version }}/rmats_turbo_v{{ version|replace(".","_") }}.tar.gz build: diff --git a/recipes/rnachipintegrator/meta.yaml b/recipes/rnachipintegrator/meta.yaml index b6907f8bef2de..4c0073646a6dc 100644 --- a/recipes/rnachipintegrator/meta.yaml +++ b/recipes/rnachipintegrator/meta.yaml @@ -1,5 +1,5 @@ {% set name = "rnachipintegrator" %} -{% set version = "2.0.0" %} +{% set version = "3.0.0" %} package: name: '{{ name|lower }}' @@ -7,14 +7,16 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/RnaChipIntegrator-{{ version }}.tar.gz - sha256: 97adf6e8a71bfdef7661472540d661f0965ed6c2140f1d268f57a5e5bbd873b0 + sha256: bdb5cd278a2d93bc7c0e3a7980609db5f24ffa0199b8857818ec8481c59ea0ed build: - number: 1 + number: 0 entry_points: - RnaChipIntegrator = rnachipintegrator.cli:main script: python -m pip install --no-deps --ignore-installed . noarch: python + run_exports: + - {{ pin_subpackage('rnachipintegrator', max_pin="x") }} requirements: host: diff --git a/recipes/rnamining/meta.yaml b/recipes/rnamining/meta.yaml new file mode 100644 index 0000000000000..75d6dbef536c0 --- /dev/null +++ b/recipes/rnamining/meta.yaml @@ -0,0 +1,47 @@ +{% set name = "rnamining" %} +{% set version = "1.0.4" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/rnamining-{{ version }}.tar.gz + sha256: 03339dd81c1b163b966006559b50fbdca21481d3d82b14f52849b331d105012f + +build: + entry_points: + - rnamining = rnamining.rnamining:main + noarch: python + script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv " + number: 0 + run_exports: + - {{ pin_subpackage('rnamining',max_pin="x") }} + +requirements: + host: + - python >=3.8 + - pip + run: + - python >=3.8 + - scipy + - biopython >=1.78 + - scikit-learn >=0.21.3 + - pandas >=0.23.3 + - xgboost ==1.2.0 + +test: + imports: + - rnamining + commands: + - rnamining -h + +about: + home: https://github.com/lfreitasl/RNAmining/tree/pypackage + summary: Package to predict potential coding of RNA sequences provided in fasta format + license: MIT + license_file: LICENSE + +extra: + recipe-maintainers: + - lfreitasl diff --git a/recipes/rnanorm/meta.yaml b/recipes/rnanorm/meta.yaml new file mode 100644 index 0000000000000..ee38e16598b55 --- /dev/null +++ b/recipes/rnanorm/meta.yaml @@ -0,0 +1,52 @@ +{% set name = "rnanorm" %} +{% set version = "2.1.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/rnanorm-{{ version }}.tar.gz + sha256: 651bce77059548b907a4719615646898b6b51fe6915ba713686d2e6aa42d687f + +build: + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} + entry_points: + - rnanorm = rnanorm.cli:main + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + +requirements: + host: + - python >=3.8,<3.13 + - setuptools >=64.0.0 + - setuptools-scm >=6.4.0 + - pip + run: + - python >=3.8,<3.13 + - click + - numpy >=1.0.0 + - pandas >=1.0.0 + - scikit-learn >=1.0.0 + - pandera + +test: + imports: + - rnanorm + commands: + - pip check + - rnanorm --help + requires: + - pip + +about: + summary: Common RNA-seq normalization methods + license: Apache-2.0 + license_file: LICENSE + home: https://github.com/genialis/RNAnorm + +extra: + recipe-maintainers: + - VinzentRisch diff --git a/recipes/rnastructure/meta.yaml b/recipes/rnastructure/meta.yaml index d994092a66833..10976d6e6a4e0 100644 --- a/recipes/rnastructure/meta.yaml +++ b/recipes/rnastructure/meta.yaml @@ -1,13 +1,19 @@ +{% set name = "RNAstructure" %} +{% set version = "6.4" %} +{% set sha256 = "e2a372a739153293185eeffee3d3265f9f50dc6976053a1d013ccf086b06d975" %} + package: - name: rnastructure - version: '6.3' + name: {{ name | lower }} + version: {{ version }} source: - sha256: e922591ceaa99e0db8ab4572a8716ff625fc0109906650415e92d099d927b310 - url: http://rna.urmc.rochester.edu/Releases/6.3/RNAstructureSource.tgz + sha256: {{ sha256 }} + url: http://rna.urmc.rochester.edu/Releases/{{ version }}/RNAstructureSource.tgz build: - number: 3 + number: 0 + run_exports: + - {{ pin_subpackage(name | lower, max_pin="x.x") }} requirements: build: diff --git a/recipes/robust-bias-aware/meta.yaml b/recipes/robust-bias-aware/meta.yaml new file mode 100644 index 0000000000000..acc4799297c89 --- /dev/null +++ b/recipes/robust-bias-aware/meta.yaml @@ -0,0 +1,49 @@ +{% set name = "robust-bias-aware" %} +{% set version = "0.0.1" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: "https://github.com/lspindler2509/robust_bias_aware_pip_package/archive/refs/tags/v{{ version }}-xi.tar.gz" + sha256: 182c413b2f39b34d89fec657afdcf350a1c1a7b9f75b799746a3c0a18ce40744 + +build: + number: 1 + script: + - "{{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation" + - mkdir -p $PREFIX/site-packages + - cp -r $SRC_DIR/robust_bias_aware/* $PREFIX/site-packages + noarch: python + run_exports: + - {{ pin_subpackage('robust-bias-aware', max_pin="x.x") }} + +requirements: + build: + - python + - setuptools + host: + - pip >=3.7 + - python + + run: + - numpy >=1.26.4 + - matplotlib-base >=3.2.2 + - pandas >=1.3.5 + - networkx >=2.6.3 + - pcst-fast + - python >=3.7 + + +test: + commands: + - robust-bias-aware --help + + +about: + home: https://github.com/bionetslab/robust_bias_aware_pip_package + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE + summary: "Robust bias aware." diff --git a/recipes/rrikindp/build.sh b/recipes/rrikindp/build.sh new file mode 100644 index 0000000000000..f76fe49b36083 --- /dev/null +++ b/recipes/rrikindp/build.sh @@ -0,0 +1,8 @@ +#!/bin/sh + +$PYTHON -m pip install . --no-deps --ignore-installed -vv + +cd src/rrikindp + +make -j ${CPU_COUNT} CXXFLAGS+="-I${CONDA_PREFIX}/include" +install RRIkinDP "${PREFIX}/bin" diff --git a/recipes/rrikindp/meta.yaml b/recipes/rrikindp/meta.yaml new file mode 100644 index 0000000000000..3e89245d087da --- /dev/null +++ b/recipes/rrikindp/meta.yaml @@ -0,0 +1,66 @@ + +{% set name = "RRIkinDP" %} +{% set version = "0.0.2" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/mwaldl/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: 3bdaa7657224b90945d864d0238010cf3337975f58c41106ab60427dd52bc93f + +build: + number: 0 + run_exports: + - {{ pin_subpackage('rrikindp', max_pin="x.x,x") }} + +requirements: + build: + - python + - pip + - make + - pybind11 + - {{ compiler('cxx') }} + host: + - pybind11 + - python + - boost-cpp + - viennarna >=2.6.0 + - intarna + - llvm-openmp + run: + - boost-cpp + - llvm-openmp + - python >=3.6 + - intarna + - viennarna >=2.6.0 + - matplotlib-base >=3.7.0 + - seaborn >=0.12.0 + - pandas >=2.0.0 + +test: + commands: + - RRIkinDP --version + imports: + - rrikindp + +about: + home: "https://github.com/mwaldl/RRIkinDP" + license: "GPL-3.0-only" + license_family: GPL + license_file: COPYING + summary: 'Evaluation of thermodynamic and kinetic features of RNA-RNA interactions.' + description: | + RRIkinDP evaluated thermodynamic and kinetic features of RNA-RNA interactions. As input, two RNA + sequences as well as their interaction structure is provided. The tool generates the state space of + all intermediate interactions from single base pair interactions to the full input interaction. + On top of this state space it computes the barrier energy for the best direct path from a given + start interaction to the full input interaction. + doc_url: https://doi.org/10.1101/2023.07.28.548983 + dev_url: https://github.com/mwaldl/RRIkinDP + +extra: + recipe-maintainers: + - mwaldl + - s-will diff --git a/recipes/rsv-typer/meta.yaml b/recipes/rsv-typer/meta.yaml index a022aa258f893..454e207a3ea42 100644 --- a/recipes/rsv-typer/meta.yaml +++ b/recipes/rsv-typer/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.2.0" %} +{% set version = "0.3.0" %} package: name: rsv-typer @@ -6,14 +6,16 @@ package: source: url: https://github.com/DiltheyLab/RSVTyper/archive/refs/tags/v{{ version }}.tar.gz - sha256: ca302df7eb22f4d8cb0e5e6b9eb78b0e236714f95ab136c35d2afd05552d1229 + sha256: d91607ebe37c305fb3aba4871161d51c6fa2bd7aa43d5d6defcca8d9def74431 build: - number: 0 + number: 1 noarch: python script: python -m pip install . entry_points: - rsv-typer = rsv_typer.process_RSV_sample:main + run_exports: + - {{ pin_subpackage("rsv-typer", max_pin="x.x") }} requirements: host: - python @@ -25,6 +27,8 @@ requirements: - minimap2 >=2.17 - muscle =3.8 - pyvcf =0.6.8=py36h9f0ad1d_1002 + - absl-py =1.4.0 + - longshot =0.4.5 test: commands: - rsv-typer -h diff --git a/recipes/rtk2/build.sh b/recipes/rtk2/build.sh new file mode 100644 index 0000000000000..0b901b830f550 --- /dev/null +++ b/recipes/rtk2/build.sh @@ -0,0 +1,16 @@ +#!/bin/bash +set -euxo pipefail + +mkdir -p "$PREFIX"/bin + +echo "Setting environment variables" +# Fix zlib +export CFLAGS="$CFLAGS -O3 -I$PREFIX/include" +export LDFLAGS="$LDFLAGS -L$PREFIX/lib" +export C_INCLUDE_PATH=${PREFIX}/include + +echo "RUN MAKE" +make test + +chmod 755 rtk2 +mv rtk2 "$PREFIX"/bin/ diff --git a/recipes/rtk2/meta.yaml b/recipes/rtk2/meta.yaml new file mode 100644 index 0000000000000..89654d1a8e8b7 --- /dev/null +++ b/recipes/rtk2/meta.yaml @@ -0,0 +1,35 @@ +{% set version = "2.11.1" %} +{% set name = "rtk2" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/hildebra/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: d816684a1a04f2a48ec2cf605ed33dc938baae01d509ed01e9d84565d54259cc + +build: + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} + +requirements: + build: + - make + - {{ compiler('cxx') }} + host: + - zlib + +test: + commands: + - '{{ name }} -h' + #- '{{ name }} --version | grep -w "{{ version }}"' + +about: + home: https://github.com/hildebra/rtk2/ + license: 'GPL-2.0-or-later' + license_family: GPL + license_file: LICENSE + summary: 'rtk2 - a CLI rarefaction toolkit for OTU tables' + dev_url: https://github.com/hildebra/rtk2/ diff --git a/recipes/rust-bio-tools/build.sh b/recipes/rust-bio-tools/build.sh index 403679dd60ea7..c5cc18c7f9bc5 100644 --- a/recipes/rust-bio-tools/build.sh +++ b/recipes/rust-bio-tools/build.sh @@ -1,11 +1,6 @@ #!/bin/bash -e -# TODO: Remove the following export when pinning is updated and we use -# {{ compiler('rust') }} in the recipe. -export \ - CARGO_NET_GIT_FETCH_WITH_CLI=true \ - CARGO_HOME="${BUILD_PREFIX}/.cargo" - export BINDGEN_EXTRA_CLANG_ARGS="${CFLAGS} ${CPPFLAGS} ${LDFLAGS}" +RUST_BACKTRACE=1 cargo install --no-track --verbose --root "${PREFIX}" --path . diff --git a/recipes/rust-bio-tools/build_failure.linux-64.yaml b/recipes/rust-bio-tools/build_failure.linux-64.yaml deleted file mode 100644 index 26ac40babfcbc..0000000000000 --- a/recipes/rust-bio-tools/build_failure.linux-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: 37fa4d78a2ee8b18065a0bd0f594ad1e9587bb4ac7edf1b4629a9f10fa45d0a5 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |2- - Compiling linear-map v1.2.0 - Running rustc --crate-name linear_map /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/linear-map-1.2.0/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no -C metadata=49dea80bcdb65bf0 -C extra-filename=-49dea80bcdb65bf0 --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --cap-lints allow - Compiling ieee754 v0.2.6 - Running rustc --crate-name ieee754 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/ieee754-0.2.6/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no -C metadata=3d851bc61679c0fc -C extra-filename=-3d851bc61679c0fc --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --cap-lints allow - Compiling strum v0.23.0 - Running rustc --crate-name strum --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/strum-0.23.0/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="default"' --cfg 'feature="std"' -C metadata=bd8b155d4a3212cb -C extra-filename=-bd8b155d4a3212cb --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --cap-lints allow - Compiling bio v0.39.2 - Running rustc --crate-name bio --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/bio-0.39.2/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no -C metadata=bfcb0c8ea87843f8 -C extra-filename=-bfcb0c8ea87843f8 --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern anyhow=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libanyhow-8a64e709a9ea7090.rmeta --extern approx=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libapprox-796d96a1d4a24564.rmeta --extern bio_types=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libbio_types-8f2580fc26dc2a4c.rmeta --extern bit_set=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libbit_set-5f69a9e374261aee.rmeta --extern bv=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libbv-c65acac672bf1382.rmeta --extern bytecount=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libbytecount-49ce67f909ab9836.rmeta --extern csv=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libcsv-0a2495576c650dd0.rmeta --extern custom_derive=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libcustom_derive-a31ad87d2c35141e.rmeta --extern enum_map=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libenum_map-e623b86d6eda7738.rmeta --extern fxhash=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libfxhash-b9c70ea26a93b20f.rmeta --extern getset=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libgetset-4a8df41f803195c1.so --extern itertools=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libitertools-f77dc74df281f0e9.rmeta --extern itertools_num=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libitertools_num-2f4a9790e16745e6.rmeta --extern lazy_static=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblazy_static-aef73a8347dc17b1.rmeta --extern multimap=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libmultimap-b0e538eda3526cdf.rmeta --extern ndarray=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libndarray-ef7993ff5859fb97.rmeta --extern newtype_derive=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libnewtype_derive-a5908103a51871d4.rmeta --extern num_integer=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libnum_integer-b03516cba3dc07e2.rmeta --extern num_traits=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libnum_traits-d20b06288d507dcf.rmeta --extern ordered_float=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libordered_float-a04622cb02bc5a6f.rmeta --extern petgraph=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libpetgraph-f249a594137b7f6e.rmeta --extern rand=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/librand-776acd9a3185d913.rmeta --extern regex=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libregex-88299f7761f9c60d.rmeta --extern serde=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libserde-7d6c4f20cee1b377.rmeta --extern serde_derive=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libserde_derive-c1fd716d558cc7fa.so --extern statrs=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libstatrs-9170518eab8196ec.rmeta --extern strum=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libstrum-bd8b155d4a3212cb.rmeta --extern strum_macros=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libstrum_macros-5d4b4ce44430108b.so --extern thiserror=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libthiserror-1d405cc10f35d668.rmeta --extern triple_accel=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libtriple_accel-744d8b0eeecdf446.rmeta --extern vec_map=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libvec_map-daef5ce73b6a7510.rmeta --cap-lints allow - Compiling tempfile v3.5.0 - Running rustc --crate-name tempfile --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/tempfile-3.5.0/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no -C metadata=984bbc1631ac0d4a -C extra-filename=-984bbc1631ac0d4a --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern cfg_if=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libcfg_if-1cc625933ee68d00.rmeta --extern fastrand=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libfastrand-ee1f69f245bfe81a.rmeta --extern rustix=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/librustix-e70d1125d1402ad4.rmeta --cap-lints allow - Running rustc --crate-name rgsl /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/GSL-1.1.0/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type dylib --crate-type rlib --emit=dep-info,link -C prefer-dynamic -C opt-level=3 -C embed-bitcode=no --cfg 'feature="v2"' -C metadata=f9a0167cc0ea59a9 -C extra-filename=-f9a0167cc0ea59a9 --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern c_vec=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libc_vec-d24918881fb43fb1.so --extern c_vec=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libc_vec-d24918881fb43fb1.rlib --extern libc=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblibc-0731363918231ed5.rlib --cap-lints allow -L native=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_h_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehol/lib -l gsl -l gslcblas -l m -l cblas -l m --cfg 'feature="v2"' - Compiling reqwest v0.9.24 - Running rustc --crate-name reqwest /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/reqwest-0.9.24/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="default"' --cfg 'feature="default-tls"' --cfg 'feature="hyper-tls"' --cfg 'feature="native-tls"' --cfg 'feature="tls"' -C metadata=e5874b3f83f03ba1 -C extra-filename=-e5874b3f83f03ba1 --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern base64=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libbase64-a19d784f86588919.rmeta --extern bytes=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libbytes-3e7ae724b77406fb.rmeta --extern cookie=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libcookie-58754e0f73623939.rmeta --extern cookie_store=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libcookie_store-a04b026bdb49d687.rmeta --extern encoding_rs=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libencoding_rs-7b87e74193d0c407.rmeta --extern flate2=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libflate2-70dc71a48c006913.rmeta --extern futures=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libfutures-82cdf9f97ecdab5c.rmeta --extern http=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libhttp-7f8b83c7faa5bad9.rmeta --extern hyper=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libhyper-7943bea2a0ceffab.rmeta --extern hyper_tls=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libhyper_tls-7f8fbc2858a55a76.rmeta --extern log=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblog-6684351ec618d44f.rmeta --extern mime=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libmime-a05a37379b161b05.rmeta --extern mime_guess=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libmime_guess-1b2487e823506fa3.rmeta --extern native_tls=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libnative_tls-e50dec9310c1d4f2.rmeta --extern serde=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libserde-7d6c4f20cee1b377.rmeta --extern serde_json=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libserde_json-89fb4aba726d8fd2.rmeta --extern serde_urlencoded=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libserde_urlencoded-34e063fcff545fb3.rmeta --extern time=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libtime-14a856f0f5513dee.rmeta --extern tokio=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libtokio-7cf2810afdd496d2.rmeta --extern tokio_executor=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libtokio_executor-99a3d933a3bde1bc.rmeta --extern tokio_io=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libtokio_io-7dc5a2eeaf6caba3.rmeta --extern tokio_threadpool=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libtokio_threadpool-2737f5c5fb2b0b23.rmeta --extern tokio_timer=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libtokio_timer-18df72f395af0a55.rmeta --extern url=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liburl-796aa9590a4d4722.rmeta --extern uuid=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libuuid-4f90eabc1e5c34d1.rmeta --cap-lints allow -L native=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/build/openssl-sys-ee91e98132c0c133/out/openssl-build/install/lib - Compiling tera v1.18.1 - Running rustc --crate-name tera --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/tera-1.18.1/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="builtins"' --cfg 'feature="chrono"' --cfg 'feature="chrono-tz"' --cfg 'feature="default"' --cfg 'feature="humansize"' --cfg 'feature="percent-encoding"' --cfg 'feature="rand"' --cfg 'feature="slug"' --cfg 'feature="urlencode"' -C metadata=966d160b89ea163c -C extra-filename=-966d160b89ea163c --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern chrono=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libchrono-89a888186eb22b5d.rmeta --extern chrono_tz=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libchrono_tz-b753c3237e3c7fbf.rmeta --extern globwalk=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libglobwalk-61174e9b3ae5e9d7.rmeta --extern humansize=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libhumansize-be7ba658b667f616.rmeta --extern lazy_static=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblazy_static-aef73a8347dc17b1.rmeta --extern percent_encoding=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libpercent_encoding-72cf279d7fef5fd6.rmeta --extern pest=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libpest-438ddbb2964fe264.rmeta --extern pest_derive=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libpest_derive-34cee7d48c31178c.so --extern rand=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/librand-776acd9a3185d913.rmeta --extern regex=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libregex-88299f7761f9c60d.rmeta --extern serde=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libserde-7d6c4f20cee1b377.rmeta --extern serde_json=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libserde_json-89fb4aba726d8fd2.rmeta --extern slug=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libslug-76fec5f36d416b3e.rmeta --extern thread_local=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libthread_local-b464f97d53aac3cd.rmeta --extern unic_segment=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libunic_segment-99bae7b6ba5ce771.rmeta --cap-lints allow - Compiling indicatif v0.11.0 - Running rustc --crate-name indicatif /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/indicatif-0.11.0/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no -C metadata=06ccea25cd3ff8c1 -C extra-filename=-06ccea25cd3ff8c1 --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern console=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libconsole-1d6c5204c86792bd.rmeta --extern lazy_static=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblazy_static-aef73a8347dc17b1.rmeta --extern number_prefix=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libnumber_prefix-539ed0474b8cb3ca.rmeta --extern parking_lot=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libparking_lot-1cf157db8cfd6e1c.rmeta --extern regex=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libregex-88299f7761f9c60d.rmeta --cap-lints allow - Compiling ordered-float v0.5.2 - Running rustc --crate-name ordered_float /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/ordered-float-0.5.2/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no -C metadata=1ebef4224276407e -C extra-filename=-1ebef4224276407e --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern num_traits=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libnum_traits-6aa76da748f47036.rmeta --extern unreachable=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libunreachable-94a8b606b3e4d516.rmeta --cap-lints allow - Compiling structopt v0.3.26 - Running rustc --crate-name structopt --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/structopt-0.3.26/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="default"' -C metadata=1710fde95804ad58 -C extra-filename=-1710fde95804ad58 --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern clap=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libclap-3d4bf005a1c7cfcf.rmeta --extern lazy_static=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblazy_static-aef73a8347dc17b1.rmeta --extern structopt_derive=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libstructopt_derive-f7376ff427964336.so --cap-lints allow - Compiling rand v0.7.3 - Running rustc --crate-name rand --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/rand-0.7.3/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="alloc"' --cfg 'feature="default"' --cfg 'feature="getrandom"' --cfg 'feature="getrandom_package"' --cfg 'feature="libc"' --cfg 'feature="std"' -C metadata=3fa9641229006373 -C extra-filename=-3fa9641229006373 --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern getrandom_package=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libgetrandom-1fcfb9b16db7f095.rmeta --extern libc=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblibc-0731363918231ed5.rmeta --extern rand_chacha=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/librand_chacha-cc23ecaa15cfa639.rmeta --extern rand_core=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/librand_core-a96d615a8c0dca75.rmeta --cap-lints allow - Compiling rayon v1.7.0 - Running rustc --crate-name rayon --edition=2021 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/rayon-1.7.0/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no -C metadata=fa12cbfdd336486c -C extra-filename=-fa12cbfdd336486c --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern either=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libeither-22dbb8c1509ff59b.rmeta --extern rayon_core=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/librayon_core-f52a9815ab27f729.rmeta --cap-lints allow - Compiling fern v0.5.9 - Running rustc --crate-name fern --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/fern-0.5.9/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no -C metadata=b34cbfb0b0bdbf78 -C extra-filename=-b34cbfb0b0bdbf78 --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern chrono=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libchrono-89a888186eb22b5d.rmeta --extern log=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblog-6684351ec618d44f.rmeta --cap-lints allow - Compiling jsonm v0.1.4 - Running rustc --crate-name jsonm /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/jsonm-0.1.4/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no -C metadata=b04562a7e837d49d -C extra-filename=-b04562a7e837d49d --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern regex=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libregex-88299f7761f9c60d.rmeta --extern serde=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libserde-7d6c4f20cee1b377.rmeta --extern serde_json=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libserde_json-89fb4aba726d8fd2.rmeta --cap-lints allow - Compiling itertools v0.9.0 - Running rustc --crate-name itertools --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/itertools-0.9.0/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="default"' --cfg 'feature="use_std"' -C metadata=98d11c369e8eac7e -C extra-filename=-98d11c369e8eac7e --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern either=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libeither-22dbb8c1509ff59b.rmeta --cap-lints allow - Compiling streaming-stats v0.2.3 - Running rustc --crate-name stats /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/streaming-stats-0.2.3/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no -C metadata=841e89977bc962ef -C extra-filename=-841e89977bc962ef --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern num_traits=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libnum_traits-d20b06288d507dcf.rmeta --cap-lints allow - Compiling approx v0.4.0 - Running rustc --crate-name approx /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/approx-0.4.0/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="default"' --cfg 'feature="std"' -C metadata=cb99626e744706fd -C extra-filename=-cb99626e744706fd --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern num_traits=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libnum_traits-d20b06288d507dcf.rmeta --cap-lints allow - Compiling rustc-serialize v0.3.24 - Running rustc --crate-name rustc_serialize /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/rustc-serialize-0.3.24/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no -C metadata=04bf5da549563244 -C extra-filename=-04bf5da549563244 --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --cap-lints allow - Compiling lz-str v0.1.0 - Running rustc --crate-name lz_str --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/lz-str-0.1.0/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type cdylib --crate-type rlib --emit=dep-info,link -C opt-level=3 -C embed-bitcode=no -C metadata=fa57445c11776e7e -C extra-filename=-fa57445c11776e7e --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --cap-lints allow - Running rustc --crate-name bzip2_sys /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/bzip2-sys-0.1.111.0.8/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="static"' -C metadata=36eb47ca640e666e -C extra-filename=-36eb47ca640e666e --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern libc=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblibc-0731363918231ed5.rmeta --cap-lints allow -L native=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/build/bzip2-sys-c7eb3073c8ac667e/out/lib -l static=bz2 - Running rustc --crate-name zstd_sys --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/zstd-sys-2.0.8zstd.1.5.5/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="default"' --cfg 'feature="legacy"' --cfg 'feature="zdict_builder"' -C metadata=0384f761716dfc01 -C extra-filename=-0384f761716dfc01 --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern libc=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblibc-0731363918231ed5.rmeta --cap-lints allow -L native=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/build/zstd-sys-ea5ebf1b5416cf7d/out -l static=zstd - Running /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/build/librocksdb-sys-f2c64cbc0e46c402/build-script-build - Running rustc --crate-name curl_sys --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/curl-sys-0.4.62curl-8.1.0/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="default"' --cfg 'feature="openssl-sys"' --cfg 'feature="protocol-ftp"' --cfg 'feature="ssl"' --cfg 'feature="static-curl"' --cfg 'feature="static-ssl"' -C metadata=1c22fe32ec4c58ae -C extra-filename=-1c22fe32ec4c58ae --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern libc=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblibc-0731363918231ed5.rmeta --extern libz_sys=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblibz_sys-f37bec32b21ef27e.rmeta --extern openssl_sys=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/libopenssl_sys-e014ce30be3b6ca5.rmeta --cap-lints allow -L native=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/build/curl-sys-1684153d67f93086/out/build -l static=curl -L native=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/build/libz-sys-5d58d7855283952d/out/lib -L native=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/build/openssl-sys-ee91e98132c0c133/out/openssl-build/install/lib --cfg libcurl_vendored --cfg link_libz --cfg link_openssl - Running rustc --crate-name libxlsxwriter_sys --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/libxlsxwriter-sys-1.1.5/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="no-md5"' --cfg 'feature="use-openssl-md5"' -C metadata=4957ba847f8189c2 -C extra-filename=-4957ba847f8189c2 --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --cap-lints allow -L native=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/build/libxlsxwriter-sys-f910310a21b7ae2e/out -l static=xlsxwriter - Compiling xlsxwriter v0.3.5 - Running rustc --crate-name xlsxwriter --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/xlsxwriter-0.3.5/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="no-md5"' --cfg 'feature="use-openssl-md5"' -C metadata=cb61c42d9cf38f2c -C extra-filename=-cb61c42d9cf38f2c --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern libxlsxwriter_sys=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblibxlsxwriter_sys-4957ba847f8189c2.rmeta --cap-lints allow -L native=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/build/libxlsxwriter-sys-f910310a21b7ae2e/out - error[E0412]: cannot find type size_t in crate libxlsxwriter_sys - --> /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/xlsxwriter-0.3.5/src/worksheet.rs:1126:52 - | - 1126 | buffer.len() as libxlsxwriter_sys::size_t, - | ^^^^^^ help: a type alias with a similar name exists: time_t - | - ::: /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/build/libxlsxwriter-sys-f910310a21b7ae2e/out/bindings.rs:398:1 - | - 398 | pub type time_t = __time_t; - | --------------- similarly named type alias time_t defined here - - error[E0412]: cannot find type size_t in crate libxlsxwriter_sys - --> /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/xlsxwriter-0.3.5/src/worksheet.rs:1150:52 - | - 1150 | buffer.len() as libxlsxwriter_sys::size_t, - | ^^^^^^ help: a type alias with a similar name exists: time_t - | - ::: /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/build/libxlsxwriter-sys-f910310a21b7ae2e/out/bindings.rs:398:1 - | - 398 | pub type time_t = __time_t; - | --------------- similarly named type alias time_t defined here - - error[E0063]: missing fields output_buffer and output_buffer_size in initializer of lxw_workbook_options - --> /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/xlsxwriter-0.3.5/src/workbook.rs:90:40 - | - 90 | let mut workbook_options = libxlsxwriter_sys::lxw_workbook_options { - | ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ missing output_buffer and output_buffer_size - - Some errors have detailed explanations: E0063, E0412. - For more information about an error, try rustc --explain E0063. - error: could not compile xlsxwriter due to 3 previous errors - - Caused by: - process didn't exit successfully: rustc --crate-name xlsxwriter --edition=2018 /opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/xlsxwriter-0.3.5/src/lib.rs --error-format=json --json=diagnostic-rendered-ansi,artifacts,future-incompat --crate-type lib --emit=dep-info,metadata,link -C opt-level=3 -C embed-bitcode=no --cfg 'feature="no-md5"' --cfg 'feature="use-openssl-md5"' -C metadata=cb61c42d9cf38f2c -C extra-filename=-cb61c42d9cf38f2c --out-dir /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps -C linker=/opt/conda/conda-bld/rust-bio-tools_1685451378291/_build_env/bin/x86_64-conda-linux-gnu-cc -L dependency=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps --extern libxlsxwriter_sys=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/deps/liblibxlsxwriter_sys-4957ba847f8189c2.rmeta --cap-lints allow -L native=/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target/release/build/libxlsxwriter-sys-f910310a21b7ae2e/out (exit status: 1) - warning: build failed, waiting for other jobs to finish... - error: failed to compile rust-bio-tools v0.42.0 (/opt/conda/conda-bld/rust-bio-tools_1685451378291/work), intermediate artifacts can be found at /opt/conda/conda-bld/rust-bio-tools_1685451378291/work/target - Traceback (most recent call last): - File "/opt/conda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/conda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 2198, in build - utils.check_call_env(cmd, env=env, rewrite_stdout_env=rewrite_env, - File "/opt/conda/lib/python3.8/site-packages/conda_build/utils.py", line 451, in check_call_env - return _func_defaulting_env_to_os_environ("call", *popenargs, **kwargs) - File "/opt/conda/lib/python3.8/site-packages/conda_build/utils.py", line 427, in _func_defaulting_env_to_os_environ - raise subprocess.CalledProcessError(proc.returncode, _args) - subprocess.CalledProcessError: Command '['/bin/bash', '-o', 'errexit', '/opt/conda/conda-bld/rust-bio-tools_1685451378291/work/conda_build.sh']' returned non-zero exit status 101. -# Last 100 lines of the build log. diff --git a/recipes/rust-bio-tools/meta.yaml b/recipes/rust-bio-tools/meta.yaml index 7e0e2da27e5b6..4df8383242ee8 100644 --- a/recipes/rust-bio-tools/meta.yaml +++ b/recipes/rust-bio-tools/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.42.0" %} +{% set version = "0.42.2" %} package: name: rust-bio-tools @@ -7,16 +7,18 @@ package: build: number: 1 skip: True # [osx] + run_exports: + - {{ pin_subpackage('rust-bio-tools', max_pin="x.x") }} source: url: https://github.com/rust-bio/rust-bio-tools/archive/v{{ version }}.tar.gz - sha256: 93642d7ebd4b85da8a043fd394a0c2d3ca112d0d8ecc0620cb8400ae703148ca + sha256: 860b29bb917f2d9ca1479d416b43856791c2ca726a0c22df30354bb5c44191c6 requirements: build: - {{ compiler('c') }} - {{ compiler('cxx') }} - - rust >=1.30 + - {{ compiler('rust') }} - clangdev - pkg-config - make @@ -35,11 +37,15 @@ test: about: home: https://github.com/rust-bio/rust-bio-tools license: MIT + license_family: MIT summary: | A growing collection of fast and secure command line utilities for dealing with NGS data implemented on top of Rust-Bio. + dev_url: https://github.com/rust-bio/rust-bio-tools extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - fxwiegand - felixmoelder diff --git a/recipes/sage-proteomics/meta.yaml b/recipes/sage-proteomics/meta.yaml index 75e03453a0b0e..2e26967970fd3 100644 --- a/recipes/sage-proteomics/meta.yaml +++ b/recipes/sage-proteomics/meta.yaml @@ -1,6 +1,6 @@ {% set name = "sage-proteomics" %} -{% set version = "0.14.5" %} -{% set sha256 = "a85b91c6651dfd028d5807163bdb62aa4a8eb222cac03348bd607323af1238c9" %} +{% set version = "0.14.7" %} +{% set sha256 = "894b59429a67dc22592fc65fca547ee6d67f8bada71d09f7c1a81524b65fe6da" %} package: name: {{ name }} diff --git a/recipes/salmon/build.sh b/recipes/salmon/build.sh index 027cadd4c97e5..ec521e821cd85 100644 --- a/recipes/salmon/build.sh +++ b/recipes/salmon/build.sh @@ -8,6 +8,7 @@ mkdir -p build cd build cmake -DCMAKE_BUILD_TYPE=RELEASE \ -DCONDA_BUILD=TRUE \ + -DLIBSTADEN_LDFLAGS=-L$PREFIX/lib \ -DBoost_NO_BOOST_CMAKE=ON \ -DCMAKE_OSX_DEPLOYMENT_TARGET=10.11 \ -DCMAKE_INSTALL_PREFIX:PATH=$PREFIX \ diff --git a/recipes/salmon/meta.yaml b/recipes/salmon/meta.yaml index f5f3ede9e394b..91a5f42d76e10 100644 --- a/recipes/salmon/meta.yaml +++ b/recipes/salmon/meta.yaml @@ -1,4 +1,4 @@ -{% set version="1.10.2" %} +{% set version="1.10.3" %} package: name: salmon @@ -6,10 +6,12 @@ package: build: number: 0 + run_exports: + - {{ pin_subpackage("salmon", max_pin="x.x") }} source: url: https://github.com/COMBINE-lab/salmon/archive/v{{ version }}.tar.gz - sha256: 976989182160fef3afb4429ee8b85d8dd39ed6ca212bb14d6a65cde0e985fb98 + sha256: a053fba63598efc4ade3684aa2c8e8e2294186927d4fcdf1041c36edc2aa0871 requirements: @@ -17,6 +19,8 @@ requirements: - autoconf - cmake - make + - bzip2 + - zlib - {{ compiler('cxx') }} - {{ compiler('c') }} host: @@ -44,6 +48,8 @@ about: summary: Highly-accurate & wicked fast transcript-level quantification from RNA-seq reads using selective alignment extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - rob-p - k3yavi diff --git a/recipes/salty/meta.yaml b/recipes/salty/meta.yaml index baee1a01d7b94..1b9e8d2ffcbfa 100644 --- a/recipes/salty/meta.yaml +++ b/recipes/salty/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.0.5" %} +{% set version = "1.0.6" %} {% set name = "salty" %} package: @@ -7,12 +7,14 @@ package: source: url: https://github.com/LanLab/{{ name }}/archive/v{{ version }}.tar.gz - sha256: 85cc90e93fdce30685a9c0c2fecc0d3079c0d7903c02eba9096a1b73e2c4fbd6 + sha256: 85c7fd21665606e9e31807c36a6e6edf5dd77a41a3929eb10c94291cede6ff4b build: noarch: python - number: 1 + number: 0 script: {{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: host: @@ -21,7 +23,7 @@ requirements: run: - python >=3.7 - kma >=1.4.9 - - pandas >=1.5.0 + - pandas >=2.0 - mlst >=2.23.0 test: diff --git a/recipes/samblaster/build.sh b/recipes/samblaster/build.sh index 6c134704ab89c..e583b50b8c314 100644 --- a/recipes/samblaster/build.sh +++ b/recipes/samblaster/build.sh @@ -3,5 +3,5 @@ BIN=$PREFIX/bin mkdir -p $BIN sed -i.bak 's/CPPFLAGS = /CPPFLAGS = $(CXXFLAGS) /' Makefile -make CPP=$CXX +make CPP=$CXX -j${CPU_COUNT} cp samblaster $BIN diff --git a/recipes/samblaster/meta.yaml b/recipes/samblaster/meta.yaml index 25b42d4cf8568..016234e899fb5 100644 --- a/recipes/samblaster/meta.yaml +++ b/recipes/samblaster/meta.yaml @@ -1,5 +1,7 @@ build: - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage('samblaster', max_pin='x.x') }} # Started based on: https://anaconda.org/Judowill/samblaster @@ -25,3 +27,7 @@ about: home: https://github.com/GregoryFaust/samblaster license: MIT summary: Mark duplicates in and extract discordant and split reads from SAM files. + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/samestr/meta.yaml b/recipes/samestr/meta.yaml index 36690b13adb95..54f65bf516a7c 100644 --- a/recipes/samestr/meta.yaml +++ b/recipes/samestr/meta.yaml @@ -1,5 +1,5 @@ {% set name = "samestr" %} -{% set version = "1.2023.4" %} +{% set version = "1.2024.2.post1" %} package: name: "{{ name|lower }}" @@ -7,12 +7,14 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 268b26ea7e7225373ea35ff75f30e4f0f8840946a92469b6bf51a7433d0b7d2c + sha256: d03c5f1fd89fd018409bcf332c3a95e752aca9fb47b88c617fad702581630bdd build: number: 0 - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" noarch: python + run_exports: + - {{ pin_subpackage('samestr', max_pin=None) }} requirements: host: @@ -47,7 +49,7 @@ test: about: home: "https://github.com/danielpodlesny/samestr/" - license: "GNU Affero General Public License v3" + license: "AGPL-3.0-or-later" license_family: AGPL license_file: LICENSE summary: "SameStr identifies shared strains between pairs of metagenomic samples based on the similarity of SNV profiles." diff --git a/recipes/samsum/meta.yaml b/recipes/samsum/meta.yaml index 6988988dd4f66..74767cb6d3564 100644 --- a/recipes/samsum/meta.yaml +++ b/recipes/samsum/meta.yaml @@ -10,11 +10,13 @@ source: sha256: 36b1fc0eaa4da1b7a70d2791357c7547612c9653e4e0ea7db39ba96cdd03ffc5 build: - number: 3 + number: 4 skip: True # [py2k] entry_points: - samsum = samsum.__main__:main script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv " + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: build: @@ -45,5 +47,7 @@ about: summary: A light-weight python package for summarizing sequence coverage from SAM and BAM files extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - cmorganl diff --git a/recipes/samtools/meta.yaml b/recipes/samtools/meta.yaml index b17cf299e837e..f098279936380 100644 --- a/recipes/samtools/meta.yaml +++ b/recipes/samtools/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.19" %} +{% set version = "1.20" %} package: name: samtools @@ -11,7 +11,7 @@ build: source: url: https://github.com/samtools/samtools/releases/download/{{ version }}/samtools-{{ version }}.tar.bz2 - sha256: fa6b3b18e20851b6f3cb55afaf3205d02fcb79dae3b849fcf52e8fc10ff08b83 + sha256: c71be865e241613c2ca99679c074f1a0daeb55288af577db945bdabe3eb2cf10 requirements: build: @@ -35,6 +35,8 @@ test: - samtools view 'https://example.com' 2>&1 | grep 'fail to read the header' -q extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:samtools - usegalaxy-eu:samtools_flagstat diff --git a/recipes/sanntis/meta.yaml b/recipes/sanntis/meta.yaml index 8924ab66247f5..72516e12f2345 100644 --- a/recipes/sanntis/meta.yaml +++ b/recipes/sanntis/meta.yaml @@ -1,6 +1,6 @@ {% set name = "sanntis" %} -{% set version = "0.9.3.4" %} -{% set sha256 = "a5b1fad410981e330827949699f29dd9a521bafbbef0ea2859ae33bd3add024e" %} +{% set version = "0.9.3.5" %} +{% set sha256 = "6e6753afb557fd4c1a5bb63059bfe9ce68bcdaf64a41162494cb5ebbef16ab18" %} package: name: {{ name }} diff --git a/recipes/sansa/build.sh b/recipes/sansa/build.sh index a3f3b721a6495..dc2400afabae2 100644 --- a/recipes/sansa/build.sh +++ b/recipes/sansa/build.sh @@ -1,5 +1,3 @@ #!/bin/sh -make all CXX=$CXX CXXFLAGS="-D__STDC_FORMAT_MACROS -I${PREFIX}/include -L${PREFIX}/lib" -mkdir -p $PREFIX/bin -cp src/sansa $PREFIX/bin +CXXFLAGS="${CXXFLAGS} -D__STDC_FORMAT_MACROS" make CXX="${CXX}" prefix="${PREFIX}" install diff --git a/recipes/sansa/meta.yaml b/recipes/sansa/meta.yaml index 0cab341eedf48..50e1fa53b64ec 100644 --- a/recipes/sansa/meta.yaml +++ b/recipes/sansa/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.0.8" %} -{% set sha256 = "124abc76cd65d13dbc3f1bc701af266d55e3d58be618f01b772d6d9dd6b185ee" %} +{% set version = "0.2.1" %} +{% set sha256 = "f43b088b8339d3ba395adf922d723b074e31f8bf548c9e9039cccace5acc60ee" %} package: name: sansa @@ -10,18 +10,31 @@ source: sha256: '{{ sha256 }}' build: - number: 6 + number: 0 + run_exports: + - {{ pin_subpackage('sansa', max_pin="x.x") }} requirements: build: - make - {{ compiler('cxx') }} + - autoconf + - automake + - pkg-config + - clangdev + - llvm-openmp host: - boost-cpp - htslib + - zlib + - bzip2 + - clangdev + - llvm-openmp run: - boost-cpp - htslib + - zlib + - bzip2 test: commands: @@ -29,7 +42,7 @@ test: about: home: https://github.com/dellytools/sansa - license: BSD License + license: BSD-3-Clause license_family: BSD license_file: LICENSE summary: Structural variant annotation diff --git a/recipes/sativa/build.sh b/recipes/sativa/build.sh index 4c880d868a6ea..9f821444e5974 100644 --- a/recipes/sativa/build.sh +++ b/recipes/sativa/build.sh @@ -3,30 +3,9 @@ export USE_AVX=yes export USE_AVX2=yes -case `uname` in -Darwin) export DARWIN=1;; -Linux) export DARWIN=0;; -*) echo "Unknown architecture"; exit 1;; -esac - -make -C ./raxml CC="$CC" - -install -d ${PREFIX}/tmp -install -d ${PREFIX}/bin - -if [ $DARWIN -eq 1 ]; then - install sativa.cfg *.py ${PREFIX} -else - install -t ${PREFIX} *.py sativa.cfg -fi - -# Place a symlink to sativa.py in bin/ -( cd ${PREFIX}/bin; ln -s ../sativa.py . ) - -mkdir ${PREFIX}/raxml -cp ./raxml/raxmlHPC8* ./raxml/*.sh ${PREFIX}/raxml - -cp -r ./epac ${PREFIX} -cp -r ./tests ${PREFIX} -cp -r ./example ${PREFIX} +make -C raxml +cp -r raxml ${PREFIX}/bin +cp -r epac ${PREFIX}/bin +cp *.py ${PREFIX}/bin +cp sativa.cfg ${PREFIX}/bin diff --git a/recipes/sativa/gpl_license b/recipes/sativa/gpl_license new file mode 100644 index 0000000000000..818433ecc0e09 --- /dev/null +++ b/recipes/sativa/gpl_license @@ -0,0 +1,674 @@ + GNU GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU General Public License is a free, copyleft license for +software and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. We, the Free Software Foundation, use the +GNU General Public License for most of our software; it applies also to +any other work released this way by its authors. You can apply it to +your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you have +certain responsibilities if you distribute copies of the software, or if +you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the manufacturer +can do so. This is fundamentally incompatible with the aim of +protecting users' freedom to change the software. The systematic +pattern of such abuse occurs in the area of products for individuals to +use, which is precisely where it is most unacceptable. Therefore, we +have designed this version of the GPL to prohibit the practice for those +products. If such problems arise substantially in other domains, we +stand ready to extend this provision to those domains in future versions +of the GPL, as needed to protect the freedom of users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU Affero General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the special requirements of the GNU Affero General Public License, +section 13, concerning interaction through a network will apply to the +combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU General Public License from time to time. Such new versions will +be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + + Copyright (C) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see . + +Also add information on how to contact you by electronic and paper mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + Copyright (C) + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + +The hypothetical commands `show w' and `show c' should show the appropriate +parts of the General Public License. Of course, your program's commands +might be different; for a GUI interface, you would use an "about box". + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU GPL, see +. + + The GNU General Public License does not permit incorporating your program +into proprietary programs. If your program is a subroutine library, you +may consider it more useful to permit linking proprietary applications with +the library. If this is what you want to do, use the GNU Lesser General +Public License instead of this License. But first, please read +. diff --git a/recipes/sativa/meta.yaml b/recipes/sativa/meta.yaml index 600f238ce24c5..7fa6e1aee16b4 100644 --- a/recipes/sativa/meta.yaml +++ b/recipes/sativa/meta.yaml @@ -1,5 +1,5 @@ {% set name = "sativa" %} -{% set version = "0.9.1" %} +{% set version = "0.9.3" %} package: name: {{ name|lower }} @@ -7,10 +7,13 @@ package: source: url: https://github.com/amkozlov/sativa/archive/refs/tags/v{{ version }}.zip - sha256: 14b772c7e1bc242655e1876e7492fd8d50d363058236bdf513aa5afca7d94841 + sha256: 0d0ae82f0f9608f51301ecadc367f85653fe9954855d9ebbbef8f889eef586b8 build: - number: 1 + number: 0 + skip: true # [osx] + run_exports: + - {{ pin_subpackage('sativa', max_pin="x.x") }} requirements: build: @@ -23,16 +26,17 @@ requirements: - python >=3.0.0 test: - imports: - - unittest + files: + - sequences.alnfna + - taxonomy.tsv commands: -# - python sativa.py -h - - python -m unittest discover -v + - sativa.py -s sequences.alnfna -t taxonomy.tsv -x bac -debug about: home: https://github.com/amkozlov/sativa license: GPL-3 license_family: GPL + license_file: gpl_license summary: "SATIVA Semi-Automatic Taxonomy Improvement and Validation Algorithm" extra: diff --git a/recipes/sativa/sequences.alnfna b/recipes/sativa/sequences.alnfna new file mode 100644 index 0000000000000..7e0aa83c9190c --- /dev/null +++ b/recipes/sativa/sequences.alnfna @@ -0,0 +1,230 @@ +>RS_GCF_000019605.1~NC_010482.1 +---GGTTGATCCTGCCGGAGGGAAC-----CCCTATCGGGCTCGCACTAAGCCATGCGAG +TCTGCTGGGGG------------------------------------------------- +------------------------------------CCCCTGCCCCTGGCGGCGCACGGC +TCCGTAATACACGGTCAACCTGTCCTGGGGACCGGGATAA-------------------- +CCTCGGGAAACTGAGGTTAAT---ACCGGATAGGGGTGGATTCCTGGAATGGGTCCACCC +CTAAAGTAGGCGGGGGGACG-GCC-----CCGCTGAGGCCCCAGGGTGGGACCGTGGCCT +AT-CAGG----TAGTAGGTGGGGTA---------ACGGCCCACCTAGCCTAAGACGGGTA +CGGG------CTCTGAGAG-GAGG-AGCCCGGAGATGGGCACTGAGACAAGGGCCCAGGC +C-CTACGGGGCGCAGCAG--------GCGGGAAACTTCCCCAATG-----CGCGCAAGCG +TGAGGGAGTGAGCCCGAGTGCCGCCCGCTGAGGG------CGGCTGTTCCCCTGTGTAA- +--------A-AAG-------CAGGGGGTAGGAAG-GGGAG-------GGTAAGGCTGGTG +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------CCAGCCGCCGCGGTAAAACCAGC---------TCC-CCGA-- +-GGG--GTTCCCACGCATACTGGGCCTAAAGCGTCCGTAGCCGGCCCCGTAAGTCCTCGG +TT---AAATCCGC--CTGAAGACAGG--CGGACCGCCGAGGAT------A--CTGCGGGG +C-TAGGGAGC--GGGAGGGGCCGAGGGTATTCCGGGGGGAGCGGTAAAATGCGT------ +------------------------------------------AGATCCCCGGAGGACC-- +-ACCAGTGGCGAAGGCGCTCGGCTGGAACGCGTCCGACGGTGAGGG--------ACGAAA +GCTGGG-GGAG------------------CAAACCGGATTAGATACCCGGGTAGTCCCAG +CCGTAAACGATGCCGG---CTAGGTGCCG---GCTGAGG---------TTTCGGCCTCAG +CCGGTGTCGA---------------------AGCGAAGGCATTAAGCCGGCCGC-CTGAG +GAGTACAGCCGCAAGGCCGAAA----------CTTAAAGGAATTG-ACGGGGGGGC---- +------------------------------------------------------------ +--------------------------ACCACAAGGGGTGAATGCCTGCGGCTCAATTGGA +CTCAACGCCGGGAATC-TTACCGGGGGCGACAGCAGGATGAAGGTCAGG----------- +------------------------------------------------------------ +--------------------------------------CTG-------AA---------- +-------GACCTTACCTGAC----GCGCTGAG--GG-GTGGTGCATGGC---------CG +TCGCCAGCTCGTGCCGTGAGGTGT--CCTGTTAAGTCAGGC-------AACGAGCGAGAC +-CCCCGCCCTC-AGTTGCCAGCGGGGCCTT-ACGGCTGG-C-CG-GGCAAACTGGGGGGA +CTGCCGGCGAAGA---GCCGGAGGAAGGAGGGGGCTACGGCAGGTCAGTATGCCCCTAAT +C---CCCCGGGCCGCACGCGGGCTGCAATGGGCGGGACA---GCGG---------G-ATG +CGAC-CCCGAGAGGGGGAGCAAATCCCTGAAACCCGCCCGT-G--GTTGGGATCGAGGGT +TGCAACTCGCCCTCGTGA-ACCCGGAATCCCTAGTAACCGCGGTTCTCC-ATAC------ +----------------------------CGCGGTGAATACGTCCCTGCCCCTTGTACACA +CCGCCCGTCAACCCACCCGAGTGGACTTGGGGCGAGGCCCAGCTCAA------------- +-------------------TGGCTGGGTCGAGCTTTGGGTCCGCGAGGGGGGGTAAGTCG +TAACAAGGTAGCCGTAG---GGGAACCTGCGGCTGGATCACCTCCC-------------- +------------------------------------------------------------ +------------------- +>RS_GCF_000092465.1~NC_014205.1 +------------------------------------------------------------ +------------------------------------------------------------ +----------------------AGGTGATCCA----GCCGCAGGTTCCCCTACGGCTACC +TTGTTACGACTTCTCCCCCCTTGGGAGGGGGGAGTTCGACCTGGCCCCC----CGGGTTT +CCCCGGGAGACCAGGCCTCAC---TCCCCCCTCCCTCGGGTGGAGCGACGGGCGGTGTGT +GCAAGGAGCAGGGA--CG---TATTC--ACCGC-GCGATGATGACGCGCGGTTACTAGGG +ATTCCACGTTCACGAGGG-CGAGTT------------------GCAGCCCTCGATCCCAA +CTGCGGCGGGGTTTGAGGGATTGCCTCCCCCTTAC-GGGGTCGGATCCCGCTGTCCCCGC +CATTGTAGCCC---------------GCGTGTAGCCCGGGGGATT-----CGGGGCATGC +TGAC-------------------------------------------------------- +---------------------------------------------CTGCCGTGGCCCCCT +CCTTCCTCCGCCTTATACGGCGGCAGTCCCCCTAGTGTG-CCCC-GG--AGCCGGAGCTC +CGGGTAGCAACTAGGGGCGGGGGT-CTCGCTCGTTGC------------CGGACTTAACC +GGACACCTCACGG----CACGAGCTGGCGACGGCCATGCACCTCCTCTCAGCGCG----- +-TCGGGCAA--------------------------------------------------- +------------------------------------------------------------ +---------------------------GGCCGTTAGCCTGGCCGTCATC-CTGCTG---- +------------------------------------------------------------ +------------------------------------------------------------ +--------------------------TCGCCCCCGGTGAGG------------TTCCCGG +CGTTGACTCCAATTAAACCG--CAGGCTCCACC---CCTTGTGGTGCTCCCCCGC----- +-------------------CAATTCCTTTAAGTTTCAGCCTTGCGGCCGTACTCCCCAG- +-GCGGCGGGCTTAACGGCTTCCCTGCGGCACTGGGCGGGCTCT-AA-G-CCCGCCCAACA +CCTAGCCCGCATCGT---------------TTACAGCCGGGACTACCCGGGTATCTAATC +CGGTTCGCTCCCCC------------------GGCTTTCGCCCCTCACCGTCG------- +----------------GGCGCGTTCCAGCCGAGCGCCTTCGCCACTGGTGGTCCTCCCGG +GATTATAGGATTTCGCCCCTAC-----------C------------------CCGGGAGT +ACCCTCGGCCTCTCCCGCCCCCTAGCCTGGCAGTTTCCCCTCCAGTC-C-CCGGGTTGAG +CCCGGGGATTTAGGAGGGGACTTG-CCAGGCCGGCTACGG------GCGCTTTAGGCCCA +ATAATCGTCCCGA----CCACTCGCGGGGCTGGTATTACCGCGGCGGCTGACACCAGTCT +TGCCCCCCGCTTATTCCCCC---------------------------------------- +------------------------------------------------------------ +-----GCCTTCTTACAGCGG-GGAAAAGCCCC------CT-AATTAGGGGGCACTCGGGG +TGACCCCGTCACGGTTGCCCGCAT--TGCGGAGGTTTCGCGCCTGGTGCACCCCGTAGGG +CCTGGGCCCTTGTCT--CAGTGCCCATCTG----GGGGC-----TCCCGCTCTCA-CGGC +CCCTACCCGTTATCGGCTTGGCGGGCCGTTACCCCGCCAACTACCTG-ATGGGCCGCAGC +CCCATCCTCGGGCTGCGCGGCGGCGATAACCCCCGCCGCA--CCC--TTTCGGGGAGGAA +CCCTTCCAGGCGTCCT---CCCCTATGG-GGGATTAGCACC-A--GTTTCCC---GG-TG +TTATCCCCCTCCCGAGGGTAGGTTAGCCACGTGTTACTCAGCCGTCCGCCACGCTCCGCA +GCGG----------CGGAGCGTACGACTCCCATGGCTTAGCCCCACCCCGATAGCGGTCG +GGTCCGGCAGGATCAACCGGAGTT------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------- +>RS_GCF_000970205.1~NZ_CP009512.1-#2 +------------------------------------------------------------ +------------------------------------------------------------ +---------------------GAGGTGATCCA----GCCGCAGATTCCCCTACGGCTACC +TTGTTACGACTTAACCCCCCTTGCAAAGCACAGGTTCGAACACGGCAC-G---------- +----A-AGTCCGTGCCCTCAC---CCATACCTCACTCGGGTGGTTTGACGGGCGGTGTGT +GCAAGGAGCAGGGA--CG---TATTC--ACCGC-GCTATATTGAAACGCGATTACTACGG +ATTCCAGCTTCACGA-GGGCGAGTT------------------ACAGCCCTCGATCCGAA +CTACGAATGGGTTTGTGAGATTAC-CAGCCCTTTTCAGGGGAGGGACCCATTGTCCCATC +CATTGTAGCCC---------------GCGTGTAGCCCGGGAGATT-----CGGGGCATAC +TGAC-------------------------------------------------------- +---------------------------------------------CTACCGTGGCCCGCA +CCTTCCTCCGATTTAACATCGGCGGTCCCCACAGAGTACCCATCGTCCC----GGAGGAC +ATGCTGGTAACAGTGGGCACGGGT-CTCGCTCGTTGC------------CTGACTTAACA +GGATGCTTCACAG----TACGAACTGGCGACGGCCATGCACCTCCTCTCAGCGAT----- +-TCAGGCAA--------------------------------------------------- +------------------------------------------------------------ +---------------------------AGTCTTCAGCTTGGCCTACATA-TTGCTG---- +------------------------------------------------------------ +------------------------------------------------------------ +--------------------------TCGCCCCCGGTGAGT------------TGTCCGG +CGTTGAGTCCAATTAAACCG--CAGGCTCCACC---CGTTGTTGTGCTCCCCCGC----- +-------------------CAATTCCTTTAAGTTTCAGCCTTGCGGCCGTACTTCCCAG- +-GTGGCTCGCTTCACGGCTTCCCTGCGGCACCAGACACGGTCG-CG-C-CATGCCTGACA +CCTAGCGAGCATCGT---------------TTACGGCTGGGACTACCCGGGTATCTAATC +CGGTTCGTGCCCCC------------------AGCTTTCGTCCCTCACCGTCG------- +----------------AACCCGTTCTGGTAAGACGCCTTCGCCACAGGTGGTCCCACAGG +GATTACAAGATTTCACTCCTAC-----------C------------------CCTGTAGT +ACCTCTTACCTCTCCCGGTTCCAAGTCTGGCAGTATCCCCCGAAAGCCT-AATAGTTGAG +CTATCAGATTTCCCGGAGGACTGA-CCAAACCGGCTACGG------ACCCTTTAGACCCA +ATAATCACGATCA----CCACTCGGGCCGCCGGTGTTACCGCGGCGGCTGGCACCGGTCT +TGCCCGGCCCTTGCTAACGG---------------------------------------- +------------------------------------------------------------ +-----ATGTATTTTACACATCCGGACAGCCA------GCATATGATGCTGGCACTCGGTG +TCCCCTTATCACGGTTTCCCGCAT--TGTAAAGTTTTCGCGCCTGCTGCGCCCCGTAGGG +CCTGGATTCATGTCT--CAGAATCCATCTC----CGGGC-----TCTTGCTCTCA-CAAC +CCGTACCCGTCGCTGGCTAGTAGGTACATTACACCCACTACTAC-CTGATAGGCCGCAGA +CCCATCCTTGGGCAGACGAATCCTT-------------------T--T--GACGCATAAA +GCATTCCAGCAAATAT---GCGTTATCC-GGAATTATCCCC-A--GTTTCCC---GG-GG +TTATGCCGGTCCCAAGGGCAGGTTATCCACGTGTTACTGAGCAGTACGCCATGTATT--- +---------------GCTACATATGACTCGCATGGCTTAGGCGAACACCGATAGCAGTAA +CCTCTGGCAGGATCAACCAGAATT------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------- +>RS_GCF_000302455.1~NZ_AMPO01000020.1 +-CCGTTTGATCCTGGCGGAGGCCAC-----TGCTATTGGGTTTCGATTAAGCCATGCAAG +TCGTACGATCCT------------------------------------------------ +-----------------------------------TTC----GGGGTCGTGGCATACGGC +TCAGTAACACGTGGATAACCTACCCTTAGGACTGGGATAA-------------------- +CCCCGGGAAACTGGGGACAAT---ACCGGATATGTAGAGTTGCCTGGAATTGGTACTCTA +TTGAAA-------------------T-GTATTCGTGCGCCTAAGGATGGATCTGCGGCAG +AT-TAGG----TAGTTGGCGGGGTA---------AATGCCCACCAAGCCAGTAATCTGTA +CGGG------TTGTGAGAG-CAAG-AGCCCGGAGATGGAACCTGAGACAAGGTTCCAGGC +C-CTACGGGGCGCAGCAG--------GCGCGAAACCTCCGCAATG-----CACGAAAGTG +CGACGGGGGAAACCCAAGTGCCACTCTTAACG--GG----GTGGCTTTTCTTAAGTGTA- +--------AAAAG-------CTTTTGGAATAAGA-GCTGG-------GC-AAGACCGGTG +C----------------------------------------------------------- +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +-------------------CAGCCGCCGCGGTAACACCGGC---------AGC-TCAA-- +-GTG--GTGGCCATTTTTATTGGGCCTAAAGCGTTCGTAGCCGGTTTGATAAGTCTCTGG +TG---AAATCTCA--CGGCTTAACCGTGAGAATTGCTGGAGAT------A--CTATTAGG +C-TTGAGGCC--GGGAGAGGTTAGCGGTACTCCCAGGGTAGGGGTGAAATCCTA------ +------------------------------------------TAATCCTGGGAGGACC-- +-ACCTGTGGCGAAGGCGGCTAACTGGAACGGACCTGACGGTGAGTA--------ACGAAA +GCCAGG-GGCG------------------CGAACCGGATTAGATACCCGGGTAGTCCTGG +CCGTAAACGATGTGGA---CTTGGTGTTG---GGATGGC--------------------- +------------------------------------------------------------ +---------------------------------TCCGAGCTGCCC-CAGTGCCGAAGGGA +AGCTGTTAAGTCCACC-------GCCTGGGAAGTACG-GTCGCAAGACTGAAACTTAAAG +G------AATTGGCGGGGGAG----CACCACAACGCGTGGAGCCT-GCGGTTTAATTGGA +TTCAACGCCGGACATC-TCACCAGGGGCGACAGCAGAATGATAGCCAGG----------- +------------------------------------------------------------ +--------------------------------------TTG-------AT---------- +-------GACCTTGCTTGAC----AAGCTGAG--AG-GAGGTGCATGGC---------CG +CCGTCAGCTCGTACCGTGAGGCGT--CCTGTTAAGTCAGGC-------AACGAGCGAGAC +-CCACGCCCTT-AGTTACCAGCGGATCCTT-T--GGGAT-G-CCGGGCACACTAAGGGGA +CCGCCAGTGATAA---ACTGGAGGAAGGAGTGGACGACGGTAGGTCCGTATGCCCCGAAT +C---CCCTGGGCTACACGCGGGCTACAATGGCTAGGACA---ATGG---------G-TTC +CGACACTGAA-AAGTGAAGGTAATCTCCTAAACCTAGCCTT-A--GTTCGGATTGAGGGC +TGTAACTCGCCCTCATGA-AGCTGGAATGCGTAGTAATCGCGTGTCATA-ACCG------ +----------------------------CGCGGTGAATACGTCCCTGCTCCTTGCACACA +CCGCCCGTCACGCCACCCAAAAAGGGTTTGGATGAGGCCATAGTCTTT------------ +--G--------------TTGGTTATGGTCGAATCTGGGTTCTTTGAGGAGGGCGAAGTCG +TAACAAGGTAGCCGTAG---GGGAACCTGCGGCTGGATCACCTCCTT------------- +------------------------------------------------------------ +------------------- +>RS_GCF_000993805.1~NZ_CP009961.1 +TCCGGTTGATCCTGCCGGACCCGAC-----TGCTATCAGGGTGGGGCTAACCCATGGAAG +TCTAGGAGCCGGG----------------------------------------------- +---------------------------------GC--TACGGCCGGCTCCGGCGGACGGC +TCAGTAGCACGTGGCTAACCTACCCTCGGGAGGGGGATAA-------------------- +CCCCGGGAAACTGGGGCTAAT---CCCCCATAGGCGCAGACTCCTGGAATGGGTCCGCGC +CGAAAAGGCTGCAACGCCAT-GCCCG---TTGCAGCCGCCCGAGGATGGGGCTGCGCCCC +AT-CAGG----TAGTTGGCGGGGTA---------ACGGCCCGCCAAGCCGATAACGGGTG +GGGG------CCGTGAGAG-CGGG-AGCCCCGAGATGGGCACTGAGACAAGGGCCCAGGC +C-CTACGGGGCGCACCAG--------GGGCGAAACTTCCGCAATG-----CGGGAAACCG +TGACGGAGCCACCCTGAGTGCCACCCGATGAGGG------TGGCTTTTGCCCGGTCTAA- +--------A-AAG-------CCGGGCGAATAAGC-GGGG--------GGCAAGCCTGGTG +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------------------------------------------------ +------------------TCAGCCGCCGCGGTAATACCAGC---------CCC-GCGA-- +-GTG--GTCGGGACGATTATTGGGCCTAAAGCGTCCGTAGCCGGCCCGGCAAGTCCCCCT +TT---AAAGCCCA--CGGCTCAACCG--TGGGAGCGGGGGGAT------A--CTGTCGGG +C-TAGGGGGC--GGGAGAGGCCGGGGGTACTCCTGGGGTAGGGGCGAAATCCTA------ +------------------------------------------TAATCCCAGGAGGACC-- +-ACCAGTGGCGAAGGCGCCCGGCTGGAACGCGCCCGACGGTGAGGG--------ACGAAA +GCTGGG-GGAG------------------CAAAGGGGATTAGATACCCCCGTAGTCCCAG +CTGTAAACGATGCGGG---CTAGGTGTTG---GGTGGG----------CCTCGAGCCCGC +CCAGTGTCGT---------------------AGGGAAGCCGTTAAGCCCGCCGC-CTGGG +GAGTACGGCCGCAAGGCTGAAA----------CTTAAAGGAATTG-GCGGGGGAGC---- +------------------------------------------------------------ +--------------------------ACCACAAGGGGTGAAGCTT-GCGGTTTAATTGGA +GTCAACGCCGGAAACC-TCACCGGGGGCGACAGCAGGATGAAGGCCAGG----------- +------------------------------------------------------------ +--------------------------------------CTA-------AC---------- +-------GACCTTGCCAGAC----GAGCTGAG--AG-GAGGTGCATGGC---------CG +TCGCCGGCTCGTGCCGTGAGGTGT--CCTGTTAAGTCAGGG-------AACGAGCGAGAC +-CCCCGCCCCT-AGTTGCAACCCAGCCTTT-CGGGGCTG-G-GG--CACTCTAGGGGGAC +TGCCGGCGA-TAA---GCCGGAGGAAGGTGGGGGCTACGGCAGGTCAGTATGCCCCGAAA +C---CCCCGGGCTACACGCGAGCTGCAATGGCGGGGACA---GCGG---------G-CTC +CG-ACCCCGAAAGGGGAAGGAAATCCCGTAAACCCCGCCTC-A--GTAGGAATCGAGGGC +TGCAACTCGCCCTCGTGA-ACGTGGAATCCCTAGTAACCGCGTGTCACC-AACG------ +----------------------------CGCGGTGAATACGTCCCTGCTCCTTGCACACA +CCGCCCGTCGCTCCACCCGAGGGAGGCCCAGGTGAGGCCTCTCGCCGAAAG--------- +-------------------GTGGGAGGTCGAATCTGGGCCTCCCAAGGGGGGAGAAGTCG +TAACAAGGTGGCCGTAG---GGGAACCTGCGGCCGGATCACCTCCTT------------- +------------------------------------------------------------ +------------------- diff --git a/recipes/sativa/taxonomy.tsv b/recipes/sativa/taxonomy.tsv new file mode 100644 index 0000000000000..349a7c83c9d8d --- /dev/null +++ b/recipes/sativa/taxonomy.tsv @@ -0,0 +1,5 @@ +RS_GCF_000019605.1~NC_010482.1 d__Archaea;p__Crenarchaeota;c__Korarchaeia;o__Korarchaeales;f__Korarchaeaceae;g__Korarchaeum;s__Korarchaeum +RS_GCF_000092465.1~NC_014205.1 d__Archaea;p__Crenarchaeota;c__Thermoprotei;o__Desulfurococcales;f__Desulfurococcaceae;g__Staphylothermus;s__Staphylothermus +RS_GCF_000970205.1~NZ_CP009512.1-#2 d__Archaea;p__Halobacterota;c__Methanosarcinia;o__Methanosarcinales;f__Methanosarcinaceae;g__Methanosarcina;s__Methanosarcina +RS_GCF_000302455.1~NZ_AMPO01000020.1 d__Archaea;p__Euryarchaeota;c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__Methanobacterium;s__Methanobacterium +RS_GCF_000993805.1~NZ_CP009961.1 d__Archaea;p__Crenarchaeota;c__Thermoprotei;o__Thermofilales;f__Thermofilaceae;g__Thermofilum_A;s__Thermofilum_A diff --git a/recipes/savana/meta.yaml b/recipes/savana/meta.yaml index 1e02c7e699603..346e21295480e 100644 --- a/recipes/savana/meta.yaml +++ b/recipes/savana/meta.yaml @@ -1,5 +1,5 @@ {% set name = "savana" %} -{% set version = "1.0.4" %} +{% set version = "1.0.5" %} package: name: "{{ name }}" @@ -7,7 +7,7 @@ package: source: url: "https://github.com/cortes-ciriano-lab/{{ name }}/archive/{{ version }}.tar.gz" - sha256: f870ec9d36b20c1caf7849a4bff7af8cc984cd076b2f4d39153661e15776c644 + sha256: 987cf91c355f98e45b29fbca32d7766284eea98d63333ed34f60885d8234510e build: number: 0 diff --git a/recipes/scanpy-scripts/meta.yaml b/recipes/scanpy-scripts/meta.yaml index 5428c9ec3c8ab..990206e2e559f 100644 --- a/recipes/scanpy-scripts/meta.yaml +++ b/recipes/scanpy-scripts/meta.yaml @@ -1,5 +1,5 @@ {% set name = "scanpy-scripts" %} -{% set version = "1.1.6" %} +{% set version = "1.9.301" %} package: name: "{{ name|lower }}" @@ -7,17 +7,13 @@ package: source: - url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 1701e35f93f5370ab451760b3892caf01b46d2898c3dd149e1dcba602e45eea1 + sha256: c681d9cf5670d8b771b7327684f19d52f9661ee31e685241af4d960220a5d63b folder: scanpy-scripts - - url: https://pypi.io/packages/source/s/scanpy/scanpy-1.8.1.tar.gz - sha256: 1b8603a868d783bd6c18c8db763a450153feefc8daed862c440749790d47c654 - folder: scanpy - patches: - - scrublet.patch build: number: 0 noarch: python + run_exports: '{{ pin_compatible("scanpy-scripts", max_pin="x.x") }}' entry_points: - scanpy-cli=scanpy_scripts.cli:cli - scanpy-read-10x=scanpy_scripts.cmds:READ_CMD @@ -36,37 +32,57 @@ build: - scanpy-integrate=scanpy_scripts.cli:integrate - scanpy-multiplet=scanpy_scripts.cli:multiplet script: - - "{{ PYTHON }} -m pip install {{ SRC_DIR }}/scanpy --no-deps --ignore-installed -vv" - "{{ PYTHON }} -m pip install {{ SRC_DIR }}/scanpy-scripts --no-deps --ignore-installed -vv" requirements: host: - - python >=3.7 + - python <3.10 - pip + - scanpy =1.9.3 + - louvain + - igraph + - leidenalg + - loompy + - Click <8 + - harmonypy >=0.0.5 + - bbknn >=1.5.0,<1.6.0 + - mnnpy >=0.1.9.5 + - scipy <1.9.0 + - scikit-learn <1.3.0 + - scrublet + - fa2 + # for testing + - bats + - black + - pytest - flit-core - setuptools_scm - pytoml - packaging run: - - anndata - - bbknn>=1.5.0 - - click<8 - - fa2 - - h5py<3.0.0 - - harmonypy>=0.0.5 + - python <3.10 + - scanpy =1.9.3 - leidenalg - loompy - louvain - - matplotlib-base - - mnnpy>=0.1.9.5 - - packaging - - pandas - - python>=3.6 - - scanpy=1.8.1 - - scikit-misc - - scipy + - igraph + - Click <8 + - harmonypy >=0.0.5 + - bbknn >=1.5.0,<1.6.0 + - mnnpy >=0.1.9.5 + # for mnnpy using n_jobs + - scipy <1.9.0 + - scikit-learn <1.3.0 - scrublet - - umap-learn + - fa2 + # for testing + - bats + - black + - pytest + - flit-core + - setuptools_scm + - pytoml + - packaging test: imports: @@ -104,3 +120,4 @@ extra: recipe-maintainers: - nh3 - pinin4fjords + - pcm32 diff --git a/recipes/scib/meta.yaml b/recipes/scib/meta.yaml index a8598ccf3891c..ceedea58c4998 100644 --- a/recipes/scib/meta.yaml +++ b/recipes/scib/meta.yaml @@ -1,6 +1,5 @@ {% set name = "scib" %} -{% set version = "1.1.4" %} - +{% set version = "1.1.5" %} package: name: "{{ name|lower }}" @@ -8,24 +7,23 @@ package: build: number: 0 - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vvv " - skip: True # [ py < 37 or py > 311] + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + skip: True # [ py < 38 or py > 311] run_exports: - - {{ pin_subpackage(name, max_pin='x.x') }} + - {{ pin_subpackage(name, max_pin='x') }} source: - url: https://github.com/theislab/scib/archive/v{{ version }}.tar.gz - sha256: aebdad725b58a0bf8f3660a57e1ab81a06845632bb1b6cf9c64f6378d191154b + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/scib-{{ version }}.tar.gz + sha256: 7ab3183065f2d861b64f88823a55cec767327a37ad6d0eaccce7b43c996293ad patches: - setup_compiler.patch requirements: + build: + - {{ compiler('cxx') }} host: - python - pip - - setuptools - build: - - {{ compiler('cxx') }} run: - anndata >=0.7.2 - deprecated @@ -35,10 +33,10 @@ requirements: - llvmlite - matplotlib-base - numpy - - pandas + - pandas <2 - pydot - python - - scanpy >=1.5 + - scanpy >=1.5, <1.10 - scikit-learn - scikit-misc - scipy @@ -46,10 +44,18 @@ requirements: - umap-learn test: - commands: - - python3 -c "import scib; print(scib.__version__)" + imports: + - scib about: home: https://github.com/theislab/scib license: MIT - summary: "Evaluating single-cell data integration methods" \ No newline at end of file + license_family: MIT + license_file: LICENSE.txt + summary: "Evaluating single-cell data integration methods" + doc_url: https://scib.readthedocs.io/en/latest/ + dev_url: https://github.com/theislab/scib + +extra: + identifiers: + - doi:10.1038/s41592-021-01336-8 diff --git a/recipes/scirpy/meta.yaml b/recipes/scirpy/meta.yaml index 1d42f7a62616a..31113a54a3a49 100644 --- a/recipes/scirpy/meta.yaml +++ b/recipes/scirpy/meta.yaml @@ -1,5 +1,5 @@ {% set name = "scirpy" %} -{% set version = "0.14.0" %} +{% set version = "0.16.1" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 26a5a5374503925c1db16595ef67b1814a6389a4932edc2aa48607a47a00bf43 + sha256: b8e5697184c79b6d526bb42f5ce5c5cfd03b827770eaf64aa71a8ba876e6a3f2 folder: "{{ name }}-{{ version }}" build: @@ -45,6 +45,7 @@ requirements: - numba >=0.41.0 - pooch >=1.7.0 - pycairo >=1.20 # [win] + - joblib >=1.3.1 test: imports: diff --git a/recipes/screadcounts/meta.yaml b/recipes/screadcounts/meta.yaml index c9e32396235b3..3780536d73673 100644 --- a/recipes/screadcounts/meta.yaml +++ b/recipes/screadcounts/meta.yaml @@ -1,6 +1,6 @@ {% set name = "screadcounts" %} -{% set version = "1.3.2" %} -{% set sha256 = "d7dde05a80227ac5207b0495323fc9154202f2d4d082296964a1d5f16468870d" %} +{% set version = "1.4.0" %} +{% set sha256 = "61856534dc5c578e9d12bcb397dc696747685b33ef056c49d1ff766960676c30" %} package: name: {{ name }} @@ -13,6 +13,8 @@ source: build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage('screadcounts', max_pin="x.x") }} extra: skip-lints: diff --git a/recipes/scsplit/meta.yaml b/recipes/scsplit/meta.yaml new file mode 100644 index 0000000000000..eabd6ab147f87 --- /dev/null +++ b/recipes/scsplit/meta.yaml @@ -0,0 +1,39 @@ +{% set name = "scSplit" %} +{% set version = "1.0.8.2" %} + +package: + name: "{{ name|lower }}" + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/scSplit-{{ version }}.tar.gz + sha256: e39e2e840ec34bec289619817d7ccee70165e79a361041b1b38e53beac1b7fa3 + +build: + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage('scsplit', max_pin="x.x.x") }} + +requirements: + host: + - python + - pip + run: + - python + +test: + imports: + - scSplit + commands: + - pip check + requires: + - pip + +about: + home: https://github.com/jon-xu/scSplit + summary: Genotype-free demultiplexing of pooled single-cell RNA-Seq + license: MIT + + diff --git a/recipes/freebayes/LICENSE b/recipes/sctriangulate/LICENSE similarity index 87% rename from recipes/freebayes/LICENSE rename to recipes/sctriangulate/LICENSE index 9e3322e991a3d..f8836ff0edea6 100644 --- a/recipes/freebayes/LICENSE +++ b/recipes/sctriangulate/LICENSE @@ -1,4 +1,6 @@ -Copyright (c) 2010 Erik Garrison, Gabor Marth +MIT License + +Copyright (c) 2021 Guangyuan(Frank) Li Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal @@ -7,13 +9,13 @@ to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: -The above copyright notice and this permission notice shall be included in -all copies or substantial portions of the Software. +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, -OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN -THE SOFTWARE. +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. diff --git a/recipes/sctriangulate/meta.yaml b/recipes/sctriangulate/meta.yaml new file mode 100644 index 0000000000000..9d3d2eb7a402a --- /dev/null +++ b/recipes/sctriangulate/meta.yaml @@ -0,0 +1,41 @@ +{% set name = "sctriangulate" %} +{% set version = "0.13.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/sctriangulate-{{ version }}.tar.gz + sha256: dc24a47c912c15d06465ea6ec87599e5bcdf06d18955d964f96eebce445a7bc2 + +build: + number: 0 + noarch: python + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + run_exports: + - {{ pin_subpackage('sctriangulate', max_pin="x.x") }} + +requirements: + host: + - python >=3.7 + - pip + run: + - python >=3.7 + - squidpy + - gseapy ==0.10.4 + - scrublet ==0.2.3 + - yattag + - anytree + - mygene ==3.2.2 + +test: + imports: + - sctriangulate + +about: + home: https://github.com/frankligy/scTriangulate + summary: A Python package to mix-and-match conflicting clustering results in single cell analysis, and generate reconciled clustering solutions. + license: MIT + license_family: MIT + license_file: LICENSE diff --git a/recipes/sdeper/meta.yaml b/recipes/sdeper/meta.yaml index 4c96919459ae1..22d7453514edc 100755 --- a/recipes/sdeper/meta.yaml +++ b/recipes/sdeper/meta.yaml @@ -1,7 +1,7 @@ # This is the recipe file to publish SDePER to Bioconda {% set name = "sdeper" %} -{% set version = "1.0.0" %} +{% set version = "1.2.0" %} package: name: "{{ name|lower }}" @@ -9,7 +9,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 9790a1d6e9534f2354e6257cfc9e82fd5fe3b4ee88ee07296308289dcabcb964 + sha256: d4ea77888be125cbebc1185937778d058e065332aac0f991bc67659e8e597161 build: number: 0 @@ -18,10 +18,12 @@ build: - runImputation = imputation:main script: "{{ PYTHON }} -m pip install . -vv" noarch: python + run_exports: + - {{ pin_subpackage('sdeper', max_pin="x.x") }} requirements: host: - - python >=3.9.12 + - python >=3.9.12,<=3.11 - pip run: - distinctipy ==1.2.2 @@ -31,15 +33,18 @@ requirements: - numpy ==1.22.4 - openpyxl ==3.0.10 - pandas ==1.4.3 - - python >=3.9.12 - - reportlab ==3.6.12 + - python >=3.9.12,<=3.11 + - reportlab ==4.1.0 - scanpy ==1.9.1 - scikit-learn ==1.1.1 - scikit-misc ==0.1.4 - scipy ==1.8.1 - seaborn ==0.11.2 - - tensorflow ==2.9.1 + - tensorflow-base 2.9.1 cpu_* # explicitly specify to use cpu version out from cpu_, cuda, eigen_, gpu_, or mkl_ in conda packages - umap-learn ==0.5.3 + - libopencv ==4.6.0 # install opencv in conda requires installing these 3 packages, headless version is used + - opencv ==4.6.0 + - py-opencv ==4.6.0 test: commands: @@ -54,6 +59,7 @@ about: summary: "Spatial Deconvolution method with Platform Effect Removal" doc_url: "https://sdeper.readthedocs.io/en/latest/" dev_url: "https://github.com/az7jh2/SDePER" + description: "SDePER (Spatial Deconvolution method with Platform Effect Removal) is a hybrid machine learning and regression method to deconvolve Spatial barcoding-based transcriptomic data using reference single-cell RNA sequencing data, considering platform effects removal, sparsity of cell types per capture spot and across-spots spatial correlation in cell type compositions. SDePER is also able to impute cell type compositions and gene expression at unmeasured locations in a tissue map with enhanced resolution." extra: recipe-maintainers: diff --git a/recipes/sdrf-pipelines/meta.yaml b/recipes/sdrf-pipelines/meta.yaml index 781f33c8be3ae..3727971a305b5 100644 --- a/recipes/sdrf-pipelines/meta.yaml +++ b/recipes/sdrf-pipelines/meta.yaml @@ -1,5 +1,5 @@ {% set name = "sdrf-pipelines" %} -{% set version = "0.0.24" %} +{% set version = "0.0.26" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: a52441d8b4be0b597c64973d45a4ad2dc2b91560cf7fbee956080efd9a306dbd + sha256: eba64fddad8ecc05ac3efecc43e19a7ba556ede7cd5b57475277a3ec20195216 build: number: 0 diff --git a/recipes/searchgui/meta.yaml b/recipes/searchgui/meta.yaml index 6108e9779ef2a..5f489c4eb2479 100644 --- a/recipes/searchgui/meta.yaml +++ b/recipes/searchgui/meta.yaml @@ -1,7 +1,7 @@ # Do not forget to update the version string in the searchgui.py file {% set name = "SearchGUI" %} -{% set version = "4.3.5" %} -{% set sha256 = "51458d20745f83c88fe1041d0e3ff64b148538c63795a0b548c1aa3f7ca8f67d" %} +{% set version = "4.3.6" %} +{% set sha256 = "76c3662165e929a82d49408d344409b62057cb0c0cf6a4834b54585a756cf894" %} {% set build = "0" %} package: diff --git a/recipes/searchgui/searchgui.py b/recipes/searchgui/searchgui.py index f697c358d602e..c6c3cfb7c386d 100755 --- a/recipes/searchgui/searchgui.py +++ b/recipes/searchgui/searchgui.py @@ -14,7 +14,7 @@ from os import getenv from os import X_OK -jar_file = 'SearchGUI-4.3.5.jar' +jar_file = 'SearchGUI-4.3.6.jar' default_jvm_mem_opts = ['-Xms2g', '-Xmx4g'] diff --git a/recipes/segalign-full/meta.yaml b/recipes/segalign-full/meta.yaml new file mode 100644 index 0000000000000..500fbccebf7c8 --- /dev/null +++ b/recipes/segalign-full/meta.yaml @@ -0,0 +1,41 @@ +{% set version = "0.1.2.1" %} + +package: + name: segalign-full + version: {{ version }} + +build: + number: 0 + noarch: generic + run_exports: + - {{ pin_compatible('segalign-full', max_pin='x.x') }} + +requirements: + run: + - segalign + - lastz + - ucsc-fatotwobit + +test: + commands: + - segalign --help + - segalign_repeat_masker --help + - lastz --version 2>&1 | grep released + - which faToTwoBit + +about: + home: https://github.com/gsneha26/SegAlign + summary: 'SegAlign: A Scalable GPU-Based Whole Genome Aligner' + description: | + SegAlign is a Scalable GPU System for Pairwise Whole Genome + Alignments based on LASTZ's seed-filter-extend paradigm. + license: MIT + license_family: MIT + license_url: https://github.com/gsneha26/SegAlign/blob/main/LICENSE + doc_url: https://github.com/gsneha26/SegAlign/blob/main/README.md + dev_url: https://github.com/gsneha26/SegAlign + +extra: + identifiers: + - doi:10.1109/SC41405.2020.00043 + - doi:10.5281/zenodo.3880947 diff --git a/recipes/segmetrics/meta.yaml b/recipes/segmetrics/meta.yaml index 73bb5a142078f..bc1fdeceb7031 100644 --- a/recipes/segmetrics/meta.yaml +++ b/recipes/segmetrics/meta.yaml @@ -1,20 +1,20 @@ {% set name = "segmetrics" %} -{% set version = "1.4" %} -{% set repo_url = "https://github.com/BMCV/segmetrics.py" %} -{% set docs_url = "https://segmetrics.readthedocs.io" %} +{% set version = "1.5" %} package: name: "{{ name }}" version: "{{ version }}" source: - url: "{{ repo_url }}/archive/refs/tags/{{ version }}.zip" - sha256: 65fce3cd45c4f1fa0f83013a3f7c245e8ea2698ed94a75454b5f5dc833c97ad5 + url: "https://github.com/BMCV/segmetrics/archive/refs/tags/{{ version }}.zip" + sha256: 3169055e6d7fdc269d7ce0d32c1f5871752001a0e03f13a25de67d52a1b4e386 build: number: 0 noarch: python script: "{{ PYTHON }} -m pip install --no-deps --ignore-installed . -vv " + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} requirements: host: @@ -39,11 +39,11 @@ test: - python -m segmetrics.cli --help about: - home: "{{ repo_url }}" + home: "https://github.com/BMCV/segmetrics" license: MIT summary: "A Python package implementing image segmentation and object detection performance measures, for biomedical image analysis and beyond." - dev_url: "{{ repo_url }}" - doc_url: "{{ docs_url }}" + dev_url: "https://github.com/BMCV/segmetrics" + doc_url: "https://segmetrics.readthedocs.io" extra: recipe-maintainers: diff --git a/recipes/segzoo/meta.yaml b/recipes/segzoo/meta.yaml index 40c193fa5d709..9d650119df3f1 100644 --- a/recipes/segzoo/meta.yaml +++ b/recipes/segzoo/meta.yaml @@ -1,5 +1,5 @@ {% set name = "segzoo" %} -{% set version = "1.0.11" %} +{% set version = "1.0.13" %} package: name: "{{ name|lower }}" @@ -7,26 +7,29 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 3422fc3e29320253e15bafef22d378470ed1d0d88b8364ecb553b756bb9a9d53 + sha256: 03903414891982e4d296f253119cf404a525844abdc84b02285923866926a708 build: noarch: python number: 0 entry_points: - segzoo=segzoo.main:main - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation" + run_exports: + - {{ pin_subpackage('segzoo', max_pin="x") }} requirements: host: - - python >=3.8 + - python >=3.7 - pip run: - - python >=3.8 + - python >=3.7 - seaborn - segtools - ggd - - snakemake + - snakemake-minimal - pybedtools + test: imports: - segzoo @@ -35,7 +38,7 @@ test: about: home: "https://github.com/hoffmangroup/segzoo" - license: "GNU General Public v2 (GPLv2)" + license: "GPL-2.0-or-later" license_family: GPL2 license_file: LICENSE.txt summary: "System for turnkey analysis of semi-automated genome annotations" diff --git a/recipes/selam/meta.yaml b/recipes/selam/meta.yaml index 8a34616bd07a0..befd25c006cac 100644 --- a/recipes/selam/meta.yaml +++ b/recipes/selam/meta.yaml @@ -11,7 +11,9 @@ source: sha256: {{sha256}} build: - number: 2 + number: 3 + run_exports: + - {{ pin_subpackage("selam", max_pin="x.x.x") }} requirements: build: @@ -45,3 +47,5 @@ about: extra: identifiers: - doi:10.1093/bioinformatics/btw365 # Paper in Bioinformatics + additional-platforms: + - linux-aarch64 diff --git a/recipes/semibin/meta.yaml b/recipes/semibin/meta.yaml index bdc98bc800525..3904aca49cebb 100644 --- a/recipes/semibin/meta.yaml +++ b/recipes/semibin/meta.yaml @@ -1,5 +1,5 @@ {% set name = "SemiBin" %} -{% set version = "2.0.2" %} +{% set version = "2.1.0" %} package: name: "{{ name|lower }}" @@ -7,13 +7,14 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: b428a68fa9a16e6c713001f8f5afb0b19ae1997a10b66c54076a72d75b1ad8d8 + sha256: 5345982bbc38e283043867d361ca8db727fec34a4c40b3a70e01914154d39bd5 build: noarch: python number: 0 entry_points: - - SemiBin=SemiBin.main:main1 + - SemiBin=SemiBin.main:main_no_version + - SemiBin1=SemiBin.main:main1 - SemiBin2=SemiBin.main:main2 script: {{ PYTHON }} -m pip install --no-deps --no-build-isolation . -vvv run_exports: @@ -37,7 +38,6 @@ requirements: - mmseqs2 13.45111 - bedtools - hmmer - - fraggenescan - numexpr - prodigal - samtools diff --git a/recipes/sentieon/meta.yaml b/recipes/sentieon/meta.yaml index 2660842aebff9..cb9b80ca081b4 100644 --- a/recipes/sentieon/meta.yaml +++ b/recipes/sentieon/meta.yaml @@ -1,11 +1,11 @@ -{% set version="202308.01" %} +{% set version="202308.02" %} package: name: sentieon version: {{ version }} source: - url: https://s3.amazonaws.com/sentieon-release/software/sentieon-genomics-{{ version }}.tar.gz # [linux64] - sha256: 047899a2b4247adaace82032a6fe269a57f70b1c9ecbc84d77914f902a714d50 # [linux64] + sha256: a04b98c1b7c4e8916fdc45f15685d5fd83db56386ec2478eb5ea594170405bd5 # [linux64] patches: # [linux64] # Fix driver scripts so they resolves location including symlinks - sentieon_symlinks.patch # [linux64] diff --git a/recipes/sentieon/sentieon_symlinks.patch b/recipes/sentieon/sentieon_symlinks.patch index 41c95cc0c9b16..7278200c99ff8 100644 --- a/recipes/sentieon/sentieon_symlinks.patch +++ b/recipes/sentieon/sentieon_symlinks.patch @@ -4,7 +4,7 @@ index 52f51aaefd..e27fea8c2b 100755 +++ b/bin/sentieon @@ -1,13 +1,17 @@ #!/bin/sh - # Copyright (c) 2014-2023 Sentieon Inc. All rights reserved + # Copyright (c) 2014-2024 Sentieon Inc. All rights reserved -case "$0" in -/*) bin_dir=$(dirname "$0");; -*) bin_dir=$(dirname "$(pwd)/$0");; diff --git a/recipes/sepp/4.3.10/build.sh b/recipes/sepp/4.3.10/build.sh new file mode 100644 index 0000000000000..a21681feb1e3a --- /dev/null +++ b/recipes/sepp/4.3.10/build.sh @@ -0,0 +1,42 @@ +#!/bin/bash +set -ex +python setup.py config -c +python setup.py upp -c + +# ensure SEPP's configuration file is at the correct location ... +echo "${PREFIX}/share/sepp/sepp" > home.path +# ensure directory is created ... ($SP_DIR = Python's site-packages location, see https://docs.conda.io/projects/conda-build/en/stable/user-guide/environment-variables.html#environment-variables-set-during-the-build-process) +mkdir -p $SP_DIR/ +# ... before we copy content into it +cp -rv home.path $SP_DIR/ +mkdir -p $PREFIX/share/sepp/sepp +# ... and holds correct path names +mv -v sepp-package/sepp/default.main.config $PREFIX/share/sepp/sepp/main.config +# copy upp config, as it's still needed +cp ./.sepp/upp.config $PREFIX/share/sepp/sepp/upp.config +# replace $PREFIX with /opt/anaconda1anaconda2anaconda3 for later replacement of concrete build PREFIX +# note: can't apply a patch here, as upp.config is not part of upstream but gets generated during python setup +if [ $unamestr == 'Linux' ]; +then + sed -i 's@'"$PREFIX"'@/opt/anaconda1anaconda2anaconda3@g' $PREFIX/share/sepp/sepp/upp.config +elif [ $unamestr == 'Darwin' ]; +then + gsed -i 's@'"$PREFIX"'@/opt/anaconda1anaconda2anaconda3@g' $PREFIX/share/sepp/sepp/upp.config +fi + +$PYTHON -m pip install . --ignore-installed --no-deps -vv + +# copy bundled binaries, but hmmer which should be provided by conda, into $PREFIX/bin/ +mkdir -p $PREFIX/bin/ +cp `cat $SRC_DIR/.sepp/main.config | grep "^path" -m 1 | grep -v "hmm" | cut -d "=" -f 2 | xargs dirname`/* $PREFIX/bin/ +cp `cat $SRC_DIR/.sepp/upp.config | grep "^path" -m 1 | grep -v "hmm" | cut -d "=" -f 2 | xargs dirname`/* $PREFIX/bin/ + +# configure run-sepp.sh for qiime2 fragment-insertion +mv -v sepp-package/run-sepp.sh $PREFIX/bin/run-sepp.sh + +# copy files for tests to shared conda directory +mkdir -p $PREFIX/share/sepp/ref/ +cp -v test/unittest/data/q2-fragment-insertion/input_fragments.fasta $PREFIX/share/sepp/ref/ +cp -v test/unittest/data/q2-fragment-insertion/reference_alignment_tiny.fasta $PREFIX/share/sepp/ref/ +cp -v test/unittest/data/q2-fragment-insertion/reference_phylogeny_tiny.nwk $PREFIX/share/sepp/ref/ +cp -v test/unittest/data/q2-fragment-insertion/RAxML_info-reference-gg-raxml-bl.info $PREFIX/share/sepp/ref/ diff --git a/recipes/sepp/4.3.10/meta.yaml b/recipes/sepp/4.3.10/meta.yaml new file mode 100644 index 0000000000000..74c5177ff7068 --- /dev/null +++ b/recipes/sepp/4.3.10/meta.yaml @@ -0,0 +1,63 @@ +{% set version = "4.3.10" %} +{% set sha256 = "24d8d410138563017e6f2f1263d5e34427f5bbddb875b72a036f7c879cef203b" %} +package: + name: sepp + version: '{{version}}' + +source: + - url: https://github.com/smirarab/sepp/archive/{{version}}.tar.gz + sha256: '{{sha256}}' + patches: + - relocate.run-sepp.sh.patch + - relocate.sepp.config.patch + # prevent python's setup to search for dendropy dependency via pip. + # Instead use dendropy provided by conda: + - nodeps.setup.py.patch + +build: + number: 3 + run_exports: + - {{ pin_subpackage('sepp', max_pin="x") }} + +# upstream is not (yet) compatible with python >=3.10 +requirements: + host: + - python <=3.9 + - setuptools + - pip + - dendropy 4.4.0 + - openjdk + - hmmer ==3.1b2 + + run: + - python <=3.9 + - dendropy 4.4.0 + - openjdk + - hmmer ==3.1b2 + - pasta + # TODO: source bundled binaries as conda packages. + # But pplacer / guppy are not available for OSX. + # - pplacer + +test: + commands: + - run_sepp.py --help + - run-sepp.sh $PREFIX/share/sepp/ref/input_fragments.fasta testrun_tiny -a $PREFIX/share/sepp/ref/reference_alignment_tiny.fasta -t $PREFIX/share/sepp/ref/reference_phylogeny_tiny.nwk -r $PREFIX/share/sepp/ref/RAxML_info-reference-gg-raxml-bl.info -x 1 -b 1 + - grep "f__Halomonadaceae" testrun_tiny_placement.tog.relabelled.tre + - grep "testseqd" testrun_tiny_placement.tog.relabelled.tre + - run_upp.py --help + +about: + home: https://github.com/smirarab/sepp + license: GPLv3 + license_family: GPL3 + license_file: LICENSE + summary: SATe-enabled phylogenetic placement + +extra: + identifiers: + - biotools:sepp + skip-lints: + # necessary, because sepp is NOT platform independent: + # during build time, platform specific binaries for pplacer / guppy are copied into the PREFIX/bin dir + - should_be_noarch_generic diff --git a/recipes/sepp/4.3.10/nodeps.setup.py.patch b/recipes/sepp/4.3.10/nodeps.setup.py.patch new file mode 100644 index 0000000000000..f93b859cf421e --- /dev/null +++ b/recipes/sepp/4.3.10/nodeps.setup.py.patch @@ -0,0 +1,11 @@ +--- setup.py 2019-03-31 07:43:25.000000000 +0200 ++++ setup.py 2019-04-03 12:12:30.701516881 +0200 +@@ -219,7 +219,7 @@ + author_email="smirarab@gmail.com, namphuon@cs.utah.edu", + + license="General Public License (GPL)", +- install_requires=["dendropy >= 4.0.0"], ++ install_requires=[], + provides=["sepp"], + scripts=["run_sepp.py", 'run_tipp.py', 'run_upp.py', 'run_abundance.py', + "split_sequences.py", "run_tipp_tool.py"], diff --git a/recipes/sepp/4.3.10/relocate.run-sepp.sh.patch b/recipes/sepp/4.3.10/relocate.run-sepp.sh.patch new file mode 100644 index 0000000000000..89839cb66476f --- /dev/null +++ b/recipes/sepp/4.3.10/relocate.run-sepp.sh.patch @@ -0,0 +1,36 @@ +--- sepp/sepp-package/run-sepp.sh 2019-03-19 16:33:17.267182143 +0100 ++++ sepp-package/run-sepp.sh 2019-03-19 20:23:08.591954892 +0100 +@@ -111,7 +111,7 @@ + done + + +-DIR=$( cd "$( dirname "${BASH_SOURCE[0]}" )" && pwd ) ++DIR=/opt/anaconda1anaconda2anaconda3/share/sepp/ + + # Reference tree + if [ -z $t ]; then +@@ -134,7 +134,7 @@ + if [ ! -z "$printDebug" ]; then + export SEPP_DEBUG=True + fi; +-python $DIR/sepp/run_sepp.py -P $p -A $a -t $t -a $alg -r $rxi -f $f -o $name $opts -d $tmp/ -p $tmpssd 1>sepp-$name-out.log 2>sepp-$name-err.log ++run_sepp.py -P $p -A $a -t $t -a $alg -r $rxi -f $f -o $name $opts -d $tmp/ -p $tmpssd 1>sepp-$name-out.log 2>sepp-$name-err.log + + tail sepp-$name-* + +@@ -146,13 +146,11 @@ + # we might want to split computation in two parts: a) obtaining placements and b) creation of an insertion tree. + # If -n set to something, we stop after a) and leave it to the user to compute b) afterwards. + if [ -z ${noTree+x} ]; then +- gbin=$( dirname `grep -A1 "pplacer" $DIR/sepp/.sepp/main.config |grep path|sed -e "s/^path=//g"` ) +- +- $gbin/guppy tog ${name}_placement.json ++ guppy tog ${name}_placement.json + + cat ${name}_placement.tog.tre | python ${name}_rename-json.py > ${name}_placement.tog.relabelled.tre + +- $gbin/guppy tog --xml ${name}_placement.json ++ guppy tog --xml ${name}_placement.json + + cat ${name}_placement.tog.xml | python ${name}_rename-json.py > ${name}_placement.tog.relabelled.xml + else diff --git a/recipes/sepp/4.3.10/relocate.sepp.config.patch b/recipes/sepp/4.3.10/relocate.sepp.config.patch new file mode 100644 index 0000000000000..cb5f917265157 --- /dev/null +++ b/recipes/sepp/4.3.10/relocate.sepp.config.patch @@ -0,0 +1,28 @@ +--- sepp-package/sepp/default.main.config 2019-03-18 10:14:42.363446570 +0100 ++++ sepp-package/sepp/default.main.config 2019-04-04 10:10:22.171485197 +0200 +@@ -1,20 +1,20 @@ + [pplacer] +-path=~/pplacer ++path=/opt/anaconda1anaconda2anaconda3/bin/pplacer + + [hmmalign] +-path=~/hmmalign ++path=/opt/anaconda1anaconda2anaconda3/bin/hmmalign + + [hmmsearch] +-path=~/hmmsearch ++path=/opt/anaconda1anaconda2anaconda3/bin/hmmsearch + piped=False + elim=10000 + filters=True + + [hmmbuild] +-path=~/hmmbuild ++path=/opt/anaconda1anaconda2anaconda3/bin/hmmbuild + + [jsonmerger] +-path=~/seppJsonMerger.jar ++path=/opt/anaconda1anaconda2anaconda3/bin/seppJsonMerger.jar + + [exhaustive] + strategy = centroid diff --git a/recipes/sepp/build.sh b/recipes/sepp/build.sh index 679123229a05e..925564b6363c6 100644 --- a/recipes/sepp/build.sh +++ b/recipes/sepp/build.sh @@ -5,13 +5,26 @@ python setup.py upp -c # ensure SEPP's configuration file is at the correct location ... echo "${PREFIX}/share/sepp/sepp" > home.path -cp home.path ${PREFIX}/lib/python*/site-packages/ +# ensure directory is created ... ($SP_DIR = Python's site-packages location, see https://docs.conda.io/projects/conda-build/en/stable/user-guide/environment-variables.html#environment-variables-set-during-the-build-process) +mkdir -p $SP_DIR/ +# ... before we copy content into it +cp -rv home.path $SP_DIR/ mkdir -p $PREFIX/share/sepp/sepp # ... and holds correct path names mv -v sepp-package/sepp/default.main.config $PREFIX/share/sepp/sepp/main.config # copy upp config, as it's still needed cp ./.sepp/upp.config $PREFIX/share/sepp/sepp/upp.config +# replace $PREFIX with /opt/anaconda1anaconda2anaconda3 for later replacement of concrete build PREFIX +# note: can't apply a patch here, as upp.config is not part of upstream but gets generated during python setup +if [ $unamestr == 'Linux' ]; +then + sed -i 's@'"$PREFIX"'@/opt/anaconda1anaconda2anaconda3@g' $PREFIX/share/sepp/sepp/upp.config +elif [ $unamestr == 'Darwin' ]; +then + gsed -i 's@'"$PREFIX"'@/opt/anaconda1anaconda2anaconda3@g' $PREFIX/share/sepp/sepp/upp.config +fi + $PYTHON -m pip install . --ignore-installed --no-deps -vv # copy bundled binaries, but hmmer which should be provided by conda, into $PREFIX/bin/ diff --git a/recipes/sepp/meta.yaml b/recipes/sepp/meta.yaml index 731db6eeaceb8..980e754e11f8c 100644 --- a/recipes/sepp/meta.yaml +++ b/recipes/sepp/meta.yaml @@ -15,13 +15,13 @@ source: - nodeps.setup.py.patch build: - number: 3 + number: 4 run_exports: - {{ pin_subpackage('sepp', max_pin="x") }} requirements: host: - - python 3.7 + - python <=3.9 - setuptools - pip - dendropy <=4.5.1 @@ -29,7 +29,7 @@ requirements: - hmmer ==3.1b2 run: - - python 3.7 + - python <=3.9 - dendropy <=4.5.1 - openjdk - hmmer ==3.1b2 diff --git a/recipes/seq2science/meta.yaml b/recipes/seq2science/meta.yaml index dd78a09be0e26..87aeaebd5f332 100644 --- a/recipes/seq2science/meta.yaml +++ b/recipes/seq2science/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.2.1" %} +{% set version = "1.2.2" %} package: name: seq2science @@ -6,7 +6,7 @@ package: source: url: https://github.com/vanheeringen-lab/seq2science/archive/v{{ version }}.tar.gz - sha256: f4543413118f9bdf69e1143f14708f4debf2f1089952569d55a1ca539d676bff + sha256: 5adbaf1689e8f302ec2d5c98f85a206b51f17d0e70e3fc0f16d872ae2099fdc5 build: noarch: python diff --git a/recipes/seqan3/fix_glibcxx_debug.patch b/recipes/seqan3/fix_glibcxx_debug.patch new file mode 100644 index 0000000000000..529cc94d0f3f9 --- /dev/null +++ b/recipes/seqan3/fix_glibcxx_debug.patch @@ -0,0 +1,25 @@ +From 47b77ef92911ff1667f4487edb3961f0c28f407b Mon Sep 17 00:00:00 2001 +From: Simon Gene Gottlieb +Date: Wed, 17 Jan 2024 12:09:11 +0100 +Subject: [PATCH] [FIX] Do not use constexpr vector with _GLIBCXX_DEBUG + +--- + include/seqan3/core/platform.hpp | 2 +- + 1 file changed, 1 insertion(+), 1 deletion(-) + +diff --git a/include/seqan3/core/platform.hpp b/include/seqan3/core/platform.hpp +index 1fd92faa7..e0c7687fe 100644 +--- a/include/seqan3/core/platform.hpp ++++ b/include/seqan3/core/platform.hpp +@@ -252,7 +252,7 @@ static_assert(sdsl::sdsl_version_major == 3, "Only version 3 of the SDSL is supp + #endif + + //!\brief Our char literals returning std::vector should be constexpr if constexpr std::vector is supported. +-#if defined(__cpp_lib_constexpr_vector) && __cpp_lib_constexpr_vector >= 201907L ++#if __cpp_lib_constexpr_vector >= 201907L && !defined(_GLIBCXX_DEBUG) + # define SEQAN3_WORKAROUND_LITERAL constexpr + #else + # define SEQAN3_WORKAROUND_LITERAL inline +-- +2.43.0 + diff --git a/recipes/seqan3/meta.yaml b/recipes/seqan3/meta.yaml index c5f14a78f7ae3..abb3a201426e9 100644 --- a/recipes/seqan3/meta.yaml +++ b/recipes/seqan3/meta.yaml @@ -8,10 +8,12 @@ package: source: url: https://github.com/seqan/{{ name|lower }}/releases/download/{{ version }}/seqan3-{{ version }}-Source.tar.xz sha256: da2fb621268ebc52b9cc26087e96f4a94109db1f4f28d363d19c7c9cdbd788b1 + patches: + - fix_glibcxx_debug.patch # Fix will be included in 3.4.0 build: noarch: generic - number: 0 + number: 1 run_exports: - {{ pin_subpackage('seqan3', max_pin="x") }} diff --git a/recipes/seqerakit/meta.yaml b/recipes/seqerakit/meta.yaml index 4ee5c9b1f6cd7..d25275da10179 100644 --- a/recipes/seqerakit/meta.yaml +++ b/recipes/seqerakit/meta.yaml @@ -1,5 +1,5 @@ {% set name = "seqerakit" %} -{% set version = "0.4.5" %} +{% set version = "0.4.7" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/seqerakit-{{ version }}.tar.gz - sha256: 792bd4fa53de4b3959929413d1ad8f39e20587971c9c5451419da1ff68cf3f49 + sha256: ad87c8f9561811b09bb163da29914a9ef16e6b75dd6485bf776236d948a665a3 build: entry_points: diff --git a/recipes/seqfu/build.sh b/recipes/seqfu/build.sh index 41e15120f4793..0b5b964b47460 100644 --- a/recipes/seqfu/build.sh +++ b/recipes/seqfu/build.sh @@ -14,19 +14,25 @@ export CFLAGS="$CFLAGS -I$PREFIX/include" export LDFLAGS="$LDFLAGS -L$PREFIX/lib" export CPATH=${PREFIX}/include -echo "GXX: $GXX" -echo "GCC: $GCC" +echo "GXX: ${GXX:-'not set'}" +echo "GCC: ${GCC:-'not set'}" echo "----------" -echo "Patching makefile" -# Trying to fix build when gcc or g++ are required -sed -i 's/gcc/$(GCC)/g' Makefile -sed -i 's/g++/$(GXX)/g' Makefile -sed -i '1iGCC ?= gcc' Makefile -sed -i '1iGXX ?= g++' Makefile + + if [[ $OSTYPE == "darwin"* ]]; then + echo "OSX" export HOME="/Users/distiller" export HOME=`pwd` +else + # Trying to fix build when gcc or g++ are required + echo "LINUX: Patching makefile" + sed -i 's/gcc/gcc $(LDFLAGS)/g' Makefile + sed -i 's/g++/g++ $(LDFLAGS)/g' Makefile + sed -i 's/gcc/$(GCC)/g' Makefile + sed -i 's/g++/$(GXX)/g' Makefile + sed -i '1iGCC ?= gcc' Makefile + sed -i '1iGXX ?= g++' Makefile fi mkdir -p "$PREFIX"/bin diff --git a/recipes/seqfu/meta.yaml b/recipes/seqfu/meta.yaml index b8c6278466772..13b66f49d86fe 100644 --- a/recipes/seqfu/meta.yaml +++ b/recipes/seqfu/meta.yaml @@ -11,8 +11,7 @@ source: sha256: {{ sha256 }} build: - number: 0 - skip: True # Let's skip MacOS until we find out more + number: 1 run_exports: - {{ pin_subpackage(name, max_pin="x.x") }} @@ -49,6 +48,8 @@ about: Tools to interleave and deinterleave, to calculate stats, and extract portions of sequence datasets. extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - telatin identifiers: diff --git a/recipes/seqkit/meta.yaml b/recipes/seqkit/meta.yaml index 845a461c51f7a..da25cd788f00c 100644 --- a/recipes/seqkit/meta.yaml +++ b/recipes/seqkit/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.6.1" %} +{% set version = "2.8.1" %} package: name: seqkit @@ -6,10 +6,13 @@ package: source: url: https://github.com/shenwei356/seqkit/releases/download/v{{ version }}/seqkit_darwin_amd64.tar.gz # [osx] - md5: c3596d65d5fa973a7c65485a97d735ac # [osx] + md5: f68fcff143f20385110498803aabe9ac # [osx] url: https://github.com/shenwei356/seqkit/releases/download/v{{ version }}/seqkit_linux_amd64.tar.gz # [linux] - md5: c48e7806a03cb9e3f2c1a091c9113908 # [linux] + md5: bf0800bdfbdae8434a2c696e585740fc # [linux] + + url: https://github.com/shenwei356/seqkit/releases/download/v{{ version }}/seqkit_linux_arm64.tar.gz # [aarch64] + md5: b84657ab1186f4ac07f92bb5f98e10d2 # [aarch64] build: number: 0 @@ -26,6 +29,8 @@ about: license: MIT extra: + additional-platforms: + - linux-aarch64 skip-lints: - should_be_noarch_generic - should_not_be_noarch_source diff --git a/recipes/seqnado/meta.yaml b/recipes/seqnado/meta.yaml new file mode 100644 index 0000000000000..96fbd7eb7d54e --- /dev/null +++ b/recipes/seqnado/meta.yaml @@ -0,0 +1,67 @@ +{% set name = "seqnado" %} +{% set version = "0.5.1" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/seqnado-{{ version }}.tar.gz + sha256: 3202446e4b1fdb046b5b79c30e5558e84fb05b7b7a507d0c9bfaf279fba5effa + + +build: + number: 1 + noarch: python + script_env: + - SETUPTOOLS_SCM_PRETEND_VERSION={{ version }} + script: {{ PYTHON }} -m pip install . --no-deps -vvv + entry_points: + - seqnado = seqnado.cli:cli_pipeline + - seqnado-design = seqnado.cli:cli_design + - seqnado-config = seqnado.cli:cli_config + run_exports: + - {{ pin_subpackage('seqnado', max_pin="x.x") }} + +requirements: + host: + - python >=3.10 + - setuptools >=61.0 + - wheel + - setuptools-scm >=6.2 + - pip + run: + - click + - cookiecutter + - drmaa + - pandas + - pulp <=2.7.0 + - pydantic + - python >=3.10 + - pyyaml + - seaborn + - setuptools-scm + - singularity + - snakemake >=8, <9 + - snakemake-wrapper-utils + - tracknado + - wget + +test: + imports: + - seqnado + commands: + - seqnado --help + - seqnado-design --help + - seqnado-config --help + +about: + home: https://alsmith151.github.io/SeqNado/ + summary: Pipelines for genomics analysis + license: GPL-3.0-or-later + license_file: LICENSE + +extra: + recipe-maintainers: + - alsmith151 + - CChahrour diff --git a/recipes/seqsero2/meta.yaml b/recipes/seqsero2/meta.yaml index 2ee2a03b296e5..577b4e289f04a 100644 --- a/recipes/seqsero2/meta.yaml +++ b/recipes/seqsero2/meta.yaml @@ -1,6 +1,6 @@ {% set name = "SeqSero2" %} -{% set version = "1.2.1" %} -{% set sha256 = "911b3f31ed35b7ac421001ab739782895c479f1e3a733ad17210069c8b7011ff" %} +{% set version = "1.3.1" %} +{% set sha256 = "5fa2a0957d053f36061fa76f5a4de6ea3d33b5307f4c122dc4cdf807d1c3514d" %} package: name: '{{ name | lower }}' @@ -11,9 +11,11 @@ source: sha256: '{{ sha256 }}' build: - number: 0 + number: 1 noarch: python - script: python -m pip install --no-deps --ignore-installed . + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + run_exports: + - {{ pin_subpackage('seqsero2', max_pin="x") }} requirements: host: @@ -26,10 +28,11 @@ requirements: - samtools >=1.8 - bedtools =2.17.0 - sra-tools >=2.8.0 - - spades >=3.9.0 + - spades >=3.15.5 - sra-tools >=2.8.0 - salmid =0.1.23 - bwa >=0.7.12 + - seqtk >=1.3 test: commands: - SeqSero2_package.py -h @@ -38,7 +41,7 @@ test: about: home: https://github.com/denglab/{{ name }} - license: GPLv2 + license: GPL-2.0-or-later license_family: GPL license_file: 'LICENSE' summary: Salmonella serotype prediction from genome sequencing data diff --git a/recipes/seqsizzle/LICENSE.md b/recipes/seqsizzle/LICENSE.md new file mode 100644 index 0000000000000..fe6b9036ba181 --- /dev/null +++ b/recipes/seqsizzle/LICENSE.md @@ -0,0 +1,662 @@ + GNU AFFERO GENERAL PUBLIC LICENSE + Version 3, 19 November 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU Affero General Public License is a free, copyleft license for +software and other kinds of works, specifically designed to ensure +cooperation with the community in the case of network server software. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +our General Public Licenses are intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + Developers that use our General Public Licenses protect your rights +with two steps: (1) assert copyright on the software, and (2) offer +you this License which gives you legal permission to copy, distribute +and/or modify the software. + + A secondary benefit of defending all users' freedom is that +improvements made in alternate versions of the program, if they +receive widespread use, become available for other developers to +incorporate. Many developers of free software are heartened and +encouraged by the resulting cooperation. However, in the case of +software used on network servers, this result may fail to come about. +The GNU General Public License permits making a modified version and +letting the public access it on a server without ever releasing its +source code to the public. + + The GNU Affero General Public License is designed specifically to +ensure that, in such cases, the modified source code becomes available +to the community. It requires the operator of a network server to +provide the source code of the modified version running there to the +users of that server. Therefore, public use of a modified version, on +a publicly accessible server, gives the public access to the source +code of the modified version. + + An older license, called the Affero General Public License and +published by Affero, was designed to accomplish similar goals. This is +a different license, not a version of the Affero GPL, but Affero has +released a new version of the Affero GPL which permits relicensing under +this license. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU Affero General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Remote Network Interaction; Use with the GNU General Public License. + + Notwithstanding any other provision of this License, if you modify the +Program, your modified version must prominently offer all users +interacting with it remotely through a computer network (if your version +supports such interaction) an opportunity to receive the Corresponding +Source of your version by providing access to the Corresponding Source +from a network server at no charge, through some standard or customary +means of facilitating copying of software. This Corresponding Source +shall include the Corresponding Source for any work covered by version 3 +of the GNU General Public License that is incorporated pursuant to the +following paragraph. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the work with which it is combined will remain governed by version +3 of the GNU General Public License. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU Affero General Public License from time to time. Such new versions +will be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU Affero General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU Affero General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU Affero General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + + Copyright (C) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as published + by the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . + +Also add information on how to contact you by electronic and paper mail. + + If your software can interact with users remotely through a computer +network, you should also make sure that it provides a way for users to +get its source. For example, if your program is a web application, its +interface could display a "Source" link that leads users to an archive +of the code. There are many ways you could offer source, and different +solutions will be better for different programs; see section 13 for the +specific requirements. + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU AGPL, see +. + diff --git a/recipes/seqsizzle/build.sh b/recipes/seqsizzle/build.sh new file mode 100644 index 0000000000000..397f07f5695be --- /dev/null +++ b/recipes/seqsizzle/build.sh @@ -0,0 +1,7 @@ +#!/bin/bash -euo + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="$(pwd)/.cargo" + +RUST_BACKTRACE=1 cargo install --verbose --path . --root $PREFIX diff --git a/recipes/seqsizzle/meta.yaml b/recipes/seqsizzle/meta.yaml new file mode 100644 index 0000000000000..04e45be842289 --- /dev/null +++ b/recipes/seqsizzle/meta.yaml @@ -0,0 +1,40 @@ +{% set version = "0.1.4" %} +{% set sha256 = "8c8fd6ff9c3752676fa6673fe3cdab32220033c0b5790828740430f8890f20e3" %} + +package: + name: seqsizzle + version: {{ version }} + +source: + url: https://github.com/ChangqingW/SeqSizzle/archive/v{{version}}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage('seqsizzle', max_pin="x") }} + +requirements: + build: + - {{ compiler("c") }} + - rust + - pkg-config + host: + - xz + - zlib + - bzip2 + run: + - xz + - zlib + - bzip2 + +test: + commands: + - seqsizzle -h + +about: + home: https://github.com/ChangqingW/SeqSizzle + license: AGPL-3.0-or-later + licence_family: AGPL + license_file: LICENSE.md + summary: A pager for viewing FASTQ files with fuzzy adaptor matching and coloring. diff --git a/recipes/seqtk/meta.yaml b/recipes/seqtk/meta.yaml index df6b2e5bb7c06..6425b4714964d 100644 --- a/recipes/seqtk/meta.yaml +++ b/recipes/seqtk/meta.yaml @@ -12,7 +12,9 @@ source: - 0001-makefile.patch build: - number: 1 + number: 2 + run_exports: + - {{ pin_subpackage('seqtk', max_pin="x.x") }} requirements: build: @@ -33,5 +35,7 @@ about: summary: Seqtk is a fast and lightweight tool for processing sequences in the FASTA or FASTQ format extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:seqtk diff --git a/recipes/sequali/meta.yaml b/recipes/sequali/meta.yaml index 8aeec56e9acfe..6efff8664aeb6 100644 --- a/recipes/sequali/meta.yaml +++ b/recipes/sequali/meta.yaml @@ -1,5 +1,5 @@ {% set name = "sequali" %} -{% set version = "0.4.1" %} +{% set version = "0.7.1" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: cc62e1641d85fc14eaa70418f0e32cac2b0639374d8b1eba9e9d95388daab369 + sha256: 4c77a54e986c8afbac80e3cc5511b0b1a53e6d8572db11ea691edd83fa58e08c build: number: 0 @@ -28,10 +28,10 @@ requirements: host: - python run: - - pygal >=3.0.0 + - pygal >=3.0.4 - python - tqdm - - xopen >=1.8.0 + - xopen >=2.0.0 test: imports: diff --git a/recipes/sequenoscope/meta.yaml b/recipes/sequenoscope/meta.yaml index 2d9184f285845..59a8abbf2222c 100644 --- a/recipes/sequenoscope/meta.yaml +++ b/recipes/sequenoscope/meta.yaml @@ -9,7 +9,7 @@ source: sha256: aac98d2ab286da78c9c4b621e52cac2a16fd6ea3d1200b05861bf82e3fb49701 build: - number: 0 + number: 1 noarch: python run_exports: - {{ pin_subpackage("sequenoscope", max_pin="x.x") }} @@ -26,7 +26,7 @@ requirements: - pysam >=0.16.0 - minimap2 >=2.26 - mash >=2.3 - - fastp >=0.22.0 + - fastp >=0.22.0,<=0.23.2 - seqtk >=1.4 - plotly >=5.16.1 - biopython >=1.7 diff --git a/recipes/seqwish/meta.yaml b/recipes/seqwish/meta.yaml index 14eeca808d85c..61ad99d0a7389 100644 --- a/recipes/seqwish/meta.yaml +++ b/recipes/seqwish/meta.yaml @@ -1,5 +1,5 @@ {% set name = "seqwish" %} -{% set version = "0.7.9" %} +{% set version = "0.7.10" %} package: name: "{{ name }}" @@ -7,11 +7,13 @@ package: source: url: https://github.com/ekg/{{ name }}/releases/download/v{{ version }}/{{ name }}-v{{ version }}.tar.gz - sha256: 1ca7ebf02a35ad147c8a2b81f087aaba2deb878fec7acb4deb9f14e932e89d36 + sha256: 133b32c9c99caf44eba955b74bae338681da78300e4b21269e07475f88c88b29 build: skip: True # [osx] - number: 2 + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} + number: 0 requirements: build: diff --git a/recipes/sercol/meta.yaml b/recipes/sercol/meta.yaml index 47cefcfa8bf95..cedf8663759d9 100644 --- a/recipes/sercol/meta.yaml +++ b/recipes/sercol/meta.yaml @@ -1,5 +1,5 @@ {% set name = "sercol" %} -{% set version = "0.1.4" %} +{% set version = "1.0.0" %} package: name: "{{ name|lower }}" @@ -7,12 +7,14 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: eab962cf60bccb3c500b0eac7f51e865efefc4203d0323da3c4d5414e0b4e577 + sha256: 6507f5efcee4596eb77c45f1580ff562533ef5d115918a6a28bc4eac09ec191c build: number: 0 noarch: python - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('sercol', max_pin="x") }} requirements: host: @@ -30,7 +32,8 @@ test: about: home: "https://github.com/openvax/sercol" - license: Apache Software + license: Apache-2.0 + license_file: LICENSE license_family: APACHE summary: "Rich collection class with grouping and filtering helpers" diff --git a/recipes/serotypefinder/build.sh b/recipes/serotypefinder/build.sh index f86371d384563..bdcf3a4a8221e 100644 --- a/recipes/serotypefinder/build.sh +++ b/recipes/serotypefinder/build.sh @@ -5,32 +5,23 @@ mkdir -p ${PREFIX}/bin chmod +x serotypefinder.py cp serotypefinder.py ${PREFIX}/bin/serotypefinder +# create folder for database download +target=${PREFIX}/share/${PKG_NAME}-${PKG_VERSION} +mkdir -p ${target}/db/ +touch ${target}/db/.empty + +# copy script to download database +cp ${RECIPE_DIR}/download-db.sh ${PREFIX}/bin +chmod +x ${PREFIX}/bin/download-db.sh + # copy script to download database chmod +x ${RECIPE_DIR}/update-serotypefinder-db.sh cp ${RECIPE_DIR}/update-serotypefinder-db.sh ${PREFIX}/bin/update-serotypefinder-db -# Grab latest database -# The SerotypeFinder database is not tagged and versioned, but it's also not updated -# very often (~7 commits in 5 years). 25ddd141d245db6382ca5876f7c7ddd0288aeb30 is the -# latest commit as of 2021/07/22. A script is provided to allow users to update in the -# event an update is made. -mkdir database/ -git clone https://bitbucket.org/genomicepidemiology/serotypefinder_db.git database/ -cd database/ -git checkout 25ddd141d245db6382ca5876f7c7ddd0288aeb30 -python3 INSTALL.py -echo "25ddd141d245db6382ca5876f7c7ddd0288aeb30" > serotypefinder-db-commit.txt -cd .. - -# Path for database -outdir=${PREFIX}/share/${PKG_NAME}-${PKG_VERSION}-${PKG_BUILDNUM} -mkdir -p ${outdir}/ -mv ./database/ ${outdir}/ - # set SEROTYPEFINDER_DB variable on env activation mkdir -p ${PREFIX}/etc/conda/activate.d ${PREFIX}/etc/conda/deactivate.d cat <> ${PREFIX}/etc/conda/activate.d/serotypefinder.sh -export SEROTYPEFINDER_DB=${outdir}/database/ +export SEROTYPEFINDER_DB=${target}/db/ EOF cat <> ${PREFIX}/etc/conda/deactivate.d/serotypefinder.sh diff --git a/recipes/serotypefinder/download-db.sh b/recipes/serotypefinder/download-db.sh new file mode 100644 index 0000000000000..74296aca0dcd7 --- /dev/null +++ b/recipes/serotypefinder/download-db.sh @@ -0,0 +1,21 @@ +#!/usr/bin/env bash + +echo "Downloading SerotypeFinder database to ${SEROTYPEFINDER_DB}..." + +# Grab latest database +# The SerotypeFinder database is not tagged and versioned, but it's also not updated +# very often (~7 commits in 5 years). ada62c62a7fa74032448bb2273d1f7045c59fdda is the +# latest commit as of 2022/05/16. A script is provided to allow users to update in the +# event an update is made. + +cd ${SEROTYPEFINDER_DB} +# download SerotypeFinder database +git clone https://bitbucket.org/genomicepidemiology/serotypefinder_db.git db_serotypefinder +cd db_serotypefinder +python3 INSTALL.py +git rev-parse HEAD > serotypefinder-db-commit.txt +cd .. + +echo "SerotypeFinder database is downloaded." + +exit 0 diff --git a/recipes/serotypefinder/meta.yaml b/recipes/serotypefinder/meta.yaml index ae555ddfebb03..9bbaafbbaa65d 100644 --- a/recipes/serotypefinder/meta.yaml +++ b/recipes/serotypefinder/meta.yaml @@ -1,5 +1,5 @@ {% set name = "SerotypeFinder" %} -{% set version = "2.0.1" %} +{% set version = "2.0.2" %} package: name: "{{ name|lower }}" @@ -7,23 +7,27 @@ package: source: url: https://bitbucket.org/genomicepidemiology/{{ name|lower }}/get/{{ version }}.tar.gz - sha256: b937c0d85085f77f750665f28181656e5fb689e0d19a920ff7064f2ab4463783 + sha256: c6e13a3ef91c2f137bad99925a6b64e31330b768a4d8214bb767a51b3ea11446 patches: - - database_path.patch + - database_path.patch build: - number: 0 + number: 1 noarch: generic + run_exports: + - {{ pin_subpackage('serotypefinder', max_pin="x") }} requirements: + host: + - python >=3.8 run: - - biopython =1.73 + - biopython >=1.79 - blast >=2.8.1 - cgecore >=1.5.5 - kma - - python >=3 - - tabulate >=0.7.7 - + - python >=3.8 + - tabulate >=0.8.9 + - git test: commands: diff --git a/recipes/sevenbridges-python/meta.yaml b/recipes/sevenbridges-python/meta.yaml index 7c534eeee72b4..43ffddea1b422 100644 --- a/recipes/sevenbridges-python/meta.yaml +++ b/recipes/sevenbridges-python/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.10.0" %} -{% set sha256 = "6e370de45b5af6574a2937e8a8aba76108f779f55982b360eb796a113e9399e6" %} +{% set version = "2.11.0" %} +{% set sha256 = "0a20b2f75cc9110adad747c0cfe7b7389b1c978008a77fae942ab66614f32534" %} package: name: sevenbridges-python diff --git a/recipes/severus/meta.yaml b/recipes/severus/meta.yaml index 6fbcfbe6a28f5..313e6ac2f4c3d 100644 --- a/recipes/severus/meta.yaml +++ b/recipes/severus/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.1.2" %} +{% set version = "1.0" %} package: name: severus @@ -6,13 +6,13 @@ package: source: url: https://github.com/KolmogorovLab/Severus/archive/refs/tags/{{ version }}.tar.gz - sha256: 6fd60f673aea6e6ff930a207311be3c533a944c8875e9a677235b99dc18e5135 + sha256: c14b76b4c952f8c68adbdd885e7c59e3500714aad39eaef00302a8c57aea82c7 build: number: 0 noarch: python run_exports: - - {{ pin_subpackage('severus', max_pin='x.x') }} + - {{ pin_subpackage('severus', max_pin='x') }} requirements: host: @@ -31,6 +31,7 @@ requirements: - biopython - numpy - pysam + - plotly extra: skip-lints: diff --git a/recipes/shiver/build.sh b/recipes/shiver/build.sh index 54b89dbf3429e..9ec97bacf120e 100644 --- a/recipes/shiver/build.sh +++ b/recipes/shiver/build.sh @@ -1,16 +1,16 @@ #!/bin/bash mkdir $PREFIX/bin -mkdir $PREFIX/bin/tools -install ${SRC_DIR}/shiver_align_contigs.sh -t $PREFIX/bin -install ${SRC_DIR}/shiver_full_auto.sh -t $PREFIX/bin -install ${SRC_DIR}/shiver_funcs.sh -t $PREFIX/bin -install ${SRC_DIR}/shiver_init.sh -t $PREFIX/bin -install ${SRC_DIR}/shiver_map_reads.sh -t $PREFIX/bin - -install ${SRC_DIR}/tools/*.py -t $PREFIX/bin/tools/ -install ${SRC_DIR}/tools/*.R -t $PREFIX/bin/tools/ -install ${SRC_DIR}/tools/*.sh -t $PREFIX/bin/tools/ - - +mkdir $PREFIX/bin/tools +mkdir $PREFIX/data +mkdir $PREFIX/data/external +install ${SRC_DIR}/bin/shiver_align_contigs.sh -t $PREFIX/bin +install ${SRC_DIR}/bin/shiver_funcs.sh -t $PREFIX/bin +install ${SRC_DIR}/bin/shiver_init.sh -t $PREFIX/bin +install ${SRC_DIR}/bin/shiver_map_reads.sh -t $PREFIX/bin +install ${SRC_DIR}/bin/config.sh -t $PREFIX/bin +install ${SRC_DIR}/bin/tools/*.py -t $PREFIX/bin/tools/ +install ${SRC_DIR}/bin/tools/*.R -t $PREFIX/bin/tools/ +install ${SRC_DIR}/bin/tools/*.sh -t $PREFIX/bin/tools/ +install ${SRC_DIR}/data/external/B.FR.83.HXB2_LAI_IIIB_BRU.K03455.fasta -t $PREFIX/data/external diff --git a/recipes/shiver/meta.yaml b/recipes/shiver/meta.yaml index 267510208db68..0838950193b3e 100644 --- a/recipes/shiver/meta.yaml +++ b/recipes/shiver/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.5.7" %} # put in correct version here +{% set version = "1.7.3" %} # put in correct version here {% set name = "shiver" %} package: @@ -6,11 +6,12 @@ package: version: {{ version }} source: url: https://github.com/ChrisHIV/{{ name|lower }}/archive/v{{ version }}.tar.gz - sha256: 64973462bfc10c725ef5f21e85532ef8dd58d26795b2cee326a77f690d31ebf0 - patches: - - python2-python3.patch + sha256: 4d373bf4d257e52ea1cc548c492bfe654dc677c65df1d07402f898f73c9f1c65 build: - number: 1 + number: 0 + noarch: generic + run_exports: + - {{ pin_subpackage('shiver', max_pin="x") }} requirements: @@ -21,16 +22,18 @@ requirements: - samtools - biopython - mafft - - picard - blast >=2.2.28 - pyfastaq + - six + - pandas + - bc test: commands: - - shiver_init.sh 2>&1 | grep "Arguments" - - shiver_full_auto.sh 2>&1 | grep "Arguments" - - shiver_align_contigs.sh 2>&1 | grep "Arguments" - - shiver_map_reads.sh 2>&1 | grep "Arguments" + - shiver_init.sh --test $PREFIX/bin/config.sh + - shiver_align_contigs.sh --test $PREFIX/bin/config.sh + - shiver_map_reads.sh --test $PREFIX/bin/config.sh paired + - $PREFIX/bin/tools/TestPythonModulesInstalled.py about: home: https://github.com/ChrisHIV/shiver @@ -43,3 +46,4 @@ extra: recipe-maintainers: - notestaff - gtonkinhill + - chrishiv diff --git a/recipes/sigprofilermatrixgenerator/meta.yaml b/recipes/sigprofilermatrixgenerator/meta.yaml new file mode 100644 index 0000000000000..e608211acf216 --- /dev/null +++ b/recipes/sigprofilermatrixgenerator/meta.yaml @@ -0,0 +1,47 @@ +{% set name = "SigProfilerMatrixGenerator" %} +{% set version = "1.2.26" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/SigProfilerMatrixGenerator-{{ version }}.tar.gz + sha256: c405db79fbe5e42447e3ec2ae8b85519cc2ab8e94b23f66f50e8963345b2f797 + +build: + entry_points: + - SigProfilerMatrixGenerator=SigProfilerMatrixGenerator.scripts.SigProfilerMatrixGenerator_CLI:main_function + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x") }} + +requirements: + host: + - python >=3.8 + - pip + run: + - python >=3.8 + - matplotlib-base >=2.2.2 + - sigprofilerplotting >=1.3.16 + - statsmodels >=0.9.0 + - scipy >=1.1.0 + - numpy >=1.18.5 + - pandas >=0.23.4,<2.0.0 + +test: + imports: + - SigProfilerMatrixGenerator + commands: + - pip check + - SigProfilerMatrixGenerator install --help + requires: + - pip + +about: + home: https://github.com/AlexandrovLab/SigProfilerMatrixGenerator.git + summary: SigProfiler matrix generator tool + license: BSD-2-Clause + license_file: LICENSE diff --git a/recipes/sigprofilerplotting/meta.yaml b/recipes/sigprofilerplotting/meta.yaml new file mode 100644 index 0000000000000..0487d51de9645 --- /dev/null +++ b/recipes/sigprofilerplotting/meta.yaml @@ -0,0 +1,45 @@ +{% set name = "SigProfilerPlotting" %} +{% set version = "1.3.22" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/sigProfilerPlotting-{{ version }}.tar.gz + sha256: a14a11504b01fa11f4fade4931818052f42d00fa5eabf107804442f1af066d28 + +build: + entry_points: + - SigProfilerPlotting=sigProfilerPlotting.sigProfilerPlotting_CLI:main_function + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x") }} + +requirements: + host: + - python + - pip + run: + - python + - matplotlib-base >=3.4.3 + - pandas >=1.2.4,<2.0.0 + - scikit-learn >=1.1.3 + - pillow >=10.0.0 + +test: + imports: + - sigProfilerPlotting + commands: + - pip check + - SigProfilerPlotting plotSBS --help + requires: + - pip + +about: + home: https://github.com/alexandrovlab/SigProfilerPlotting + summary: SigProfiler plotting tool + license: BSD-2-Clause + license_file: LICENSE diff --git a/recipes/simpleaf/meta.yaml b/recipes/simpleaf/meta.yaml index 689fa08030ddc..3d1763a882e62 100644 --- a/recipes/simpleaf/meta.yaml +++ b/recipes/simpleaf/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.15.1" %} +{% set version = "0.16.2" %} package: name: simpleaf @@ -12,7 +12,7 @@ build: source: url: https://github.com/COMBINE-lab/simpleaf/archive/v{{ version }}.tar.gz - sha256: 888ebb199a27ef4f009fa890fce221da3ed8b08420269faee3169e48d754932a + sha256: e35fb2773b3f4f158d23ebc6d0b51aed29ea54206a3c57a56931325e67add720 requirements: build: @@ -25,6 +25,7 @@ requirements: run: - alevin-fry >=0.8.1 - salmon >=1.10.1 + - piscem >=0.7.0 # [not osx-arm64] test: commands: diff --git a/recipes/sirius-csifingerid/meta.yaml b/recipes/sirius-csifingerid/meta.yaml index ef47cac572991..818c2dd93a169 100644 --- a/recipes/sirius-csifingerid/meta.yaml +++ b/recipes/sirius-csifingerid/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "5.8.5" %} +{% set version = "5.8.6" %} {% set siriusDistDir = "sirius_gui_dist" %} package: @@ -15,7 +15,7 @@ build: source: - url: https://github.com/boecker-lab/sirius/archive/refs/tags/v{{ version }}.zip - sha256: 72bf7762f143740c6f2be06a268149e85787c97064586791348b8a27f9e9f5c8 + sha256: f769a474140d6e28168d6d1526afc9e923e66eaeb0ace400e6c2ae77aa7f9202 requirements: build: diff --git a/recipes/sistr_cmd/build.sh b/recipes/sistr_cmd/build.sh new file mode 100644 index 0000000000000..27efb5e5b1c08 --- /dev/null +++ b/recipes/sistr_cmd/build.sh @@ -0,0 +1,3 @@ +#!/bin/bash +python -m pip install . --no-deps --no-build-isolation --ignore-installed --no-cache-dir -vvv +${PREFIX}/bin/sistr_init diff --git a/recipes/sistr_cmd/meta.yaml b/recipes/sistr_cmd/meta.yaml index b87ccfaeab3f3..ed0a38044b262 100644 --- a/recipes/sistr_cmd/meta.yaml +++ b/recipes/sistr_cmd/meta.yaml @@ -1,33 +1,44 @@ {% set name = "sistr_cmd" %} -{% set version = "1.1.1" %} +{% set version = "1.1.2" %} package: name: "{{ name|lower }}" version: "{{ version }}" source: - url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: bf6f076b2bf4b7df78ff86bc905f11f19f982bddc812effb1ae373de86d4ae6f + url: https://github.com/phac-nml/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: 5acffbaeb345bb6bdea4fae3317e651c254b114b37762eeb284c5bfa928329a2 + build: + number: 1 noarch: python - number: 3 - script: "{{ PYTHON }} -m pip install . --no-deps -vv" + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} + entry_points: + - sistr=sistr.sistr_cmd:main + - sistr_init=sistr.sistr_cmd:setup_sistr_dbs requirements: host: - - python + - python >=3.4 - pip + - setuptools ==58.2.0 + - pandas >=0.22,<3 + - pycurl + - scipy >=1.1.0,<2 + - pytables >=3.3.0 + - numpy run: - - python - - numpy >=1.11.1,<1.23.5 - - pandas >=0.18.1,<=1.0.5 + - python >=3.4 + - {{ pin_compatible('numpy', max_pin="x") }} + - pandas >=0.22,<3 - pytables >=3.3.0 - - pycurl >=7.43.0,<8 - - scipy >=1.1.0,<2 - - blast + - {{ pin_compatible('scipy', max_pin="x.x") }} + - {{ pin_compatible('pycurl') }} + - blast >=2.9.0 - mafft - - mash + - mash >=2.0 - python-dateutil test: @@ -36,8 +47,15 @@ test: - sistr -V about: - home: https://github.com/peterk87/sistr_cmd/ + home: https://github.com/phac-nml/sistr_cmd/ license: Apache-2.0 license_family: APACHE license_file: LICENSE - summary: "Salmonella In Silico Typing Resource (SISTR) commandline tool for serovar prediction" \ No newline at end of file + summary: "Salmonella In Silico Typing Resource (SISTR) commandline tool for serovar prediction" + dev_url: https://github.com/phac-nml/sistr_cmd + +extra: + identifiers: + - usegalaxy-eu:sistr_cmd + - doi:10.1371/journal.pone.0147101 + - biotools:SISTR diff --git a/recipes/ska2/meta.yaml b/recipes/ska2/meta.yaml index bd250923fcb6e..99e4a3aa8967f 100644 --- a/recipes/ska2/meta.yaml +++ b/recipes/ska2/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ska2" %} -{% set version = "0.3.5" %} +{% set version = "0.3.7" %} package: name: {{ name|lower}} @@ -7,10 +7,10 @@ package: source: url: https://github.com/bacpop/ska.rust/archive/v{{ version }}.tar.gz - sha256: 507290aef6ec268e2b5098b60a208dddfc690f1c029e50b68eb5169ba3b1c9f0 + sha256: ea7234428f253638b2093abdd6c8b1e8362ecad0ba56e3b29700af9a4481d911 build: - number: 0 + number: 1 script: "cargo install --no-track --locked --verbose --root \"${PREFIX}\" --path ." run_exports: - {{ pin_subpackage("ska2", max_pin="x.x") }} @@ -29,3 +29,7 @@ about: license_family: APACHE license_file: LICENSE summary: SKA (Split Kmer Analysis) version 2 + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/skder/meta.yaml b/recipes/skder/meta.yaml index 4dd0dfc2b7538..f89f93f93ff8a 100644 --- a/recipes/skder/meta.yaml +++ b/recipes/skder/meta.yaml @@ -1,5 +1,5 @@ {% set name = "skder" %} -{% set version = "1.0.8" %} +{% set version = "1.0.10" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/raufs/skDER/archive/refs/tags/v{{ version }}.tar.gz - sha256: 5d48666d6c7db738777c3bbe2601b01707c2c961b987aecde0f4210154605254 + sha256: af12a8a2709709036b84f79e39b7f13f728e45151d62251792991b23d002c54e build: number: 0 diff --git a/recipes/skyline2isocor/meta.yaml b/recipes/skyline2isocor/meta.yaml new file mode 100644 index 0000000000000..be8a9b9d96ae9 --- /dev/null +++ b/recipes/skyline2isocor/meta.yaml @@ -0,0 +1,45 @@ +{% set name = "skyline2isocor" %} +{% set version = "1.0.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/skyline2isocor-{{ version }}.tar.gz + sha256: b202927c63bd10693c5b423cc6a4bd93efcbac0fb0ab86d5a68fae69b026a6d2 + +build: + entry_points: + - skyline2isocor = skyline2isocor.cli:start_cli + noarch: python + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage('skyline2isocor', max_pin="x.x") }} + +requirements: + host: + - python >=3.11,<4.0 + - poetry-core + - pip + run: + - python >=3.11.0,<4.0.0 + - pandas >=2.1.4,<3.0.0 + +test: + imports: + - skyline2isocor + commands: + - skyline2isocor --help + +about: + home: https://pypi.org/project/skyline2isocor/ + summary: Convert skyline output to IsoCor input format + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE + +extra: + recipe-maintainers: + - llegregam diff --git a/recipes/slow5curl/meta.yaml b/recipes/slow5curl/meta.yaml index 4830b0486ce78..3c6270698f1c6 100644 --- a/recipes/slow5curl/meta.yaml +++ b/recipes/slow5curl/meta.yaml @@ -1,5 +1,5 @@ {% set name = "slow5curl" %} -{% set version = "0.2.0" %} +{% set version = "0.2.1" %} package: name: {{ name }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/BonsonW/slow5curl/releases/download/v{{ version }}/slow5curl-v{{ version }}-release.tar.gz - sha256: 11eac212e3452fb91e158999d0c5b186ac238d5580e3a9696a87590c21206bd3 + sha256: 6c062e59dc3e8bd65612613da7ac9a2518544061f1ef81d159e938e717393d3e build: number: 0 diff --git a/recipes/smoothxg/meta.yaml b/recipes/smoothxg/meta.yaml index da6405499ebc3..b0382f7fd18a9 100644 --- a/recipes/smoothxg/meta.yaml +++ b/recipes/smoothxg/meta.yaml @@ -1,5 +1,5 @@ {% set name = "smoothxg" %} -{% set version = "0.7.2" %} +{% set version = "0.7.4" %} package: name: "{{ name }}" @@ -7,7 +7,7 @@ package: source: url: https://github.com/pangenome/{{ name }}/releases/download/v{{ version }}/{{ name }}-v{{ version }}.tar.gz - sha256: 68784e7f32accfadfbcbebaeb36099fc48296655adc67e62417f08a55459a8df + sha256: 6c15c1156ac3e1a29cdb4db20f46e1b22382b22640beaa7ec8e0d76564dc53ca patches: - CMakeLists.patch diff --git a/recipes/snakedeploy/meta.yaml b/recipes/snakedeploy/meta.yaml index 4a3d9f0e594f6..ee301e9d00857 100644 --- a/recipes/snakedeploy/meta.yaml +++ b/recipes/snakedeploy/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.9.1" %} +{% set version = "0.10.0" %} package: name: snakedeploy @@ -6,7 +6,7 @@ package: source: url: https://pypi.io/packages/source/s/snakedeploy/snakedeploy-{{ version }}.tar.gz - sha256: 3ce399ae67f991647f62ff67a73649cbf786842d888c17a93b1f98b34bfb98e5 + sha256: 85922677897e90e3d179e74ba41f28e174084ed184d4e2712a4c0be3890c6279 build: number: 0 diff --git a/recipes/snakefmt/meta.yaml b/recipes/snakefmt/meta.yaml index 399a36ceda420..91ea56d632d39 100644 --- a/recipes/snakefmt/meta.yaml +++ b/recipes/snakefmt/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.9.0" %} +{% set version = "0.10.1" %} package: name: snakefmt @@ -6,10 +6,10 @@ package: source: url: https://pypi.io/packages/source/s/snakefmt/snakefmt-{{ version }}.tar.gz - sha256: 54c78050edead20cea5f87a6c9674ee1b5e4e38faac2852b45d0650faf9cb319 + sha256: b04a34fc5481b15667c8bc7f23b5722b98ef827b27c6fd6dfbab8b34b245e32b build: - number: 1 + number: 0 noarch: python entry_points: - snakefmt = snakefmt.snakefmt:main @@ -19,14 +19,14 @@ build: requirements: host: - - black >=23.12.1,<24.0 + - black >=24.3,<25.0 - click >=8.0.0,<9.0.0 - pip - python >=3.8 - toml >=0.10.2,<0.11.0 - poetry >=1.3,<2.0 run: - - black >=23.12.1,<24.0 + - black >=24.3,<25.0 - click >=8.0.0,<9.0.0 - python >=3.8 - toml >=0.10.2,<0.11.0 diff --git a/recipes/snakemake-executor-plugin-cluster-generic/meta.yaml b/recipes/snakemake-executor-plugin-cluster-generic/meta.yaml index 0abb031d05075..a49c5bcab174a 100644 --- a/recipes/snakemake-executor-plugin-cluster-generic/meta.yaml +++ b/recipes/snakemake-executor-plugin-cluster-generic/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snakemake-executor-plugin-cluster-generic" %} -{% set version = "1.0.7" %} +{% set version = "1.0.9" %} package: name: {{ name|lower }} @@ -7,11 +7,11 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_executor_plugin_cluster_generic-{{ version }}.tar.gz - sha256: 093808e63cc48294a9d1eb0b620cdff8cc970806294a2f6ba127a49f8a81d473 + sha256: ad0dc2d8bde7d4f336364bebe11a3b2209653c481ce8fbb0ae8bec81016a9a14 build: noarch: python - script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation number: 0 run_exports: - {{ pin_subpackage(name, max_pin='x') }} @@ -23,21 +23,18 @@ requirements: - pip run: - python >=3.11.0,<4.0.0 - - snakemake-interface-executor-plugins >=8.1.0,<9.0.0 + - snakemake-interface-executor-plugins >=9.0.0,<10.0.0 - snakemake-interface-common >=1.13.0,<2.0.0 test: imports: - snakemake_executor_plugin_cluster_generic - commands: - - pip check - requires: - - pip about: home: https://github.com/snakemake/snakemake-executor-plugin-cluster-generic - summary: '' + summary: 'Generic cluster executor for Snakemake' license: MIT + license_family: MIT license_file: LICENSE extra: diff --git a/recipes/snakemake-executor-plugin-cluster-sync/meta.yaml b/recipes/snakemake-executor-plugin-cluster-sync/meta.yaml index 8c85124cc99e3..04a8c2b648553 100644 --- a/recipes/snakemake-executor-plugin-cluster-sync/meta.yaml +++ b/recipes/snakemake-executor-plugin-cluster-sync/meta.yaml @@ -1,5 +1,6 @@ {% set name = "snakemake-executor-plugin-cluster-sync" %} -{% set version = "0.1.3" %} +{% set version = "0.1.4" %} +# Upon version update, requirements have to be checked! package: name: {{ name|lower }} @@ -7,7 +8,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_executor_plugin_cluster_sync-{{ version }}.tar.gz - sha256: c30fca6ccb98a3f7ca52ca8a95414c71360a3d4a835bd4a097a13445d6fce2ac + sha256: 6a6dcb2110d4c2ee74f9a48ea68e0fd7ddd2800672ebef00a01faa4affa835ad build: noarch: python @@ -24,7 +25,7 @@ requirements: run: - python >=3.11.0,<4.0.0 - snakemake-interface-common >=1.14.0,<2.0.0 - - snakemake-interface-executor-plugins >=8.1.0,<9.0.0 + - snakemake-interface-executor-plugins >=9.0.0,<10.0.0 test: imports: diff --git a/recipes/snakemake-executor-plugin-drmaa/meta.yaml b/recipes/snakemake-executor-plugin-drmaa/meta.yaml index ecc427cb7d15e..7937a06afe146 100644 --- a/recipes/snakemake-executor-plugin-drmaa/meta.yaml +++ b/recipes/snakemake-executor-plugin-drmaa/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snakemake-executor-plugin-drmaa" %} -{% set version = "0.1.3" %} +{% set version = "0.1.4" %} package: name: {{ name|lower }} @@ -7,14 +7,14 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_executor_plugin_drmaa-{{ version }}.tar.gz - sha256: 1250d0f307bf3db3aa3f26f85ea5ecc7ae00b2598ea1e1afceab7a457042fa12 + sha256: 93ddefc3fcb5ee2241e4622d04fd1ffcfc58776ff9e723e958a0da2cc2c5fcb7 build: noarch: python - script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation number: 0 run_exports: - - {{ pin_subpackage(name, max_pin='x') }} + - {{ pin_subpackage(name, max_pin='x.x') }} requirements: host: @@ -24,7 +24,7 @@ requirements: run: - python >=3.11.0,<4.0.0 - snakemake-interface-common >=1.13.0,<2.0.0 - - snakemake-interface-executor-plugins >=8.1.0,<9.0.0 + - snakemake-interface-executor-plugins >=9.0.0,<10.0.0 - drmaa >=0.7.9,<0.8.0 test: @@ -39,6 +39,7 @@ about: home: https://github.com/snakemake/snakemake-executor-plugin-drmaa summary: A snakemake executor plugin for submission of jobs via DRMAA. license: MIT + license_family: MIT license_file: LICENSE extra: diff --git a/recipes/snakemake-executor-plugin-googlebatch/meta.yaml b/recipes/snakemake-executor-plugin-googlebatch/meta.yaml index 2b428cb274a58..4383f0b34e857 100644 --- a/recipes/snakemake-executor-plugin-googlebatch/meta.yaml +++ b/recipes/snakemake-executor-plugin-googlebatch/meta.yaml @@ -1,5 +1,6 @@ {% set name = "snakemake-executor-plugin-googlebatch" %} -{% set version = "0.2.0" %} +{% set version = "0.3.3" %} +# Upon version update, requirements have to be checked! package: name: {{ name|lower }} @@ -7,14 +8,14 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_executor_plugin_googlebatch-{{ version }}.tar.gz - sha256: 3cccef6db07f47d53c0863db960c36d24c6336caabbea2b7fd3f2fc42c95edc4 + sha256: fbc3f3dad6fca51f9d65cd66a6a1272b056213ed3ab03759523f27590c58bcd8 build: noarch: python script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation number: 0 run_exports: - - {{ pin_subpackage(name, max_pin='x') }} + - {{ pin_subpackage(name, max_pin='x.x') }} requirements: host: @@ -28,7 +29,7 @@ requirements: - google-api-core >=2.12.0,<3.0.0 - google-cloud-storage >=2.12.0,<3.0.0 - snakemake-interface-common >=1.14.0,<2.0.0 - - snakemake-interface-executor-plugins >=8.1.1,<9.0.0 + - snakemake-interface-executor-plugins >=9.0.0,<10.0.0 - jinja2 >=3.1.2,<4.0.0 - google-cloud-logging >=3.8.0,<4.0.0 diff --git a/recipes/snakemake-executor-plugin-kubernetes/meta.yaml b/recipes/snakemake-executor-plugin-kubernetes/meta.yaml index c355b079a0b3e..c4ffe95046b1e 100644 --- a/recipes/snakemake-executor-plugin-kubernetes/meta.yaml +++ b/recipes/snakemake-executor-plugin-kubernetes/meta.yaml @@ -1,5 +1,6 @@ {% set name = "snakemake-executor-plugin-kubernetes" %} -{% set version = "0.1.4" %} +{% set version = "0.1.5" %} +# Upon version update, requirements have to be checked! package: name: {{ name|lower }} @@ -7,14 +8,14 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_executor_plugin_kubernetes-{{ version }}.tar.gz - sha256: c3aeac87939ec5d038efdc3ba7dbbef5eeb3171c1b718b8af850b6287b9c54ff + sha256: 7984ef057c25ce1ff46ceac5839dfad01e2938faa649e59fa439e8154e8025eb build: noarch: python script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation number: 0 run_exports: - - {{ pin_subpackage(name, max_pin='x') }} + - {{ pin_subpackage(name, max_pin='x.x') }} requirements: host: @@ -24,7 +25,7 @@ requirements: run: - python >=3.11.0,<4.0.0 - snakemake-interface-common >=1.14.1,<2.0.0 - - snakemake-interface-executor-plugins >=8.0.2,<9.0.0 + - snakemake-interface-executor-plugins >=9.0.0,<10.0.0 - python-kubernetes >=27.2.0,<28.0.0 test: diff --git a/recipes/snakemake-executor-plugin-lsf-jobstep/meta.yaml b/recipes/snakemake-executor-plugin-lsf-jobstep/meta.yaml new file mode 100644 index 0000000000000..27f1ea3595b3f --- /dev/null +++ b/recipes/snakemake-executor-plugin-lsf-jobstep/meta.yaml @@ -0,0 +1,41 @@ +{% set name = "snakemake-executor-plugin-lsf-jobstep" %} +{% set version = "0.1.10" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_executor_plugin_lsf_jobstep-{{ version }}.tar.gz + sha256: 72d29f3cd22061a61f138bba0ab6803b3fb7017f9475276acfa40ad20d23f44d + +build: + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin='x') }} + +requirements: + host: + - python >=3.11,<4.0 + - poetry-core + - pip + run: + - python >=3.11.0,<4.0.0 + - snakemake-interface-common >=1.17.1,<2.0.0 + - snakemake-interface-executor-plugins >=9.0.0,<10.0.0 + +test: + imports: + - snakemake_executor_plugin_lsf_jobstep + +about: + home: https://github.com/BEFH/snakemake-executor-plugin-lsf-jobstep + summary: A Snakemake executor plugin for running bjobs jobs inside of LSF jobs (meant for internal use by snakemake-executor-plugin-lsf) + license: MIT + license_file: LICENSE + +extra: + recipe-maintainers: + - BFH diff --git a/recipes/snakemake-executor-plugin-lsf/meta.yaml b/recipes/snakemake-executor-plugin-lsf/meta.yaml new file mode 100644 index 0000000000000..c894203d80e0d --- /dev/null +++ b/recipes/snakemake-executor-plugin-lsf/meta.yaml @@ -0,0 +1,43 @@ +{% set name = "snakemake-executor-plugin-lsf" %} +{% set version = "0.2.4" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_executor_plugin_lsf-{{ version }}.tar.gz + sha256: b4a7e59d0aacdfb48dc152169602ec0a3ff1b5a4b3c3a26bd52eb597539a63a0 + +build: + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin='x') }} + +requirements: + host: + - python >=3.11,<4.0 + - poetry-core + - pip + run: + - python >=3.11.0,<4.0.0 + - snakemake-interface-common >=1.17.1,<2.0.0 + - snakemake-interface-executor-plugins >=9.0.0,<10.0.0 + - snakemake-executor-plugin-lsf-jobstep >=0.1.10,<0.2.0 + - throttler >=1.2.2,<2.0.0 + +test: + imports: + - snakemake_executor_plugin_lsf + +about: + home: https://github.com/befh/snakemake-executor-plugin-lsf + summary: A Snakemake executor plugin for submitting jobs to a LSF cluster. + license: MIT + license_file: LICENSE + +extra: + recipe-maintainers: + - BEFH diff --git a/recipes/snakemake-executor-plugin-slurm-jobstep/meta.yaml b/recipes/snakemake-executor-plugin-slurm-jobstep/meta.yaml index 0674423f6262c..1e48b4f3c9c2b 100644 --- a/recipes/snakemake-executor-plugin-slurm-jobstep/meta.yaml +++ b/recipes/snakemake-executor-plugin-slurm-jobstep/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snakemake-executor-plugin-slurm-jobstep" %} -{% set version = "0.1.10" %} +{% set version = "0.2.1" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_executor_plugin_slurm_jobstep-{{ version }}.tar.gz - sha256: 321b6bdf7883a8fb40ff4aeeb88633502e4db8394e40b6628db41a430c2eae2b + sha256: 58894d52b5998a34fa6f60ec511ff0bfde4a9ec96714bcaa3cd2f46cf8a33859 build: noarch: python @@ -24,7 +24,7 @@ requirements: run: - python >=3.11.0,<4.0.0 - snakemake-interface-common >=1.13.0,<2.0.0 - - snakemake-interface-executor-plugins >=8.2.0,<9.0.0 + - snakemake-interface-executor-plugins >=9.0.0,<10.0.0 test: imports: diff --git a/recipes/snakemake-executor-plugin-slurm/meta.yaml b/recipes/snakemake-executor-plugin-slurm/meta.yaml index a7cdccccdb508..06ad75219b25e 100644 --- a/recipes/snakemake-executor-plugin-slurm/meta.yaml +++ b/recipes/snakemake-executor-plugin-slurm/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snakemake-executor-plugin-slurm" %} -{% set version = "0.2.1" %} +{% set version = "0.4.5" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_executor_plugin_slurm-{{ version }}.tar.gz - sha256: dd484fcb136612a3f2bdcccf15ca4ebffc2f5fcdfa7f1fcc14416dd272812999 + sha256: 5b28371f17d81bb6287f35190fedd6cd50c78b62e21952cb30e4b4ba0b13d829 build: noarch: python @@ -24,8 +24,8 @@ requirements: run: - python >=3.11.0,<4.0.0 - snakemake-interface-common >=1.13.0,<2.0.0 - - snakemake-interface-executor-plugins >=8.2.0,<9.0.0 - - snakemake-executor-plugin-slurm-jobstep >=0.1.10,<0.2.0 + - snakemake-interface-executor-plugins >=9.1.1,<10.0.0 + - snakemake-executor-plugin-slurm-jobstep >=0.2.0,<0.3.0 - throttler >=1.2.2,<2.0.0 test: diff --git a/recipes/snakemake-interface-common/meta.yaml b/recipes/snakemake-interface-common/meta.yaml index c5e119044e696..854fad21ef1e9 100644 --- a/recipes/snakemake-interface-common/meta.yaml +++ b/recipes/snakemake-interface-common/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snakemake-interface-common" %} -{% set version = "1.15.1" %} +{% set version = "1.17.2" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_interface_common-{{ version }}.tar.gz - sha256: 5a779c7a0f27412bce26e1dfe4ccc712d04e0c0b9ceaa1640335a35d02509732 + sha256: 7a2bba88df98c1a0a5cec89b835c62dd2e6e72c1fb8fd104fe73405c800b87c0 build: noarch: python diff --git a/recipes/snakemake-interface-executor-plugins/meta.yaml b/recipes/snakemake-interface-executor-plugins/meta.yaml index a52840165b3ea..fd5036d4ce8bb 100644 --- a/recipes/snakemake-interface-executor-plugins/meta.yaml +++ b/recipes/snakemake-interface-executor-plugins/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snakemake-interface-executor-plugins" %} -{% set version = "8.2.0" %} +{% set version = "9.1.1" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_interface_executor_plugins-{{ version }}.tar.gz - sha256: 4c74e3e1751bab6b266baf8688e854b8b4c5c5e10f5e34c581f42d69af4ff13b + sha256: 357c3b1d633b26241693a4e5ce291fbe198c03a54a30acfa86dd97dc252fa2c6 build: noarch: python diff --git a/recipes/snakemake-interface-report-plugins/meta.yaml b/recipes/snakemake-interface-report-plugins/meta.yaml new file mode 100644 index 0000000000000..16c4632e6a84d --- /dev/null +++ b/recipes/snakemake-interface-report-plugins/meta.yaml @@ -0,0 +1,44 @@ +{% set name = "snakemake-interface-report-plugins" %} +{% set version = "1.0.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_interface_report_plugins-{{ version }}.tar.gz + sha256: 02311cdc4bebab2a1c28469b5e6d5c6ac6e9c66998ad4e4b3229f1472127490f + +build: + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage("snakemake-interface-report-plugins", max_pin="x") }} + +requirements: + host: + - python >=3.11,<4.0 + - poetry-core + - pip + run: + - python >=3.11.0,<4.0.0 + - snakemake-interface-common >=1.16.0,<2.0.0 + +test: + imports: + - snakemake_interface_report_plugins + commands: + - pip check + requires: + - pip + +about: + summary: This package provides a stable interface for interactions between Snakemake and its report plugins. + home: https://github.com/snakemake/snakemake-interface-report-plugins + license: MIT + license_file: LICENSE + +extra: + recipe-maintainers: + - koesterlab diff --git a/recipes/snakemake-interface-storage-plugins/meta.yaml b/recipes/snakemake-interface-storage-plugins/meta.yaml index f3ebb462501db..f837051ef43ce 100644 --- a/recipes/snakemake-interface-storage-plugins/meta.yaml +++ b/recipes/snakemake-interface-storage-plugins/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snakemake-interface-storage-plugins" %} -{% set version = "3.0.0" %} +{% set version = "3.2.2" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_interface_storage_plugins-{{ version }}.tar.gz - sha256: f20d85ee7e86a1e2ffa3f72e2385dd5abb17fa7b58a26cba8ba59096872fe169 + sha256: fc8a70ef5b1fd054bc64270925228e2054158da9bcf8fa8bd4be36d93a82678b build: noarch: python diff --git a/recipes/snakemake-storage-plugin-azure/meta.yaml b/recipes/snakemake-storage-plugin-azure/meta.yaml index 0bea4ce30457f..a02ed329f2e5a 100644 --- a/recipes/snakemake-storage-plugin-azure/meta.yaml +++ b/recipes/snakemake-storage-plugin-azure/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snakemake-storage-plugin-azure" %} -{% set version = "0.1.4" %} +{% set version = "0.1.5" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_storage_plugin_azure-{{ version }}.tar.gz - sha256: dcfcf285c9f1b1aa89db359afbf02b28d9e57a97ddac66747d3e46832e7ddbff + sha256: c200d5ffc1d593083028014becba83ace43749a666f394e567435b7299566568 build: noarch: python diff --git a/recipes/snakemake-storage-plugin-fs/meta.yaml b/recipes/snakemake-storage-plugin-fs/meta.yaml index 2f0f622a761d0..0790f6203c2b5 100644 --- a/recipes/snakemake-storage-plugin-fs/meta.yaml +++ b/recipes/snakemake-storage-plugin-fs/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snakemake-storage-plugin-fs" %} -{% set version = "0.1.5" %} +{% set version = "1.0.4" %} package: name: {{ name|lower }} @@ -7,14 +7,14 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_storage_plugin_fs-{{ version }}.tar.gz - sha256: f1a54248008b6c65102a1fde2064e3b66aadd9f6795522bacb452deecfe181ad + sha256: d9467d2d8f00689c6af6478f67f693373ce3cb0404d10c6d783997465d5110a9 build: noarch: python - script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation number: 0 run_exports: - - {{ pin_subpackage(name, max_pin="x.x") }} + - {{ pin_subpackage(name, max_pin="x") }} requirements: host: @@ -23,9 +23,10 @@ requirements: - pip run: - python >=3.11.0,<4.0.0 - - snakemake-interface-common >=1.14.2,<2.0.0 - - snakemake-interface-storage-plugins >=3.0.0,<4.0.0 + - snakemake-interface-common >=1.17.0,<2.0.0 + - snakemake-interface-storage-plugins >=3.1.0,<4.0.0 - sysrsync >=1.1.1,<2.0.0 + - reretry >=0.11.8,<0.12.0 test: # We do not test the import as the plugin needs snakemake for importing, but adding @@ -39,6 +40,7 @@ about: home: https://github.com/snakemake/snakemake-storage-plugin-fs summary: 'A Snakemake storage plugin that reads and writes from a locally mounted filesystem using rsync' license: MIT + license_family: MIT license_file: LICENSE extra: diff --git a/recipes/snakemake-storage-plugin-gcs/meta.yaml b/recipes/snakemake-storage-plugin-gcs/meta.yaml index d9da699d0876f..b269805339223 100644 --- a/recipes/snakemake-storage-plugin-gcs/meta.yaml +++ b/recipes/snakemake-storage-plugin-gcs/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snakemake-storage-plugin-gcs" %} -{% set version = "0.1.3" %} +{% set version = "1.0.0" %} package: name: {{ name|lower }} @@ -7,11 +7,11 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_storage_plugin_gcs-{{ version }}.tar.gz - sha256: f0315596120160656b8c8afec66e3b31b4a2889b9d0cead2102f9d924ec0b326 + sha256: a5ca15813a74ae18d41cc5dbde0792e2ec5bfc32e8615d458b41dded1b430e14 build: noarch: python - script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation number: 0 run_exports: - {{ pin_subpackage(name, max_pin="x.x") }} @@ -23,6 +23,8 @@ requirements: - pip run: - python >=3.11.0,<4.0.0 + - snakemake-interface-common >=1.14.2,<2.0.0 + - snakemake-interface-storage-plugins >=3.0.0,<4.0.0 - google-cloud-storage >=2.12.0,<3.0.0 - google-crc32c >=1.1.2,<2.0.0 @@ -38,6 +40,7 @@ about: home: https://github.com/snakemake/snakemake-storage-plugin-gcs summary: A Snakemake storage plugin for Google Cloud Storage license: MIT + license_family: MIT license_file: LICENSE extra: diff --git a/recipes/snakemake-storage-plugin-irods/meta.yaml b/recipes/snakemake-storage-plugin-irods/meta.yaml index 143d7d1b12075..698ed88bc3071 100644 --- a/recipes/snakemake-storage-plugin-irods/meta.yaml +++ b/recipes/snakemake-storage-plugin-irods/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snakemake-storage-plugin-irods" %} -{% set version = "0.1.1" %} +{% set version = "0.1.2" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_storage_plugin_irods-{{ version }}.tar.gz - sha256: af823c0d18a4e3807d05e9bcfe5687c7ce6c711224fc37259fd74558917ec71d + sha256: e5ceac168095bf7a2ef2d82d9d74ddfc6780c1665ecaa75b16041fc2428ead77 build: noarch: python diff --git a/recipes/snakemake-storage-plugin-s3/meta.yaml b/recipes/snakemake-storage-plugin-s3/meta.yaml index 9bc32ac5fff7f..998e66cac163b 100644 --- a/recipes/snakemake-storage-plugin-s3/meta.yaml +++ b/recipes/snakemake-storage-plugin-s3/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snakemake-storage-plugin-s3" %} -{% set version = "0.2.8" %} +{% set version = "0.2.11" %} package: name: {{ name|lower }} @@ -7,12 +7,12 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snakemake_storage_plugin_s3-{{ version }}.tar.gz - sha256: 4006be9cec5113aaead77a0c9f362be4f3af5409a5da1a3a0f7d69675b222605 + sha256: edbac21ca22d2e674eaadf05f21c611891df37366d4fbd6a712d79172d788895 build: noarch: python - script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation - number: 1 + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation + number: 0 run_exports: - {{ pin_subpackage(name, max_pin="x.x") }} @@ -24,9 +24,10 @@ requirements: run: - python >=3.11.0,<4.0.0 - snakemake-interface-common >=1.14.0,<2.0.0 - - snakemake-interface-storage-plugins >=3.0.0,<4.0.0 - - boto3 >=1.28.55,<2.0.0 - - botocore >=1.31.55,<2.0.0 + - snakemake-interface-storage-plugins >=3.2.2,<4.0.0 + - boto3 >=1.33.0,<2.0.0 + - botocore >=1.33.0,<2.0.0 + - urllib3 >=2.0,<2.2 test: # We do not test the import as the plugin needs snakemake for importing, but adding @@ -40,7 +41,9 @@ about: summary: A Snakemake storage plugin for S3 API storage (AWS S3, MinIO, etc.) home: https://github.com/snakemake/snakemake-storage-plugin-s3 license: MIT + license_family: MIT license_file: LICENSE + doc_url: https://snakemake.github.io/snakemake-plugin-catalog/plugins/storage/s3.html extra: recipe-maintainers: diff --git a/recipes/snakemake/meta.yaml b/recipes/snakemake/meta.yaml index cedec7fc176f7..408d9f3f9b50b 100644 --- a/recipes/snakemake/meta.yaml +++ b/recipes/snakemake/meta.yaml @@ -1,12 +1,15 @@ -{% set version = "8.2.0" %} +# Attention: when upgrading the version, please compare below dependencies with +# https://github.com/snakemake/snakemake/blob/{version}/setup.cfg +{% set name = "snakemake" %} +{% set version = "8.11.1" %} package: - name: snakemake + name: {{ name }} version: {{ version }} source: - url: https://pypi.io/packages/source/s/snakemake/snakemake-{{ version }}.tar.gz - sha256: 4226179d344152e046d5ceaa589f4a77c2b19af99976322ca2ede58a57942a63 + url: https://pypi.io/packages/source/s/{{ name }}/snakemake-{{ version }}.tar.gz + sha256: 54df0a2fab378f334741459a48c5293f05ae372b31ac0fd4c3ec8d19f2309356 build: number: 0 @@ -42,6 +45,10 @@ test: about: home: https://snakemake.github.io license: MIT + license_family: MIT + license_file: LICENSE.md + dev_url: https://github.com/snakemake/snakemake + doc_url: https://snakemake.readthedocs.io/en/stable/ summary: A popular workflow management system aiming at full in-silico reproducibility. description: | Snakemake is a workflow management system that aims to reduce the complexity of creating @@ -51,13 +58,13 @@ about: files from input files. extra: + additional-platforms: + - linux-aarch64 identifiers: - doi:10.1093/bioinformatics/bts480 - - biotools:Snakemake + - biotools:snakemake skip-lints: - - uses_setuptools # uses pkg_resoures during run time - should_be_noarch_python # toplevel metapackage is noarch:generic - - missing_run_exports recipe-maintainers: - johanneskoester - corneliusroemer @@ -67,7 +74,7 @@ outputs: build: noarch: python - script: python -m pip install --no-deps --ignore-installed . + script: python -m pip install --no-deps --no-build-isolation --no-cache-dir . -vvv entry_points: - snakemake = snakemake.cli:main run_exports: @@ -77,20 +84,17 @@ outputs: host: - python >=3.11 - pip - - setuptools run: - # Keep in sync with snakemake/setup.cfg + # Keep in sync with snakemake/setup.cfg - python >=3.11,<3.13 - - immutables - appdirs - - conda-inject >=1.3.1,<2.0 + - immutables - configargparse - connection_pool >=0.0.3 - datrie - docutils - gitpython - humanfriendly - - immutables - jinja2 >=3.0,<4.0 - jsonschema - nbformat @@ -100,16 +104,19 @@ outputs: - pyyaml - requests >=2.8.1 - reretry - - smart_open >=3.0 - - snakemake-interface-executor-plugins >=8.1.3,<9.0 - - snakemake-interface-common >=1.15.0,<2.0 - - snakemake-interface-storage-plugins >=3.0.0,<4.0 + - smart_open >=4.0,<8.0 + - snakemake-interface-executor-plugins >=9.1.0,<10.0.0 + - snakemake-interface-common >=1.17.0,<2.0 + - snakemake-interface-storage-plugins >=3.1.0,<4.0 + - snakemake-interface-report-plugins >=1.0.0,<2.0.0 - stopit - tabulate - throttler - - toposort >=1.10 - - yte >=1.5.1,<2.0 + - toposort >=1.10,<2.0 - wrapt + - yte >=1.5.1,<2.0 + - dpath >=2.1.6,<3.0.0 + - conda-inject >=1.3.1,<2.0 test: imports: @@ -122,6 +129,10 @@ outputs: about: home: https://snakemake.github.io license: MIT + license_family: MIT + license_file: LICENSE.md + dev_url: https://github.com/snakemake/snakemake + doc_url: https://snakemake.readthedocs.io/en/stable/ summary: A popular workflow management system aiming at full in-silico reproducibility. description: | Snakemake is a workflow management system that aims to reduce the complexity diff --git a/recipes/snaketool-utils/meta.yaml b/recipes/snaketool-utils/meta.yaml index 36bc8b6314b9f..2d9130b89bfb3 100644 --- a/recipes/snaketool-utils/meta.yaml +++ b/recipes/snaketool-utils/meta.yaml @@ -1,5 +1,5 @@ {% set name = "snaketool-utils" %} -{% set version = "0.0.4" %} +{% set version = "0.0.5" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/snaketool_utils-{{ version }}.tar.gz - sha256: 75a35ba887be3ead290087241d1222dc8ef79e36cb3ccb395d9c7059b72cbe06 + sha256: a686300efcec715fba806479b10dde0f98781a90600c7bf7cadcca1ebb655305 build: noarch: python diff --git a/recipes/sneep/meta.yaml b/recipes/sneep/meta.yaml index 97578dcf17ba2..3b772e54672ed 100644 --- a/recipes/sneep/meta.yaml +++ b/recipes/sneep/meta.yaml @@ -1,5 +1,5 @@ {% set name = "SNEEP" %} -{% set version = "0.8" %} +{% set version = "1.1" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/SchulzLab/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz - sha256: 147e10e6f64056f6fde4fec609f7019d0a765a5b4b14ead954e1ef3071d95d49 + sha256: 663a327abb928770c3252630a2ba3a0f69888f81e803567e32a2e5df09d94de9 build: skip: True # [py2k] diff --git a/recipes/sniffles/meta.yaml b/recipes/sniffles/meta.yaml index a6fd59a98adda..981b06693c8d7 100644 --- a/recipes/sniffles/meta.yaml +++ b/recipes/sniffles/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.2" %} -{% set sha256 = "744ee05017e0e95a4b2e21020d7a7277d8fabae2c2c20cd982287bb7775d8ecf" %} +{% set version = "2.3.2" %} +{% set sha256 = "72531b65e479157473bd84dd3ba20118ba38ef27dcd502bf9d53b9d1f2a7d50f" %} package: name: sniffles @@ -10,17 +10,21 @@ source: sha256: '{{sha256}}' build: - number: 0 + number: 1 noarch: python - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vvv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('sniffles', max_pin="x") }} requirements: host: - - python >=3.7 - - setuptools + - python >=3.10 + - pip run: - - python >=3.7 - - pysam + - python >=3.10 + - pysam >=0.21.0 + - edlib >=1.3.9 + - psutil >=5.9.4 test: commands: @@ -33,3 +37,5 @@ about: license_family: MIT summary: Sniffles is a structural variation caller using third generation sequencing (PacBio or Oxford Nanopore) + doc_url: https://github.com/fritzsedlazeck/Sniffles/wiki + dev_url: https://github.com/fritzsedlazeck/Sniffles diff --git a/recipes/snippy/meta.yaml b/recipes/snippy/meta.yaml index f20c442102beb..42b89cd854fde 100644 --- a/recipes/snippy/meta.yaml +++ b/recipes/snippy/meta.yaml @@ -12,8 +12,10 @@ source: sha256: '{{ sha256 }}' build: - number: 3 + number: 4 noarch: generic + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: run: @@ -26,6 +28,7 @@ requirements: - parallel >=20170422 - freebayes >=1.3.1 - vcflib >=1.0.0_rc3,<=1.0.2 # crashes with v1.0.3 and later + - tabixpp 1.1.0 # vcflib requires libtabixpp.so.0, no longer available as of 1.1.2 - snpeff >=4.3,<=5.0 # crashes with v5.1 - vt >=0.5772 - snp-sites >=2.4 diff --git a/recipes/soda-gallery/meta.yaml b/recipes/soda-gallery/meta.yaml index 018c0cf1d077c..195229557cff0 100644 --- a/recipes/soda-gallery/meta.yaml +++ b/recipes/soda-gallery/meta.yaml @@ -1,5 +1,5 @@ {% set name = "soda-gallery" %} -{% set version = "1.0.1" %} +{% set version = "1.2.0" %} package: name: "{{ name|lower }}" @@ -7,33 +7,28 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 7b505ef8283e04fb381ad566b488aab3bd995641cf2b5c5380739d414ea6472e + sha256: dc71f503ecdf3d54ad00c9648176e98c0a1db37a18fe6fe7d5d1ea763340e92c build: noarch: python number: 0 entry_points: - soda = soda.soda:main - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('soda-gallery', max_pin="x") }} requirements: host: - - beautifulsoup4 >=4.9.3 - - certifi >=2021.5.30 - - jinja2 >=3.0.1 - - pdfminer >=20191125 - - pdfrw >=0.4 - pip - - python - - requests >=2.25.1 - - requests-kerberos >=0.12.0 + - python >=3 run: - beautifulsoup4 >=4.9.3 - - certifi >=2021.5.30 + - certifi >=2024.2.2 - jinja2 >=3.0.1 - pdfminer >=20191125 - pdfrw >=0.4 - - python + - python >=3 - requests >=2.25.1 - requests-kerberos >=0.12.0 diff --git a/recipes/somalier/meta.yaml b/recipes/somalier/meta.yaml index 84fc5a4dd9425..32d5d2be59eec 100644 --- a/recipes/somalier/meta.yaml +++ b/recipes/somalier/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.2.18" %} +{% set version = "0.2.19" %} package: name: somalier @@ -6,7 +6,7 @@ package: source: url: https://github.com/brentp/somalier/archive/refs/tags/v{{ version }}.tar.gz - sha256: e95ba09a1ec0bd352643ea1907a1c3d23a43801b176e10fdbee198c0bec02af4 + sha256: d93b34d15deb12d75ce4637857d4c74eb94572e0aac6303df539a345e3485fa8 # Skip OSX following https://github.com/bioconda/bioconda-recipes/blob/73a14544ca8ef7926797b39259cb58b83732b7da/recipes/slivar/meta.yaml build: @@ -19,7 +19,7 @@ requirements: build: - {{ compiler('c') }} - curl - - nim + - nim <2 host: - openblas - htslib @@ -38,6 +38,7 @@ about: license: MIT summary: 'fast sample-swap and relatedness checks on BAMs/CRAMs/VCFs/GVCFs.' + extra: identifiers: - doi:10.1186/s13073-020-00761-2 diff --git a/recipes/somaticseq/meta.yaml b/recipes/somaticseq/meta.yaml index 7dd1f0e852f15..cd81c589f93e9 100644 --- a/recipes/somaticseq/meta.yaml +++ b/recipes/somaticseq/meta.yaml @@ -1,6 +1,6 @@ {% set name = "somaticseq" %} -{% set version = "3.7.3" %} -{% set sha256 = "3721c03646496980a17141fe63a90e09ee10328edc1b692aae57bc07c2477e3c" %} +{% set version = "3.7.4" %} +{% set sha256 = "d072300bc403f12265fcadba74c4e6ba82175e749f22f66b46a1e32bf851e24d" %} package: name: {{ name|lower }} @@ -13,7 +13,9 @@ source: build: number: 0 noarch: python - script: {{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv + run_exports: + - {{ pin_subpackage('somaticseq', max_pin="x") }} requirements: host: @@ -25,7 +27,7 @@ requirements: - pysam - scipy - pandas - - xgboost + - xgboost >=1.4 - r-base - r-ada - bedtools @@ -45,7 +47,7 @@ test: - makeSomaticScripts.py --help about: - home: http://bioinform.github.io/somaticseq/ + home: https://bioinform.github.io/somaticseq/ license: BSD-2-Clause license_file: LICENSE.txt license_family: BSD diff --git a/recipes/sonlib/build.sh b/recipes/sonlib/build.sh index 3786386a73c83..79758c33af1fb 100644 --- a/recipes/sonlib/build.sh +++ b/recipes/sonlib/build.sh @@ -1,3 +1,14 @@ #!/bin/bash +set -eux + +# prevent header contamination +rm -rf externalTools/ + +make -j $CPU_COUNT shlib +mkdir -p "$PREFIX"/{bin,lib,include/sonLib} +install sonLib_daemonize.py "${PREFIX}/bin/" +# some header files are named generic enough to warrant namespacing +cp lib/*.h "${PREFIX}/include/sonLib/" +cp lib/*.so "${PREFIX}/lib/" $PYTHON setup.py install --single-version-externally-managed --record=record.txt diff --git a/recipes/sonlib/meta.yaml b/recipes/sonlib/meta.yaml index 73ab7fdf6ae2d..21f47d0c439bb 100644 --- a/recipes/sonlib/meta.yaml +++ b/recipes/sonlib/meta.yaml @@ -1,27 +1,62 @@ +{% set name = "sonlib" %} +# No version is tagged upstream yet, but commit e25181b changes the setup.py version to 2.0 +# For now, set the .dev version to number of commits on master since then: +# git tag v2.0 e25181b && git describe --tags +{% set version = "2.0.dev88" %} +{% set commit = "9734083dffb180e3d76c323609c082b401336c0a" %} + package: - name: sonlib - version: "1.1.0" + name: {{ name }} + version: {{ version }} source: - url: https://pypi.python.org/packages/c5/63/5c597eb4895ad59e6b57050de0dbc579b400e9e2bfc7a698d6b19d91caaf/sonLib-1.1.0.tar.gz - md5: b6051a1c664ad51f8620d80a3652aa05 + url: https://github.com/ComparativeGenomicsToolkit/sonLib/archive/{{ commit }}.tar.gz + sha256: 6669056081bc96205de14b3c59c70c379dd57ab031d630480e8110e3d448628b + patches: + - patches/0001-Add-devendored-shared-library-build.patch + - patches/0002-Remove-need-for-CuTest-during-build.patch build: - noarch: python - number: 2 + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: + build: + - {{ compiler('c') }} + - make + - pkg-config host: - - python <3 - - pip + - python + - zlib + - quicktree run: - - python <3 + - python + - networkx test: imports: - sonLib + - sonLib.bioio + - sonLib.misc + - sonLib.nxnewick + - sonLib.nxtree + - sonLib.tree + requires: + - {{ compiler('c') }} + - make + - zlib + - cutest + source_files: + - Makefile + - include.mk + - allTests.py + - bioioTest.py + - cigarsTest.py + - C/Makefile + - C/tests/* about: - home: https://github.com/benedictpaten/sonLib + home: https://github.com/ComparativeGenomicsToolkit/sonLib license: MIT summary: 'Small general purpose library for C and Python with focus on bioinformatics.' diff --git a/recipes/sonlib/patches/0001-Add-devendored-shared-library-build.patch b/recipes/sonlib/patches/0001-Add-devendored-shared-library-build.patch new file mode 100644 index 0000000000000..3de5a2a9f3c45 --- /dev/null +++ b/recipes/sonlib/patches/0001-Add-devendored-shared-library-build.patch @@ -0,0 +1,247 @@ +From 1e06372425d4492bc943b34ade7a9ef443cb1bec Mon Sep 17 00:00:00 2001 +From: Travis Wrightsman +Date: Tue, 23 Jan 2024 21:04:37 -0500 +Subject: [PATCH] Add devendored shared library build + +--- + C/Makefile | 14 ++++++++++++++ + C/impl/stPhylogeny.c | 6 +++--- + C/tests/cigarsTest.c | 10 +++++----- + C/tests/fastaCTest.c | 6 +++--- + C/tests/kvDatabaseTestCommon.c | 2 +- + C/tests/sonLibCommonTest.c | 2 +- + C/tests/sonLibExceptTest.c | 6 +++--- + C/tests/sonLibGlobalsTest.h | 2 +- + C/tests/stPhylogenyTest.c | 4 ++-- + C/tests/stThreadPoolTest.c | 2 +- + C/tests/stUnionFindTest.c | 2 +- + Makefile | 6 ++++++ + setup.py | 2 +- + 13 files changed, 42 insertions(+), 22 deletions(-) + +diff --git a/C/Makefile b/C/Makefile +index fcb627a..92856ac 100644 +--- a/C/Makefile ++++ b/C/Makefile +@@ -1,4 +1,6 @@ + rootPath = .. ++BINDIR = ../bin ++LIBDIR = ../lib + + include ../include.mk + +@@ -23,6 +25,13 @@ LDLIBS = ${LIBDIR}/sonLib.a ${dblibs} ${LIBS} + + all : ${LIBDIR}/sonLib.a ${testProgs} ${libHeadersDep} + ++shlib : ${LIBDIR}/libsonLib.so ++ ++tests-shlib: ++ ${CC} ${CPPFLAGS} ${CFLAGS} ${LDFLAGS} -o ${rootPath}/sonLibTests tests/allTests.c ${libTests} -lsonLib -lcutest -lz -lm -lpthread ++ ${CC} ${CPPFLAGS} ${CFLAGS} ${LDFLAGS} -o ${rootPath}/sonLib_cigarTest tests/cigarsTest.c -l sonLib -lz -lpthread ++ ${CC} ${CPPFLAGS} ${CFLAGS} ${LDFLAGS} -o ${rootPath}/sonLib_fastaCTest tests/fastaCTest.c -l sonLib -lz -lpthread ++ + # note: old Makefile put .o files in this directory, clean if for now (FIXME: remove soon) + clean : + rm -rf ${BINDIR} ${LIBDIR} ${libObjs} *.o +@@ -62,5 +71,10 @@ ${LIBDIR}/sonLib.a : ${libObjs} + ${RANLIB} sonLib.a + mv sonLib.a ${LIBDIR}/ + ++${LIBDIR}/libsonLib.so : ${libObjs} ++ @mkdir -p $(dir $@) ++ ${CC} ${CPPFLAGS} ${CFLAGS} ${LDFLAGS} -shared -fPIC ${libObjs} -lquicktree -lz -o libsonLib.so ++ mv libsonLib.so ${LIBDIR}/ ++ + test: + ${PYTHON} allTests.py --testLength=SHORT --logLevel CRITICAL +diff --git a/C/impl/stPhylogeny.c b/C/impl/stPhylogeny.c +index fd0fcf4..33b594d 100644 +--- a/C/impl/stPhylogeny.c ++++ b/C/impl/stPhylogeny.c +@@ -2,9 +2,9 @@ + #include "sonLib.h" + #include "stPhylogeny.h" + // QuickTree includes +-#include "cluster.h" +-#include "tree.h" +-#include "buildtree.h" ++#include "quicktree/cluster.h" ++#include "quicktree/tree.h" ++#include "quicktree/buildtree.h" + // Spimap C/C++ translation layer include + #include "stSpimapLayer.h" + +diff --git a/C/tests/cigarsTest.c b/C/tests/cigarsTest.c +index 5189f69..a4547ba 100644 +--- a/C/tests/cigarsTest.c ++++ b/C/tests/cigarsTest.c +@@ -9,11 +9,11 @@ + #include + #include + +-#include "fastCMaths.h" +-#include "avl.h" +-#include "commonC.h" +-#include "bioioC.h" +-#include "pairwiseAlignment.h" ++#include "sonLib/fastCMaths.h" ++#include "sonLib/avl.h" ++#include "sonLib/commonC.h" ++#include "sonLib/bioioC.h" ++#include "sonLib/pairwiseAlignment.h" + + int main(int argc, char *argv[]) { + int64_t i; +diff --git a/C/tests/fastaCTest.c b/C/tests/fastaCTest.c +index 9cc81db..4d41ca4 100644 +--- a/C/tests/fastaCTest.c ++++ b/C/tests/fastaCTest.c +@@ -9,9 +9,9 @@ + #include + #include + +-#include "fastCMaths.h" +-#include "commonC.h" +-#include "bioioC.h" ++#include "sonLib/fastCMaths.h" ++#include "sonLib/commonC.h" ++#include "sonLib/bioioC.h" + + int main(int argc, char *argv[]) { + FILE *fileHandle; +diff --git a/C/tests/kvDatabaseTestCommon.c b/C/tests/kvDatabaseTestCommon.c +index eccf3c3..b5a9b21 100644 +--- a/C/tests/kvDatabaseTestCommon.c ++++ b/C/tests/kvDatabaseTestCommon.c +@@ -9,7 +9,7 @@ + */ + #include "sonLibGlobalsTest.h" + #include "kvDatabaseTestCommon.h" +-#include "stSafeC.h" ++#include "sonLib/stSafeC.h" + #include + + /* usage message and exit */ +diff --git a/C/tests/sonLibCommonTest.c b/C/tests/sonLibCommonTest.c +index 1c208fc..6924ffa 100644 +--- a/C/tests/sonLibCommonTest.c ++++ b/C/tests/sonLibCommonTest.c +@@ -11,7 +11,7 @@ + * Author: benedictpaten + */ + #include "sonLibGlobalsTest.h" +-#include "bioioC.h" ++#include "sonLib/bioioC.h" + + static void test_st_logging(CuTest *testCase) { + /* +diff --git a/C/tests/sonLibExceptTest.c b/C/tests/sonLibExceptTest.c +index db00120..4d3f1cf 100644 +--- a/C/tests/sonLibExceptTest.c ++++ b/C/tests/sonLibExceptTest.c +@@ -7,12 +7,12 @@ + /* + * basic tests of stExcept. + */ +-#include "sonLibExcept.h" ++#include "sonLib/sonLibExcept.h" + #include "sonLibGlobalsTest.h" +-#include "sonLibCommon.h" ++#include "sonLib/sonLibCommon.h" + #include + #include +-#include "stSafeC.h" ++#include "sonLib/stSafeC.h" + + /* test throwing through two levels */ + static const char *const ERR1 = "err1"; +diff --git a/C/tests/sonLibGlobalsTest.h b/C/tests/sonLibGlobalsTest.h +index ddb1293..a704b99 100644 +--- a/C/tests/sonLibGlobalsTest.h ++++ b/C/tests/sonLibGlobalsTest.h +@@ -28,6 +28,6 @@ + #include + + #include "CuTest.h" +-#include "sonLib.h" ++#include "sonLib/sonLib.h" + + #endif // SONLIB_GLOBALS_TEST_H_ +diff --git a/C/tests/stPhylogenyTest.c b/C/tests/stPhylogenyTest.c +index ea4c84b..93c3f1d 100644 +--- a/C/tests/stPhylogenyTest.c ++++ b/C/tests/stPhylogenyTest.c +@@ -1,8 +1,8 @@ + #include + #include + #include "CuTest.h" +-#include "sonLib.h" +-#include "stPhylogeny.h" ++#include "sonLib/sonLib.h" ++#include "sonLib/stPhylogeny.h" + + static stIndexedTreeInfo *getIndex(stTree *node) { + assert(node != NULL); +diff --git a/C/tests/stThreadPoolTest.c b/C/tests/stThreadPoolTest.c +index 8a456a6..a3f3128 100644 +--- a/C/tests/stThreadPoolTest.c ++++ b/C/tests/stThreadPoolTest.c +@@ -1,5 +1,5 @@ + #include "CuTest.h" +-#include "sonLib.h" ++#include "sonLib/sonLib.h" + + // Test sorting a few sublists into a larger list to try to catch out + // any race conditions. +diff --git a/C/tests/stUnionFindTest.c b/C/tests/stUnionFindTest.c +index c39826d..b7caf53 100644 +--- a/C/tests/stUnionFindTest.c ++++ b/C/tests/stUnionFindTest.c +@@ -1,5 +1,5 @@ + #include "CuTest.h" +-#include "sonLib.h" ++#include "sonLib/sonLib.h" + + // Simple static test. + static void stUnionFind_staticTest(CuTest *testCase) { +diff --git a/Makefile b/Makefile +index b244b55..e04e298 100644 +--- a/Makefile ++++ b/Makefile +@@ -5,6 +5,9 @@ BINDIR = ./bin + + all : cP ${BINDIR}/sonLib_daemonize.py + ++shlib: ++ cd C && ${MAKE} shlib ++ + clean : cP.clean externalToolsP.clean + rm -f ${BINDIR}/sonLib_daemonize.py + +@@ -23,6 +26,9 @@ externalToolsP.clean : + test : all + PYTHONPATH=src:. PATH=$$(pwd)/bin:$$PATH ${PYTHON} allTests.py --testLength=SHORT --logLevel=WARN + ++tests-shlib: ++ cd C && ${MAKE} tests-shlib ++ + ${BINDIR}/sonLib_daemonize.py : sonLib_daemonize.py cP + cp sonLib_daemonize.py ${BINDIR}/sonLib_daemonize.py + chmod +x ${BINDIR}/sonLib_daemonize.py +diff --git a/setup.py b/setup.py +index 9d96fd0..7db446e 100755 +--- a/setup.py ++++ b/setup.py +@@ -12,7 +12,7 @@ class BuildWithMake(distutils.command.build_py.build_py): + """ + def run(self): + # Call make. +- subprocess.check_call(["make"]) ++ #subprocess.check_call(["make"]) + + # Keep building the Python stuff + distutils.command.build_py.build_py.run(self) +-- +2.39.2 + diff --git a/recipes/sonlib/patches/0002-Remove-need-for-CuTest-during-build.patch b/recipes/sonlib/patches/0002-Remove-need-for-CuTest-during-build.patch new file mode 100644 index 0000000000000..bdb17a155cc5d --- /dev/null +++ b/recipes/sonlib/patches/0002-Remove-need-for-CuTest-during-build.patch @@ -0,0 +1,24 @@ +From 9852a11e4c38f92725f72eefc041cfe5fadc2ea6 Mon Sep 17 00:00:00 2001 +From: Travis Wrightsman +Date: Tue, 23 Jan 2024 22:18:44 -0500 +Subject: [PATCH] Remove need for CuTest during build + +--- + C/impl/sonLibGlobalsInternal.h | 1 - + 1 file changed, 1 deletion(-) + +diff --git a/C/impl/sonLibGlobalsInternal.h b/C/impl/sonLibGlobalsInternal.h +index f8542a0..9a2e51d 100644 +--- a/C/impl/sonLibGlobalsInternal.h ++++ b/C/impl/sonLibGlobalsInternal.h +@@ -29,7 +29,6 @@ + #include + #include + +-#include "CuTest.h" + #include "sonLib.h" + #include "sonLibListPrivate.h" + +-- +2.39.2 + diff --git a/recipes/sonlib/run_test.sh b/recipes/sonlib/run_test.sh new file mode 100644 index 0000000000000..21a8a0e080ad4 --- /dev/null +++ b/recipes/sonlib/run_test.sh @@ -0,0 +1,7 @@ +#!/bin/bash + +set -eux + +make tests-shlib + +PATH="$PWD:$PATH" python allTests.py diff --git a/recipes/sorted_nearest/meta.yaml b/recipes/sorted_nearest/meta.yaml index 613fe31b6243f..8cd37892ae730 100644 --- a/recipes/sorted_nearest/meta.yaml +++ b/recipes/sorted_nearest/meta.yaml @@ -14,8 +14,10 @@ source: '{{ hash_type }}': '{{ hash_value }}' build: - number: 0 + number: 1 script: python setup.py install --single-version-externally-managed --record=record.txt + run_exports: + - {{ pin_subpackage(name|lower, max_pin='x.x') }} requirements: build: @@ -36,3 +38,7 @@ about: home: https://github.com/endrebak/sorted_nearest license: BSD summary: Find nearest interval. + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/sourmash/meta.yaml b/recipes/sourmash/meta.yaml index 4feaa4aaee077..7a632308a3484 100644 --- a/recipes/sourmash/meta.yaml +++ b/recipes/sourmash/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "4.8.5" %} +{% set version = "4.8.8" %} package: name: sourmash @@ -6,7 +6,7 @@ package: source: url: https://pypi.io/packages/source/s/sourmash/sourmash-{{ version }}.tar.gz - sha256: 9016c338d6b01f152d2c7becf5631000b058ff657f4fc50daa6ef15373d8a02a + sha256: 667da4b014f003032bdffa43318bb5668edbbc55055fe109dab959a914d69842 build: number: 0 diff --git a/recipes/spacepharer/build.sh b/recipes/spacepharer/build.sh index 0d987840efe4b..b06956020200b 100644 --- a/recipes/spacepharer/build.sh +++ b/recipes/spacepharer/build.sh @@ -1,8 +1,18 @@ -#!/bin/bash -e +#!/bin/bash + +ARCH_BUILD="" +case $(uname -m) in + x86_64) ARCH_BUILD="-DHAVE_SSE4_1=1" ;; + arm64|aarch64) ARCH_BUILD="-DHAVE_ARM8=1" ;; +esac + +if [ -z "${ARCH_BUILD}" ]; then + echo "Invalid architecture" + exit 1 +fi mkdir build cd build -cmake -DCMAKE_INSTALL_PREFIX="${PREFIX}" -DHAVE_TESTS=0 -DHAVE_MPI=0 -DHAVE_SSE4_1=1 -DVERSION_OVERRIDE="${PKG_VERSION}" .. +cmake -DCMAKE_INSTALL_PREFIX="${PREFIX}" -DHAVE_TESTS=0 -DHAVE_MPI=0 ${ARCH_BUILD} -DVERSION_OVERRIDE="${PKG_VERSION}" .. make -j${CPU_COUNT} ${VERBOSE_CM} make install - diff --git a/recipes/spacepharer/meta.yaml b/recipes/spacepharer/meta.yaml index b42834234a7ea..ed8c6096e102d 100644 --- a/recipes/spacepharer/meta.yaml +++ b/recipes/spacepharer/meta.yaml @@ -6,7 +6,9 @@ package: version: {{ version|replace("-", ".") }} build: - number: 3 + number: 4 + run_exports: + - {{ pin_subpackage('spacepharer', max_pin="x") }} source: url: https://github.com/soedinglab/spacepharer/archive/{{ version }}.tar.gz @@ -46,3 +48,5 @@ extra: identifiers: - doi:10.1093/bioinformatics/btab222 - biotools:spacepharer + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/spaln/build.sh b/recipes/spaln/build.sh index 516965f0874e8..d660fa42671ea 100644 --- a/recipes/spaln/build.sh +++ b/recipes/spaln/build.sh @@ -1,6 +1,24 @@ -(cd src && \ - ./configure --exec_prefix=${PREFIX}/bin --table_dir=${PREFIX}/share/spaln/table --alndbs_dir=${PREFIX}/share/spaln/alndbs --use_zlib=1 && \ - make AR="${AR:-ar} rc" LDFLAGS="-L${PREFIX}/lib" && make install) +#!/bin/bash -#(cd ${SRC_DIR}/perl && perl Makefile.PL && \ -# sed -i -s '1s^#!/usr/bin/perl^#!/usr/bin/env perl^' *.pl && make && make install && chmod u+w ${PREFIX}/bin/*.pl) +mkdir -p "${PREFIX}/bin" + +export INCLUDES="-I${PREFIX}/include" +export LIBPATH="-L${PREFIX}/lib" +export LDFLAGS="${LDFLAGS} -L${PREFIX}/lib" + +export CPPFLAGS="${CPPFLAGS} -I${PREFIX}/include" +export CFLAGS="${CFLAGS} -O3 ${LDFLAGS}" + +sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' ${SRC_DIR}/perl/*.pl +rm -rf ${SRC_DIR}/perl/*.bak +cp -rf ${SRC_DIR}/perl/*.pl "${PREFIX}/bin" + +cd src + +./configure --exec_prefix="${PREFIX}/bin" --table_dir="${PREFIX}/share/spaln/table" \ + --alndbs_dir="${PREFIX}/share/spaln/alndbs" + +make CFLAGS="${CFLAGS}" AR="${AR:-ar} rc" LDFLAGS="${LDFLAGS}" -j4 +make install + +make clearall diff --git a/recipes/spaln/makefile.patch b/recipes/spaln/makefile.patch index d58ad71183684..05b4085926c03 100644 --- a/recipes/spaln/makefile.patch +++ b/recipes/spaln/makefile.patch @@ -1,6 +1,8 @@ +diff --git a/src/Makefile.in b/src/Makefile.in +index ed5cb96..2d837d0 100644 --- a/src/Makefile.in +++ b/src/Makefile.in -@@ -1,14 +1,14 @@ +@@ -1,19 +1,19 @@ # Makefile.in for splan/sortgrcd # Copyright(c) Osamu Gotoh <> @@ -14,10 +16,16 @@ +CXX = $(CXX) #CXX = clang++ -CFLAGS = -O3 -march=native -+CFLAGS = -O3 -march=native -I$(PREFIX)/include ++CFLAGS += -O3 RANLIB = ranlib -LD = g++ +LD = $(CXX) AR = ar ru DEL = rm -f DEFLT = -DM_THREAD=1 + +-CXX := $(CXX) $(CFLAGS) $(DEFLT) ++CXX := $(CXX) $(CFLAGS) $(CPPFLAGS) $(DEFLT) + + .SUFFIXES: .o .cc .h .sh + diff --git a/recipes/spaln/meta.yaml b/recipes/spaln/meta.yaml index a127680c665c8..98884708d7d91 100644 --- a/recipes/spaln/meta.yaml +++ b/recipes/spaln/meta.yaml @@ -1,6 +1,6 @@ {% set name = "spaln" %} -{% set version = "3.0.1" %} -{% set sha256 = "efb7d492c81053180f2cbda831250d99ecb89cfa760217859aa78afbe9b3aefd" %} +{% set version = "3.0.4" %} +{% set sha256 = "6001a901e2e1ea5dbf19f34ee18b61ebd9afaf3a3c5107f937dd13e9b63ea870" %} package: name: {{ name|lower }} @@ -25,23 +25,24 @@ requirements: - make host: - perl - - zlib ==1.2.11 + - zlib run: - perl test: commands: - - spaln -h 2>&1 |grep 'SPALN version' >/dev/null - - makblk.pl 2>&1 |grep makblk.pl >/dev/null - - sortgrcd -h 2>&1 |grep sortgrcd >/dev/null - - makmdm -h 2>&1 |grep makmdm >/dev/null - - makdbs -h 2>&1 |grep makdbs >/dev/null - - makeidx.pl -h 2>&1 |grep makeidx.pl >/dev/null + - spaln -h 2>&1 | grep "version {{ version }}" >/dev/null + - makblk.pl 2>&1 | grep makblk.pl >/dev/null + - sortgrcd -h 2>&1 | grep sortgrcd >/dev/null + - makmdm -h 2>&1 | grep makmdm >/dev/null + - makdbs -h 2>&1 | grep makdbs >/dev/null + - makeidx.pl -h 2>&1 | grep makeidx.pl >/dev/null about: - home: http://www.genome.ist.i.kyoto-u.ac.jp/~aln_user/spaln/ + home: https://github.com/ogotoh/spaln + doc_url: "https://github.com/ogotoh/spaln/blob/master/README.md" dev_url: https://github.com/ogotoh/spaln - license: GPL-2.0 + license: "GPL-2.0-or-later" license_family: GPL license_file: COPYING summary: 'Map and align a set of cDNA/EST or protein sequences onto a genome' @@ -55,4 +56,5 @@ about: extra: identifiers: - doi:10.1093/nar/gks708 + - doi:10.1093/bioinformatics/btl067 - usegalaxy-eu:spaln diff --git a/recipes/splitcode/build.sh b/recipes/splitcode/build.sh new file mode 100644 index 0000000000000..ef216459a9484 --- /dev/null +++ b/recipes/splitcode/build.sh @@ -0,0 +1,8 @@ +#!/bin/bash + +mkdir -p "${PREFIX}/bin" +mkdir -p build +cd build || exit 1 +cmake -DCMAKE_INSTALL_PREFIX:PATH="$PREFIX" .. +make +make install diff --git a/recipes/splitcode/meta.yaml b/recipes/splitcode/meta.yaml new file mode 100644 index 0000000000000..7b1bc1431eb64 --- /dev/null +++ b/recipes/splitcode/meta.yaml @@ -0,0 +1,45 @@ +{% set version = "0.29.4" %} + +package: + name: splitcode + version: {{ version }} + +source: + url: https://github.com/pachterlab/splitcode/archive/v0.29.4.tar.gz + sha256: 1e815543ba62628f5e65fc68fa324f8c871fa3f3b182385b0e381b89948b38d8 + +build: + number: 0 + run_exports: + - {{ pin_subpackage('splitcode', max_pin="x.x") }} + +requirements: + build: + - make + - cmake + - {{ compiler('cxx') }} + host: + - zlib + run: + - zlib + +test: + commands: + - splitcode --version + +about: + home: "https://github.com/pachterlab/splitcode" + license: BSD-2-Clause + license_family: BSD + summary: Flexible parsing, interpretation, and editing of technical sequences + dev_url: https://github.com/pachterlab/splitcode + doc_url: "https://splitcode.readthedocs.io" + +extra: + identifiers: + - biotools:splitcode + - doi:10.1101/2023.03.20.533521 + recipe-maintainers: + - Yenaled + additional-platforms: + - linux-aarch64 diff --git a/recipes/squigulator/meta.yaml b/recipes/squigulator/meta.yaml index cdb6c3d60102f..e55f517d8a142 100644 --- a/recipes/squigulator/meta.yaml +++ b/recipes/squigulator/meta.yaml @@ -1,5 +1,5 @@ {% set name = "squigulator" %} -{% set version = "0.2.2" %} +{% set version = "0.3.0" %} package: name: {{ name }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/hasindu2008/squigulator/releases/download/v{{ version }}/squigulator-v{{ version }}-release.tar.gz - sha256: c1159c71ab04623e678c265081a2b0fc6b790b5cc86260deac1646d87c180e35 + sha256: fca1427fe609c20125e679459c1f509b320acf8a44887fa265649607d8a47789 build: number: 0 diff --git a/recipes/sra-tools/build.sh b/recipes/sra-tools/build.sh index 61adcee08e6b5..5b55bd0ccec80 100755 --- a/recipes/sra-tools/build.sh +++ b/recipes/sra-tools/build.sh @@ -1,17 +1,13 @@ #!/bin/bash -e -export INCLUDE_PATH="${PREFIX}/include" -export LIBRARY_PATH="${PREFIX}/lib" -export LDFLAGS="-L${PREFIX}/lib" -export CXX_FOR_BUILD=${CXX} - -export CFLAGS="-DH5_USE_110_API -I${PREFIX}/include ${LDFLAGS}" -export CXXFLAGS="-I${PREFIX}/include ${LDFLAGS}" +export LDFLAGS="${LDFLAGS} -L${PREFIX}/lib" +export CFLAGS="${CFLAGS} -O3 -DH5_USE_110_API -D_FILE_OFFSET_BITS=64 ${LDFLAGS}" +export CXXFLAGS="${CXXFLAGS} -O3 -I${PREFIX}/include" echo "compiling sra-tools" if [[ ${OSTYPE} == "darwin"* ]]; then export CFLAGS="${CFLAGS} -DTARGET_OS_OSX" - export CXXFLAGS="${CXXFLAGS} -DTARGET_OS_OSX -D_LIBCPP_DISABLE_AVAILABILITY" + export CXXFLAGS="${CXXFLAGS} -DTARGET_OS_OSX" fi mkdir -p obj/ngs/ngs-java/javadoc/ngs-doc # prevent error on OSX @@ -20,16 +16,24 @@ mkdir -p obj/ngs/ngs-java/javadoc/ngs-doc # prevent error on OSX # Execute Make commands from a separate subdirectory. Else: # ERROR: In source builds are not allowed export SRA_BUILD_DIR=${SRC_DIR}/build_sratools -mkdir ${SRA_BUILD_DIR} -pushd ${SRA_BUILD_DIR} -cmake ../sra-tools/ -DVDB_BINDIR=${BUILD_PREFIX}/lib64 \ - -DVDB_LIBDIR=${BUILD_PREFIX}/lib64 \ - -DVDB_INCDIR=${BUILD_PREFIX}/include \ - -DCMAKE_INSTALL_PREFIX=${PREFIX} \ - -DCMAKE_BUILD_TYPE=Release -cmake --build . -j 4 -v -cmake --install . -popd +mkdir -p ${SRA_BUILD_DIR} + +if [[ "$(uname)" == "Darwin" ]]; then + export VDB_INC="${SRC_DIR}/ncbi-vdb/interfaces" +else + export VDB_INC="${PREFIX}/include" +fi + +cmake -S sra-tools/ -B build_sratools/ \ + -DVDB_BINDIR="${PREFIX}" \ + -DVDB_LIBDIR="${PREFIX}/lib64" \ + -DVDB_INCDIR="${VDB_INC}" \ + -DCMAKE_INSTALL_PREFIX="${PREFIX}" \ + -DCMAKE_BUILD_TYPE=Release \ + -DCMAKE_CXX_COMPILER="${CXX}" \ + -DCMAKE_CXX_FLAGS="${CXXFLAGS}" + +cmake --build build_sratools/ --target install -j ${CPU_COUNT} -v # Strip package version from binary names @@ -42,5 +46,5 @@ for exe in \ srapath-orig \ sra-pileup-orig do - ln -s "${exe}.${PKG_VERSION}" "${exe}" + ln -sf "${exe}.${PKG_VERSION}" "${exe}" done diff --git a/recipes/sra-tools/build_failure.linux-64.yaml b/recipes/sra-tools/build_failure.linux-64.yaml deleted file mode 100644 index 7d780860f3697..0000000000000 --- a/recipes/sra-tools/build_failure.linux-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: 74068ce82e029b1de83b1336a271611bb232a4f1c51434eb8bb0c9b87a402e99 # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |- - /opt/conda/conda-bld/sra-tools_1685393115370/work/sra-tools/tools/external/sra-pileup/sam-dump.c: In function 'DumpCGSAM.part.0': - /opt/conda/conda-bld/sra-tools_1685393115370/work/sra-tools/tools/external/sra-pileup/sam-dump.c:2457:40: warning: 'last_cig_op' may be used uninitialized in this function [-Wmaybe-uninitialized] - 2457 | ciglen = last_ciglen sprintf(dstlast_ciglen,"%d%c",last_cig_oplen,last_cig_op); \ - | ^~~~~~~ - /opt/conda/conda-bld/sra-tools_1685393115370/work/sra-tools/tools/external/sra-pileup/sam-dump.c:2445:14: note: 'last_cig_op' was declared here - 2445 | char last_cig_op; - | ^~~~~~~~~~~ - [ 68%] Building C object tools/external/sra-pileup/CMakeFiles/sam-dump.dir/sam-dump3.c.o - /opt/conda/conda-bld/sra-tools_1685393115370/work/sra-tools/tools/external/sra-pileup/sam-dump3.c: In function 'KMain': - /opt/conda/conda-bld/sra-tools_1685393115370/work/sra-tools/tools/external/sra-pileup/sam-dump3.c:510:10: warning: 'mode' may be used uninitialized in this function [-Wmaybe-uninitialized] - 510 | rc = init_out_redir( &redir, mode, opts->outputfile, opts->output_buffer_size ); /* from out_redir.c */ - | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - /opt/conda/conda-bld/sra-tools_1685393115370/work/sra-tools/tools/external/sra-pileup/sam-dump3.c:502:25: note: 'mode' was declared here - 502 | enum out_redir_mode mode; - | ^~~~ - [ 68%] Building C object tools/external/sra-pileup/CMakeFiles/sam-dump.dir/dyn_string.c.o - [ 69%] Linking C executable ../../../bin/sam-dump - [ 69%] Built target sam-dump - [ 70%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/helper.c.o - [ 70%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/arg_helper.c.o - [ 70%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/dflt_defline.c.o - [ 71%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/tool_ctx.c.o - [ 71%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/inspector.c.o - [ 71%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/sbuffer.c.o - [ 71%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/err_msg.c.o - [ 72%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/file_tools.c.o - [ 72%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/var_fmt.c.o - [ 72%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/flex_printer.c.o - [ 72%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/temp_dir.c.o - [ 73%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/progress_thread.c.o - [ 73%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/cleanup_task.c.o - [ 73%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/index.c.o - [ 74%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/lookup_writer.c.o - [ 74%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/lookup_reader.c.o - [ 74%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/locked_file_list.c.o - [ 74%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/locked_value.c.o - [ 75%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/file_printer.c.o - [ 75%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/merge_sorter.c.o - [ 75%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/sorter.c.o - [ 76%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/cmn_iter.c.o - [ 76%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/raw_read_iter.c.o - [ 76%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/special_iter.c.o - [ 76%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/fastq_iter.c.o - [ 77%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/db_join.c.o - [ 77%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/tbl_join.c.o - [ 77%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/temp_registry.c.o - [ 77%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/copy_machine.c.o - [ 78%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/concatenator.c.o - [ 78%] Building C object tools/external/fasterq-dump/CMakeFiles/fasterq-dump.dir/fasterq-dump.c.o - [ 78%] Linking C executable ../../../bin/fasterq-dump - [ 78%] Built target fasterq-dump - [ 79%] Building C object tools/external/vdb-dump/CMakeFiles/vdb-dump.dir/vdb-dump-context.c.o - [ 79%] Building C object tools/external/vdb-dump/CMakeFiles/vdb-dump.dir/vdb-dump-coldefs.c.o - [ 79%] Building C object tools/external/vdb-dump/CMakeFiles/vdb-dump.dir/vdb-dump-tools.c.o - In file included from /opt/conda/conda-bld/sra-tools_1685393115370/work/sra-tools/tools/external/vdb-dump/vdb-dump-tools.c:41: - /opt/conda/conda-bld/sra-tools_1685393115370/work/sra-tools/tools/external/vdb-dump/vdb-dump-tools.c: In function 'vdt_dump_float_element': - /opt/conda/conda-bld/sra-tools_1685393115370/_build_env/include/cc/gcc/x86_64/bitstr.h:35:20: warning: 'value' may be used uninitialized in this function [-Wmaybe-uninitialized] - 35 | #define BSWAP( x ) bswap_32 ( x ) - | ^~~~~~~~ - /opt/conda/conda-bld/sra-tools_1685393115370/_build_env/include/cc/gcc/x86_64/bitstr.h:35:20: warning: 'value' may be used uninitialized in this function [-Wmaybe-uninitialized] - /opt/conda/conda-bld/sra-tools_1685393115370/_build_env/include/cc/gcc/x86_64/bitstr.h:35:20: warning: '*((void *)&value4)' may be used uninitialized in this function [-Wmaybe-uninitialized] - [ 79%] Building C object tools/external/vdb-dump/CMakeFiles/vdb-dump.dir/vdb-dump-str.c.o - [ 80%] Building C object tools/external/vdb-dump/CMakeFiles/vdb-dump.dir/vdb-dump-helper.c.o - [ 80%] Building C object tools/external/vdb-dump/CMakeFiles/vdb-dump.dir/vdb-dump-formats.c.o - [ 80%] Building C object tools/external/vdb-dump/CMakeFiles/vdb-dump.dir/vdb-dump-redir.c.o - [ 80%] Building C object tools/external/vdb-dump/CMakeFiles/vdb-dump.dir/vdb-dump-fastq.c.o - [ 81%] Building C object tools/external/vdb-dump/CMakeFiles/vdb-dump.dir/vdb_info.c.o - [ 81%] Building C object tools/external/vdb-dump/CMakeFiles/vdb-dump.dir/vdb-dump.c.o - [ 81%] Linking C executable ../../../bin/vdb-dump - [ 81%] Built target vdb-dump - [ 81%] Building C object tools/external/vdb-validate/CMakeFiles/vdb-validate.dir/vdb-validate.c.o - /opt/conda/conda-bld/sra-tools_1685393115370/work/sra-tools/tools/external/vdb-validate/vdb-validate.c: In function 'kdbcc': - /opt/conda/conda-bld/sra-tools_1685393115370/work/sra-tools/tools/external/vdb-validate/vdb-validate.c:410:18: error: too many arguments to function 'KTableConsistencyCheck' - 410 | rc = KTableConsistencyCheck ( tbl, 0, level, report, & ctx, platform ); - | ^~~~~~~~~~~~~~~~~~~~~~ - In file included from /opt/conda/conda-bld/sra-tools_1685393115370/work/sra-tools/tools/external/vdb-validate/vdb-validate.c:41: - /opt/conda/conda-bld/sra-tools_1685393115370/_build_env/include/kdb/consistency-check.h:126:20: note: declared here - 126 | KDB_EXTERN rc_t CC KTableConsistencyCheck ( struct KTable const *self, - | ^~~~~~~~~~~~~~~~~~~~~~ - make[2]: *** [tools/external/vdb-validate/CMakeFiles/vdb-validate.dir/build.make:76: tools/external/vdb-validate/CMakeFiles/vdb-validate.dir/vdb-validate.c.o] Error 1 - make[1]: *** [CMakeFiles/Makefile2:2495: tools/external/vdb-validate/CMakeFiles/vdb-validate.dir/all] Error 2 - make: *** [Makefile:166: all] Error 2 - Traceback (most recent call last): - File "/opt/conda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/conda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 2198, in build - utils.check_call_env(cmd, env=env, rewrite_stdout_env=rewrite_env, - File "/opt/conda/lib/python3.8/site-packages/conda_build/utils.py", line 451, in check_call_env - return _func_defaulting_env_to_os_environ("call", *popenargs, **kwargs) - File "/opt/conda/lib/python3.8/site-packages/conda_build/utils.py", line 427, in _func_defaulting_env_to_os_environ - raise subprocess.CalledProcessError(proc.returncode, _args) - subprocess.CalledProcessError: Command '['/bin/bash', '-o', 'errexit', '/opt/conda/conda-bld/sra-tools_1685393115370/work/conda_build.sh']' returned non-zero exit status 2. -# Last 100 lines of the build log. diff --git a/recipes/sra-tools/conda_build_config.yaml b/recipes/sra-tools/conda_build_config.yaml index 1271f9dfbd295..fc9d91e7aedb6 100644 --- a/recipes/sra-tools/conda_build_config.yaml +++ b/recipes/sra-tools/conda_build_config.yaml @@ -1,7 +1,7 @@ # current version does not build with newer compilers cxx_compiler_version: - - 10 # [linux] + - 11 # [linux] - 14 # [osx] c_compiler_version: - - 10 # [linux] + - 11 # [linux] - 14 # [osx] diff --git a/recipes/sra-tools/meta.yaml b/recipes/sra-tools/meta.yaml index a108dacb2488c..bd3db099f622f 100644 --- a/recipes/sra-tools/meta.yaml +++ b/recipes/sra-tools/meta.yaml @@ -1,19 +1,21 @@ {% set name = "sra-tools" %} -{% set version = "3.0.10" %} -{% set sha256 = "93cfa802938506866b9d565a18a31ac84fd26f2929636b23f1f8dd9f39cf977d" %} +{% set version = "3.1.0" %} +{% set sha256 = "ce92ce887ee4a7581a7511cfb6b965ac6a5e38841bad9be66a3aee903ec48952" %} package: name: {{ name }} version: {{ version }} source: - url: https://github.com/ncbi/sra-tools/archive/refs/tags/{{version}}.tar.gz +- url: https://github.com/ncbi/sra-tools/archive/refs/tags/{{version}}.tar.gz sha256: {{ sha256 }} folder: sra-tools +- url: https://github.com/ncbi/ncbi-vdb/archive/refs/tags/{{version}}.tar.gz # [osx] + sha256: eec5a64b8353a201bd4cf2c58cfcbb3622327397c3b11696ae59d827fcfcea9d # [osx] + folder: ncbi-vdb # [osx] build: - number: 0 - skip: True # [osx] + number: 1 run_exports: - {{ pin_subpackage(name, max_pin='x') }} @@ -24,6 +26,7 @@ requirements: - cmake - bison - flex + host: - ncbi-vdb >={{ version }} run: - ca-certificates @@ -57,6 +60,8 @@ about: description: | The SRA Toolkit and SDK from NCBI is a collection of tools and libraries for using data in the INSDC Sequence Read Archives. + dev_url: https://github.com/ncbi/sra-tools + doc_url: https://github.com/ncbi/sra-tools/wiki extra: notes: 'After installation, you should run the configuration tool: ./vdb-config diff --git a/recipes/srahunter/meta.yaml b/recipes/srahunter/meta.yaml new file mode 100644 index 0000000000000..2efaca256b3a9 --- /dev/null +++ b/recipes/srahunter/meta.yaml @@ -0,0 +1,46 @@ +{% set name = "srahunter" %} +{% set version = "0.0.2" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/GitEnricoNeko/srahunter/archive/refs/tags/{{version}}.tar.gz + sha256: 635dbea61296fc84857b8290fb8858b5dbc26301031d8fce3a5de2e340c78740 +build: + entry_points: + - srahunter=scripts.cli:main + noarch: python + script: {{ PYTHON }} -m pip install . --no-build-isolation --no-deps -vvv + number: 0 + run_exports: + - {{ pin_subpackage('srahunter', max_pin="x") }} + +requirements: + host: + - python >=3.6 + - pip + run: + - datavzrd + - entrez-direct + - python >=3.6 + - pandas >=2.0.2 + - psutil >=5.7 + - pyfiglet + - requests >=2.31.0 + - tqdm >=4.66.1 + - sra-tools + +test: + commands: + - pip check + - srahunter --help + requires: + - pip + +about: + home: https://github.com/GitEnricoNeko/srahunter + license: MIT + license_file: LICENSE + summary: "srahunter is a tool for processing SRA accession numbers." diff --git a/recipes/staden_io_lib/meta.yaml b/recipes/staden_io_lib/meta.yaml index 281cfd3b3d0e7..ed1200fa9c0ff 100644 --- a/recipes/staden_io_lib/meta.yaml +++ b/recipes/staden_io_lib/meta.yaml @@ -11,7 +11,7 @@ source: sha256: {{ hash }} build: - number: 7 + number: 8 skip: True # [osx] run_exports: - {{ pin_subpackage('staden_io_lib', max_pin='x.x') }} @@ -42,3 +42,7 @@ about: license: BSD license_file: COPYRIGHT summary: 'Staden io_lib is a library of file reading and writing code e.g. for SAM/BAM/CRAM' + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/star-fusion/meta.yaml b/recipes/star-fusion/meta.yaml index 2730d3d2414c3..1b1614c82a910 100644 --- a/recipes/star-fusion/meta.yaml +++ b/recipes/star-fusion/meta.yaml @@ -1,40 +1,42 @@ {% set name = "STAR-Fusion" %} -{% set version = "1.12.0" %} -{% set sha256 = "f99e008a69bdbd8e3cfe51a50f1a57860d4c9a30e2f4f2de80a9b32c97f50e41" %} +{% set version = "1.13.0" %} +{% set sha256 = "39087681abfea5d09e3bff54f91853588b11ec5a924481ab5dc7cfbbd0742e03" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://github.com/STAR-Fusion/STAR-Fusion/releases/download/STAR-Fusion-v{{ version }}/STAR-Fusion-v{{ version }}.FULL.tar.gz + url: https://github.com/STAR-Fusion/STAR-Fusion/releases/download/STAR-Fusion-v{{ version }}/STAR-Fusion.v0.13.0.FULL.tar.gz sha256: {{ sha256 }} build: - number: 1 + number: 0 noarch: generic + run_exports: + - {{ pin_subpackage('star-fusion', max_pin="x") }} requirements: run: - - bbmap - - blast - - bzip2 - - gmap - - htslib - - igv-reports - - openssl - - perl - - perl-carp - - perl-carp-assert - - perl-db-file - - perl-io-gzip - - perl-json-xs - - perl-set-intervaltree - - perl-uri - - python - - samtools <1.10 - - star ==2.7.8a - - trinity <2.9 + - bbmap + - blast + - bzip2 + - gmap + - htslib + - igv-reports + - openssl + - perl + - perl-carp + - perl-carp-assert + - perl-db-file + - perl-io-gzip + - perl-json-xs + - perl-set-intervaltree + - perl-uri + - python + - samtools <1.10 + - star ==2.7.8a + - trinity <2.9 test: commands: @@ -48,3 +50,11 @@ about: license_file: LICENSE license_family: BSD summary: "STAR-Fusion fusion variant caller. All dependencies required to run FusionInspector and FusionAnnotator are included." + doc_url: https://github.com/STAR-Fusion/STAR-Fusion/wiki + dev_url: https://github.com/STAR-Fusion/STAR-Fusion + +extra: + identifiers: + - doi:10.1186/s13059-019-1842-9 + - biotools:star-fusion + - usegalaxy-eu:star_fusion diff --git a/recipes/star/build.sh b/recipes/star/build.sh index fd1118c08c27b..c10bb36255423 100644 --- a/recipes/star/build.sh +++ b/recipes/star/build.sh @@ -23,7 +23,7 @@ else cp ../simd-dispatch.sh $PREFIX/bin/STAR cp ../simd-dispatch.sh $PREFIX/bin/STARlong else - make pj "$(nproc)" STAR STARlong + make -pj "$(nproc)" STAR STARlong cp STAR $PREFIX/bin/STAR cp STARlong $PREFIX/bin/STARlong fi diff --git a/recipes/star/meta.yaml b/recipes/star/meta.yaml index 08e21507fba8d..d0504bcb00d36 100644 --- a/recipes/star/meta.yaml +++ b/recipes/star/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.7.11a" %} -{% set sha256 = "542457b1a4fee73f27a581b1776e9f73ad2b4d7e790388b6dc71147bd039f99a" %} +{% set version = "2.7.11b" %} +{% set sha256 = "3f65305e4112bd154c7e22b333dcdaafc681f4a895048fa30fa7ae56cac408e7" %} package: name: star @@ -15,7 +15,7 @@ source: - patches/0003-create-simd-dispatch.patch build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('star', max_pin="x") }} @@ -27,8 +27,10 @@ requirements: - vim host: - htslib + - zlib run: - htslib + - zlib test: commands: @@ -42,7 +44,11 @@ about: summary: An RNA-seq read aligner. extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:star - usegalaxy-eu:rna_starsolo - usegalaxy-eu:rna_star + recipe-maintainers: + - mjsteinbaugh diff --git a/recipes/starcode/meta.yaml b/recipes/starcode/meta.yaml index 7421d4d857ad0..2d1b57415ccf5 100644 --- a/recipes/starcode/meta.yaml +++ b/recipes/starcode/meta.yaml @@ -9,7 +9,9 @@ source: sha256: b4f0eae9498f2dcf9c8a7fa2fa88b141c6d5abcf6da44b03d5d85e5f1a8fd5b1 build: - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage('starcode', max_pin='x.x') }} requirements: build: @@ -25,3 +27,7 @@ about: home: https://github.com/gui11aume/starcode license: GPLv3 summary: 'Starcode: sequence clustering based on all-pairs search' + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/stecfinder/meta.yaml b/recipes/stecfinder/meta.yaml index 93560d5d7a168..4309d12496f0b 100644 --- a/recipes/stecfinder/meta.yaml +++ b/recipes/stecfinder/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.1.1" %} +{% set version = "1.1.2" %} {% set name = "stecfinder" %} package: @@ -7,7 +7,7 @@ package: source: url: https://github.com/LanLab/{{ name }}/archive/v{{ version }}.tar.gz - sha256: 270a80b78f7ab9d69f35b67128da967e23a08538a608dc919865158236ca5de5 + sha256: 56143eca071f750d9aad69451c3028ecffb7c4f701386b7cf923a193ef916965 build: noarch: python diff --git a/recipes/straglr/meta.yaml b/recipes/straglr/meta.yaml index ea5ed75c81eaf..572fb1c829da6 100644 --- a/recipes/straglr/meta.yaml +++ b/recipes/straglr/meta.yaml @@ -1,32 +1,36 @@ -{% set version = "1.4.1" %} +{% set name = "straglr" %} +{% set version = "1.5.0" %} package: - name: straglr + name: {{ name }} version: {{ version }} source: - url: https://github.com/bcgsc/straglr/archive/refs/tags/v1.4.1.tar.gz - sha256: 6c37a5f5cd91b81d766f0a524170fcf96fb288d184f796bfabb6bda335212f9e + url: https://github.com/bcgsc/straglr/archive/refs/tags/v1.5.0.tar.gz + sha256: 9daab4251a640959e3caa59e9ebfec1fbd0384c78730b4e71fd5a81d7fa23f58 build: noarch: python number: 0 - script: {{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv + run_exports: + - {{ pin_subpackage('straglr', max_pin="x") }} requirements: host: - python >=3.7 - pip run: + - python >=3.7 - trf - blast - pysam >=0.14.0 - - pybedtools >=0.7.9 + - pybedtools >=0.9.0 - intspan >=1.5.8 - - numpy >=1.14.2 + - numpy >=1.22.3 - pathos >=0.2.3 - - scikit-learn >=0.19.0 - - scipy >=1.0.1 + - scikit-learn >=1.1 + - scipy >=1.8.0 test: commands: @@ -34,10 +38,12 @@ test: about: home: https://github.com/bcgsc/straglr - license: MIT License + license: GPL-3.0-or-later summary: 'Short-tandem repeat genotyping using long reads ' license_family: GPL3 - + license_file: LICENSE + dev_url: https://github.com/bcgsc/straglr + extra: recipe-maintainers: - wdecoster diff --git a/recipes/straindesign/meta.yaml b/recipes/straindesign/meta.yaml index d7951054be15c..ead98afb52998 100644 --- a/recipes/straindesign/meta.yaml +++ b/recipes/straindesign/meta.yaml @@ -1,5 +1,5 @@ {% set name = "straindesign" %} -{% set version = "3.2.2" %} +{% set version = "3.2.3" %} package: name: {{ name }} @@ -7,23 +7,24 @@ package: source: url: https://github.com/brsynth/{{ name }}/archive/{{ version }}.tar.gz - sha256: 3574003d2034d2e417230990d751840ddef9c505e57ddcc60e243cc6980779e2 + sha256: 326d55fb45321a89a2f32b9a8e966dbe1a15e070e504366c5e0fa050b67baca8 build: number: 0 noarch: python script: {{ PYTHON }} -m pip install -vv . + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: build: - pip - - python + - python >=3.8 - pyyaml - setuptools run: - biopython - blessings - - click - cobra >=0.24 - escher - future @@ -32,14 +33,11 @@ requirements: - IProgress - lazy-object-proxy - plotly - - python - - markupsafe + - python >=3.8 - networkx - numexpr - - numpy <1.24 # Related to https://github.com/numpy/numpy/pull/22607 - openbabel - openpyxl - - optlang - ordered-set - palettable - pandas @@ -63,3 +61,4 @@ about: extra: recipe-maintainers: - guillaume-gricourt + - tduigou diff --git a/recipes/strainr2/build.sh b/recipes/strainr2/build.sh index 9e30d76742542..7919ee79c22f1 100644 --- a/recipes/strainr2/build.sh +++ b/recipes/strainr2/build.sh @@ -1,7 +1,8 @@ -#! /bin/bash -mkdir -p ${PREFIX}/bin +#!/bin/bash -euo -$CC $SRC_DIR/subcontig.c -o subcontig +mkdir -p "${PREFIX}/bin" + +${CC} ${SRC_DIR}/subcontig.c -o subcontig chmod +x $SRC_DIR/PreProcessR chmod +x $SRC_DIR/subcontig @@ -9,8 +10,8 @@ chmod +x $SRC_DIR/hashcounter.py chmod +x $SRC_DIR/Plot.R chmod +x $SRC_DIR/StrainR -cp $SRC_DIR/PreProcessR ${PREFIX}/bin/ -cp $SRC_DIR/subcontig ${PREFIX}/bin/ -cp $SRC_DIR/hashcounter.py ${PREFIX}/bin/ -cp $SRC_DIR/Plot.R ${PREFIX}/bin/ -cp $SRC_DIR/StrainR ${PREFIX}/bin/ +cp $SRC_DIR/PreProcessR ${PREFIX}/bin/ +cp $SRC_DIR/subcontig ${PREFIX}/bin/ +cp $SRC_DIR/hashcounter.py ${PREFIX}/bin/ +cp $SRC_DIR/Plot.R ${PREFIX}/bin/ +cp $SRC_DIR/StrainR ${PREFIX}/bin/ diff --git a/recipes/strainr2/meta.yaml b/recipes/strainr2/meta.yaml index d0e50a9dcfb66..588aa7c636683 100644 --- a/recipes/strainr2/meta.yaml +++ b/recipes/strainr2/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.0.0" %} +{% set version = "1.0.1" %} package: name: strainr2 @@ -6,28 +6,28 @@ package: source: url: https://github.com/BisanzLab/StrainR2/archive/v{{ version }}.tar.gz - sha256: 6ed9671c875ec6388960dbac02a73629d58ad20adad1fe297d905d8969ec0489 + sha256: 943121e54a386bf3cf6e8278b6d443d0d3d2b0edfaff795bcc25777ad3879abb build: number: 0 run_exports: - - {{ pin_subpackage("strainr2", max_pin="x.x") }} + - {{ pin_subpackage("strainr2", max_pin="x") }} requirements: build: - {{ compiler('c') }} host: - - python >=3.12.0 - - r-base >=4.3.2 + - python + - r-base >=4.2.0 run: - - bbmap >=39.01 - - fastp >=0.23.4 - - python >=3.12.0 - - samtools >=1.18 - - sourmash >=4.8.4 - - r-base >=4.3.2 - - r-optparse >=1.7.3 - - r-tidyverse >=2.0.0 + - python + - bbmap + - fastp + - samtools + - sourmash >=4.0.0 + - r-base >=4.2.0 + - r-optparse + - r-tidyverse test: commands: diff --git a/recipes/strainscan/meta.yaml b/recipes/strainscan/meta.yaml index e4bb6caf0e437..a16796f4a5b47 100644 --- a/recipes/strainscan/meta.yaml +++ b/recipes/strainscan/meta.yaml @@ -10,7 +10,7 @@ source: sha256: 2d927c5ac4d9b89a166afeca2aabaf4086d49b097e357ed0feb34181295cf243 build: - number: 0 + number: 1 entry_points: - strainscan = StrainScan.StrainScan:main - strainscan_build = StrainScan.StrainScan_build:main @@ -25,7 +25,7 @@ requirements: - python ==3.7.3 run: - python ==3.7.3 - - sibeliaz ==1.2.2 + - sibeliaz ==1.2.3 - r-base ==4.0.2 - numpy ==1.17.3 - pandas ==1.0.1 diff --git a/recipes/stringtie/build.sh b/recipes/stringtie/build.sh index 5e2d7207edd0d..cb22d7d109407 100644 --- a/recipes/stringtie/build.sh +++ b/recipes/stringtie/build.sh @@ -1,5 +1,7 @@ #!/bin/sh +ln -s $PREFIX/lib/libz.so.1 $PREFIX/lib/libz.so + export C_INCLUDE_PATH=$PREFIX/include export CPLUS_INCLUDE_PATH=$PREFIX/include export LINKER="$CXX" diff --git a/recipes/stringtie/meta.yaml b/recipes/stringtie/meta.yaml index a005ac59713ab..fe28cb6bc9bc5 100644 --- a/recipes/stringtie/meta.yaml +++ b/recipes/stringtie/meta.yaml @@ -1,6 +1,6 @@ {% set name = "StringTie" %} -{% set version = "2.2.1" %} -{% set sha256 = "ce4eec532bbbe39af462be844afa6395ab38fa3418ef5fc2431e2d6194129527" %} +{% set version = "2.2.2" %} +{% set sha256 = "f75f23b8466898d27984fb99cf6f828094fb3ed0307aed7af76e334acb997010" %} package: name: {{ name|lower }} @@ -13,7 +13,9 @@ source: - patch build: - number: 5 + number: 0 + run_exports: + - {{ pin_subpackage("stringtie", max_pin="x.x") }} # TODO currently fails to build on osx. # Feel free to re-enable and debug. skip: true # [osx] @@ -21,6 +23,7 @@ build: requirements: build: - make + - zlib - {{ compiler('c') }} - {{ compiler('cxx') }} host: @@ -44,6 +47,8 @@ about: dev_url: https://github.com/gpertea/stringtie extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:StringTie - usegalaxy-eu:stringtie diff --git a/recipes/strobealign/meta.yaml b/recipes/strobealign/meta.yaml index 11fa5f4b70fe5..f2b28b7497ef1 100644 --- a/recipes/strobealign/meta.yaml +++ b/recipes/strobealign/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.12.0" %} +{% set version = "0.13.0" %} package: name: strobealign @@ -11,7 +11,7 @@ build: source: url: https://github.com/ksahlin/strobealign/archive/refs/tags/v{{ version }}.tar.gz - sha256: 1ea8d081ee172b5444578bcbf261d130ea6744d9cbfc76154121e17f405ea975 + sha256: 50f1585a8b3b733680067aa7ae20146a7d94d064d9fa234df0715bfcc5289c41 requirements: build: diff --git a/recipes/submission-excel2xml/build.sh b/recipes/submission-excel2xml/build.sh index e94caa89de577..a873d246167d1 100644 --- a/recipes/submission-excel2xml/build.sh +++ b/recipes/submission-excel2xml/build.sh @@ -1,58 +1,40 @@ #! /bin/bash -gem install date -v "3.0.0" -gem install open3 -v "0.1.2" -gem install mini_portile2 -v "2.4.0" -gem install nokogiri -v "1.15.3" -gem install rubyzip -v "2.3.2" -gem install roo -v "2.10.0" -gem install builder -v "3.2.4" -gem install rexml -v "3.2.5" +APPROOT=$PREFIX/opt/$PKG_NAME -APPROOT=$PREFIX/opt/submission-excel2xml +mkdir -p $APPROOT +bundle install && \ + bundle exec rake install && \ + bundle exec rake clobber + + +sed -i '1s|^.*$|#! /usr/bin/env ruby|' $PREFIX/share/rubygems/bin/excel2xml_dra +sed -i '1s|^.*$|#! /usr/bin/env ruby|' $PREFIX/share/rubygems/bin/excel2xml_jga +sed -i '1s|^.*$|#! /usr/bin/env ruby|' $PREFIX/share/rubygems/bin/submission-excel2xml +sed -i '1s|^.*$|#! /usr/bin/env ruby|' $PREFIX/share/rubygems/bin/validate_meta_dra +sed -i '1s|^.*$|#! /usr/bin/env ruby|' $PREFIX/share/rubygems/bin/validate_meta_jga + + + +# Downloading xsd files +# Files will be downloaded to $PREFIX/opt/submission-excel2xml/data +# "submission-excel2xml/data" is hard-coded in the source code. +export XDG_DATA_HOME=$PREFIX/opt +submission-excel2xml download_xsd + +# copy sample files +cp -r example/ $APPROOT/ + + +## Set variables on env activation +mkdir -p ${PREFIX}/etc/conda/activate.d ${PREFIX}/etc/conda/deactivate.d +cat <> ${PREFIX}/etc/conda/activate.d/${PKG_NAME}.sh +export XDG_DATA_HOME=$PREFIX/opt +EOF + +cat <> ${PREFIX}/etc/conda/deactivate.d/${PKG_NAME}.sh +unset XDG_DATA_HOME +EOF -mkdir -p $APPROOT -# sed -i.bak '1 s|^.*$|#!/usr/bin/env ruby|g' *.rb - -cp excel2xml_dra.rb $APPROOT/ -cp validate_meta_dra.rb $APPROOT/ -cp excel2xml_jga.rb $APPROOT/ -cp validate_meta_jga.rb $APPROOT/ - -chmod a+x $APPROOT/excel2xml_dra.rb -chmod a+x $APPROOT/validate_meta_dra.rb -chmod a+x $APPROOT/excel2xml_jga.rb -chmod a+x $APPROOT/validate_meta_jga.rb - - -mkdir -p $APPROOT/xsd - -cd $APPROOT/xsd - -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/dra/xsd/1-5/SRA.analysis.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/dra/xsd/1-5/SRA.annotation.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/dra/xsd/1-5/SRA.common.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/dra/xsd/1-5/SRA.experiment.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/dra/xsd/1-5/SRA.package.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/dra/xsd/1-5/SRA.run.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/dra/xsd/1-5/SRA.sample.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/dra/xsd/1-5/SRA.study.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/dra/xsd/1-5/SRA.submission.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/jga/xsd/1-2/JGA.analysis.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/jga/xsd/1-2/JGA.common.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/jga/xsd/1-2/JGA.dac.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/jga/xsd/1-2/JGA.data.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/jga/xsd/1-2/JGA.dataset.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/jga/xsd/1-2/JGA.experiment.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/jga/xsd/1-2/JGA.policy.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/jga/xsd/1-2/JGA.sample.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/jga/xsd/1-2/JGA.study.xsd -curl -LO https://raw.githubusercontent.com/ddbj/pub/master/docs/jga/xsd/1-2/JGA.submission.xsd - -cd $PREFIX/bin -ln -s ../opt/submission-excel2xml/excel2xml_dra.rb ./ -ln -s ../opt/submission-excel2xml/validate_meta_dra.rb ./ -ln -s ../opt/submission-excel2xml/excel2xml_jga.rb ./ -ln -s ../opt/submission-excel2xml/validate_meta_jga.rb ./ diff --git a/recipes/submission-excel2xml/meta.yaml b/recipes/submission-excel2xml/meta.yaml index fe1bdec983d3e..8a1c9a794ed3f 100644 --- a/recipes/submission-excel2xml/meta.yaml +++ b/recipes/submission-excel2xml/meta.yaml @@ -1,6 +1,9 @@ +{% set version = "2.6" %} + package: name: submission-excel2xml - version: "2.0.0" + version: {{ version }} + build: number: 0 noarch: generic @@ -8,26 +11,25 @@ build: - {{ pin_subpackage('submission-excel2xml', max_pin="x") }} source: - url: https://github.com/ddbj/submission-excel2xml/archive/refs/heads/master.zip - md5: 746ef9a1e1bd13f20a0b348fd080eb45 - patches: - - patch + url: https://github.com/ddbj/submission-excel2xml/archive/refs/tags/v{{ version }}.tar.gz + sha256: 50d903242184967be8a39a88bb0e0bd0cf6d0d185c89b89fe3ed9525875fe01d requirements: - build: - - make host: - - ruby 3.2.2 + - make + - ruby >=3.0 - compilers - - libxml2 run: - - ruby 3.2.2 - - compilers + - ruby >=3.0 - libxml2 test: commands: - - "excel2xml_jga.rb -h" + # - excel2xml_dra -h + # - excel2xml_jga -h + - excel2xml_dra -a example -i 0001 -p PRJDB7252 ${XDG_DATA_HOME}/submission-excel2xml/example/example-0001_dra_metadata.xlsx && validate_meta_dra -a example -i 0001 + - excel2xml_dra -a example -i 0002 -p PRJDB7252 -c "National Institute of Genetics" ${XDG_DATA_HOME}/submission-excel2xml/example/example-0002_dra_metadata.xlsx && validate_meta_dra -a example -i 0002 + - excel2xml_jga -j JSUB999999 ${XDG_DATA_HOME}/submission-excel2xml/example/JSUB999999_jga_metadata.xlsx && validate_meta_jga -j JSUB999999 about: home: https://github.com/ddbj/submission-excel2xml diff --git a/recipes/submission-excel2xml/patch b/recipes/submission-excel2xml/patch deleted file mode 100644 index 59faa15a8cfa7..0000000000000 --- a/recipes/submission-excel2xml/patch +++ /dev/null @@ -1,60 +0,0 @@ -diff --git a/excel2xml_dra.rb b/excel2xml_dra.rb -index ff30c77..2dbf2ba 100644 ---- a/excel2xml_dra.rb -+++ b/excel2xml_dra.rb -@@ -1,4 +1,4 @@ --#! /usr/bin/ruby -+#! /usr/bin/env ruby - # -*- coding: utf-8 -*- - - require 'rubygems' -diff --git a/excel2xml_jga.rb b/excel2xml_jga.rb -index 8bd6b32..0cdfebe 100644 ---- a/excel2xml_jga.rb -+++ b/excel2xml_jga.rb -@@ -1,4 +1,4 @@ --#! /usr/bin/ruby -+#! /usr/bin/env ruby - # -*- coding: utf-8 -*- - - require 'rubygems' -diff --git a/validate_meta_dra.rb b/validate_meta_dra.rb -index 47d417d..8256cfb 100644 ---- a/validate_meta_dra.rb -+++ b/validate_meta_dra.rb -@@ -1,4 +1,4 @@ --#! /usr/bin/ruby -+#! /usr/bin/env ruby - # -*- coding: utf-8 -*- - - require 'rubygems' -@@ -53,7 +53,7 @@ end - - ## Validate DRA XML against xsd - #xsd_path = "/opt/submission-excel2xml/" --xsd_path = "xsd/" -+xsd_path = __dir__ + "/xsd/" - - puts "\n== XML validation against SRA xsd ==" - if FileTest.exist?("#{submission_id}_dra_Submission.xml") -diff --git a/validate_meta_jga.rb b/validate_meta_jga.rb -index 055bc61..1d3d2f6 100644 ---- a/validate_meta_jga.rb -+++ b/validate_meta_jga.rb -@@ -1,4 +1,4 @@ --#! /usr/bin/ruby -+#! /usr/bin/env ruby - # -*- coding: utf-8 -*- - - require 'rexml/document' -@@ -41,8 +41,8 @@ meta_object = ['Submission', 'Study', 'Sample', 'Experiment', 'Data', 'Analysis' - ## - - ## Validate XMLs against JGA xsd --xsd_path = "/opt/submission-excel2xml/" --#xsd_path = "xsd/" -+#xsd_path = "/opt/submission-excel2xml/" -+xsd_path = __dir__ + "/xsd/" - - xml_a = [] - Dir.glob("#{submission_id}*xml").each{|xml| diff --git a/recipes/superdsm/meta.yaml b/recipes/superdsm/meta.yaml index 12aa1e1c73a4d..2cd31150b245f 100644 --- a/recipes/superdsm/meta.yaml +++ b/recipes/superdsm/meta.yaml @@ -1,5 +1,5 @@ {% set name = "SuperDSM" %} -{% set version = "0.1.3" %} +{% set version = "0.2.0" %} {% set repo_url = "https://github.com/BMCV/SuperDSM" %} {% set docs_url = "https://superdsm.readthedocs.io" %} @@ -9,12 +9,14 @@ package: source: url: "{{ repo_url }}/archive/refs/tags/v{{ version }}.zip" - sha256: f55abbd6818a66886ddfe3f7fd9c5dd93c63ed2b6e3179552106e560a000ad5f + sha256: 9e9365f8df6e925851dd2bf2adeb71cdb52a6d20c775b1da4c7d8e641a02f8d7 build: - number: 1 + number: 0 noarch: python script: "{{ PYTHON }} -m pip install --no-deps --ignore-installed . -vv " + run_exports: + - {{ pin_subpackage(name|lower, max_pin="x.x") }} requirements: host: diff --git a/recipes/svync/build.sh b/recipes/svync/build.sh new file mode 100644 index 0000000000000..888542f1bb2ed --- /dev/null +++ b/recipes/svync/build.sh @@ -0,0 +1,4 @@ +#!/bin/bash +chmod a+x svync* +mkdir -p $PREFIX/bin +cp svync* $PREFIX/bin/svync \ No newline at end of file diff --git a/recipes/svync/meta.yaml b/recipes/svync/meta.yaml new file mode 100644 index 0000000000000..9430c018d9b6c --- /dev/null +++ b/recipes/svync/meta.yaml @@ -0,0 +1,36 @@ +{% set version = '0.1.2' %} +{% set name = 'svync' %} + +package: + name: {{ name }} + version: {{ version }} + +source: + - url: https://github.com/nvnieuwk/svync/releases/download/{{ version }}/svync-{{ version }}-darwin-amd64.tar.gz # [osx-amd64] + md5: 2f64a4d9b81124917766bd8a754ea470 # [osx] + - url: https://github.com/nvnieuwk/svync/releases/download/{{ version }}/svync-{{ version }}-linux-amd64.tar.gz # [linux] + md5: 298f930c1f30918bd41d07db5bbfd348 # [linux] + +build: + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} + +requirements: + run: + - tabix + +test: + commands: + - "{{ name }} --help" + - bgzip -h + +extra: + skip-lints: + - should_be_noarch_generic # uses per platform binaries + - should_not_be_noarch_source # uses binaries + +about: + home: https://github.com/nvnieuwk/svync + license: MIT + summary: A tool to standardize VCF files from structural variant callers diff --git a/recipes/swarm/meta.yaml b/recipes/swarm/meta.yaml index 1b196da3524e4..a7f72703f9624 100644 --- a/recipes/swarm/meta.yaml +++ b/recipes/swarm/meta.yaml @@ -1,5 +1,5 @@ {% set name = "swarm" %} -{% set version = "3.1.4" %} +{% set version = "3.1.5" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/torognes/swarm/archive/v{{ version }}.tar.gz - sha256: 83353096d7df5de1a96b5f1c8987c2efec26635364521741e5691fd49b5a58e4 + sha256: 68ccd814adc06e5325b73e102d7c8a34ee1367d0bfca704d513e4f06bab860d0 requirements: build: @@ -30,6 +30,7 @@ test: about: home: https://github.com/torognes/swarm license: Affero GPL + license_file: LICENSE summary: A robust and fast clustering method for amplicon-based studies. extra: diff --git a/recipes/sylph/meta.yaml b/recipes/sylph/meta.yaml index c83ec07b1e0fd..06ecabc04a199 100644 --- a/recipes/sylph/meta.yaml +++ b/recipes/sylph/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.5.1" %} +{% set version = "0.6.1" %} package: name: sylph @@ -11,7 +11,7 @@ build: source: url: https://github.com/bluenote-1577/sylph/archive/v{{ version }}.tar.gz - sha256: 300b0f4ae77e25c28a05fd2f5323c112003a13111130f136d7d4bf4ded90e10c + sha256: 9f384ecf33d5eed57e518c1cc238ffb5ac68948dcf921731ba77ccbd02b57bdb requirements: build: diff --git a/recipes/synapseclient/meta.yaml b/recipes/synapseclient/meta.yaml index 3b475ae73277e..91cd8644638db 100644 --- a/recipes/synapseclient/meta.yaml +++ b/recipes/synapseclient/meta.yaml @@ -1,5 +1,5 @@ {% set name = "synapseclient" %} -{% set version = "3.2.0" %} +{% set version = "4.2.0" %} package: name: {{ name|lower }} @@ -7,14 +7,14 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/synapseclient-{{ version }}.tar.gz - sha256: 87c91f03dbca7074efd18144325df07db24e07ea92e0b7c8691aaec46c28329a + sha256: 89222661125de1795b1a096cf8c58b8115c19d6b0fa5846ed2a41cdb394ef773 build: noarch: python entry_points: - synapse = synapseclient.__main__:main number: 0 - script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation --no-cache-dir -vvv run_exports: - {{ pin_subpackage('synapseclient', max_pin="x") }} @@ -26,18 +26,17 @@ requirements: - python >=3.8 - requests >=2.22 - urllib3 <2 - - six - - future - - backports.csv - deprecated >=1.2.4 - - keyring >=15.0.0 - opentelemetry-api - opentelemetry-sdk - - opentelemetry-exporter-otlp - run_constrained: - - pandas >=0.25.0 - - pysftp >=0.2.8 - - boto3 >=1.7.0 + - opentelemetry-exporter-otlp-proto-http + - nest-asyncio + - asyncio-atexit + - httpx + - tqdm + - loky + - async-lru + - psutil test: imports: @@ -55,3 +54,4 @@ about: scientists to share and analyze data together. license_file: LICENSE dev_url: https://github.com/Sage-Bionetworks/synapsePythonClient + doc_url: https://python-docs.synapse.org/ diff --git a/recipes/syri/import-sys.patch b/recipes/syri/import-sys.patch new file mode 100644 index 0000000000000..001ae2d87f0e3 --- /dev/null +++ b/recipes/syri/import-sys.patch @@ -0,0 +1,12 @@ +diff --git a/syri/pyxFiles/findshv.pyx b/syri/pyxFiles/findshv.pyx +index b23bd33..4bc3372 100644 +--- a/syri/pyxFiles/findshv.pyx ++++ b/syri/pyxFiles/findshv.pyx +@@ -9,6 +9,7 @@ from collections import defaultdict + import pandas as pd + from functools import partial + import os ++import sys + import logging + from re import findall + \ No newline at end of file diff --git a/recipes/syri/meta.yaml b/recipes/syri/meta.yaml index 583b8c738ccee..3ab1f4198571e 100755 --- a/recipes/syri/meta.yaml +++ b/recipes/syri/meta.yaml @@ -8,31 +8,37 @@ package: source: url: https://github.com/schneebergerlab/syri/archive/v{{ version }}.tar.gz sha256: {{ sha256 }} + patches: + - import-sys.patch build: - number: 1 - skip: True # [py < 38 or py > 39] + number: 2 script: "{{ PYTHON }} setup.py install --single-version-externally-managed --record=record.txt" + run_exports: + - {{ pin_subpackage('syri', max_pin="x") }} requirements: build: - {{ compiler('c') }} - {{ compiler('cxx') }} host: - - python + - python 3.8 - setuptools - - numpy >=1.20 - - cython + - numpy >=1.21.2 + # Please review cython pinning on future releases + # see: https://github.com/schneebergerlab/syri/pull/217 + - cython <=0.29.36 run: - - python - - numpy >=1.20 - - pandas - - scipy - - psutil - - python-igraph - - pysam + - python 3.8 + - numpy >=1.21.2 + - pandas >=1.2.4 + - scipy >=1.6.2 + - psutil >=5.8 + - python-igraph >=0.9.1 + - pysam >=0.16.0.1 - longestrunsubsequence - pulp + - mummer4 test: commands: diff --git a/recipes/tabixpp/meta.yaml b/recipes/tabixpp/meta.yaml index db6ce10c381fa..b8f8488b7f72c 100644 --- a/recipes/tabixpp/meta.yaml +++ b/recipes/tabixpp/meta.yaml @@ -12,12 +12,12 @@ source: patches: - shared_lib.patch - pkg-config.patch # [osx] -- url: https://github.com/samtools/htslib/releases/download/1.17/htslib-1.17.tar.bz2 - sha256: 763779288c40f07646ec7ad98b96c378c739171d162ad98398868783b721839f +- url: https://github.com/samtools/htslib/releases/download/1.19.1/htslib-1.19.1.tar.bz2 + sha256: 222d74d3574fb67b158c6988c980eeaaba8a0656f5e4ffb76b5fa57f035933ec folder: htslib build: - number: 1 + number: 2 run_exports: # Observed ABI version increase from 1.1.0 to 1.1.2. # Hence, we pin to the patch version even. @@ -53,3 +53,5 @@ extra: - biotools:tabixpp recipe-maintainers: - jpuritz + additional-platforms: + - linux-aarch64 diff --git a/recipes/tabixpp/shared_lib.patch b/recipes/tabixpp/shared_lib.patch index 819773b164a42..da684d327f915 100644 --- a/recipes/tabixpp/shared_lib.patch +++ b/recipes/tabixpp/shared_lib.patch @@ -38,9 +38,10 @@ index f2ba44e..7718d76 100644 DFLAGS = -D_FILE_OFFSET_BITS=64 -D_USE_KNETFILE BIN = tabix++ -LIB = libtabix.a -+LIB = libtabixpp.a - SOVERSION = 1 +-SOVERSION = 1 -SLIB = libtabix.so.$(SOVERSION) ++LIB = libtabixpp.a ++SOVERSION = 0 +SLIB = libtabixpp.so.$(SOVERSION) OBJS = tabix.o SUBDIRS = . diff --git a/recipes/tajimas_d/meta.yaml b/recipes/tajimas_d/meta.yaml index a9d4c00070e44..f218c3de18a2e 100644 --- a/recipes/tajimas_d/meta.yaml +++ b/recipes/tajimas_d/meta.yaml @@ -1,5 +1,5 @@ {% set name = "tajimas_d" %} -{% set version = "2.0.0" %} +{% set version = "2.0.2" %} package: name: {{ name }} @@ -7,12 +7,16 @@ package: source: url: https://github.com/not-a-feature/tajimas_d/archive/refs/tags/v{{ version }}.tar.gz - sha256: c877bc1e1ca78c2e8bd4b4f5fd37aa40fcd5a91880e508c9038eb5f8479015e9 + sha256: 899cf84e8e89ecccc9fbd106c21ee2777bc7736c163b5470e4cce3b843cbe36a build: noarch: python number: 0 - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + entry_points: + - tajimas_d = tajimas_d._tajimas_d:run_cli + run_exports: + - {{ pin_subpackage('tajimas_d', max_pin="x") }} requirements: host: @@ -24,16 +28,13 @@ requirements: test: imports: - tajimas_d - commands: - - pip check requires: - - pip - miniFasta about: home: https://github.com/not-a-feature/tajimas_d license: GPL-3.0-or-later - license_family: GPL + license_family: GPL3 license_file: LICENSE summary: 'Computes Tajimas D, the Pi- or Watterson-Estimator for multiple sequences.' description: | diff --git a/recipes/taxmyphage/meta.yaml b/recipes/taxmyphage/meta.yaml index 0d0b81c087803..fac201dd375df 100644 --- a/recipes/taxmyphage/meta.yaml +++ b/recipes/taxmyphage/meta.yaml @@ -1,5 +1,5 @@ {% set name = "taxmyphage" %} -{% set version = "0.2.6" %} +{% set version = "0.2.9" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/taxmyphage-{{ version }}.tar.gz - sha256: 1058adb02296ec0493b21dedd899447a144804230a4e13f4c98f94dcc0548076 + sha256: 53208a3490d4c6ca0dab9b762ab0c9c609dcff2489926e3659277680fb4ef6b6 build: entry_points: diff --git a/recipes/taxonkit/meta.yaml b/recipes/taxonkit/meta.yaml index ebb8e35f5e385..1027498def2d6 100644 --- a/recipes/taxonkit/meta.yaml +++ b/recipes/taxonkit/meta.yaml @@ -1,19 +1,21 @@ -{% set version = "0.15.1" %} +{% set version = "0.16.0" %} package: name: taxonkit version: {{ version }} build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('taxonkit', max_pin='x.x') }} source: - url: https://github.com/shenwei356/taxonkit/releases/download/v{{ version }}/taxonkit_darwin_amd64.tar.gz # [osx] - md5: cc61492e7642ecf6e0708fb934de7e5f # [osx] - - url: https://github.com/shenwei356/taxonkit/releases/download/v{{ version }}/taxonkit_linux_amd64.tar.gz # [linux] - md5: c40825316860d0a23a51fb782561eef7 # [linux] + md5: 0f36df3f255caf87004087b4f6a3c718 # [osx] + - url: https://github.com/shenwei356/taxonkit/releases/download/v{{ version }}/taxonkit_linux_amd64.tar.gz # [linux and x86_64] + md5: dcf41d21493a29594b399cdafce16233 # [linux and x86_64] + - url: https://github.com/shenwei356/taxonkit/releases/download/v{{ version }}/taxonkit_linux_arm64.tar.gz # [linux and aarch64] + md5: f07a5cff687752de4d03a0b1e6df9a9c # [linux and aarch64] test: commands: @@ -26,6 +28,8 @@ about: license_family: MIT extra: + additional-platforms: + - linux-aarch64 skip-lints: - should_be_noarch_generic - should_not_be_noarch_source diff --git a/recipes/taxonomy/build.sh b/recipes/taxonomy/build.sh index 9a5673054d7ff..e7403810f522a 100644 --- a/recipes/taxonomy/build.sh +++ b/recipes/taxonomy/build.sh @@ -1,17 +1,18 @@ #!/bin/bash -set -ex +set -euo + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" if [ `uname` == Darwin ]; then - export HOME=`mktemp -d` + export HOME=`mktemp -d` + export PATH="$CARGO_HOME/bin:$PATH" fi -curl https://sh.rustup.rs -sSf | sh -s -- --default-toolchain nightly --profile=minimal -y - -export PATH="$HOME/.cargo/bin:$PATH" - -export CARGO_TARGET_X86_64_UNKNOWN_LINUX_GNU_LINKER="$CC" - -maturin build --interpreter python --release #--cargo-extra-args="--features=python" +# build statically linked binary with Rust +RUST_BACKTRACE=1 +maturin build -b cffi --interpreter "${PYTHON}" --release --strip #--cargo-extra-args="--features=python" -$PYTHON -m pip install target/wheels/*.whl --no-deps --ignore-installed -vv +${PYTHON} -m pip install . --no-deps --no-build-isolation -vvv diff --git a/recipes/taxonomy/meta.yaml b/recipes/taxonomy/meta.yaml index 793be03563091..eb6ba753a1b93 100644 --- a/recipes/taxonomy/meta.yaml +++ b/recipes/taxonomy/meta.yaml @@ -1,26 +1,30 @@ {% set name = "taxonomy" %} -{% set version = "0.9.0" %} +{% set version = "0.10.0" %} package: name: "{{ name|lower }}" version: "{{ version }}" source: - url: https://github.com/onecodex/taxonomy/archive/v{{ version }}.tar.gz - sha256: 3d9fb6604ce119bd46635eb1ab43212f9da591f0b6fc53cfcd8c97598025d159 + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/taxonomy-{{ version }}.tar.gz + sha256: 3ff7e2299c9554b8b8be2f00bb4cd9722d0ae820e8a271aaf1390a7e790c3f51 + patches: + - pyproject.patch build: number: 1 - skip: True # [py < 37] + run_exports: + - {{ pin_subpackage('taxonomy', max_pin="x.x") }} requirements: build: - {{ compiler('c') }} + - {{ compiler('rust') }} host: + - python - pip - cffi - maturin - - python run: - python - cffi @@ -31,8 +35,7 @@ test: about: home: https://github.com/onecodex/taxonomy/ - license: MIT License + license: MIT license_family: MIT license_file: LICENSE summary: "Python and Rust library for loading, saving, and manipulating taxonomic trees" - diff --git a/recipes/taxonomy/pyproject.patch b/recipes/taxonomy/pyproject.patch new file mode 100644 index 0000000000000..7d6fc2b1b3235 --- /dev/null +++ b/recipes/taxonomy/pyproject.patch @@ -0,0 +1,9 @@ +--- a/pyproject.toml ++++ b/pyproject.toml +@@ -1,5 +1,5 @@ + [build-system] +-requires = ["maturin>=0.14,<0.15"] ++requires = ["maturin>=1.0,<2.0"] + build-backend = "maturin" + + [project] diff --git a/recipes/taxor/build.sh b/recipes/taxor/build.sh new file mode 100755 index 0000000000000..92946f0a50a31 --- /dev/null +++ b/recipes/taxor/build.sh @@ -0,0 +1,10 @@ +#!/bin/bash + +mkdir ${SRC_DIR}/build/ +cd ${SRC_DIR}/build/ +cmake ${SRC_DIR}/src +cmake --build . --config Release + +cp ${SRC_DIR}/build/main/taxor $PREFIX/bin +chmod +x $PREFIX/bin/taxor + diff --git a/recipes/taxor/meta.yaml b/recipes/taxor/meta.yaml new file mode 100755 index 0000000000000..767c30ea4dcda --- /dev/null +++ b/recipes/taxor/meta.yaml @@ -0,0 +1,47 @@ +{% set version = "0.1.3" %} + +package: + name: taxor + version: {{ version }} + +source: + url: https://github.com/JensUweUlrich/Taxor/archive/refs/tags/{{ version }}.tar.gz # [linux] + md5: 7bffd64282894433b4db60af8f1052c9 # [linux] + +build: + number: 0 + run_exports: + - {{ pin_subpackage('taxor', max_pin='x.x.x') }} + skip: true # [osx] + +requirements: + build: + - make + - {{ compiler('cxx') }} + - {{ compiler('c') }} + - cmake >=3.21 + host: + - zlib + - bzip2 + - libgomp # [linux] + - cxxopts >=2.2.0 + - grep + - coreutils + - curl + - diffutils + run: + - grep + - coreutils + - curl + - diffutils + +test: + commands: + - taxor --help + +about: + home: https://github.com/JensUweUlrich/Taxor + summary: Fast and space-efficient taxonomic classification of long reads + license: BSD-3-Clause + license_family: BSD + license_file: LICENSE.md diff --git a/recipes/tb-profiler/build.sh b/recipes/tb-profiler/build.sh index ee5d4d66e8d82..4aaad0eabd6d3 100644 --- a/recipes/tb-profiler/build.sh +++ b/recipes/tb-profiler/build.sh @@ -1,8 +1,8 @@ #!/bin/bash python -m pip install --no-deps --ignore-installed . -gatk CreateSequenceDictionary -R $PREFIX/share/tbprofiler/tbdb.fasta -samtools faidx $PREFIX/share/tbprofiler/tbdb.fasta +# gatk CreateSequenceDictionary -R $PREFIX/share/tbprofiler/tbdb.fasta +# samtools faidx $PREFIX/share/tbprofiler/tbdb.fasta bwa index $PREFIX/share/tbprofiler/tbdb.fasta # this downloads Mycobacterium_tuberculosis_h37rv DB to $PREFIX/share/snpeff-SNPEFF_VERSION/data snpEff download Mycobacterium_tuberculosis_h37rv diff --git a/recipes/tb-profiler/meta.yaml b/recipes/tb-profiler/meta.yaml index c98196104add1..62489b7775eec 100644 --- a/recipes/tb-profiler/meta.yaml +++ b/recipes/tb-profiler/meta.yaml @@ -1,6 +1,6 @@ {% set name = "tb-profiler" %} -{% set version = "5.0.1" %} -{% set sha256 = "71da60ab38cd3c11f1951bac8e26e7cfe2c91700afa8132cf9001e73a2bae252" %} +{% set version = "6.2.0" %} +{% set sha256 = "23880e0a38541629f5d2b66fd5323dc9df07fb357e359ad3dc640e4c5b77a206" %} package: name: {{name}} @@ -12,7 +12,7 @@ source: build: noarch: python - number: 1 + number: 0 run_exports: - {{ pin_subpackage('tb-profiler', max_pin="x") }} @@ -28,7 +28,7 @@ requirements: - python >=3.8 - git - jinja2 - - pathogen-profiler =3.1.0 + - pathogen-profiler =4.1.0 - filelock - docxtpl - iqtree diff --git a/recipes/tbtamr/meta.yaml b/recipes/tbtamr/meta.yaml index 435271ec684fd..459fa16a643f1 100644 --- a/recipes/tbtamr/meta.yaml +++ b/recipes/tbtamr/meta.yaml @@ -12,7 +12,7 @@ source: build: noarch: python - number: 0 + number: 1 entry_points: - tbtamr=tbtamr.tbtamr:main run_exports: @@ -36,6 +36,10 @@ requirements: - bcftools - bedtools - delly + - xlsxwriter + - requests + - tqdm + test: imports: diff --git a/recipes/tcdemux/meta.yaml b/recipes/tcdemux/meta.yaml index b424f8dcdc1fb..68c8d6e811719 100644 --- a/recipes/tcdemux/meta.yaml +++ b/recipes/tcdemux/meta.yaml @@ -1,5 +1,5 @@ --- -{% set version = "0.0.24" %} +{% set version = "0.0.25" %} package: name: tcdemux @@ -7,10 +7,10 @@ package: source: url: https://github.com/TomHarrop/tcdemux/archive/refs/tags/{{ version }}.tar.gz - sha256: ab40fd9230e126e4691a9d7c0799cfe52baac0a7e86230f22aefa42206609fda + sha256: 03d8deea92762ad8ccc3fb3e2231cc00ec702efe52682c71fb8737f8317e819e build: - number: 0 + number: 1 noarch: python script: {{ PYTHON }} -m pip install --ignore-installed . run_exports: @@ -20,17 +20,17 @@ requirements: host: - python >=3.10 run: - - bbmap + - bbmap <=38.95 - biopython >=1.81 - - cutadapt >=4.4 - - pandas >=2.0.3 + - cutadapt >=4.5 + - pandas >=2.1.1 - pigz - python >=3.10 - r-bit64 >=4.0.5 - r-data.table >=1.14.8 - r-ggplot2 >=3.4.3 - r-viridis >=0.6.4 - - snakemake >=7.31.0 + - snakemake >=7.32.4 test: commands: diff --git a/recipes/terrace/build.sh b/recipes/terrace/build.sh new file mode 100644 index 0000000000000..7a0d70011ef7a --- /dev/null +++ b/recipes/terrace/build.sh @@ -0,0 +1,5 @@ +#!/bin/bash + +./configure --prefix=$PREFIX +make LIBS+=-lhts +make install diff --git a/recipes/terrace/meta.yaml b/recipes/terrace/meta.yaml new file mode 100644 index 0000000000000..6def5bd34e555 --- /dev/null +++ b/recipes/terrace/meta.yaml @@ -0,0 +1,41 @@ +{% set name = "terrace" %} +{% set version = "1.1.2" %} + +package: + name: "{{ name }}" + version: "{{ version }}" + +source: + url: "https://github.com/Shao-Group/TERRACE/releases/download/v{{ version }}/terrace-{{ version }}.tar.gz" + sha256: "cac4e9ae9ec61f49089c898f8c9484057ff16534fa1b12b02a5a06346dc56e8c" + +build: + number: 0 + run_exports: + - {{ pin_subpackage('terrace', max_pin="x") }} + +requirements: + build: + - make + - {{ compiler('c') }} + - {{ compiler('cxx') }} + host: + - htslib + - boost-cpp + run: + - htslib + - boost-cpp + +test: + commands: + - terrace --help + +about: + home: "https://github.com/Shao-Group/TERRACE" + license: BSD-3-Clause + license_file: LICENSE + summary: "TERRACE is an assembler for circular RNAs." + +extra: + recipe-maintainers: + - shaomingfu diff --git a/recipes/thapbi-pict/meta.yaml b/recipes/thapbi-pict/meta.yaml index d1eca3abad919..3d0df49663cbd 100644 --- a/recipes/thapbi-pict/meta.yaml +++ b/recipes/thapbi-pict/meta.yaml @@ -1,5 +1,5 @@ {% set name = "thapbi-pict" %} -{% set version = "1.0.5" %} +{% set version = "1.0.12" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name | replace("-", "_") }}/{{ name | replace("-", "_") }}-{{ version }}.tar.gz - sha256: c7e42668397ac37b869b2c5774e721635e892ebb99eefc014d634b090d9f7c08 + sha256: 638c8d11b5071895381fcb5cf59f8cbe4dc1b2426f796f636131dcd3e63f55c4 build: noarch: python @@ -21,18 +21,18 @@ build: requirements: host: - pip - - python >=3.7 + - python >=3.8 run: # Python - biom-format >=2.1.14 - - biopython >=1.73 + - biopython >=1.82 - cutadapt >=4.0 - matplotlib-base >=3.7 - networkx >=2.4,!=2.8.3,!=2.8.4 - pydot - - python >=3.7 + - python >=3.8 - rapidfuzz >=2.4.0 - - sqlalchemy + - sqlalchemy >=2.0 - xlsxwriter # Command line - blast diff --git a/recipes/tides-ml/meta.yaml b/recipes/tides-ml/meta.yaml index c3a3d4bc436e8..75f14a4175336 100644 --- a/recipes/tides-ml/meta.yaml +++ b/recipes/tides-ml/meta.yaml @@ -1,5 +1,5 @@ {% set name = "tides-ml" %} -{% set version = "1.1.2" %} +{% set version = "1.2.0" %} package: name: {{ name|lower }} @@ -7,23 +7,23 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/TIdeS-ML-{{ version }}.tar.gz - sha256: 17ad86b841d5e8fca4dbad58d114aa919d332a22190c7d002472ec6c1541609a + sha256: 8c31f4429303e5d34c031b243963fae3eec1f0d9c97e856949a7eac17f82452c build: entry_points: - tides = tides.tides:main noarch: python - script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + script: {{ PYTHON }} -m pip install . -vvv --no-deps --no-build-isolation number: 0 run_exports: - {{ pin_subpackage(name, max_pin="x.x") }} requirements: host: - - python >=3.8 + - python <3.12 - pip run: - - python >=3.8 + - python <3.12 - biopython >=1.79 - ete3 >=3.1.2 - optuna >=3.0 @@ -33,7 +33,7 @@ requirements: - diamond >=2.1.3 - cd-hit >=4.8.1 - barrnap >=0.9 - - kraken2 >=2.0.0 + - kraken2 >=2.0.0 test: imports: @@ -44,12 +44,12 @@ test: - (barrnap --help 2>&1; true) | grep -q Options - tides --help - kraken2 --version - about: home: https://github.com/xxmalcala/TIdeS summary: Tool for ORF-calling and ORF-classification using ML approaches license: MIT + license_family: MIT license_file: LICENSE extra: diff --git a/recipes/tidyp/build.sh b/recipes/tidyp/build.sh index 6e31603e6254a..591e6774ea67f 100644 --- a/recipes/tidyp/build.sh +++ b/recipes/tidyp/build.sh @@ -1,7 +1,14 @@ #!/bin/bash +set -xe +mkdir -p ${HOME}/bin +export PATH="${HOME}/bin:$PATH" +ln -s ${CC} ${HOME}/bin/gcc -./configure --prefix="$PREFIX" +pushd build/gmake make -make install +popd + +mkdir -p ${PREFIX}/bin +cp ./bin/tidyp ${PREFIX}/bin diff --git a/recipes/tidyp/build_failure.linux-64.yaml b/recipes/tidyp/build_failure.linux-64.yaml deleted file mode 100644 index f3772fe0477fb..0000000000000 --- a/recipes/tidyp/build_failure.linux-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: 5f54a99372501e5b639643248f525296d6bb59524021c5ff02d871c634b5787a # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |2- - - environment location: /opt/conda/conda-bld/tidyp_1685392106059/_build_env - - - The following NEW packages will be INSTALLED: - - _libgcc_mutex: 0.1-conda_forge conda-forge - _openmp_mutex: 4.5-2_gnu conda-forge - binutils_impl_linux-64: 2.39-he00db2b_1 conda-forge - binutils_linux-64: 2.39-h5fc0e48_13 conda-forge - gcc_impl_linux-64: 12.2.0-hcc96c02_19 conda-forge - gcc_linux-64: 12.2.0-h4798a0e_13 conda-forge - kernel-headers_linux-64: 2.6.32-he073ed8_15 conda-forge - ld_impl_linux-64: 2.39-hcc3a1bd_1 conda-forge - libgcc-devel_linux-64: 12.2.0-h3b97bd3_19 conda-forge - libgcc-ng: 12.2.0-h65d4601_19 conda-forge - libgomp: 12.2.0-h65d4601_19 conda-forge - libsanitizer: 12.2.0-h46fd767_19 conda-forge - libstdcxx-ng: 12.2.0-h46fd767_19 conda-forge - make: 4.3-hd18ef5c_1 conda-forge - sysroot_linux-64: 2.12-he073ed8_15 conda-forge - - Preparing transaction: ...working... done - Verifying transaction: ...working... done - Executing transaction: ...working... done - Source cache directory is: /opt/conda/conda-bld/src_cache - INFO:conda_build.source:Source cache directory is: /opt/conda/conda-bld/src_cache - Downloading source to cache: 1.04_5f09650411.tar.gz - INFO:conda_build.source:Downloading source to cache: 1.04_5f09650411.tar.gz - Downloading https://github.com/petdance/tidyp/archive/refs/tags/1.04.tar.gz - INFO:conda_build.source:Downloading https://github.com/petdance/tidyp/archive/refs/tags/1.04.tar.gz - Success - INFO:conda_build.source:Success - Extracting download - source tree in: /opt/conda/conda-bld/tidyp_1685392106059/work - export PREFIX=/opt/conda/conda-bld/tidyp_1685392106059/_h_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placeho - export BUILD_PREFIX=/opt/conda/conda-bld/tidyp_1685392106059/_build_env - export SRC_DIR=/opt/conda/conda-bld/tidyp_1685392106059/work - INFO: activate-binutils_linux-64.sh made the following environmental changes: - ADDR2LINE=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-addr2line - AR=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ar - AS=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-as - CXXFILT=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-cfilt - ELFEDIT=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-elfedit - GPROF=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gprof - LD=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ld - LD_GOLD=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ld.gold - NM=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-nm - OBJCOPY=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-objcopy - OBJDUMP=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-objdump - RANLIB=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ranlib - READELF=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-readelf - SIZE=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-size - STRINGS=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-strings - STRIP=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-strip - INFO: activate-gcc_linux-64.sh made the following environmental changes: - BUILD=x86_64-conda-linux-gnu - CC=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-cc - CC_FOR_BUILD=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-cc - CFLAGS=-march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/tidyp-1.04 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix - CMAKE_ARGS=-DCMAKE_AR=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ar -DCMAKE_CXX_COMPILER_AR=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-ar -DCMAKE_C_COMPILER_AR=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-ar -DCMAKE_RANLIB=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ranlib -DCMAKE_CXX_COMPILER_RANLIB=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-ranlib -DCMAKE_C_COMPILER_RANLIB=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-ranlib -DCMAKE_LINKER=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-ld -DCMAKE_STRIP=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-strip -DCMAKE_FIND_ROOT_PATH_MODE_PROGRAM=NEVER -DCMAKE_FIND_ROOT_PATH_MODE_LIBRARY=ONLY -DCMAKE_FIND_ROOT_PATH_MODE_INCLUDE=ONLY -DCMAKE_FIND_ROOT_PATH=$PREFIX;$BUILD_PREFIX/x86_64-conda-linux-gnu/sysroot -DCMAKE_INSTALL_PREFIX=$PREFIX -DCMAKE_INSTALL_LIBDIR=lib -DCMAKE_PROGRAM_PATH=$BUILD_PREFIX/bin;$PREFIX/bin - CMAKE_PREFIX_PATH=$PREFIX:$BUILD_PREFIX/x86_64-conda-linux-gnu/sysroot/usr - CONDA_BUILD_SYSROOT=$BUILD_PREFIX/x86_64-conda-linux-gnu/sysroot - CONDA_TOOLCHAIN_BUILD=x86_64-conda-linux-gnu - CONDA_TOOLCHAIN_HOST=x86_64-conda-linux-gnu - CPP=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-cpp - CPPFLAGS=-DNDEBUG -D_FORTIFY_SOURCE=2 -O2 -isystem $PREFIX/include - DEBUG_CFLAGS=-march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-all -fno-plt -Og -g -Wall -Wextra -fvar-tracking-assignments -ffunction-sections -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/tidyp-1.04 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix - DEBUG_CPPFLAGS=-D_DEBUG -D_FORTIFY_SOURCE=2 -Og -isystem $PREFIX/include - GCC=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc - GCC_AR=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-ar - GCC_NM=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-nm - GCC_RANLIB=$BUILD_PREFIX/bin/x86_64-conda-linux-gnu-gcc-ranlib - HOST=x86_64-conda-linux-gnu - LDFLAGS=-Wl,-O2 -Wl,--sort-common -Wl,--as-needed -Wl,-z,relro -Wl,-z,now -Wl,--disable-new-dtags -Wl,--gc-sections -Wl,--allow-shlib-undefined -Wl,-rpath,$PREFIX/lib -Wl,-rpath-link,$PREFIX/lib -L$PREFIX/lib - MESON_ARGS=--buildtype release --prefix=$PREFIX -Dlibdir=lib - _CONDA_PYTHON_SYSCONFIGDATA_NAME=_sysconfigdata_x86_64_conda_cos6_linux_gnu - build_alias=x86_64-conda-linux-gnu - host_alias=x86_64-conda-linux-gnu - -BUILD=x86_64-conda_cos6-linux-gnu - -CONDA_BUILD_SYSROOT= - /opt/conda/conda-bld/tidyp_1685392106059/work/conda_build.sh: line 8: ./configure: No such file or directory - Traceback (most recent call last): - File "/opt/conda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/conda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/conda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/conda/lib/python3.8/site-packages/conda_build/build.py", line 2198, in build - utils.check_call_env(cmd, env=env, rewrite_stdout_env=rewrite_env, - File "/opt/conda/lib/python3.8/site-packages/conda_build/utils.py", line 451, in check_call_env - return _func_defaulting_env_to_os_environ("call", *popenargs, **kwargs) - File "/opt/conda/lib/python3.8/site-packages/conda_build/utils.py", line 427, in _func_defaulting_env_to_os_environ - raise subprocess.CalledProcessError(proc.returncode, _args) - subprocess.CalledProcessError: Command '['/bin/bash', '-o', 'errexit', '/opt/conda/conda-bld/tidyp_1685392106059/work/conda_build.sh']' returned non-zero exit status 1. -# Last 100 lines of the build log. diff --git a/recipes/tidyp/build_failure.osx-64.yaml b/recipes/tidyp/build_failure.osx-64.yaml deleted file mode 100644 index 030a7aa9ec7f5..0000000000000 --- a/recipes/tidyp/build_failure.osx-64.yaml +++ /dev/null @@ -1,104 +0,0 @@ -recipe_sha: 5f54a99372501e5b639643248f525296d6bb59524021c5ff02d871c634b5787a # The commit at which this recipe failed to build. -skiplist: true # Set to true to skiplist this recipe so that it will be ignored as long as its latest commit is the one given above. -log: |2- - cctools_osx-64: 973.0.1-h48a5a9d_13 conda-forge - clang: 15.0.7-h694c41f_2 conda-forge - clang-15: 15.0.7-default_hdb78580_2 conda-forge - clang_osx-64: 15.0.7-h03d6864_3 conda-forge - clangxx: 15.0.7-default_hdb78580_2 conda-forge - compiler-rt: 15.0.7-he1888fc_1 conda-forge - compiler-rt_osx-64: 15.0.7-he1888fc_1 conda-forge - icu: 72.1-h7336db1_0 conda-forge - ld64_osx-64: 609-h8ce0179_13 conda-forge - libclang-cpp15: 15.0.7-default_hdb78580_2 conda-forge - libcxx: 16.0.4-hd57cbcb_0 conda-forge - libiconv: 1.17-hac89ed1_0 conda-forge - libllvm15: 15.0.7-he4b1e75_2 conda-forge - libxml2: 2.11.4-hd95e348_0 conda-forge - libzlib: 1.2.13-hfd90126_4 conda-forge - llvm-tools: 15.0.7-he4b1e75_2 conda-forge - make: 4.3-h22f3db7_1 conda-forge - openssl: 3.1.0-h8a1eda9_3 conda-forge - sigtool: 0.1.3-h88f4db0_0 conda-forge - tapi: 1100.0.11-h9ce4665_0 conda-forge - xz: 5.2.6-h775f41a_0 conda-forge - zstd: 1.5.2-hbc0c0cd_6 conda-forge - - Preparing transaction: ...working... done - Verifying transaction: ...working... done - Executing transaction: ...working... done - Source cache directory is: /opt/mambaforge/envs/bioconda/conda-bld/src_cache - INFO:conda_build.source:Source cache directory is: /opt/mambaforge/envs/bioconda/conda-bld/src_cache - INFO:conda_build.source:Downloading source to cache: 1.04_5f09650411.tar.gz - INFO:conda_build.source:Downloading https://github.com/petdance/tidyp/archive/refs/tags/1.04.tar.gz - Downloading source to cache: 1.04_5f09650411.tar.gz - Downloading https://github.com/petdance/tidyp/archive/refs/tags/1.04.tar.gz - Success - INFO:conda_build.source:Success - Extracting download - source tree in: /opt/mambaforge/envs/bioconda/conda-bld/tidyp_1685382282834/work - export PREFIX=/opt/mambaforge/envs/bioconda/conda-bld/tidyp_1685382282834/_h_env_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehold_placehol - export BUILD_PREFIX=/opt/mambaforge/envs/bioconda/conda-bld/tidyp_1685382282834/_build_env - export SRC_DIR=/opt/mambaforge/envs/bioconda/conda-bld/tidyp_1685382282834/work - INFO: activate_clang_osx-64.sh made the following environmental changes: - AR=x86_64-apple-darwin13.4.0-ar - AS=x86_64-apple-darwin13.4.0-as - CC=x86_64-apple-darwin13.4.0-clang - CC_FOR_BUILD=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-clang - CFLAGS=-march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/tidyp-1.04 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix - CHECKSYMS=x86_64-apple-darwin13.4.0-checksyms - CLANG=x86_64-apple-darwin13.4.0-clang - CMAKE_ARGS=-DCMAKE_AR=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ar -DCMAKE_CXX_COMPILER_AR=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ar -DCMAKE_C_COMPILER_AR=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ar -DCMAKE_RANLIB=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ranlib -DCMAKE_CXX_COMPILER_RANLIB=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ranlib -DCMAKE_C_COMPILER_RANLIB=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ranlib -DCMAKE_LINKER=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-ld -DCMAKE_STRIP=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-strip -DCMAKE_INSTALL_NAME_TOOL=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-install_name_tool -DCMAKE_LIBTOOL=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-libtool -DCMAKE_OSX_DEPLOYMENT_TARGET=10.9 -DCMAKE_BUILD_TYPE=Release -DCMAKE_OSX_SYSROOT=/Applications/Xcode_14.2.app/Contents/Developer/Platforms/MacOSX.platform/Developer/SDKs/MacOSX10.9.sdk -DCMAKE_FIND_FRAMEWORK=LAST -DCMAKE_FIND_APPBUNDLE=LAST -DCMAKE_INSTALL_PREFIX=$PREFIX -DCMAKE_INSTALL_LIBDIR=lib -DCMAKE_PROGRAM_PATH=$BUILD_PREFIX/bin;$PREFIX/bin - CMAKE_PREFIX_PATH=:$PREFIX - CONDA_TOOLCHAIN_BUILD=x86_64-apple-darwin13.4.0 - CONDA_TOOLCHAIN_HOST=x86_64-apple-darwin13.4.0 - CPPFLAGS=-D_FORTIFY_SOURCE=2 -isystem $PREFIX/include -mmacosx-version-min=10.9 - DEBUG_CFLAGS=-march=core2 -mtune=haswell -mssse3 -ftree-vectorize -fPIC -fPIE -fstack-protector-strong -O2 -pipe -Og -g -Wall -Wextra -isystem $PREFIX/include -fdebug-prefix-map=$SRC_DIR=/usr/local/src/conda/tidyp-1.04 -fdebug-prefix-map=$PREFIX=/usr/local/src/conda-prefix - HOST=x86_64-apple-darwin13.4.0 - INSTALL_NAME_TOOL=x86_64-apple-darwin13.4.0-install_name_tool - LD=x86_64-apple-darwin13.4.0-ld - LDFLAGS=-Wl,-pie -Wl,-headerpad_max_install_names -Wl,-dead_strip_dylibs -Wl,-rpath,$PREFIX/lib -L$PREFIX/lib - LDFLAGS_LD=-pie -headerpad_max_install_names -dead_strip_dylibs -rpath $PREFIX/lib -L$PREFIX/lib - LIBTOOL=x86_64-apple-darwin13.4.0-libtool - LIPO=x86_64-apple-darwin13.4.0-lipo - MESON_ARGS=--buildtype release --prefix=$PREFIX -Dlibdir=lib - NM=x86_64-apple-darwin13.4.0-nm - NMEDIT=x86_64-apple-darwin13.4.0-nmedit - OBJC=x86_64-apple-darwin13.4.0-clang - OBJC_FOR_BUILD=$BUILD_PREFIX/bin/x86_64-apple-darwin13.4.0-clang - OTOOL=x86_64-apple-darwin13.4.0-otool - PAGESTUFF=x86_64-apple-darwin13.4.0-pagestuff - RANLIB=x86_64-apple-darwin13.4.0-ranlib - REDO_PREBINDING=x86_64-apple-darwin13.4.0-redo_prebinding - SDKROOT=/Applications/Xcode_14.2.app/Contents/Developer/Platforms/MacOSX.platform/Developer/SDKs/MacOSX10.9.sdk - SEGEDIT=x86_64-apple-darwin13.4.0-segedit - SEG_ADDR_TABLE=x86_64-apple-darwin13.4.0-seg_addr_table - SEG_HACK=x86_64-apple-darwin13.4.0-seg_hack - SIZE=x86_64-apple-darwin13.4.0-size - STRINGS=x86_64-apple-darwin13.4.0-strings - STRIP=x86_64-apple-darwin13.4.0-strip - _CONDA_PYTHON_SYSCONFIGDATA_NAME=_sysconfigdata_x86_64_apple_darwin13_4_0 - ac_cv_func_malloc_0_nonnull=yes - ac_cv_func_realloc_0_nonnull=yes - build_alias=x86_64-apple-darwin13.4.0 - host_alias=x86_64-apple-darwin13.4.0 - /opt/mambaforge/envs/bioconda/conda-bld/tidyp_1685382282834/work/conda_build.sh: line 8: ./configure: No such file or directory - Traceback (most recent call last): - File "/opt/mambaforge/envs/bioconda/bin/conda-mambabuild", line 10, in - sys.exit(main()) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 256, in main - call_conda_build(action, config) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/boa/cli/mambabuild.py", line 228, in call_conda_build - result = api.build( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/api.py", line 180, in build - return build_tree( - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 3078, in build_tree - packages_from_this = build(metadata, stats, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/build.py", line 2198, in build - utils.check_call_env(cmd, env=env, rewrite_stdout_env=rewrite_env, - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/utils.py", line 451, in check_call_env - return _func_defaulting_env_to_os_environ("call", *popenargs, **kwargs) - File "/opt/mambaforge/envs/bioconda/lib/python3.8/site-packages/conda_build/utils.py", line 427, in _func_defaulting_env_to_os_environ - raise subprocess.CalledProcessError(proc.returncode, _args) - subprocess.CalledProcessError: Command '['/bin/bash', '-o', 'errexit', '/opt/mambaforge/envs/bioconda/conda-bld/tidyp_1685382282834/work/conda_build.sh']' returned non-zero exit status 1. -# Last 100 lines of the build log. diff --git a/recipes/tidyp/meta.yaml b/recipes/tidyp/meta.yaml index e95b0d8d7be46..0ff496e43703c 100644 --- a/recipes/tidyp/meta.yaml +++ b/recipes/tidyp/meta.yaml @@ -7,7 +7,9 @@ source: sha256: 5f0965041119bed0ed70a7f0be39e8f0162141eea14d77f472b49f8b3303ab0b build: - number: 5 + number: 6 + run_exports: + - {{ pin_subpackage('tidyp', max_pin="x") }} requirements: build: @@ -20,5 +22,7 @@ about: summary: "Program for cleaning up and validating HTML" extra: + additional-platforms: + - linux-aarch64 skip-lints: - missing_tests diff --git a/recipes/tir-learner/build.sh b/recipes/tir-learner/build.sh new file mode 100644 index 0000000000000..0855b1275d676 --- /dev/null +++ b/recipes/tir-learner/build.sh @@ -0,0 +1,15 @@ +#!/bin/sh +set -x -e + +TIR_LEARNER_DIR=${PREFIX}/share/TIR-Learner3.0 + +mkdir -p ${PREFIX}/bin +mkdir -p ${TIR_LEARNER_DIR} +cp -r TIR-Learner3.0/* ${TIR_LEARNER_DIR} + +cat <>${PREFIX}/bin/TIR-Learner +#!/bin/bash +python3 ${TIR_LEARNER_DIR}/TIR-Learner3.0.py \$@ +END + +chmod a+x ${PREFIX}/bin/TIR-Learner diff --git a/recipes/tir-learner/meta.yaml b/recipes/tir-learner/meta.yaml new file mode 100644 index 0000000000000..f1e308ce75f47 --- /dev/null +++ b/recipes/tir-learner/meta.yaml @@ -0,0 +1,49 @@ +{% set name = "TIR-Learner" %} +{% set version = "3.0.1" %} +{% set sha256 = "a5b8e41a0ff6cb18188e78722ade9dccab2b947cb9c23d21543ccbf2b05285f5" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://github.com/lutianyu2001/TIR-Learner/archive/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + noarch: generic + run_exports: + - {{ pin_subpackage('tir-learner', max_pin='x') }} + +requirements: + run: + - genericrepeatfinder + - genometools-genometools + - blast + - biopython + - scikit-learn + - pandas + - glob2 + - multiprocess + - regex + - tensorflow + - keras + - swifter + +test: + commands: + - TIR-Learner -v | grep 'TIR-Learner 3.0.1' + +about: + home: https://github.com/lutianyu2001/TIR-Learner + license: GPLv3 + license_family: GPL + license_file: LICENSE + summary: An ensemble method for TIR transposable element annotation + dev_url: https://github.com/lutianyu2001/TIR-Learner + doc_url: https://github.com/lutianyu2001/TIR-Learner/blob/main/docs/TIR-Learner%20v3%20flow%20chart_v2.drawio.png + +extra: + identifiers: + - doi:10.1016/j.molp.2019.02.008 diff --git a/recipes/tissuumaps/meta.yaml b/recipes/tissuumaps/meta.yaml index 8555dcfae9eba..91e0524d1ed51 100644 --- a/recipes/tissuumaps/meta.yaml +++ b/recipes/tissuumaps/meta.yaml @@ -4,7 +4,7 @@ # - add pyqt6 (or possibly pyqt>=6) dependency # Until then, only the "tissuumaps_server" script is available, not "tissuumaps" -{% set version = "3.2.0.3" %} +{% set version = "3.2.1.7" %} package: name: tissuumaps @@ -12,7 +12,7 @@ package: source: url: https://github.com/TissUUmaps/TissUUmaps/archive/refs/tags/{{ version }}.tar.gz - sha256: 372a92e7aa8fb5f6149bac1133aae6d04653c87ba3048af9ed95da84a64f2592 + sha256: d08b2e962f18bfd5fd0db32e85415a097c0655236c7f9b0f2d20dc5127ee3fc9 build: number: 0 @@ -42,7 +42,8 @@ test: about: home: https://tissuumaps.research.it.uu.se/ - license: GPLv3 + license: MIT + license_file: LICENSE summary: > TissUUmaps is a lightweight viewer that uses basic web tools to visualize gene expression data or any kind of point data on top of whole slide images diff --git a/recipes/tksm/meta.yaml b/recipes/tksm/meta.yaml index 1d3bc532de1b6..57e521aca272d 100644 --- a/recipes/tksm/meta.yaml +++ b/recipes/tksm/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.3.2" %} -{% set sha256 = "e965a8e932698570b6bc7c2ea15ebecaf7e0a50985c26cf87ece7869eaf44c83" %} +{% set version = "0.6.0" %} +{% set sha256 = "53f53f0038ee29a3c46b5eb314a731b1067045224ad9a0037551dd7cf4187eef" %} package: name: tksm @@ -11,23 +11,26 @@ source: build: number: 0 - skip: True # [py<3.8 or osx] + skip: True # [py < 3.8 or osx] + run_exports: + - {{ pin_subpackage('tksm', max_pin="x.x") }} requirements: build: + - python - {{ compiler('cxx') }} - - python {{ python }} - - zlib - make - vim - lld + - nlohmann_json host: - - python {{ python }} + - python - zlib + - nlohmann_json - cxxopts >=3.1.0 - fmt >=9.1.0 run: - - python {{ python }} + - python - zlib - python-edlib - numpy @@ -37,11 +40,14 @@ requirements: test: commands: + - tksm list - tksm sequence --help - + - tksm abundance --help + - tksm model-truncation --help about: home: https://github.com/vpc-ccg/tksm license: MIT + license_family: MIT license_file: LICENSE summary: Very modular, very cool long-read transcriptomic simulator diff --git a/recipes/tmhg/meta.yaml b/recipes/tmhg/meta.yaml new file mode 100644 index 0000000000000..39414bccf2f77 --- /dev/null +++ b/recipes/tmhg/meta.yaml @@ -0,0 +1,44 @@ +{% set name = "tmhg" %} +{% set version = "1.0.1" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: 'https://github.com/yongze-yin/tMHG-Finder/archive/refs/tags/v{{version}}.tar.gz' + sha256: a05df84ca80674154cb78f63148e26f023b88af26fa95cc2fa54e34f105efcac + +build: + run_exports: + - {{ pin_subpackage('tmhg', max_pin="x") }} + noarch: generic + number: 0 + script: "{{ PYTHON }} -m pip install ." + +requirements: + host: + - python >=3.6 + run: + - biopython + - blast + - dendropy + - numpy >=1.11 + - pandas >=1.1.3 + - networkx + - biopython + - bedtools >=2.31.1 + - pathos + - mash + - mafft + +test: + commands: + - tmhgf find --help + - tmhgf add --help + +about: + home: https://github.com/yongze-yin/tMHG-Finder/ + license: MIT + summary: tMHG-Finder is a tree-guided tool to partition whole genomes into maximal homologous groups. + diff --git a/recipes/tn93/meta.yaml b/recipes/tn93/meta.yaml index 37df7d1f5e9e2..dd0aa8184536d 100644 --- a/recipes/tn93/meta.yaml +++ b/recipes/tn93/meta.yaml @@ -9,7 +9,7 @@ source: sha256: 58f26807cd762cfc5cb6f088b57dfb26c69e8dd8e59a3e3db42a51ddea03bb3c build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('tn93', max_pin="x") }} @@ -32,3 +32,8 @@ about: license_family: MIT license_file: LICENSE summary: This is a simple program meant to compute pairwise distances between aligned nucleotide sequences in sequential FASTA format using the Tamura Nei 93 distance. + +extra: + identifiers: + - biotools:tn93 + - doi:10.1093/molbev/msy016 diff --git a/recipes/tntblast/2.4/build.sh b/recipes/tntblast/2.4/build.sh new file mode 100644 index 0000000000000..9faf1b0cc953d --- /dev/null +++ b/recipes/tntblast/2.4/build.sh @@ -0,0 +1,16 @@ +#!/bin/bash + +sed -i.bak 's/-DUSE_MPI//g' Makefile +sed -i.bak '/BLAST_DIR =/d' Makefile + +export INCLUDE_PATH="${BUILD_PREFIX}/include" +export LIBRARY_PATH="${BUILD_PREFIX}/lib" +export LD_LIBRARY_PATH="${LD_LIBRARY_PATH}:${BUILD_PREFIX}/lib" + +export LDFLAGS="-lm -lz -L${BUILD_PREFIX}/lib" +export CPPFLAGS="-I${BUILD_PREFIX}/include" + +make CC="${CXX}" INC="${CPPFLAGS}" LIBS="${LDFLAGS}" all + +mkdir -p $PREFIX/bin +cp tntblast $PREFIX/bin diff --git a/recipes/tntblast/2.4/meta.yaml b/recipes/tntblast/2.4/meta.yaml new file mode 100644 index 0000000000000..c4f641810f439 --- /dev/null +++ b/recipes/tntblast/2.4/meta.yaml @@ -0,0 +1,48 @@ +{% set name = "tntblast" %} +{% set version = "2.4" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage( name|lower, max_pin="x") }} + +source: + url: https://github.com/jgans/thermonucleotideBLAST/archive/61fee4458186cc3f08ec386e18997b5953d5c7e6.zip + sha256: 5a239413a2df7de59d9a28a1bee962e2480b81d5faed3ecfa1e0f9fd84294c0c + +requirements: + build: + - make + - {{ compiler('cxx') }} + - openmp #[linux] + - llvm-openmp #[osx] + - zlib + host: + - openmp #[linux] + - llvm-openmp #[osx] + - zlib + run: + - openmp #[linux] + - llvm-openmp #[osx] + - zlib + +test: + commands: + - '{ tntblast 2>&1 || true; } | grep v.{{ version }}' + +about: + home: https://github.com/jgans/thermonucleotideBLAST + license: BSD License + license_file: LICENSE + license_family: BSD + summary: Searching DNA/RNA sequence databases with PCR and/or probe queries + dev_url: https://github.com/jgans/thermonucleotideBLAST + doc_url: https://github.com/jgans/thermonucleotideBLAST#readme + +extra: + identifiers: + - doi:10.1093/nar/gkn301 diff --git a/recipes/tntblast/build.sh b/recipes/tntblast/build.sh new file mode 100644 index 0000000000000..31f9a2bcebb87 --- /dev/null +++ b/recipes/tntblast/build.sh @@ -0,0 +1,17 @@ +#!/bin/bash + +sed -i.bak '/BLAST_DIR =/d' Makefile + +export INCLUDE_PATH="${BUILD_PREFIX}/include" +export LIBRARY_PATH="${BUILD_PREFIX}/lib" +export LD_LIBRARY_PATH="${LD_LIBRARY_PATH}:${BUILD_PREFIX}/lib" + +export LDFLAGS="-lm -lz -L${BUILD_PREFIX}/lib" +export CPPFLAGS="-I${BUILD_PREFIX}/include" + +export CXX="${BUILD_PREFIX}/bin/mpicxx" + +make CC="${CXX}" INC="${CPPFLAGS}" LIBS="${LDFLAGS}" all + +mkdir -p $PREFIX/bin +cp tntblast $PREFIX/bin diff --git a/recipes/tntblast/meta.yaml b/recipes/tntblast/meta.yaml new file mode 100644 index 0000000000000..e10695d06f338 --- /dev/null +++ b/recipes/tntblast/meta.yaml @@ -0,0 +1,51 @@ +{% set name = "tntblast" %} +{% set version = "2.66" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage( name|lower, max_pin="x") }} + +source: + url: https://github.com/jgans/thermonucleotideBLAST/archive/refs/tags/v{{ version }}.tar.gz + sha256: 46f4ea4a1a8c3fe1a659cd54da847fd66c6a588d643d90be814412078b92da9e + +requirements: + build: + - make + - {{ compiler('cxx') }} + - mpich + - openmp #[linux] + - llvm-openmp #[osx] + - zlib + host: + - openmp #[linux] + - llvm-openmp #[osx] + - mpich + - zlib + run: + - openmp #[linux] + - llvm-openmp #[osx] + - mpich + - zlib + +test: + commands: + - '{ tntblast 2>&1 || true; } | grep v.{{ version }}' + +about: + home: https://github.com/jgans/thermonucleotideBLAST + license: BSD License + license_file: LICENSE + license_family: BSD + summary: Searching DNA/RNA sequence databases with PCR and/or probe queries + dev_url: https://github.com/jgans/thermonucleotideBLAST + doc_url: https://github.com/jgans/thermonucleotideBLAST#readme + +extra: + identifiers: + - doi:10.1093/nar/gkn301 diff --git a/recipes/toil/meta.yaml b/recipes/toil/meta.yaml index 6baaf6c98595c..7b8575a283ced 100644 --- a/recipes/toil/meta.yaml +++ b/recipes/toil/meta.yaml @@ -1,6 +1,6 @@ {% set name = "toil" %} -{% set version = "5.12.0" %} -{% set sha256 = "fb21c85b8654b0e628087ebd403fa5f53644d86a33a4c1e039ba5769dcaf6654" %} +{% set version = "6.1.0" %} +{% set sha256 = "0a92ab1b4af9ab379b9218cd4b4d59997a6bf8db2fc6e134e0dd69662d8c8a43" %} package: name: {{ name|lower }} @@ -13,35 +13,37 @@ source: build: number: 0 noarch: python - script: {{ PYTHON }} -m pip install . --use-pep517 --no-deps -vvv + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} entry_points: - toil = toil.utils.toilMain:main - _toil_worker = toil.worker:main - toil-cwl-runner = toil.cwl.cwltoil:main [cwl] - toil-wdl-runner = toil.wdl.wdltoil:main [wdl] - - toil-wdl-runner-old = toil.wdl.toilwdl:main [wdl] - toil-wes-cwl-runner = toil.server.cli.wes_cwl_runner:main [server] - _toil_mesos_executor = toil.batchSystems.mesos.executor:main [mesos] - _toil_contained_executor = toil.batchSystems.contained_executor:executor requirements: host: - - python >=3.7 + - python >=3.8 - pip run: - - python >=3.7 - - dill >=0.3.2 - - requests >=2 - - docker-py >=3.7.2,<6 - - urllib3 >=1.26.0 + - python >=3.8 + - dill >=0.3.2,<0.4 + - requests >=2,<3 + - docker-py >=3.7.2,<8 + - urllib3 >=1.26.0,<3 - python-dateutil - - psutil >=3.0.1 - # - py-tes >=0.4.2,<1 - - pypubsub >=4.0.3 - - addict >=2.2.1 + - psutil >=3.0.1,<6 + - pypubsub >=4.0.3,<5 + - addict >=2.2.1,<2.5 - pytz >=2012 - - enlighten >=1.5.2 - - typing-extensions + - enlighten >=1.5.2,<2 + - configargparse >=1.7,<2 + - typing-extensions >=4.6.2,<5 + - pyyaml >=6,<7 #mesos pymesos isn't available #server reqs # - wes-service is missing @@ -49,8 +51,8 @@ requirements: # - connexion >=2.10.0, <3 # - flask >=2.0,<3 # - werkzeug >=2.0,<3 - # - flask-cors ==3.0.10 - # - gunicorn ==20.1.0 + # - flask-cors ==4.0.0 + # - gunicorn ==21.2.0 # - celery >=5.1.0, <6 #aws reqs # mypy-boto3-{iam,sdb} are not yet in Conda @@ -66,20 +68,19 @@ requirements: - apache-libcloud >=2.2.1 - google-cloud-storage >=2,<=2.8.0 #cwl reqs - - cwltool ==3.1.20230601100705 + - cwltool ==3.1.20240112164112 - schema-salad >=8.4.20230128170514 - - galaxy-tool-util - - ruamel.yaml >=0.15,<=0.17.21 + - galaxy-tool-util <23 + - ruamel.yaml >=0.15,<=0.18.3 - ruamel.yaml.clib >=0.2.6 - - networkx >=2,<2.8.9 + - networkx <4 #htcondor reqs - python-htcondor >=10.2.0.post1 #kubernetes reqs - python-kubernetes >=12.0.1,<22 - idna >=2 #wdl reqs - # - wdlparse ==0.1.0 # not yet packaged for Conda - - mock >=4.0.3 + - miniwdl ==1.11.1 test: imports: @@ -106,9 +107,10 @@ test: - toil-cwl-runner --help about: - home: 'http://toil.ucsc-cgl.org/' + home: 'https://toil.ucsc-cgl.org/' summary: 'A scalable, efficient, cross-platform and easy-to-use workflow engine in pure Python' dev_url: 'https://github.com/DataBiosphere/toil' doc_url: 'https://toil.readthedocs.io/en/latest/' license: Apache-2.0 + license_family: APACHE license_file: LICENSE diff --git a/recipes/tooldistillator/meta.yaml b/recipes/tooldistillator/meta.yaml new file mode 100644 index 0000000000000..08c925278ff6d --- /dev/null +++ b/recipes/tooldistillator/meta.yaml @@ -0,0 +1,83 @@ +{% set version = "0.8.4.1" %} +{% set sha256 = "423be625ff79c275f696adc372abed76f82bd1aa4628b91b080070ec77cdb17a" %} + +context: {} + +package: + name: tooldistillator + version: '{{ version }}' + +source: + url: https://gitlab.com/ifb-elixirfr/abromics/tooldistillator/-/archive/{{ version }}/tooldistillator-{{ version }}.tar.gz + sha256: {{ sha256 }} +build: + noarch: python + number: 0 + script: python -m pip install --no-deps --ignore-installed . + entry_points: + - tooldistillator = tooldistillator.main:main + run_exports: + - {{ pin_subpackage('tooldistillator', max_pin='x.x') }} + +requirements: + host: + - python >=3.10 + - pip >=23.1.2 + run: + - pandas + - biopython + - python + - ld_impl_linux-64 + - _libgcc_mutex + - libstdcxx-ng + - python_abi + - ca-certificates + - libgfortran5 + - libgomp + - libgfortran-ng + - _openmp_mutex + - libgcc-ng + - libopenblas + - openssl + - xz + - ncurses + - libnsl + - libffi + - bzip2 + - libzlib + - libblas + - readline + - tk + - libsqlite + - libcblas + - liblapack + - tzdata + - wheel + - setuptools + - pip + - six + - pytz + - python-tzdata + - python-dateutil + - numpy + +test: + commands: + - tooldistillator --help + - tooldistillator --version + - tooldistillator abricate --help + +about: + dev_url: https://gitlab.com/ifb-elixirfr/abromics/tooldistillator + doc_url: https://gitlab.com/ifb-elixirfr/abromics/tooldistillator/-/blob/main/docs/_build/html/index.html + home: https://gitlab.com/ifb-elixirfr/abromics + license: GPLv3 + license_family: GPL + license_file: LICENSE.txt + summary: Tool to extract and aggregate information from different tool outputs to JSON parsable files + +extra: + recipe-maintainers: + - bebatut + - clsiguret + diff --git a/recipes/toulligqc/meta.yaml b/recipes/toulligqc/meta.yaml index 2cdff47f0734c..f9d01beea308f 100644 --- a/recipes/toulligqc/meta.yaml +++ b/recipes/toulligqc/meta.yaml @@ -1,5 +1,5 @@ {% set name = "toulligqc" %} -{% set version = "2.5" %} +{% set version = "2.5.6" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 8c8f5406e8f8dbfaa260ef446b08875a337ef3201dbaad6c8a4e0fa5cbf42f85 + sha256: 1b6087ccb927e0da6ff8f9c82c166de02d41bc55df9b9d7fc9edf264aec009f9 build: number: 0 @@ -20,20 +20,18 @@ build: requirements: host: - - pip - - python >=3.8 + - python >=3.10.0 run: - - h5py >=2.10 - - matplotlib-base >=3.1.2 - - numpy >=1.17.4 - - scipy >=1.3.3 - - pandas >=0.25.3 - - plotly >=4.5.0 - - pysam - - python >=3.8 - - seaborn >=0.10 - - scikit-learn >=0.22 - - tqdm + - h5py >=3.7.0 + - matplotlib-base >=3.6.3 + - numpy >=1.24.2 + - scipy >=1.10.1 + - pandas >=1.5.3 + - plotly >=5.15.0 + - pysam >=0.21.0 + - python >=3.10.0 + - scikit-learn >=1.2.1 + - tqdm >=4.64.1 test: imports: diff --git a/recipes/tower-cli/meta.yaml b/recipes/tower-cli/meta.yaml index bad22f588a3a3..4df0c97fac1f8 100644 --- a/recipes/tower-cli/meta.yaml +++ b/recipes/tower-cli/meta.yaml @@ -7,7 +7,7 @@ package: version: {{ version }} build: - number: 0 + number: 1 noarch: generic run_exports: - {{ pin_subpackage("tower-cli", max_pin="x.x") }} @@ -23,6 +23,7 @@ requirements: test: commands: - tw --help + - tw organizations --help about: home: "https://github.com/seqeralabs/tower-cli" diff --git a/recipes/tower-cli/tw.sh b/recipes/tower-cli/tw.sh index e1175961f7b93..09af6ae2257ff 100644 --- a/recipes/tower-cli/tw.sh +++ b/recipes/tower-cli/tw.sh @@ -61,10 +61,4 @@ if [ "$jvm_mem_opts" == "" ]; then fi pass_arr=($pass_args) -if [[ ${pass_arr[0]:=} == org* ]] -then - eval "$java" $jvm_mem_opts $jvm_prop_opts -cp "$JAR_DIR/$jar_file" $pass_args -else - eval "$java" $jvm_mem_opts $jvm_prop_opts -jar "$JAR_DIR/$jar_file" $pass_args -fi -exit +eval "$java" $jvm_mem_opts $jvm_prop_opts -jar "$JAR_DIR/$jar_file" $pass_args \ No newline at end of file diff --git a/recipes/tracegroomer/meta.yaml b/recipes/tracegroomer/meta.yaml new file mode 100644 index 0000000000000..b85ee45217450 --- /dev/null +++ b/recipes/tracegroomer/meta.yaml @@ -0,0 +1,59 @@ +{% set name = "tracegroomer" %} +{% set version = "0.1.3" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/tracegroomer-{{ version }}.tar.gz + sha256: d81c872e9ca5f52d10413c4b9c0aff3aa54cc977125b531229dd8a1e4e6a5cdf + +build: + entry_points: + - tracegroomer = tracegroomer.__main__:main + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage('tracegroomer', max_pin="x") }} + +requirements: + host: + - python >=3.10,<4.0 + - poetry-core + - pip + run: + - python >=3.10.0,<4.0.0 + - sphinx >=7.2.6,<8.0.0 + - click >=8.1.7,<9.0.0 + - matplotlib-base >=3.8.2,<4.0.0 + - mypy >=1.8.0,<2.0.0 + - numpy >=1.26.4,<2.0.0 + - pandas >=2.2.0,<3.0.0 + - scipy >=1.12.0,<2.0.0 + - scikit-learn >=1.4.0,<2.0.0 + - seaborn >=0.13.2,<0.14.0 + - openpyxl >=3.1.2,<4.0.0 + - pyyaml >=6.0.1,<7.0.0 + - python-dotenv >=1.0.1,<2.0.0 + - pydantic >=1.10.8,<2.0.0 + +test: + imports: + - tracegroomer + commands: + - pip check + - tracegroomer --help + requires: + - pip + +about: + summary: 'Format and normalise tracer metabolomics given file(s), to produce the .csv files which are ready for DIMet analysis.' + license: MIT + license_file: LICENSE + home: 'https://github.com/cbib/TraceGroomer' + +extra: + recipe-maintainers: + - hechth diff --git a/recipes/trackhub/meta.yaml b/recipes/trackhub/meta.yaml index 55e40d38900f7..0bdb126054bcf 100644 --- a/recipes/trackhub/meta.yaml +++ b/recipes/trackhub/meta.yaml @@ -1,14 +1,16 @@ package: name: trackhub - version: "0.2.4" + version: "1.0" source: - url: https://pypi.python.org/packages/25/db/cf42623bcb91f209469d7d28d9647b814af2b51e1bbf1dce0a2df006ca34/trackhub-0.2.4.tar.gz - md5: 6d80a98e48fbb62b27777f5e14e6159c + url: https://files.pythonhosted.org/packages/f1/76/42a10f8849a56de359fde3e34f495e60709fbb75a8048afac4fb239fb424/trackhub-1.0.tar.gz + sha256: b7d85fcb0b17834343a900bb713d2e7e01d06bb4bf1dd0e06680e270572bda22 build: noarch: python - number: 2 + number: 0 + run_exports: + - {{ pin_subpackage("trackhub", max_pin="x.x") }} requirements: host: @@ -19,12 +21,18 @@ requirements: run: - python - docutils + - requests + - beautifulsoup4 + - html5lib + - openpyxl test: imports: - trackhub - trackhub.test - trackhub.test.data + commands: + - trackhub_from_excel -h about: home: http://github.com/daler/trackhub diff --git a/recipes/tracknado/meta.yaml b/recipes/tracknado/meta.yaml index a54f302c9211c..9d5e8997a66e1 100644 --- a/recipes/tracknado/meta.yaml +++ b/recipes/tracknado/meta.yaml @@ -1,6 +1,6 @@ {% set name = "tracknado" %} -{% set version = "0.2.3" %} -{% set sha256 = "a7a1e25b54f41c1b5b18fbe1a2fab626e00cd4da4f747f901b58b4f78d4c2651" %} +{% set version = "0.2.4" %} +{% set sha256 = "5d03efa896c0c61e0d5072dd2e6474e308d9014a0ef387cf11d4148ac376f64b" %} package: name: {{ name|lower }} diff --git a/recipes/trackplot/meta.yaml b/recipes/trackplot/meta.yaml index 0c723aed874f0..f0d3984428fb9 100644 --- a/recipes/trackplot/meta.yaml +++ b/recipes/trackplot/meta.yaml @@ -1,5 +1,5 @@ {% set name = "trackplot" %} -{% set version = "0.3.6" %} +{% set version = "0.3.7" %} package: name: trackplot @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: f1f8706c954abd0f8c426f1c3ed51b458d69940c8a275aa61544864788a93956 + sha256: 5e650448e71d81eaae61fbbdcf88e8130b79f008278128ee1311c2b16a24b803 build: noarch: python @@ -20,11 +20,11 @@ build: requirements: host: - - python >=3.8 + - python >=3.8,<3.12 - pip - poetry-core run: - - python >=3.8 + - python >=3.8,<3.12 - adjusttext >=0.7.3 - cairocffi >=1.4.0 - click diff --git a/recipes/tree-qmc/build.sh b/recipes/tree-qmc/build.sh new file mode 100644 index 0000000000000..34621c3bee530 --- /dev/null +++ b/recipes/tree-qmc/build.sh @@ -0,0 +1,13 @@ +cd external/MQLib +sed -i.bak "s#g++#${CXX}#" Makefile +make +cd ../.. +$CXX -std=c++11 -O2 \ + -I external/MQLib/include -I external/toms743 \ + -o tree-qmc \ + src/*.cpp external/toms743/toms743.cpp \ + external/MQLib/bin/MQLib.a -lm \ + -DVERSION=\"$(cat version.txt)\" +mkdir -p $PREFIX/bin +cp tree-qmc $PREFIX/bin/ +chmod a+x $PREFIX/bin/tree-qmc diff --git a/recipes/tree-qmc/conda_build_config.yaml b/recipes/tree-qmc/conda_build_config.yaml new file mode 100644 index 0000000000000..7fe2892e9edfa --- /dev/null +++ b/recipes/tree-qmc/conda_build_config.yaml @@ -0,0 +1,5 @@ +c_compiler_version: # [unix] + - 9.3.0 # [linux] + +cxx_compiler_version: + - 9.3.0 # [linux] diff --git a/recipes/tree-qmc/meta.yaml b/recipes/tree-qmc/meta.yaml new file mode 100644 index 0000000000000..e000a16bf22e1 --- /dev/null +++ b/recipes/tree-qmc/meta.yaml @@ -0,0 +1,32 @@ +{% set name = "TREE-QMC" %} +{% set version = "3.0.4" %} + + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://github.com/molloy-lab/{{ name|upper }}/archive/refs/tags/v{{ version }}.zip + sha256: d7490fb79d23d5aa8c24c661e070c150421b0991464c4a8ae6cc694cd124f83e + +build: + number: 0 + run_exports: + - {{ pin_subpackage('tree-qmc', max_pin="x") }} + +requirements: + build: + - make + - {{ compiler('cxx') }} + host: + run: + +test: + commands: + - tree-qmc -h + +about: + home: https://github.com/molloy-lab/TREE-QMC + license: MIT + summary: TREE-QMC is a quartet-based method for estimating species trees from gene trees. diff --git a/recipes/treeqmc/build.sh b/recipes/treeqmc/build.sh new file mode 100644 index 0000000000000..56130c62a04c3 --- /dev/null +++ b/recipes/treeqmc/build.sh @@ -0,0 +1,15 @@ +#!/bin/bash + +cd external/MQLib +sed -i.bak "s#g++#${CXX}#" Makefile +make +cd ../.. +$CXX -std=c++11 -O2 \ + -I external/MQLib/include -I external/toms743 \ + -o tree-qmc \ + src/*.cpp external/toms743/toms743.cpp \ + external/MQLib/bin/MQLib.a -lm \ + -DVERSION=\"$(cat version.txt)\" +mkdir -p $PREFIX/bin +cp tree-qmc $PREFIX/bin/ +chmod a+x $PREFIX/bin/tree-qmc diff --git a/recipes/treeqmc/conda_build_config.yaml b/recipes/treeqmc/conda_build_config.yaml new file mode 100644 index 0000000000000..7fe2892e9edfa --- /dev/null +++ b/recipes/treeqmc/conda_build_config.yaml @@ -0,0 +1,5 @@ +c_compiler_version: # [unix] + - 9.3.0 # [linux] + +cxx_compiler_version: + - 9.3.0 # [linux] diff --git a/recipes/treeqmc/meta.yaml b/recipes/treeqmc/meta.yaml new file mode 100644 index 0000000000000..47e3e64294ac8 --- /dev/null +++ b/recipes/treeqmc/meta.yaml @@ -0,0 +1,31 @@ +{% set name = "TREEQMC" %} +{% set version = "3.0.1" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://github.com/molloy-lab/TREE-QMC/archive/refs/tags/v{{ version }}.zip + sha256: 0fc11b22d981cbf62ee3d832ed79ac7dbf526669231b0137fd4e4756a0af506c + +build: + number: 0 + run_exports: + - {{ pin_subpackage('treeqmc', max_pin="x") }} + +requirements: + build: + - make + - {{ compiler('cxx') }} + +test: + commands: + - tree-qmc -h + +about: + home: https://github.com/molloy-lab/TREE-QMC + license: MIT + license_family: MIT + summary: TREE-QMC is a quartet-based method for estimating species trees from gene trees. + dev_url: https://github.com/molloy-lab/TREE-QMC diff --git a/recipes/treesap/meta.yaml b/recipes/treesap/meta.yaml new file mode 100644 index 0000000000000..d4ec8012f3251 --- /dev/null +++ b/recipes/treesap/meta.yaml @@ -0,0 +1,44 @@ +{% set version = "1.0.10" %} + +package: + name: "treesap" + version: "{{ version }}" + +source: + url: https://pypi.io/packages/source/t/treesap/treesap-{{ version }}.tar.gz + sha256: 74d2d6f1106f5345ec6408a443be6d2a9b983fb83e4957d04e22be88659905ab + +build: + noarch: python + number: 0 + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation --no-cache-dir -vvv" + run_exports: + - {{ pin_subpackage('treesap', max_pin="x") }} + +requirements: + host: + - pip + - python + run: + - python + - numpy + - scipy + - treeswift + +test: + imports: + - treesap + +about: + home: https://github.com/niemasd/TreeSAP + license: GPL-3.0-or-later + license_family: GPL3 + license_file: LICENSE + summary: "TreeSAP: Tree SAmpling under Phylogenetic models" + dev_url: https://github.com/niemasd/TreeSAP + +extra: + identifiers: + - biotools:treesap + maintainers: + - niemasd diff --git a/recipes/treeswift/meta.yaml b/recipes/treeswift/meta.yaml index 54fd1362581cd..4f6f75311c9c6 100644 --- a/recipes/treeswift/meta.yaml +++ b/recipes/treeswift/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.1.39" %} +{% set version = "1.1.42" %} package: name: "treeswift" @@ -6,7 +6,7 @@ package: source: url: https://pypi.io/packages/source/t/treeswift/treeswift-{{ version }}.tar.gz - sha256: bdb432acea1fd7c13111e101062f75cf0a7ee721a90d7bc86057ee3cea4edfaa + sha256: 3dbd1ba139ad28ca71154a61e362cefeee8a18bf3436123404f6269f0f38a44d build: noarch: python diff --git a/recipes/treetime/meta.yaml b/recipes/treetime/meta.yaml index 804bad35fbd08..55bc9b5fb05f4 100644 --- a/recipes/treetime/meta.yaml +++ b/recipes/treetime/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.11.1" %} -{% set sha256 = "294cf2f72e145f0642784befa8f31766469d20aeb4b798b78fed211a586577a1" %} +{% set version = "0.11.3" %} +{% set sha256 = "c19b336691fcf3fddbb2b0e55000ff6d4aafca1f2bdf75b4ab39631a57a73e2b" %} package: name: treetime diff --git a/recipes/trf/build.sh b/recipes/trf/build.sh index bc49ad10f8798..50dcf40faed52 100644 --- a/recipes/trf/build.sh +++ b/recipes/trf/build.sh @@ -1,5 +1,5 @@ #!/bin/sh ./configure --prefix=$PREFIX CPPFLAGS=-DUNIXCONSOLE -make +make -j ${CPU_COUNT} make install diff --git a/recipes/trf/meta.yaml b/recipes/trf/meta.yaml index ed87b9b7fba4e..ad38c60967d71 100644 --- a/recipes/trf/meta.yaml +++ b/recipes/trf/meta.yaml @@ -11,7 +11,9 @@ source: build: - number: 4 + number: 5 + run_exports: + - {{ pin_subpackage(name, max_pin='x') }} requirements: build: @@ -30,5 +32,7 @@ about: summary: 'Tandem Repeats Finder is a program to locate and display tandem repeats in DNA sequences.' extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:Trf diff --git a/recipes/trgt/meta.yaml b/recipes/trgt/meta.yaml index e56dd01517b57..030c04cde40a0 100644 --- a/recipes/trgt/meta.yaml +++ b/recipes/trgt/meta.yaml @@ -1,7 +1,7 @@ {% set name = "trgt" %} -{% set version = "0.7.0" %} -{% set trgt_sha256 = "09ea997ffd90e1c9aba0a25a38eaa70a95d0d4c365518003b6f340b6f6b9e186" %} -{% set trvz_sha256 = "4b7a642dc69093d68eb8d68a10c49749c382f0db8f71131ce703687438b69b13" %} +{% set version = "0.9.0" %} +{% set trgt_sha256 = "fba2edb311c2ea4f15ae1e0f1b464ae470a73f803d12630b8ea6dbeeff3cc3f9" %} +{% set trvz_sha256 = "08dcb1e5ca9d317140f26d635b323d12a8384b1263fda542e293effb2ca81280" %} package: name: {{ name }} diff --git a/recipes/trimal/build.sh b/recipes/trimal/build.sh index 27923c51cacab..3b76620205a47 100644 --- a/recipes/trimal/build.sh +++ b/recipes/trimal/build.sh @@ -1,7 +1,7 @@ #!/bin/sh cd source -make CC="${CXX}" FLAGS="${CPPFLAGS} ${CXXFLAGS}" +make CC="${CXX}" FLAGS="${CPPFLAGS} ${CXXFLAGS}" -j ${CPU_COUNT} mkdir -p $PREFIX/bin diff --git a/recipes/trimal/meta.yaml b/recipes/trimal/meta.yaml index 27bf643b5e1ef..c9a3dea2d9fab 100644 --- a/recipes/trimal/meta.yaml +++ b/recipes/trimal/meta.yaml @@ -7,7 +7,9 @@ source: md5: cb193397635da45be350e9ac96dafe45 build: - number: 8 + number: 9 + run_exports: + - {{ pin_subpackage('trimal', max_pin='x') }} requirements: build: @@ -27,5 +29,7 @@ about: license: GNU General Public License v3 or later (GPLv3+) extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:trimAl diff --git a/recipes/trimnami/meta.yaml b/recipes/trimnami/meta.yaml index 34ec5afd44ed6..f1153c947bca4 100644 --- a/recipes/trimnami/meta.yaml +++ b/recipes/trimnami/meta.yaml @@ -1,5 +1,5 @@ {% set name = "trimnami" %} -{% set version = "0.1.1" %} +{% set version = "0.1.3" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 594d14c9535ed21270afb3c56f146cad786e9e619c25a89b30556d2284f8f461 + sha256: 37e15eec675d7cc65d75b49e0d6151ceceee53ea043f854ffad05b5895ce8d78 build: noarch: python @@ -18,12 +18,13 @@ build: requirements: host: - - python >=3.8 + - python >=3.9 - pip run: - - python >=3.8 - - snaketool-utils >=0.0.3 - - snakemake >=7.14.0 + - python >=3.9 + - snaketool-utils >=0.0.4 + - snakemake >=7.14.0,<8 + - pulp <2.8 - pyyaml >=6.0 - Click >=8.1.3 - metasnek >=0.0.8 diff --git a/recipes/trinity/build.sh b/recipes/trinity/build.sh index 4d6f8b5e7ea0f..453ee990e1564 100644 --- a/recipes/trinity/build.sh +++ b/recipes/trinity/build.sh @@ -5,7 +5,7 @@ export INCLUDE_PATH="${PREFIX}/include" export LIBRARY_PATH="${PREFIX}/lib" export LDFLAGS="${LDFLAGS} -L${PREFIX}/lib -fopenmp" -export CXXFLAGS="-O3 -I${PREFIX}/include ${LDFLAGS}" +export CXXFLAGS="${CXXFLAGS} -O3 -I${PREFIX}/include ${LDFLAGS}" export BINARY_HOME="${PREFIX}/bin" export TRINITY_HOME="${PREFIX}/opt/trinity-${PKG_VERSION}" @@ -32,18 +32,20 @@ cp -LR PyLib ${TRINITY_HOME}/ cp -LR trinity-plugins ${TRINITY_HOME}/ cp -LR util ${TRINITY_HOME}/ +sed -i.bak '1 s|^.*$|#!/usr/bin/env perl|g' ${TRINITY_HOME}/util/misc/fastq_stats.pl + # add link to Trinity from bin so in PATH cd ${BINARY_HOME} -ln -s ${TRINITY_HOME}/Trinity -ln -s ${TRINITY_HOME}/util/*.pl . -ln -s ${TRINITY_HOME}/Analysis/DifferentialExpression/PtR -ln -s ${TRINITY_HOME}/Analysis/DifferentialExpression/run_DE_analysis.pl -ln -s ${TRINITY_HOME}/Analysis/DifferentialExpression/analyze_diff_expr.pl -ln -s ${TRINITY_HOME}/Analysis/DifferentialExpression/define_clusters_by_cutting_tree.pl -ln -s ${TRINITY_HOME}/Analysis/SuperTranscripts/Trinity_gene_splice_modeler.py -ln -s ${TRINITY_HOME}/Analysis/SuperTranscripts/extract_supertranscript_from_reference.py -ln -s ${TRINITY_HOME}/util/support_scripts/get_Trinity_gene_to_trans_map.pl -ln -s ${TRINITY_HOME}/util/misc/contig_ExN50_statistic.pl +ln -sf ${TRINITY_HOME}/Trinity +ln -sf ${TRINITY_HOME}/util/*.pl . +ln -sf ${TRINITY_HOME}/Analysis/DifferentialExpression/PtR +ln -sf ${TRINITY_HOME}/Analysis/DifferentialExpression/run_DE_analysis.pl +ln -sf ${TRINITY_HOME}/Analysis/DifferentialExpression/analyze_diff_expr.pl +ln -sf ${TRINITY_HOME}/Analysis/DifferentialExpression/define_clusters_by_cutting_tree.pl +ln -sf ${TRINITY_HOME}/Analysis/SuperTranscripts/Trinity_gene_splice_modeler.py +ln -sf ${TRINITY_HOME}/Analysis/SuperTranscripts/extract_supertranscript_from_reference.py +ln -sf ${TRINITY_HOME}/util/support_scripts/get_Trinity_gene_to_trans_map.pl +ln -sf ${TRINITY_HOME}/util/misc/contig_ExN50_statistic.pl cp ${TRINITY_HOME}/trinity-plugins/BIN/seqtk-trinity . # Find real path when executing from a symlink @@ -56,7 +58,6 @@ sed -i.bak "s/\$ROOTDIR\/trinity-plugins\/Trimmomatic/\/opt\/anaconda1anaconda2a sed -i.bak 's/my $TRIMMOMATIC = "\([^"]\+\)"/my $TRIMMOMATIC = '"'"'\1'"'"'/' ${TRINITY_HOME}/Trinity sed -i.bak 's/my $TRIMMOMATIC_DIR = "\([^"]\+\)"/my $TRIMMOMATIC_DIR = '"'"'\1'"'"'/' ${TRINITY_HOME}/Trinity - find ${TRINITY_HOME} -type f -name "*.bak" -print0 | xargs -0 rm -f # export TRINITY_HOME as ENV variable diff --git a/recipes/trinity/meta.yaml b/recipes/trinity/meta.yaml index c686e8c82f057..721036e21f6e1 100644 --- a/recipes/trinity/meta.yaml +++ b/recipes/trinity/meta.yaml @@ -13,7 +13,9 @@ source: - makefile.patch build: - number: 3 + number: 4 + run_exports: + - {{ pin_subpackage('trinity', max_pin="x") }} requirements: build: @@ -72,9 +74,7 @@ about: home: https://github.com/trinityrnaseq/trinityrnaseq/ license: BSD-3-Clause license_family: BSD - license_file: - - LICENSE - - LICENSE.txt + license_file: LICENSE summary: "Trinity assembles transcript sequences from Illumina RNA-Seq data." doc_url: https://github.com/trinityrnaseq/trinityrnaseq/wiki dev_url: https://github.com/trinityrnaseq/trinityrnaseq/ diff --git a/recipes/trtools/meta.yaml b/recipes/trtools/meta.yaml index f0431f6c1f2ec..9cd7d82dec675 100644 --- a/recipes/trtools/meta.yaml +++ b/recipes/trtools/meta.yaml @@ -1,5 +1,5 @@ {% set name = "trtools" %} -{% set version = "5.1.1" %} +{% set version = "6.0.1" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: e3b107d3d4a2ba2f0df49c382df911ab79bfbdf04aa15c84d3093bed67e4220d + sha256: 915e5f1e2ee490ad2e78294014da71cb103182277fc075ee0ccc1d27aab8bece build: noarch: python @@ -27,20 +27,20 @@ build: requirements: host: - - python >=3.5 - - pip >=20.1.1 + - python >=3.7.1 + - poetry-core >=1.0.0 + - pip >=20.3 run: - - cyvcf2 >=0.30.1 - - matplotlib-base >=3.2.2 - - numpy >=1.18.5 - - pandas >=1.0.5 - - pybedtools >=0.8.1 - - pysam >=0.16.0.1 - - python >=3.5 + - python >=3.7.1,<4.0 + - cyvcf2 >=0.30.4 + - matplotlib-base >=3.1.2 + - numpy >=1.17.3,<2.0 + - pandas >=1.2.0 + - pysam >=0.15.4 - scikit-learn >=0.23.1 - - scipy >=1.4.1 - - statsmodels >=0.13.5 - - pyfaidx >=0.5.3 + - scipy >=1.3.3 + - statsmodels >=0.10.2 + - pyfaidx >=0.5.6 - ART >=2016.06.05 test: @@ -71,7 +71,7 @@ test: - simTR --help about: - home: http://github.com/gymreklab/TRTools + home: https://github.com/gymreklab/TRTools license: MIT license_family: MIT license_file: LICENSE.txt @@ -83,3 +83,6 @@ extra: recipe-maintainers: - LiterallyUniqueLogin - aryarm + identifiers: + - biotools:trtools + - doi:10.1093/bioinformatics/btaa736 diff --git a/recipes/trust4/meta.yaml b/recipes/trust4/meta.yaml index 5dcd3365b3e4f..476da155b5c9f 100644 --- a/recipes/trust4/meta.yaml +++ b/recipes/trust4/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.0.13" %} +{% set version = "1.1.0" %} package: name: trust4 @@ -11,7 +11,7 @@ build: source: url: https://github.com/liulab-dfci/TRUST4/archive/v{{ version }}.tar.gz - sha256: 64069e2cad65960471f32daaf8568c05214b1d8b6b32b7fd138e56b90d634bb8 + sha256: dfb08a2d08badad0d865917d0b034a5bc8db089627157a02b335c28a9500b5ef requirements: build: diff --git a/recipes/truvari/meta.yaml b/recipes/truvari/meta.yaml index 1acdd86eb2934..b27d82385cd1e 100644 --- a/recipes/truvari/meta.yaml +++ b/recipes/truvari/meta.yaml @@ -1,17 +1,17 @@ {% set name = "truvari" %} -{% set version = "4.1.0" %} -{% set sha256 = "c30ddee89d0a7107fb0638977cf52aa9751e2f666f109d57026204ca66310ea4" %} +{% set version = "4.2.2" %} +{% set sha256 = "4e7e504e8221b99c321d0825e32299954ef324f382b16fa09c97135aa1e4f872" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/Truvari-{{ version }}.tar.gz + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/truvari-{{ version }}.tar.gz sha256: {{ sha256 }} build: - number: 1 + number: 0 noarch: python script: {{ PYTHON }} -m pip install . -vvv entry_points: @@ -21,21 +21,21 @@ build: requirements: host: - - python >=3.6 + - python >=3.8 - pip run: - - python >=3.6 + - python >=3.8 - pywfa >=0.5.1 - rich >=12.5.1 - python-edlib >=1.3.9 - - pysam >=0.15.2 - - intervaltree >=3.0.2 + - pysam >=0.22 + - intervaltree >=3.1 - joblib >=1.2.0 - - numpy - - pytabix - - bwapy - - pandas - - mafft + - pytabix >=0.1 + - bwapy >=0.1.4 + - pandas >=1.5.3 + - pyabpoa >=1.4.3 + - mafft >=7.515 test: imports: diff --git a/recipes/trycycler/meta.yaml b/recipes/trycycler/meta.yaml index 6a2dc9921ee6a..54af9c6a1546c 100644 --- a/recipes/trycycler/meta.yaml +++ b/recipes/trycycler/meta.yaml @@ -1,5 +1,5 @@ {% set name="trycycler" %} -{% set version="0.5.4" %} +{% set version="0.5.5" %} package: name: {{ name }} @@ -9,17 +9,19 @@ build: noarch: python number: 0 script: {{ PYTHON }} -m pip install --no-deps --ignore-installed . + run_exports: + - {{ pin_subpackage('trycycler', max_pin="x.x") }} source: url: https://github.com/rrwick/{{ name }}/archive/v{{ version }}.tar.gz - sha256: 6880e6920a5e4f3764fc3c7dd1dfc7ec4c9106eb5eb2ed90ae292e73c74893df + sha256: 5794a4520c3b8673adc69c975cee06d7658cd74ac6d9378d1fc7af860bec1a89 requirements: host: - - python >=3.6 + - python >=3.6,<3.11 - pip run: - - python >=3.6 + - python >=3.6,<3.11 - python-edlib - scipy - numpy diff --git a/recipes/tsebra/meta.yaml b/recipes/tsebra/meta.yaml index d0c23407dc092..8b4d1ed9618af 100644 --- a/recipes/tsebra/meta.yaml +++ b/recipes/tsebra/meta.yaml @@ -1,6 +1,6 @@ -{% set version = "1.1.2.2" %} +{% set version = "1.1.2.4" %} {% set name = "tsebra" %} -{% set sha256 = "e055efea29d3b73a6202c56fb9256bf6006005ef54c8a5de83b9aa0377fff27c" %} +{% set sha256 = "b5170dcca85af666d7d158611bee2d8336e57e29fa27d5289ded34b8084bef62" %} package: name: "{{ name }}" diff --git a/recipes/ucsc-bedclip/build.sh b/recipes/ucsc-bedclip/build.sh index af41c472a9323..a0d9457e75286 100644 --- a/recipes/ucsc-bedclip/build.sh +++ b/recipes/ucsc-bedclip/build.sh @@ -1,8 +1,17 @@ #!/bin/bash -mkdir -p "$PREFIX/bin" -export MACHTYPE=x86_64 + +if [ $(arch) = "aarch64" ] +then + export CFLAGS+=" -O3 " + export CPPFLAGS+=" -O3 " +else + export MACHTYPE=x86_64 +fi + export BINDIR=$(pwd)/bin export L="${LDFLAGS}" + +mkdir -p "$PREFIX/bin" mkdir -p "$BINDIR" (cd kent/src/lib && make) (cd kent/src/htslib && make) diff --git a/recipes/ucsc-bedclip/conda_build_config.yaml b/recipes/ucsc-bedclip/conda_build_config.yaml new file mode 100644 index 0000000000000..d8d0c3f0dc913 --- /dev/null +++ b/recipes/ucsc-bedclip/conda_build_config.yaml @@ -0,0 +1,2 @@ +c_compiler_version: + - 8 diff --git a/recipes/ucsc-bedclip/meta.yaml b/recipes/ucsc-bedclip/meta.yaml index 68be7e4c5b546..b985207becc8a 100644 --- a/recipes/ucsc-bedclip/meta.yaml +++ b/recipes/ucsc-bedclip/meta.yaml @@ -12,10 +12,13 @@ source: sha256: "{{ sha256 }}" patches: - "include.patch" + - "patch1.patch" build: skip: True # [osx] - number: 2 + number: 4 + run_exports: + - {{ pin_subpackage("ucsc-bedclip", max_pin=None) }} requirements: build: @@ -27,7 +30,6 @@ requirements: - mysql-connector-c - openssl - zlib - run: - libpng - libuuid @@ -40,6 +42,10 @@ test: # just check for existence, because the individual packages have no unified behavior - which {{ program }} +extra: + additional-platforms: + - linux-aarch64 + about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" diff --git a/recipes/ucsc-bedclip/patch1.patch b/recipes/ucsc-bedclip/patch1.patch new file mode 100644 index 0000000000000..483b0342a43da --- /dev/null +++ b/recipes/ucsc-bedclip/patch1.patch @@ -0,0 +1,19 @@ +--- userApps/kent/src/lib/htmshell.c.old 2022-10-28 08:32:08.344445121 +0000 ++++ userApps/kent/src/lib/htmshell.c 2022-10-28 08:32:31.708262420 +0000 +@@ -711,11 +711,11 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) +- { +- vfprintf(stdout, format, args); +- fprintf(stdout, "\n"); +- } ++if (format != NULL) ++ { ++ vfprintf(stdout, format, args); ++ fprintf(stdout, "\n"); ++ } + exit(-1); + } + diff --git a/recipes/ucsc-bedgraphtobigwig/meta.yaml b/recipes/ucsc-bedgraphtobigwig/meta.yaml index 96ba38c44d3e8..9aec6cf66f7a4 100644 --- a/recipes/ucsc-bedgraphtobigwig/meta.yaml +++ b/recipes/ucsc-bedgraphtobigwig/meta.yaml @@ -1,7 +1,7 @@ {% set package = "ucsc-bedgraphtobigwig" %} {% set program = "bedGraphToBigWig" %} -{% set version = "445" %} -{% set sha256 = "c7abb5db6a5e16a79aefcee849d2b59dbc71ee112ca1e41fea0afb25229cf56c" %} +{% set version = "455" %} +{% set sha256 = "e458cadad7c4a5c1b8385edafffa1b29380ac725a0c20535bf5a3bab99fe80db" %} package: name: "{{ package }}" @@ -12,9 +12,12 @@ source: sha256: "{{ sha256 }}" patches: - "include.patch" + - "patch1.patch" build: - number: 0 + number: 1 + run_exports: + - {{ pin_subpackage(package, max_pin=None) }} requirements: build: @@ -38,6 +41,10 @@ test: # just check for existence, because the individual packages have no unified behavior - which {{ program }} +extra: + additional-platforms: + - linux-aarch64 + about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" diff --git a/recipes/ucsc-bedgraphtobigwig/patch1.patch b/recipes/ucsc-bedgraphtobigwig/patch1.patch new file mode 100644 index 0000000000000..483b0342a43da --- /dev/null +++ b/recipes/ucsc-bedgraphtobigwig/patch1.patch @@ -0,0 +1,19 @@ +--- userApps/kent/src/lib/htmshell.c.old 2022-10-28 08:32:08.344445121 +0000 ++++ userApps/kent/src/lib/htmshell.c 2022-10-28 08:32:31.708262420 +0000 +@@ -711,11 +711,11 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) +- { +- vfprintf(stdout, format, args); +- fprintf(stdout, "\n"); +- } ++if (format != NULL) ++ { ++ vfprintf(stdout, format, args); ++ fprintf(stdout, "\n"); ++ } + exit(-1); + } + diff --git a/recipes/ucsc-bedtobigbed/htmshell.patch b/recipes/ucsc-bedtobigbed/htmshell.patch new file mode 100644 index 0000000000000..1e6f87375ed01 --- /dev/null +++ b/recipes/ucsc-bedtobigbed/htmshell.patch @@ -0,0 +1,11 @@ +--- kent/src/lib/htmshell.c 2024-03-27 10:56:44.493892141 +0200 ++++ kent/src/lib/htmshell.c 2024-03-27 10:57:01.073792396 +0200 +@@ -713,7 +713,7 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) ++if (format != NULL) + { + vfprintf(stdout, format, args); + fprintf(stdout, "\n"); diff --git a/recipes/ucsc-bedtobigbed/meta.yaml b/recipes/ucsc-bedtobigbed/meta.yaml index 8006d0ba56728..dc6ece24ed64b 100644 --- a/recipes/ucsc-bedtobigbed/meta.yaml +++ b/recipes/ucsc-bedtobigbed/meta.yaml @@ -12,13 +12,16 @@ source: sha256: {{ sha256 }} patches: - include.patch + - htmshell.patch build: - number: 0 + number: 1 skip: True # [osx] ignore_run_exports: - libpng - libuuid + run_exports: + - {{ pin_subpackage(package, max_pin=None) }} requirements: build: @@ -48,3 +51,7 @@ about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" summary: "Convert bed file to bigBed. (bbi version: 4)" + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/ucsc-bigwigsummary/build.sh b/recipes/ucsc-bigwigsummary/build.sh index 6f51d7e922ae0..bc10870454d00 100644 --- a/recipes/ucsc-bigwigsummary/build.sh +++ b/recipes/ucsc-bigwigsummary/build.sh @@ -1,13 +1,13 @@ #!/bin/bash mkdir -p "$PREFIX/bin" -export MACHTYPE=x86_64 +export MACHTYPE=$(uname -m) export BINDIR=$(pwd)/bin export L="${LDFLAGS}" mkdir -p "$BINDIR" -(cd kent/src/lib && make) -(cd kent/src/htslib && make) -(cd kent/src/jkOwnLib && make) -(cd kent/src/hg/lib && make) -(cd kent/src/utils/bigWigSummary && make) +(cd kent/src/lib && make -j ${CPU_COUNT}) +(cd kent/src/htslib && make -j ${CPU_COUNT}) +(cd kent/src/jkOwnLib && make -j ${CPU_COUNT}) +(cd kent/src/hg/lib && make -j ${CPU_COUNT}) +(cd kent/src/utils/bigWigSummary && make -j ${CPU_COUNT}) cp bin/bigWigSummary "$PREFIX/bin" chmod +x "$PREFIX/bin/bigWigSummary" diff --git a/recipes/ucsc-bigwigsummary/htmshell.patch b/recipes/ucsc-bigwigsummary/htmshell.patch new file mode 100644 index 0000000000000..1e6f87375ed01 --- /dev/null +++ b/recipes/ucsc-bigwigsummary/htmshell.patch @@ -0,0 +1,11 @@ +--- kent/src/lib/htmshell.c 2024-03-27 10:56:44.493892141 +0200 ++++ kent/src/lib/htmshell.c 2024-03-27 10:57:01.073792396 +0200 +@@ -713,7 +713,7 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) ++if (format != NULL) + { + vfprintf(stdout, format, args); + fprintf(stdout, "\n"); diff --git a/recipes/ucsc-bigwigsummary/meta.yaml b/recipes/ucsc-bigwigsummary/meta.yaml index 1f60c5321b8a9..ca2ca18d6646b 100644 --- a/recipes/ucsc-bigwigsummary/meta.yaml +++ b/recipes/ucsc-bigwigsummary/meta.yaml @@ -12,10 +12,13 @@ source: sha256: {{ sha256 }} patches: - include.patch + - htmshell.patch build: - number: 0 + number: 1 skip: True # [osx] + run_exports: + - {{ pin_subpackage(package|lower, max_pin=None) }} requirements: build: @@ -45,3 +48,7 @@ about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" summary: "Extract summary information from a bigWig file." + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/ucsc-bigwigtowig/build.sh b/recipes/ucsc-bigwigtowig/build.sh index 41c737003ef7d..a437ceb086a47 100644 --- a/recipes/ucsc-bigwigtowig/build.sh +++ b/recipes/ucsc-bigwigtowig/build.sh @@ -1,13 +1,13 @@ #!/bin/bash mkdir -p "$PREFIX/bin" -export MACHTYPE=x86_64 +export MACHTYPE=$(uname -m) export BINDIR=$(pwd)/bin export L="${LDFLAGS}" mkdir -p "$BINDIR" -(cd kent/src/lib && make) -(cd kent/src/htslib && make) -(cd kent/src/jkOwnLib && make) -(cd kent/src/hg/lib && make) -(cd kent/src/utils/bigWigToWig && make) +(cd kent/src/lib && make -j ${CPU_COUNT}) +(cd kent/src/htslib && make -j ${CPU_COUNT}) +(cd kent/src/jkOwnLib && make -j ${CPU_COUNT}) +(cd kent/src/hg/lib && make -j ${CPU_COUNT}) +(cd kent/src/utils/bigWigToWig && make -j ${CPU_COUNT}) cp bin/bigWigToWig "$PREFIX/bin" chmod +x "$PREFIX/bin/bigWigToWig" diff --git a/recipes/ucsc-bigwigtowig/htmshell.patch b/recipes/ucsc-bigwigtowig/htmshell.patch new file mode 100644 index 0000000000000..1e6f87375ed01 --- /dev/null +++ b/recipes/ucsc-bigwigtowig/htmshell.patch @@ -0,0 +1,11 @@ +--- kent/src/lib/htmshell.c 2024-03-27 10:56:44.493892141 +0200 ++++ kent/src/lib/htmshell.c 2024-03-27 10:57:01.073792396 +0200 +@@ -713,7 +713,7 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) ++if (format != NULL) + { + vfprintf(stdout, format, args); + fprintf(stdout, "\n"); diff --git a/recipes/ucsc-bigwigtowig/meta.yaml b/recipes/ucsc-bigwigtowig/meta.yaml index 72927f2fed2f3..31e4bcee47493 100644 --- a/recipes/ucsc-bigwigtowig/meta.yaml +++ b/recipes/ucsc-bigwigtowig/meta.yaml @@ -12,10 +12,13 @@ source: sha256: {{ sha256 }} patches: - include.patch + - htmshell.patch build: - number: 0 + number: 1 skip: True # [osx] + run_exports: + - {{ pin_subpackage(package, max_pin="x") }} requirements: build: @@ -45,3 +48,7 @@ about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" summary: "Convert bigWig to wig. This will keep more of the same structure of the original wig than bigWigToBedGraph does, but still will break up large stepped sections into smaller ones." + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/ucsc-cell-browser/meta.yaml b/recipes/ucsc-cell-browser/meta.yaml index b2e4b40352f61..1dfd309f10ef8 100644 --- a/recipes/ucsc-cell-browser/meta.yaml +++ b/recipes/ucsc-cell-browser/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '1.2.3' %} +{% set version = '1.2.5' %} {% set name = "cellbrowser" %} package: @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: "081d55d1ecc3701c20b1f0275915e9b472b8b71eaa9cb1de7dcba1a0cd0501b1" + sha256: "76757ff00f806f48d47831b0bd9df82aa9e170e4ce96629993a0e8ea5f539bf5" build: number: 0 @@ -25,14 +25,16 @@ build: - cbGenes = cellbrowser.genes:cbGenesCli - cbHub = cellbrowser.hubmaker:cbHubCli noarch: python - script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('ucsc-cell-browser', max_pin="x") }} requirements: host: - - python >=3.6 + - python >=3.6,<3.12 - pip run: - - python >=3.6 + - python >=3.6,<3.12 - numpy - anndata @@ -53,7 +55,14 @@ test: - which cbGenes about: - home: http://cells.ucsc.edu - license: GPL + home: https://cells.ucsc.edu + license: GPL-3.0-or-later + license_family: GPL3 license_file: LICENSE summary: A browser for single-cell data, main site at http://cells.ucsc.edu. UCSC Cellbrowser, an interactive browser for single cell data. Includes importers and basic pipelines for text files, Seurat, Scanpy and Cellranger. All Javascript - does not require a server backend. + doc_url: https://cellbrowser.readthedocs.io/en/master/ + dev_url: https://github.com/maximilianh/cellBrowser + +extra: + identifiers: + - doi:10.1093/bioinformatics/btab503 diff --git a/recipes/ucsc-fatotwobit/build.sh b/recipes/ucsc-fatotwobit/build.sh index 3af116406aaff..cd1c569ec1e88 100644 --- a/recipes/ucsc-fatotwobit/build.sh +++ b/recipes/ucsc-fatotwobit/build.sh @@ -1,6 +1,6 @@ #!/bin/bash mkdir -p "$PREFIX/bin" -export MACHTYPE=x86_64 +export MACHTYPE=$(uname -m) export BINDIR=$(pwd)/bin export L="${LDFLAGS}" mkdir -p "$BINDIR" diff --git a/recipes/ucsc-fatotwobit/htmshell.patch b/recipes/ucsc-fatotwobit/htmshell.patch new file mode 100644 index 0000000000000..1e6f87375ed01 --- /dev/null +++ b/recipes/ucsc-fatotwobit/htmshell.patch @@ -0,0 +1,11 @@ +--- kent/src/lib/htmshell.c 2024-03-27 10:56:44.493892141 +0200 ++++ kent/src/lib/htmshell.c 2024-03-27 10:57:01.073792396 +0200 +@@ -713,7 +713,7 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) ++if (format != NULL) + { + vfprintf(stdout, format, args); + fprintf(stdout, "\n"); diff --git a/recipes/ucsc-fatotwobit/meta.yaml b/recipes/ucsc-fatotwobit/meta.yaml index 9809766e8251f..2b337b0122fe1 100644 --- a/recipes/ucsc-fatotwobit/meta.yaml +++ b/recipes/ucsc-fatotwobit/meta.yaml @@ -12,10 +12,11 @@ source: sha256: "{{ sha256 }}" patches: - "include.patch" + - htmshell.patch build: skip: True # [osx] - number: 0 + number: 1 ignore_run_exports: - libpng - libuuid @@ -50,3 +51,7 @@ about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" summary: "Convert DNA from fasta to 2bit format" + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/ucsc-fatovcf/build.sh b/recipes/ucsc-fatovcf/build.sh index 1074509ead921..2f2c83808ef5c 100644 --- a/recipes/ucsc-fatovcf/build.sh +++ b/recipes/ucsc-fatovcf/build.sh @@ -7,7 +7,7 @@ export CFLAGS="${CFLAGS} -I${PREFIX}/include ${LDFLAGS}" export USE_HIC=0 mkdir -p "${PREFIX}/bin" -export MACHTYPE=x86_64 +export MACHTYPE=$(uname -m) export BINDIR=$(pwd)/bin export L="${LDFLAGS}" mkdir -p "${BINDIR}" diff --git a/recipes/ucsc-fatovcf/htmshell.patch b/recipes/ucsc-fatovcf/htmshell.patch new file mode 100644 index 0000000000000..1e6f87375ed01 --- /dev/null +++ b/recipes/ucsc-fatovcf/htmshell.patch @@ -0,0 +1,11 @@ +--- kent/src/lib/htmshell.c 2024-03-27 10:56:44.493892141 +0200 ++++ kent/src/lib/htmshell.c 2024-03-27 10:57:01.073792396 +0200 +@@ -713,7 +713,7 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) ++if (format != NULL) + { + vfprintf(stdout, format, args); + fprintf(stdout, "\n"); diff --git a/recipes/ucsc-fatovcf/meta.yaml b/recipes/ucsc-fatovcf/meta.yaml index 1d2de4903514d..36c44e98dcd56 100644 --- a/recipes/ucsc-fatovcf/meta.yaml +++ b/recipes/ucsc-fatovcf/meta.yaml @@ -12,10 +12,13 @@ source: sha256: {{ sha256 }} patches: - include.patch + - htmshell.patch build: - number: 0 + number: 1 skip: True # [osx] + run_exports: + - {{ pin_subpackage(package, max_pin=None) }} requirements: build: @@ -45,3 +48,7 @@ about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" summary: "Extract VCF from a multi-sequence FASTA alignment" + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/ucsc-genepredtobed/build.sh b/recipes/ucsc-genepredtobed/build.sh index 106e6c404fcf1..73f68a12d7a6a 100644 --- a/recipes/ucsc-genepredtobed/build.sh +++ b/recipes/ucsc-genepredtobed/build.sh @@ -1,6 +1,6 @@ #!/bin/bash mkdir -p "$PREFIX/bin" -export MACHTYPE=x86_64 +export MACHTYPE=$(uname -m) export BINDIR=$(pwd)/bin export L="${LDFLAGS}" mkdir -p "$BINDIR" diff --git a/recipes/ucsc-genepredtobed/htmshell.patch b/recipes/ucsc-genepredtobed/htmshell.patch new file mode 100644 index 0000000000000..1e6f87375ed01 --- /dev/null +++ b/recipes/ucsc-genepredtobed/htmshell.patch @@ -0,0 +1,11 @@ +--- kent/src/lib/htmshell.c 2024-03-27 10:56:44.493892141 +0200 ++++ kent/src/lib/htmshell.c 2024-03-27 10:57:01.073792396 +0200 +@@ -713,7 +713,7 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) ++if (format != NULL) + { + vfprintf(stdout, format, args); + fprintf(stdout, "\n"); diff --git a/recipes/ucsc-genepredtobed/meta.yaml b/recipes/ucsc-genepredtobed/meta.yaml index 62b669805fbc6..ce54339cf9111 100644 --- a/recipes/ucsc-genepredtobed/meta.yaml +++ b/recipes/ucsc-genepredtobed/meta.yaml @@ -12,13 +12,16 @@ source: sha256: {{ sha256 }} patches: - include.patch + - htmshell.patch build: - number: 0 + number: 1 skip: True # [osx] ignore_run_exports: - libpng - libuuid + run_exports: + - {{ pin_subpackage(package, max_pin=None) }} requirements: build: @@ -48,3 +51,7 @@ about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" summary: "Convert from genePred to bed format. Does not yet handle genePredExt" + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/ucsc-gtftogenepred/htmshell.patch b/recipes/ucsc-gtftogenepred/htmshell.patch new file mode 100644 index 0000000000000..1e6f87375ed01 --- /dev/null +++ b/recipes/ucsc-gtftogenepred/htmshell.patch @@ -0,0 +1,11 @@ +--- kent/src/lib/htmshell.c 2024-03-27 10:56:44.493892141 +0200 ++++ kent/src/lib/htmshell.c 2024-03-27 10:57:01.073792396 +0200 +@@ -713,7 +713,7 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) ++if (format != NULL) + { + vfprintf(stdout, format, args); + fprintf(stdout, "\n"); diff --git a/recipes/ucsc-gtftogenepred/meta.yaml b/recipes/ucsc-gtftogenepred/meta.yaml index e3c78d48bc2a7..87ed2f492e9cb 100644 --- a/recipes/ucsc-gtftogenepred/meta.yaml +++ b/recipes/ucsc-gtftogenepred/meta.yaml @@ -12,13 +12,16 @@ source: sha256: {{ sha256 }} patches: - include.patch + - htmshell.patch build: - number: 0 + number: 1 skip: True # [osx] ignore_run_exports: - libpng - libuuid + run_exports: + - {{ pin_subpackage(package|lower, max_pin=None) }} requirements: build: @@ -48,3 +51,7 @@ about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" summary: "Convert a GTF file to a genePred" + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/ucsc-liftover/build.sh b/recipes/ucsc-liftover/build.sh index 49383fe092892..189c409009472 100644 --- a/recipes/ucsc-liftover/build.sh +++ b/recipes/ucsc-liftover/build.sh @@ -1,13 +1,13 @@ #!/bin/bash mkdir -p "$PREFIX/bin" -export MACHTYPE=x86_64 +export MACHTYPE=$(uname -m) export BINDIR=$(pwd)/bin export L="${LDFLAGS}" mkdir -p "$BINDIR" -(cd kent/src/lib && make) -(cd kent/src/htslib && make) -(cd kent/src/jkOwnLib && make) -(cd kent/src/hg/lib && make) -(cd kent/src/hg/liftOver && make) +(cd kent/src/lib && make -j${CPU_COUNT}) +(cd kent/src/htslib && make -j${CPU_COUNT}) +(cd kent/src/jkOwnLib && make -j${CPU_COUNT}) +(cd kent/src/hg/lib && make -j${CPU_COUNT}) +(cd kent/src/hg/liftOver && make -j${CPU_COUNT}) cp bin/liftOver "$PREFIX/bin" chmod +x "$PREFIX/bin/liftOver" diff --git a/recipes/ucsc-liftover/htmshell.patch b/recipes/ucsc-liftover/htmshell.patch new file mode 100644 index 0000000000000..1e6f87375ed01 --- /dev/null +++ b/recipes/ucsc-liftover/htmshell.patch @@ -0,0 +1,11 @@ +--- kent/src/lib/htmshell.c 2024-03-27 10:56:44.493892141 +0200 ++++ kent/src/lib/htmshell.c 2024-03-27 10:57:01.073792396 +0200 +@@ -713,7 +713,7 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) ++if (format != NULL) + { + vfprintf(stdout, format, args); + fprintf(stdout, "\n"); diff --git a/recipes/ucsc-liftover/meta.yaml b/recipes/ucsc-liftover/meta.yaml index e69762f7a6387..4d953bf48e005 100644 --- a/recipes/ucsc-liftover/meta.yaml +++ b/recipes/ucsc-liftover/meta.yaml @@ -12,13 +12,16 @@ source: sha256: {{ sha256 }} patches: - include.patch + - htmshell.patch build: - number: 0 + number: 1 skip: True # [osx] ignore_run_exports: - libpng - libuuid + run_exports: + - {{ pin_subpackage(package, max_pin=None) }} requirements: build: @@ -48,3 +51,7 @@ about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" summary: "Move annotations from one assembly to another" + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/ucsc-twobitinfo/htmshell.patch b/recipes/ucsc-twobitinfo/htmshell.patch new file mode 100644 index 0000000000000..1e6f87375ed01 --- /dev/null +++ b/recipes/ucsc-twobitinfo/htmshell.patch @@ -0,0 +1,11 @@ +--- kent/src/lib/htmshell.c 2024-03-27 10:56:44.493892141 +0200 ++++ kent/src/lib/htmshell.c 2024-03-27 10:57:01.073792396 +0200 +@@ -713,7 +713,7 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) ++if (format != NULL) + { + vfprintf(stdout, format, args); + fprintf(stdout, "\n"); diff --git a/recipes/ucsc-twobitinfo/meta.yaml b/recipes/ucsc-twobitinfo/meta.yaml index f3fcd9757c185..32559085469d0 100644 --- a/recipes/ucsc-twobitinfo/meta.yaml +++ b/recipes/ucsc-twobitinfo/meta.yaml @@ -1,7 +1,7 @@ {% set package = "ucsc-twobitinfo" %} {% set program = "twoBitInfo" %} -{% set version = "447" %} -{% set sha256 = "747a48486f7481d891e297baf63623b15d699265ede7339f654bcbc42481ac81" %} +{% set version = "455" %} +{% set sha256 = "e458cadad7c4a5c1b8385edafffa1b29380ac725a0c20535bf5a3bab99fe80db" %} package: name: "{{ package }}" @@ -12,13 +12,16 @@ source: sha256: "{{ sha256 }}" patches: - "include.patch" + - htmshell.patch build: skip: True # [osx] - number: 0 + number: 1 ignore_run_exports: - libpng - libuuid + run_exports: + - {{ pin_subpackage(package, max_pin=None) }} requirements: build: @@ -48,3 +51,7 @@ about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" summary: "get information about sequences in a .2bit file" + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/ucsc-twobittofa/build.sh b/recipes/ucsc-twobittofa/build.sh index 56c2c2edc3e97..8f25dc11367ae 100644 --- a/recipes/ucsc-twobittofa/build.sh +++ b/recipes/ucsc-twobittofa/build.sh @@ -1,13 +1,13 @@ #!/bin/bash mkdir -p "$PREFIX/bin" -export MACHTYPE=x86_64 +export MACHTYPE=$(uname -m) export BINDIR=$(pwd)/bin export L="${LDFLAGS}" mkdir -p "$BINDIR" -(cd kent/src/lib && make) -(cd kent/src/htslib && make) -(cd kent/src/jkOwnLib && make) -(cd kent/src/hg/lib && make) -(cd kent/src/utils/twoBitToFa && make) +(cd kent/src/lib && make -j ${CPU_COUNT}) +(cd kent/src/htslib && make -j ${CPU_COUNT}) +(cd kent/src/jkOwnLib && make -j ${CPU_COUNT}) +(cd kent/src/hg/lib && make -j ${CPU_COUNT}) +(cd kent/src/utils/twoBitToFa && make -j ${CPU_COUNT}) cp bin/twoBitToFa "$PREFIX/bin" chmod +x "$PREFIX/bin/twoBitToFa" diff --git a/recipes/ucsc-twobittofa/htmshell.patch b/recipes/ucsc-twobittofa/htmshell.patch new file mode 100644 index 0000000000000..1e6f87375ed01 --- /dev/null +++ b/recipes/ucsc-twobittofa/htmshell.patch @@ -0,0 +1,11 @@ +--- kent/src/lib/htmshell.c 2024-03-27 10:56:44.493892141 +0200 ++++ kent/src/lib/htmshell.c 2024-03-27 10:57:01.073792396 +0200 +@@ -713,7 +713,7 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) ++if (format != NULL) + { + vfprintf(stdout, format, args); + fprintf(stdout, "\n"); diff --git a/recipes/ucsc-twobittofa/meta.yaml b/recipes/ucsc-twobittofa/meta.yaml index 60da0e0bea610..9469bbbab5f7e 100644 --- a/recipes/ucsc-twobittofa/meta.yaml +++ b/recipes/ucsc-twobittofa/meta.yaml @@ -12,10 +12,11 @@ source: sha256: {{ sha256 }} patches: - include.patch + - htmshell.patch build: skip: True # [osx] - number: 0 + number: 1 ignore_run_exports: - libpng - libuuid @@ -50,3 +51,7 @@ about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" summary: "Convert all or part of .2bit file to fasta" + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/ucsc-wigtobigwig/htmshell.patch b/recipes/ucsc-wigtobigwig/htmshell.patch new file mode 100644 index 0000000000000..1e6f87375ed01 --- /dev/null +++ b/recipes/ucsc-wigtobigwig/htmshell.patch @@ -0,0 +1,11 @@ +--- kent/src/lib/htmshell.c 2024-03-27 10:56:44.493892141 +0200 ++++ kent/src/lib/htmshell.c 2024-03-27 10:57:01.073792396 +0200 +@@ -713,7 +713,7 @@ + puts("Status: 400\r"); + puts("Content-Type: text/plain; charset=UTF-8\r"); + puts("\r"); +-if (format != NULL && args != NULL) ++if (format != NULL) + { + vfprintf(stdout, format, args); + fprintf(stdout, "\n"); diff --git a/recipes/ucsc-wigtobigwig/meta.yaml b/recipes/ucsc-wigtobigwig/meta.yaml index f5fe88a1de56b..c21b3a9bb7d40 100644 --- a/recipes/ucsc-wigtobigwig/meta.yaml +++ b/recipes/ucsc-wigtobigwig/meta.yaml @@ -12,10 +12,13 @@ source: sha256: {{ sha256 }} patches: - include.patch + - htmshell.patch build: - number: 1 + number: 2 skip: True # [osx] + run_exports: + - {{ pin_subpackage(package, max_pin=None) }} ignore_run_exports: - libpng - libuuid @@ -48,3 +51,7 @@ about: home: "http://hgdownload.cse.ucsc.edu/admin/exe/" license: "varies; see http://genome.ucsc.edu/license" summary: "Convert ascii format wig file (in fixedStep, variableStep)" + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/umi_tools/meta.yaml b/recipes/umi_tools/meta.yaml index 1dfa3b6caa4b6..c7f05cab66524 100644 --- a/recipes/umi_tools/meta.yaml +++ b/recipes/umi_tools/meta.yaml @@ -1,6 +1,6 @@ {% set name = "umi_tools" %} -{% set version = "1.1.4" %} -{% set sha256hash = "945c4c98e2007369c301a7a009c6f9deb0fda74b0117cd14e14bd134164a4ff6" %} +{% set version = "1.1.5" %} +{% set sha256hash = "2a87b75364ebe3e6ccf467d3b6d0501c458a48f3e6c8ab8b7c4dfb3fd7627fab" %} package: name: {{ name }} @@ -11,11 +11,13 @@ source: sha256: {{ sha256hash }} build: - number: 2 + number: 1 script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed --no-cache-dir -vvv" skip: True # [py27] entry_points: - umi_tools = umi_tools.umi_tools:main + run_exports: + - {{ pin_subpackage(name, max_pin="x") }} requirements: build: @@ -45,3 +47,7 @@ about: summary: 'Tools for dealing with Unique Molecular Identifiers (UMIs) / Random Molecular Tags (RMTs)' dev_url: https://github.com/CGATOxford/UMI-tools + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/umis/meta.yaml b/recipes/umis/meta.yaml index daa5e038df0ce..3c7b4ddff3e27 100644 --- a/recipes/umis/meta.yaml +++ b/recipes/umis/meta.yaml @@ -6,11 +6,13 @@ package: version: "{{ version }}" build: - number: 1 + number: 2 + run_exports: + - {{ pin_subpackage('umis', max_pin='x') }} source: url: "{{ github }}/archive/refs/tags/v{{ version }}.tar.gz" - sha256: a471522ccd2ad6d86cb9ae4cbb61f27ace8da80ca75d1f7f3faf980790424179 + sha256: 7d446da4cc31f075e539db6b6d7b31a3309e0c4c708875981d61780c2de7ed82 requirements: build: @@ -40,6 +42,8 @@ about: summary: Tools for processing UMI RNA-tag data extra: + additional-platforms: + - linux-aarch64 container: # click requires a unicode locale when used with Python 3 # extended-base generates en_US.UTF-8 locale and sets LC_ALL, LANG properly diff --git a/recipes/unassigner/meta.yaml b/recipes/unassigner/meta.yaml new file mode 100644 index 0000000000000..e3b7bce47b243 --- /dev/null +++ b/recipes/unassigner/meta.yaml @@ -0,0 +1,46 @@ +{% set name = "unassigner" %} +{% set version = "1.0.0" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" + sha256: 0a79a0fdf88318a2583e2a46deffb6f6ff4ce612c55b470c007eed7bb9aa2194 + +build: + number: 0 + noarch: python + entry_points: + - unassigner = unassigner.command:main + script: {{ PYTHON }} -m pip install . --ignore-installed --no-deps -vv + run_exports: + - {{ pin_subpackage('unassigner', max_pin="x") }} + +requirements: + host: + - pip + - python + run: + - python + - vsearch + - biopython + - scipy + +test: + imports: + - unassigner + commands: + - unassigner --help + +about: + home: https://github.com/PennChopMicrobiomeProgram/unassigner + license: GPL-2.0-or-later + license_family: GPL + summary: "Type strain identification for 16S reads" + dev_url: https://github.com/PennChopMicrobiomeProgram/unassigner + +extra: + recipe-maintainers: + - Ulthran diff --git a/recipes/unikseq/meta.yaml b/recipes/unikseq/meta.yaml index 7acad68484a8d..6eee8a084f202 100644 --- a/recipes/unikseq/meta.yaml +++ b/recipes/unikseq/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.3.4" %} +{% set version = "1.3.5" %} package: name: unikseq @@ -6,7 +6,7 @@ package: source: url: https://github.com/bcgsc/unikseq/releases/download/v{{ version }}/unikseq-{{ version }}.tar.gz - sha256: e5abe93ccd3bd4b66a67516cde0d877fe82d0ac275833d7d3cc9d95c19f68cf4 + sha256: 9b497384ce023a06fd79353c2488455f1517f10e575c86f1f5df1e21463d09e8 patches: - unikseq-bloom.patch - unikseq-write-bloom.patch @@ -14,6 +14,8 @@ source: build: noarch: generic number: 0 + run_exports: + - {{ pin_subpackage('unikseq', max_pin="x") }} requirements: run: @@ -27,7 +29,7 @@ test: - writeBloom.pl |grep "Usage" about: - summary: Unique DNA sequence region identification, using a k-mer approach + summary: Unique DNA sequence region identification using a k-mer approach home: https://github.com/bcgsc/unikseq license: GPL-3.0 license_file: LICENSE diff --git a/recipes/usher/meta.yaml b/recipes/usher/meta.yaml index 63b3f108e082f..107664cd88018 100644 --- a/recipes/usher/meta.yaml +++ b/recipes/usher/meta.yaml @@ -9,7 +9,7 @@ source: sha256: 95aba8f748599915f21f7bdf883c2e532f2d821138f06cb2e4e58d7323019946 build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('usher', max_pin="x.x") }} @@ -51,5 +51,7 @@ about: doc_url: https://usher-wiki.readthedocs.io/en/latest/ extra: + additional-platforms: + - linux-aarch64 identifiers: - doi:10.1038/s41588-021-00862-7 diff --git a/recipes/varcode/meta.yaml b/recipes/varcode/meta.yaml index 01e085d867ed8..061bbf466712d 100644 --- a/recipes/varcode/meta.yaml +++ b/recipes/varcode/meta.yaml @@ -1,5 +1,5 @@ {% set name = "varcode" %} -{% set version = "1.1.0" %} +{% set version = "1.2.0" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: ed2c81a322e13f4b9fcfc15fc1dba87dbeef8ab4cd808f22188ec67db9159512 + sha256: e3ae050bf772fca49417044f7dfc5f68c373b11ace7afea106d4f35b4721091f build: number: 0 @@ -15,7 +15,9 @@ build: entry_points: - varcode-genes = varcode.cli.genes_script:main - varcode = varcode.cli.effects_script:main - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv" + run_exports: + - {{ pin_subpackage('varcode', max_pin="x") }} requirements: host: @@ -44,8 +46,9 @@ test: about: home: "https://github.com/openvax/varcode" - license: Apache Software + license: Apache-2.0 license_family: APACHE + license_file: LICENSE summary: "Variant annotation in Python" extra: diff --git a/recipes/varfish-cli/meta.yaml b/recipes/varfish-cli/meta.yaml index cc5fa0f456492..6baa90f445ec8 100644 --- a/recipes/varfish-cli/meta.yaml +++ b/recipes/varfish-cli/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.5.3" %} -{% set sha256 = "ae8ee0314f0ebcfacf44518d7dcca4d9aba74d3fa50159fd0adbc04017671677" %} +{% set version = "0.6.3" %} +{% set sha256 = "7a7344b3d88b8ac303f0a54f7709fa528fe1555dd6e935c45e6ec452d955871d" %} package: name: varfish-cli @@ -10,16 +10,20 @@ source: sha256: '{{sha256}}' build: - script: python -m pip install --no-deps --ignore-installed . - noarch: python - number: 0 + noarch: python + number: 2 + script: {{ PYTHON }} -m pip install . --no-deps --no-build-isolation -vvv + entry_points: + - varfish-cli = varfish_cli.__main__:main + run_exports: + - {{ pin_subpackage('varfish-cli', max_pin="x.x") }} requirements: host: - python >=3 - pip run: - - python >=3 + - python >=3.9 - attrs - cattrs - jsonschema @@ -29,9 +33,11 @@ requirements: - tqdm - tabulate - polyleven + - pydantic >=2.0,<3.0 - python-dateutil - simplejson - typeguard + - typer test: imports: diff --git a/recipes/varfish-server-worker/meta.yaml b/recipes/varfish-server-worker/meta.yaml index c895ca635ee19..dc77bd2febe35 100644 --- a/recipes/varfish-server-worker/meta.yaml +++ b/recipes/varfish-server-worker/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.10.2" %} +{% set version = "0.11.0" %} package: name: varfish-server-worker @@ -11,8 +11,8 @@ build: - {{ pin_subpackage("varfish-server-worker", max_pin="x.x") }} source: - url: https://github.com/bihealth/varfish-server-worker/archive/refs/tags/v{{ version }}.tar.gz - sha256: d75f79952215c8be560d864adafd305e46a3694ffe6d9116243bf88c0b1465c4 + url: https://github.com/varfish-org/varfish-server-worker/archive/refs/tags/v{{ version }}.tar.gz + sha256: 81e7c2a35115989eef9e71bd08b56837fea73ac5fe4e6b09115f687d3013915a requirements: build: @@ -37,7 +37,7 @@ test: - varfish-server-worker --help about: - home: https://github.com/bihealth/varfish-server-worker + home: https://github.com/varfish-org/varfish-server-worker license: MIT summary: | Rust-based tool for the heavy lifting in varfish-server. diff --git a/recipes/varlociraptor/meta.yaml b/recipes/varlociraptor/meta.yaml index 8fb5cf321e92c..ba3b7fc4c4bb3 100644 --- a/recipes/varlociraptor/meta.yaml +++ b/recipes/varlociraptor/meta.yaml @@ -1,17 +1,17 @@ -{% set version = "8.4.2" %} +{% set version = "8.4.6" %} package: name: varlociraptor version: {{ version }} build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage("varlociraptor", max_pin="x") }} source: url: https://github.com/varlociraptor/varlociraptor/archive/v{{ version }}.tar.gz - sha256: 41dd246d34e0e0d277681e9114bbc5bdfa95d0ef01b884be975a8f00bc3b492a + sha256: b734b322a6ff96ba5f074947505bce0166907afd448350731c9eb1dd453a5311 requirements: build: @@ -43,3 +43,7 @@ about: license: GPLv3 license_family: GPL summary: Flexible, uncertainty-aware variant calling with parameter free filtration via FDR control. + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/varvamp/meta.yaml b/recipes/varvamp/meta.yaml index efbed07b77dd9..e3c567cded62a 100644 --- a/recipes/varvamp/meta.yaml +++ b/recipes/varvamp/meta.yaml @@ -1,5 +1,5 @@ {% set name = "varvamp" %} -{% set version = "1.0.1" %} +{% set version = "1.1.3" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/varvamp-{{ version }}.tar.gz - sha256: 422a4a9dc8d5377242731e3027bba4510939e0dc91555d57636d7b45961261ab + sha256: e65a8af027d32ee6626a8768fe8e373132a3ac8f00845b005b4ed80c5630e041 build: entry_points: diff --git a/recipes/ms2deepscore/LICENCE b/recipes/vcf-validator/LICENSE similarity index 99% rename from recipes/ms2deepscore/LICENCE rename to recipes/vcf-validator/LICENSE index 261eeb9e9f8b2..6b0b1270ff0ca 100644 --- a/recipes/ms2deepscore/LICENCE +++ b/recipes/vcf-validator/LICENSE @@ -1,3 +1,4 @@ + Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ @@ -199,3 +200,4 @@ WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. + diff --git a/recipes/vcf-validator/LICENSE_ODB b/recipes/vcf-validator/LICENSE_ODB new file mode 100644 index 0000000000000..52e36215fc329 --- /dev/null +++ b/recipes/vcf-validator/LICENSE_ODB @@ -0,0 +1,71 @@ + +ODB License Exception for vcf-validator (Validator for the Variant Call +Format (VCF)) Software + Version 1.0 + +1. Intent + +The intent of this License Exception is to allow the vcf-validator software +to use ODB without the "copyleft" restrictions that would normally be +imposed by the GPL, the license under which ODB is distributed. + +Specifically, the intent is to allow you to use the original vcf-validator +software in your open source or proprietary works without imposing +any additional restrictions to the terms and conditions of the +Apache 2.0 license used by vcf-validator. + +If you wish to modify the vcf-validator software in such a way that it +requires changes to the persistent object model handled by ODB, you can +continue enjoying the terms of this exception provided that you are +prepared to release your modifications under Apache 2.0 or another open +source license and you obtain a separate license exception for your +modifications from Code Synthesis Tools CC. + +While this exception is specific to vcf-validator, any open source software +project licensed under a more liberal than the GPL license can obtain +a similar exception free of charge by contacting Code Synthesis Tools CC. + +2. Definitions + +"Original Software" is the vcf-validator software, Copyright (c) EMBL - +European Bioinformatics Institute, distributed under the terms of the +Apache 2.0 license, and available to any third party from: + + https://github.com/ebivariation/vcf-validator + +"ODB-Extended Software" are any modifications to the Original Software +that require additions or changes to the persistent object model of +the Original Software that is handled by ODB. + +"Work Based on the Original Software" is any derivative work under the +copyright law that is either based on the Original Software or any +modified version of the Original Software that does not constitute +ODB-Extended Software. + +"Work Based on the ODB-Extended Software" is any derivative work under +the copyright law that is based on any modified version of the Original +Software that constitutes ODB-Extended Software. + +3. Legal Terms and Conditions + +As a special exception to the terms and conditions of version 2 of the +GPL you may use the ODB runtime libraries in Original Software and in +Works Based on the Original Software and distribute the resulting works +in object code or executable form and without making source code for +such works available to any third party, provided that all of the +following conditions are met: + + a) Original Software was licensed as a whole at no charge to all third + parties under the terms of the Apache 2.0 license. + + b) The ODB runtime libraries in Works Based on the Original Software + are used solely for the purpose of supporting the functionality of + the Original Software. + +The same exception does not apply automatically to ODB-Extended Software +or Works Based on the ODB-Extended Software. If you wish to enjoy this +exception for such works, then you will need to license ODB-Extended +Software at no charge to all third parties under the terms of the Apache 2.0 +license or another open source license. You will also need to obtain a +separate License Exception for ODB-Extended Software from Code Synthesis +Tools CC. diff --git a/recipes/vcf-validator/build.sh b/recipes/vcf-validator/build.sh new file mode 100644 index 0000000000000..acd838e4eac4f --- /dev/null +++ b/recipes/vcf-validator/build.sh @@ -0,0 +1,11 @@ +mkdir -p ${PREFIX}/bin +# Check if linux or osx +if [ -z ${OSX_ARCH+x} ]; then + mv vcf_validator_linux ${PREFIX}/bin/vcf_validator + mv vcf_assembly_checker_linux ${PREFIX}/bin/vcf_assembly_checker +else + mv vcf_validator_macos ${PREFIX}/bin/vcf_validator + mv vcf_assembly_checker_macos ${PREFIX}/bin/vcf_assembly_checker +fi + +chmod 755 ${PREFIX}/bin/vcf_assembly_checker ${PREFIX}/bin/vcf_validator diff --git a/recipes/vcf-validator/meta.yaml b/recipes/vcf-validator/meta.yaml new file mode 100644 index 0000000000000..252a24c4013d0 --- /dev/null +++ b/recipes/vcf-validator/meta.yaml @@ -0,0 +1,44 @@ +{% set name = "vcf-validator" %} +{% set version = "0.9.6" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + - url: https://github.com/EBIvariation/vcf-validator/releases/download/v{{ version }}/vcf_validator_linux # [linux] + sha256: 33fc99334e77a90e99415daebfa877a9bc0375a3d7c18809082ace64d8373cdd # [linux] + - url: https://github.com/EBIvariation/vcf-validator/releases/download/v{{ version }}/vcf_assembly_checker_linux # [linux] + sha256: 7913a6b3f12fdf5a66c98026ef144be4f8964f981f80eca4b509e06e6b8282ab # [linux] + - url: https://github.com/EBIvariation/vcf-validator/releases/download/v{{ version }}/vcf_validator_macos # [osx] + sha256: 68f50e38323260dcd77e236c27872e1a0eb5c6407736baf003cbc755c87bab94 # [osx] + - url: https://github.com/EBIvariation/vcf-validator/releases/download/v{{ version }}/vcf_assembly_checker_macos # [osx] + sha256: afb7383468fa08d597fc8f7588918dbcdafc8d6d41eb7d33d37ae71a30860cb7 # [osx] + +build: + script: + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin="x.x") }} + +test: + commands: + - vcf_validator --help + - vcf_assembly_checker --help + +about: + home: https://github.com/EBIVariation/vcf-validator + summary: EBI EVA - Validation tool to ensure VCF specification compliance + license: Apache-2.0 + license_file: + - LICENSE + - LICENSE_ODB + +extra: + recipe-maintainers: + - apriltuesday + - tcezard + - ebi-variation + skip-lints: + - should_be_noarch_generic + - should_not_be_noarch_source diff --git a/recipes/vcf2parquet/meta.yaml b/recipes/vcf2parquet/meta.yaml index f5b5e47b394db..ad6addc3938bc 100644 --- a/recipes/vcf2parquet/meta.yaml +++ b/recipes/vcf2parquet/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.4.1" %} -{% set sha256 = "c0eb32658e4ec05433b265c78c158e216e2e464a15174615c1e6d39380019a46" %} +{% set version = "0.5.0" %} +{% set sha256 = "61cba26e418d33af994bc85c4e5174ed115fc15bcf94f4f54e14a31ab839c82f" %} package: name: vcf2parquet @@ -11,17 +11,18 @@ source: build: number: 0 + run_exports: + - {{ pin_subpackage('vcf2parquet', max_pin="x.x") }} requirements: build: - {{ compiler("c") }} - - rust + - {{ compiler("rust") }} - pkg-config # [osx] host: - xz - zlib - bzip2 - run: test: commands: diff --git a/recipes/vcf2variants/meta.yaml b/recipes/vcf2variants/meta.yaml index ce21048d701da..1e86cba1234ab 100644 --- a/recipes/vcf2variants/meta.yaml +++ b/recipes/vcf2variants/meta.yaml @@ -1,5 +1,5 @@ {% set name = "vcf2variants" %} -{% set version = "1.2" %} +{% set version = "1.3" %} package: name: '{{ name|lower }}' @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 7830202ec67de08e7b223649365eed4a4a66d1339c985123d21c65cca7283728 + sha256: 152f8e97ae8d23613672e93b33713e4fb620a92bbae72bd052e75e2fc409db12 build: number: 0 diff --git a/recipes/vcfanno/meta.yaml b/recipes/vcfanno/meta.yaml index ab4d005b463ac..5432278f824fa 100644 --- a/recipes/vcfanno/meta.yaml +++ b/recipes/vcfanno/meta.yaml @@ -5,13 +5,15 @@ package: version: {{ version }} source: - url: https://github.com/brentp/vcfanno/releases/download/v{{ version }}/vcfanno_osx # [osx] - sha256: 2f51637c6358fec7e7fcb1dbbfc1b2cbbed6ff47a7c6b7ef386f1152ff74829f # [osx] - url: https://github.com/brentp/vcfanno/releases/download/v{{ version }}/vcfanno_linux64 # [linux] - sha256: a98a9be6dfec32b039b21563659c4ecf0ec884ad3cdfaf0732b44c3857520592 # [linux] + - url: https://github.com/brentp/vcfanno/releases/download/v{{ version }}/vcfanno_osx # [osx] + sha256: 2f51637c6358fec7e7fcb1dbbfc1b2cbbed6ff47a7c6b7ef386f1152ff74829f # [osx] + - url: https://github.com/brentp/vcfanno/releases/download/v{{ version }}/vcfanno_linux64 # [linux and x86_64] + sha256: a98a9be6dfec32b039b21563659c4ecf0ec884ad3cdfaf0732b44c3857520592 # [linux and x86_64] + - url: https://github.com/brentp/vcfanno/releases/download/v{{ version }}/vcfanno_linux_aarch64 # [linux and aarch64] + sha256: 732007523998f9a48071fa3dd75d4492c972dd786861b0a5d36cd0669f5d5288 # [linux and aarch64] build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage("vcfanno", max_pin="x") }} @@ -22,6 +24,8 @@ test: - "vcfanno 2>&1 | grep 'vcfanno'" extra: + additional-platforms: + - linux-aarch64 skip-lints: - should_be_noarch_generic # uses per platform binaries - should_not_be_noarch_source # uses binaries diff --git a/recipes/vcfdist/build.sh b/recipes/vcfdist/build.sh new file mode 100644 index 0000000000000..ba9402cf841f3 --- /dev/null +++ b/recipes/vcfdist/build.sh @@ -0,0 +1,9 @@ +#!/bin/bash + +export CPATH="${PREFIX}/include" +export CPLUS_INCLUDE_PATH="${PREFIX}/include" +export LD_LIBRARY_PATH="${PREFIX}/lib" + +cd src && make +install -d "${PREFIX}/bin" +install vcfdist "${PREFIX}/bin" diff --git a/recipes/vcfdist/conda_build_config.yaml b/recipes/vcfdist/conda_build_config.yaml new file mode 100644 index 0000000000000..50a90b77e33c2 --- /dev/null +++ b/recipes/vcfdist/conda_build_config.yaml @@ -0,0 +1,4 @@ +htslib: + - 1.17 +pin_run_as_build: + htslib: x.x diff --git a/recipes/vcfdist/meta.yaml b/recipes/vcfdist/meta.yaml new file mode 100644 index 0000000000000..7936d92329652 --- /dev/null +++ b/recipes/vcfdist/meta.yaml @@ -0,0 +1,42 @@ +{% set version = "2.5.1" %} +{% set sha256 = "25d7d8c8613cfcfb1c582edbe09d20d1d3cb7de6fd6d18c0b83ac4d8195637a3" %} + +package: + name: vcfdist + version: {{ version }} + +source: + url: https://github.com/TimD1/vcfdist/archive/refs/tags/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + run_exports: + - {{ pin_subpackage("vcfdist", max_pin="x.x") }} + +requirements: + build: + - make + - {{ compiler('cxx') }} + host: + - htslib + run: + - htslib + +test: + commands: + - vcfdist --version + +about: + summary: 'vcfdist: benchmarking phased germline variant calls in VCF format' + home: https://github.com/TimD1/vcfdist + license: GPL-3.0-only + license_family: GPL3 + license_file: LICENSE + doc_url: https://github.com/TimD1/vcfdist/wiki + +extra: + maintainers: + - TimD1 + identifiers: + - doi:10.5281/zenodo.8368282 diff --git a/recipes/vcflib/backport_pr_394.patch b/recipes/vcflib/backport_pr_394.patch index fa6e5e24c0671..b2be5bdcc49da 100644 --- a/recipes/vcflib/backport_pr_394.patch +++ b/recipes/vcflib/backport_pr_394.patch @@ -2,11 +2,19 @@ diff --git a/CMakeLists.txt b/CMakeLists.txt index 088605d..286c9fc 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt -@@ -445,6 +445,8 @@ if (NOT BUILD_ONLY_LIB) +@@ -462,6 +462,15 @@ if (NOT BUILD_ONLY_LIB) + target_link_libraries(vcfallelicprimitives PUBLIC ${WFALIB}) + target_link_libraries(vcfcleancomplex PUBLIC ${WFALIB}) target_link_libraries(vcfparsealts PUBLIC ${WFALIB}) - target_link_libraries(vcfroc PUBLIC ${WFALIB}) - target_link_libraries(vcfstats PUBLIC ${WFALIB}) + target_link_libraries(vcfstreamsort PUBLIC ${WFALIB}) + target_link_libraries(vcfuniq PUBLIC ${WFALIB}) ++ target_link_libraries(vcfcreatemulti PUBLIC ${WFALIB}) ++ target_link_libraries(vcfld PUBLIC ${WFALIB}) ++ target_link_libraries(vcfecho PUBLIC ${WFALIB}) ++ target_link_libraries(vcfuniqalleles PUBLIC ${WFALIB}) ++ target_link_libraries(vcffilter PUBLIC ${WFALIB}) ++ target_link_libraries(permuteGPAT++ PUBLIC ${WFALIB}) ++ target_link_libraries(vcfintersect PUBLIC ${WFALIB}) + target_link_libraries(vcfroc PUBLIC ${WFALIB}) + target_link_libraries(vcfstats PUBLIC ${WFALIB}) target_link_libraries(vcfwave PUBLIC ${WFALIB}) - install(TARGETS ${BINS} RUNTIME DESTINATION ${CMAKE_INSTALL_BINDIR}) diff --git a/recipes/vcflib/build.sh b/recipes/vcflib/build.sh index c282330d8bd3e..ac929087a86e7 100644 --- a/recipes/vcflib/build.sh +++ b/recipes/vcflib/build.sh @@ -1,12 +1,15 @@ #!/bin/bash set -ex -if [ `uname` == Darwin ]; then +OS=$(uname) +ARCH=$(uname -m) + +if [ "${OS}" == "Darwin" ]; then echo $(pwd)/zig-macos-x86_64-* export PATH="$(pwd)/zig-macos-x86_64-0.10.1:${PATH}" - else - echo $(pwd)/zig-linux-x86_64-* - export PATH="$(pwd)/zig-linux-x86_64-0.10.1:${PATH}" +else + echo $(pwd)/zig-linux-${ARCH}-* + export PATH="$(pwd)/zig-linux-${ARCH}-0.10.1:${PATH}" fi export INCLUDES="-I${PREFIX}/include -I. -Ihtslib -Itabixpp -I\$(INC_DIR)" @@ -24,7 +27,7 @@ sed -i.bak 's/g++/$(CXX) $(CXXFLAGS)/g' contrib/multichoose/Makefile sed -i.bak 's/g++/$(CXX) $(CXXFLAGS)/g' contrib/intervaltree/Makefile # MacOSX Build fix: https://github.com/chapmanb/homebrew-cbl/issues/14 -if [ "$(uname)" == "Darwin" ]; then +if [ "${OS}" == "Darwin" ]; then sed -i.bak 's/LDFLAGS=-Wl,-s/LDFLAGS=/' contrib/smithwaterman/Makefile export LDFLAGS="${LDFLAGS} -Wl,-rpath,${PREFIX}/lib" export CXXFLAGS="${CXXFLAGS} -D_LIBCPP_ENABLE_CXX17_REMOVED_FEATURES" @@ -36,15 +39,7 @@ pkg-config --list-all cmake -S . -B build \ -DZIG=ON -DOPENMP=ON -DWFA_GITMODULE=OFF \ -DCMAKE_BUILD_TYPE=Release \ - -DBUILD_SHARED_LIBS=ON \ -DCMAKE_INSTALL_PREFIX="${PREFIX}" \ - -DCMAKE_CXX_COMPILER="${CXX}" \ - -DCMAKE_CXX_FLAGS="${CXXFLAGS}" \ - -DCMAKE_C_COMPILER="${CC}" \ - -DCMAKE_INCLUDE_PATH="${PREFIX}/include" \ - -DCMAKE_LIBRARY_PATH="${PREFIX}/lib" + -DCMAKE_CXX_FLAGS="${CXXFLAGS}" cmake --build build/ --target install -j 4 -v - -#cp -n ../scripts/* $PREFIX/bin -#cp -n -r ../src/simde $PREFIX/include/ diff --git a/recipes/vcflib/meta.yaml b/recipes/vcflib/meta.yaml index aa3a495dd30c3..03b091e5953c1 100644 --- a/recipes/vcflib/meta.yaml +++ b/recipes/vcflib/meta.yaml @@ -14,15 +14,18 @@ source: - shared_lib.patch - backport_pr_394.patch # TODO remove once PR https://github.com/vcflib/vcflib/pull/394 is merged and released - tabix.patch -- url: https://ziglang.org/download/0.10.1/zig-linux-x86_64-0.10.1.tar.xz # [linux] - sha256: 6699f0e7293081b42428f32c9d9c983854094bd15fee5489f12c4cf4518cc380 # [linux] - folder: zig-linux-x86_64-0.10.1 # [linux] +- url: https://ziglang.org/download/0.10.1/zig-linux-x86_64-0.10.1.tar.xz # [linux and x86_64] + sha256: 6699f0e7293081b42428f32c9d9c983854094bd15fee5489f12c4cf4518cc380 # [linux and x86_64] + folder: zig-linux-x86_64-0.10.1 # [linux and x86_64] +- url: https://ziglang.org/download/0.10.1/zig-linux-aarch64-0.10.1.tar.xz # [linux and aarch64] + sha256: db0761664f5f22aa5bbd7442a1617dd696c076d5717ddefcc9d8b95278f71f5d # [linux and aarch64] + folder: zig-linux-aarch64-0.10.1 # [linux and aarch64] - url: https://ziglang.org/download/0.10.1/zig-macos-x86_64-0.10.1.tar.xz # [osx] sha256: 02483550b89d2a3070c2ed003357fd6e6a3059707b8ee3fbc0c67f83ca898437 # [osx] folder: zig-macos-x86_64-0.10.1 # [osx] build: - number: 4 + number: 6 run_exports: - {{ pin_subpackage('vcflib', max_pin="x") }} @@ -34,13 +37,13 @@ requirements: - pybind11-global # python really only used as a build tool; no ${PREFIX}/bin/python needed. - python >=3 + - pkg-config host: - libgomp # [linux] - llvm-openmp # [osx] - zlib - htslib - tabixpp - - pkg-config - wfa2-lib run: - python >=3 @@ -70,6 +73,8 @@ about: summary: Command-line tools for manipulating VCF files extra: + additional-platforms: + - linux-aarch64 recipe-maintainers: - jpuritz identifiers: diff --git a/recipes/vcfsim/meta.yaml b/recipes/vcfsim/meta.yaml index 4123c6047645d..5a7af5429f034 100644 --- a/recipes/vcfsim/meta.yaml +++ b/recipes/vcfsim/meta.yaml @@ -1,5 +1,5 @@ {% set name = "vcfsim" %} -{% set version = "1.0.5.alpha" %} +{% set version = "1.0.11.alpha" %} package: name: {{ name|lower }} @@ -7,62 +7,47 @@ package: source: url: https://github.com/Pie115/VCFSimulator-SamukLab/archive/{{ version }}.tar.gz - sha256: 3930958c2e52f62e5dd9e685307ff03e5387ae80158339806152da7f7aaa57ac + sha256: 9263d88be02a25a4ff9033413ecd2c72807f5ea532434092a35abf96b8858aa0 build: + noarch: python entry_points: - vcfsim=vcfsim.__main__:main script: {{ PYTHON }} -m pip install . -vv number: 0 - skip: True run_exports: - {{ pin_subpackage('vcfsim', max_pin="x") }} - -requirements: - build: - - {{ compiler('c') }} - - cross-python_{{ target_platform }} - - python - - pybind11 - - numpy +requirements: host: - - python >=3.8 - - cython + - python >=3.6 - pip - setuptools - numpy - - setuptools_scm - - gsl - + - pandas + - msprime + - ipython # Include this only if IPython features are used outside notebooks + run: - - python >=3.8 - - pandas >=1.5.2 + - python >=3.6 - numpy - - msprime >=1.0.1 - - tskit >=0.4 - - demes >=0.2 - - gsl - - scikit-allel >=1.3.5 - - scikit-learn >=1.2.0 - - scipy >=1.9.3 + - pandas + - msprime + - ipython # Include this only if IPython features are used outside notebooks test: imports: - vcfsim commands: - - pip check - vcfsim --help - requires: - - pip about: home: https://github.com/Pie115/VCFSimulator-SamukLab license: MIT license_file: LICENSE.txt - summary: "Script for generating simulated VCF's" + summary: "Script for generating simulated VCF's leveraging a coalescent simulating backend." description: | - "vcfsim is a new command-line tool for generating simulated VCF's(variant call format files for encoding genetic data). Leveraging a coalescent simulating backend and providing an interface from Msprime coalescent simulating package to pandas. VCF's can now be easily simulated with just a few command line arguments!" + "VCFSim is a new command-line tool for generating simulated VCF's(variant call format files for encoding genetic data). Leveraging a coalescent simulating backend and providing an interface from Msprime coalescent simulating package to pandas. VCF's can now be easily simulated with just a few command line arguments!" extra: recipe-maintainers: diff --git a/recipes/vcftools/meta.yaml b/recipes/vcftools/meta.yaml index 296c3146b59a1..fc5557f5b5c3b 100644 --- a/recipes/vcftools/meta.yaml +++ b/recipes/vcftools/meta.yaml @@ -13,7 +13,9 @@ source: - patch build: - number: 9 + number: 10 + run_exports: + - {{ pin_subpackage('vcftools', max_pin='x.x') }} requirements: build: @@ -41,5 +43,7 @@ about: summary: A set of tools written in Perl and C++ for working with VCF files. extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:vcftools diff --git a/recipes/vembrane/meta.yaml b/recipes/vembrane/meta.yaml index 753f85df6c5f3..5b3851289ab76 100644 --- a/recipes/vembrane/meta.yaml +++ b/recipes/vembrane/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.0.4" %} +{% set version = "1.0.5" %} package: name: vembrane @@ -6,7 +6,7 @@ package: source: url: https://pypi.io/packages/source/v/vembrane/vembrane-{{ version }}.tar.gz - sha256: 8d0892c61e4172440390f89cbda16ba2fccd0c519a3e763a0e3950479869673c + sha256: c0afc7dc69dd32ac95c45ba679b5751c2d63170e4876dbc0ce860d44f6b6c18e build: number: 0 diff --git a/recipes/verkko/meta.yaml b/recipes/verkko/meta.yaml index 5f622352244e0..247baef98498b 100644 --- a/recipes/verkko/meta.yaml +++ b/recipes/verkko/meta.yaml @@ -1,5 +1,5 @@ {% set name = "verkko" %} -{% set version = "1.4.1" %} +{% set version = "2.0" %} package: name: {{ name|lower }} @@ -7,14 +7,16 @@ package: source: url: https://github.com/marbl/{{ name }}/releases/download/v{{ version }}/{{ name }}-v{{ version }}.tar.gz - md5: 37299a7938c9806763586c2d386f38e8 + md5: be5b322b2fcfcee07c0d64fa49c6a9b4 patches: - version.patch - - tips.patch + - osx_availability.patch # [osx] build: number: 0 + run_exports: + - {{ pin_subpackage('verkko', max_pin="x.x") }} requirements: build: @@ -25,15 +27,16 @@ requirements: - rust >=1.66 host: - gsl + - zlib run: - python >=3.7 - perl >=5.6 + - seqtk - parasail-python >=1.3.3 - networkx >=2.6.3 - biopython - - snakemake-minimal >=7.8.0 - - graphaligner >=1.0.17b - - mbg >=1.0.15 + - snakemake-minimal >=7.8.0,<8.0 + - graphaligner >=1.0.19 - findutils >=4.6.0 - mashmap >=3.0.6 - winnowmap >=2.0 diff --git a/recipes/verkko/osx_availability.patch b/recipes/verkko/osx_availability.patch new file mode 100644 index 0000000000000..69344ea5b476f --- /dev/null +++ b/recipes/verkko/osx_availability.patch @@ -0,0 +1,52 @@ +diff --git a/src/MBG/makefile b/src/MBG/makefile +index 0c0113b..c6fd847 100644 +--- a/src/MBG/makefile ++++ b/src/MBG/makefile +@@ -1,7 +1,7 @@ + PLATFORM=$(shell uname -s) + + GPP=$(CXX) +-CPPFLAGS=-Wall -Wextra -std=c++17 -O3 -g -Izstr/src -Iparallel-hashmap/parallel_hashmap/ -Wno-unused-parameter -Icxxopts/include -Iconcurrentqueue `pkg-config --cflags zlib` ++CPPFLAGS=-Wall -Wextra -std=c++17 -O3 -g -Izstr/src -Iparallel-hashmap/parallel_hashmap/ -Wno-unused-parameter -Icxxopts/include -Iconcurrentqueue `pkg-config --cflags zlib` -D_LIBCPP_DISABLE_AVAILABILITY + + ODIR=obj + BINDIR=bin +diff --git a/src/hifioverlapper/MBG/makefile b/src/hifioverlapper/MBG/makefile +index 0c0113b..c6fd847 100644 +--- a/src/hifioverlapper/MBG/makefile ++++ b/src/hifioverlapper/MBG/makefile +@@ -1,7 +1,7 @@ + PLATFORM=$(shell uname -s) + + GPP=$(CXX) +-CPPFLAGS=-Wall -Wextra -std=c++17 -O3 -g -Izstr/src -Iparallel-hashmap/parallel_hashmap/ -Wno-unused-parameter -Icxxopts/include -Iconcurrentqueue `pkg-config --cflags zlib` ++CPPFLAGS=-Wall -Wextra -std=c++17 -O3 -g -Izstr/src -Iparallel-hashmap/parallel_hashmap/ -Wno-unused-parameter -Icxxopts/include -Iconcurrentqueue `pkg-config --cflags zlib` -D_LIBCPP_DISABLE_AVAILABILITY + + ODIR=obj + BINDIR=bin +diff --git a/src/hifioverlapper/makefile b/src/hifioverlapper/makefile +index 0bc9ee7..0f53de7 100644 +--- a/src/hifioverlapper/makefile ++++ b/src/hifioverlapper/makefile +@@ -1,5 +1,7 @@ ++PLATFORM=$(shell uname -s) ++ + GPP=$(CXX) +-CPPFLAGS=-Wall -Wextra -std=c++17 -O3 -g -Izstr/src -Iparallel-hashmap/parallel_hashmap/ -Icxxopts/include -Wno-unused-parameter `pkg-config --cflags zlib` -IMBG/src -Iconcurrentqueue ++CPPFLAGS=-Wall -Wextra -std=c++17 -O3 -g -Izstr/src -Iparallel-hashmap/parallel_hashmap/ -Icxxopts/include -Wno-unused-parameter `pkg-config --cflags zlib` -IMBG/src -Iconcurrentqueue -D_LIBCPP_DISABLE_AVAILABILITY + + ODIR=obj + BINDIR=bin +@@ -14,7 +16,11 @@ DEPS = $(patsubst %, $(SRCDIR)/%, $(_DEPS)) + _OBJ = MatchIndex.o MinimizerIterator.o TwobitString.o ReadStorage.o UnitigKmerCorrector.o UnitigStorage.o ReadMatchposStorage.o + OBJ = $(patsubst %, $(ODIR)/%, $(_OBJ)) + +-LINKFLAGS = $(CPPFLAGS) -Wl,-Bstatic $(LIBS) -Wl,-Bdynamic -Wl,--as-needed -lpthread -pthread -static-libstdc++ ++ifeq ($(PLATFORM),Linux) ++ LINKFLAGS = $(CPPFLAGS) -Wl,-Bstatic $(LIBS) -Wl,-Bdynamic -Wl,--as-needed -lpthread -pthread -static-libstdc++ ++else ++ LINKFLAGS = $(CPPFLAGS) $(LIBS) -lpthread -pthread -static-libstdc++ ++endif + + VERSION := Branch $(shell git rev-parse --abbrev-ref HEAD) commit $(shell git rev-parse HEAD) $(shell git show -s --format=%ci) + diff --git a/recipes/verkko/run_test.sh b/recipes/verkko/run_test.sh index 69595121dea11..05ab448c0a670 100644 --- a/recipes/verkko/run_test.sh +++ b/recipes/verkko/run_test.sh @@ -6,6 +6,8 @@ if [ ! -n "${PREFIX-}" -a "${PREFIX+defined}" != defined ]; then echo "Prefix undefined, setting it to be path to script" PREFIX=$(dirname "$0") PREFIX=$(dirname "$PREFIX") + + export PATH=$PREFIX/bin:$PATH fi # taken from yacrd recipe, see: https://github.com/bioconda/bioconda-recipes/blob/2b02c3db6400499d910bc5f297d23cb20c9db4f8/recipes/yacrd/build.sh @@ -18,20 +20,25 @@ if [ "$(uname)" == "Darwin" ]; then fi # download and run a small assembly, skip alignment of ONT on OSX to save time -rm -f ./hifi.fastq.gz ./ont.fastq.gz +rm -f ./subset.ids ./hifi.fastq.gz ./ont.fastq.gz curl -L https://obj.umiacs.umd.edu/sergek/shared/ecoli_hifi_subset24x.fastq.gz -o hifi.fastq.gz curl -L https://obj.umiacs.umd.edu/sergek/shared/ecoli_ont_subset50x.fastq.gz -o ont.fastq.gz +curl -L https://obj.umiacs.umd.edu/sergek/shared/ecoli_hifi_subset.ids -o subset.ids + +seqtk sample hifi.fastq.gz 0.5 |seqtk subseq - subset.ids > hifi_lowcov.fastq +seqtk sample ont.fastq.gz 0.10 > ont_lowcov.fastq +touch empty.fasta # now start tests -ONT="--nano ./ont.fastq.gz" -if [ "$(uname)" == "Darwin" ]; then - ONT="" -fi +ONT="--nano ./ont_lowcov.fastq" +#if [ "$(uname)" == "Darwin" ]; then +# ONT="" +#fi -verkko -d asm --no-correction --hifi ./hifi.fastq.gz $ONT +verkko -d asm --hifi ./hifi_lowcov.fastq $ONT > run.out 2>&1 if [ -s asm/assembly.fasta ]; then - python $PREFIX/lib/verkko/scripts/circularize_ctgs.py -p 10 -f 0.01 -o asm/assembly_circular.fasta --min-ovl 1000 asm/assembly.fasta + python $PREFIX/lib/verkko/scripts/circularize_ctgs.py -p 5 -f 0.01 -o asm/assembly_circular.fasta --min-ovl 1 asm/assembly.fasta fi if [ ! -s asm/assembly_circular.fasta ]; then @@ -46,9 +53,9 @@ if [ "$(uname)" == "Darwin" ]; then exit 0 fi -verkko -d asm --hifi hifi.fastq.gz $ONT --hic1 hifi.fastq.gz --hic2 hifi.fastq.gz +verkko -d asm --hifi hifi_lowcov.fastq $ONT --hic1 empty.fasta --hic2 empty.fasta > run.out 2>&1 -if [ ! -e asm/assembly.haplotype1.fasta ]; then +if [[ ! -s asm/assembly.unassigned.fasta || -s asm/assembly.haplotype1.fasta || -s asm/assembly.haplotype2.fasta ]]; then echo "Error: verkko hic assembly test failed!" tail -n +1 `find asm -name *.err` exit 1 @@ -56,9 +63,9 @@ fi #now test trio rm -rf asm/8-* asm/6-layoutContigs/ asm/7-consensus/ asm/assembly.* asm/6-rukki/ -$PREFIX/lib/verkko/bin/meryl count compress k=21 memory=4 threads=8 output empty1.meryl hifi.fastq.gz +$PREFIX/lib/verkko/bin/meryl count compress k=21 memory=4 threads=8 output empty1.meryl hifi_lowcov.fastq $PREFIX/lib/verkko/bin/meryl greater-than 100 empty1.meryl/ output empty2.meryl -verkko -d asm --hifi hifi.fastq.gz $ONT --hap-kmers empty1.meryl empty2.meryl trio +verkko -d asm --hifi hifi_lowcov.fastq $ONT --hap-kmers empty1.meryl empty2.meryl trio > run.out 2>&1 if [ ! -s asm/assembly.haplotype1.fasta ]; then echo "Error: verkko trio assembly test failed!" diff --git a/recipes/verkko/version.patch b/recipes/verkko/version.patch index 9566555502810..9a05bb37485c1 100644 --- a/recipes/verkko/version.patch +++ b/recipes/verkko/version.patch @@ -25,7 +25,7 @@ index 5f33ff4..25c2285 100644 # Perform post-processing on global variables as needed. DEFS := $(addprefix -D,${DEFS}) -INCDIRS := $(addprefix -I,$(call CANONICAL_PATH,${INCDIRS})) --VERSION := verkko release v1.4.1 +-VERSION := verkko release v2.0 +INCDIRS := $(addprefix -isystem,$(call CANONICAL_PATH,${INCDIRS})) +VERSION := bioconda $(PKG_NAME) bioconda $(PKG_VERSION) diff --git a/recipes/vg/meta.yaml b/recipes/vg/meta.yaml index 8549c995de117..bb45cdbd63658 100644 --- a/recipes/vg/meta.yaml +++ b/recipes/vg/meta.yaml @@ -1,5 +1,5 @@ {% set name = "vg" %} -{% set version = "1.53.0" %} +{% set version = "1.56.0" %} package: name: {{ name }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/vgteam/vg/releases/download/v{{ version }}/vg - sha256: a86dfc47c143af9f9a89c5e4595ed32b493384aac2b067f97d0684ec2d9a413b + sha256: 8b82e300a386d6bf34d0d1025a7dc806b2b95bb57bd063226fc3984e920710e4 build: number: 0 diff --git a/recipes/vgan/meta.yaml b/recipes/vgan/meta.yaml index 387e0125543cc..81d26a67d4c0d 100644 --- a/recipes/vgan/meta.yaml +++ b/recipes/vgan/meta.yaml @@ -1,5 +1,5 @@ {% set name = "vgan" %} -{% set version = "2.0.2" %} +{% set version = "3.0.0" %} package: name: {{ name }} @@ -7,11 +7,13 @@ package: source: url: https://github.com/grenaud/vgan/releases/download/v{{ version }}/vgan - sha256: 4340e61ff3c4ca8f8eca388604cc004d23d9399a4df860116f3cab342599d14e + sha256: 7a8fb93618fc0efe49f33e998a4f46fbd004c63c3326fa9c0e414940418c1c7b build: number: 0 skip: true # [osx] + run_exports: + - {{ pin_subpackage('vgan', max_pin="x") }} script: - mkdir -p ${PREFIX}/bin - cp vgan ${PREFIX}/bin/ @@ -19,6 +21,7 @@ build: - mkdir -p ${PREFIX}/share/vgan/ - mkdir -p ${PREFIX}/share/vgan/hcfiles/ - mkdir -p ${PREFIX}/share/vgan/euka_dir/ + - mkdir -p ${PREFIX}/share/vgan/soibean_dir/ - mkdir -p ${PREFIX}/share/vgan/damageProfiles/ - wget -nc -l1 --recursive --no-parent -P ${PREFIX}/share/vgan/ ftp://ftp.healthtech.dtu.dk:/public/haplocart/hcfiles/ - mv -fv ${PREFIX}/share/vgan/ftp.healthtech.dtu.dk/public/haplocart/hcfiles/* ${PREFIX}/share/vgan/hcfiles diff --git a/recipes/viennarna/meta.yaml b/recipes/viennarna/meta.yaml index 50fd571203462..e8213a5142c1e 100644 --- a/recipes/viennarna/meta.yaml +++ b/recipes/viennarna/meta.yaml @@ -6,7 +6,8 @@ package: version: {{ version }} build: - number: 0 + skip: True # [osx] + number: 1 run_exports: # Ronny said VRNA is stable in x.x releases - {{ pin_subpackage('viennarna', max_pin='x.x') }} @@ -45,3 +46,7 @@ about: license: custom license_file: COPYING summary: ViennaRNA package -- RNA secondary structure prediction and comparison + +extra: + additional-platforms: + - linux-aarch64 diff --git a/recipes/viguno/meta.yaml b/recipes/viguno/meta.yaml index aee151869b737..cfeec69d90f06 100644 --- a/recipes/viguno/meta.yaml +++ b/recipes/viguno/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.2.0" %} -{% set sha256 = "a4217f7ba34d55cda76b392e774be8392c18d550e752eb9db81e6cc3afa53010" %} +{% set version = "0.2.1" %} +{% set sha256 = "00da4730a4dd63b05eeb8e7ae0b58ba829e7145cc41f0f9194470376f367b937" %} package: name: viguno @@ -12,7 +12,7 @@ build: - {{ pin_subpackage("viguno", max_pin="x.x") }} source: - url: https://github.com/bihealth/viguno/archive/v{{ version }}.tar.gz + url: https://github.com/varfish-org/viguno/archive/v{{ version }}.tar.gz sha256: {{ sha256 }} requirements: @@ -38,6 +38,6 @@ test: - viguno -h about: - home: https://github.com/bihealth/viguno + home: https://github.com/bihealth/varfish-org license: MIT summary: Lookup OMIM genes and HPO terms and compute similarities diff --git a/recipes/viral_consensus/build.sh b/recipes/viral_consensus/build.sh index 94b3d4db60cbe..6637bb02284e0 100644 --- a/recipes/viral_consensus/build.sh +++ b/recipes/viral_consensus/build.sh @@ -1,4 +1,5 @@ #!/bin/bash -make CXX="$CXX" INCLUDE= RELEASEFLAGS="$CPPFLAGS $CXXFLAGS -O3 $LDFLAGS" + +make CXX="$CXX" INCLUDE="-I${PREFIX}/include -Ihtslib" RELEASEFLAGS="$CPPFLAGS $CXXFLAGS -O3 $LDFLAGS" mkdir -p $PREFIX/bin cp viral_consensus $PREFIX/bin/ diff --git a/recipes/viral_consensus/meta.yaml b/recipes/viral_consensus/meta.yaml index 48b6ef887fdee..873dff8a59be7 100644 --- a/recipes/viral_consensus/meta.yaml +++ b/recipes/viral_consensus/meta.yaml @@ -1,17 +1,17 @@ -{% set version = "0.0.4" %} +{% set version = "0.0.5" %} package: name: viral_consensus version: {{ version }} build: - number: 0 + number: 1 run_exports: - {{ pin_subpackage('viral_consensus', max_pin="x.x.x") }} source: url: https://github.com/niemasd/ViralConsensus/archive/refs/tags/{{ version }}.tar.gz - sha256: c1d81a69ff4435f65d1aaac0dc90e3065393a3d11a508629c3fd6aadb63166e7 + sha256: 798fa4d751b3b6b3cde9b6be1b2c55d469c71cd0d030b982980387e9a14011a9 requirements: build: @@ -20,14 +20,24 @@ requirements: - make host: - htslib - run: + - zlib about: - home: https://github.com/niemasd/ViralConsensus - license: GNU General Public License v3 (GPLv3) + home: https://niema.net/ViralConsensus/ + license: GPL-3.0-or-later + license_family: GPL3 license_file: LICENSE summary: Fast viral consensus genome reconstruction + dev_url: https://github.com/niemasd/ViralConsensus test: commands: - viral_consensus --version + +extra: + identifiers: + - biotools:viral_consensus + - doi:10.1093/bioinformatics/btad317 + - doi:10.1093/bioinformatics/btae018 + maintainers: + - niemasd diff --git a/recipes/viralmsa/meta.yaml b/recipes/viralmsa/meta.yaml index 78d60f0913045..acbbb36202cf5 100644 --- a/recipes/viralmsa/meta.yaml +++ b/recipes/viralmsa/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.1.41" %} +{% set version = "1.1.44" %} package: name: viralmsa @@ -6,13 +6,13 @@ package: build: noarch: python - number: 0 + number: 1 run_exports: - {{ pin_subpackage('viralmsa', max_pin="x.x.x") }} source: url: https://github.com/niemasd/ViralMSA/archive/refs/tags/{{ version }}.tar.gz - sha256: 1475eb3497823fd85febd5bb983c919b830b1e367aa7cf21af19fb33d437404b + sha256: a3f90307b86e6171beadc61bfc09309570d51d9b21085a6c74054b86a8991026 requirements: run: @@ -38,3 +38,10 @@ about: test: commands: - ViralMSA.py -h + +extra: + identifiers: + - biotools:viralmsa + - doi:10.1093/bioinformatics/btaa743 + maintainers: + - niemasd diff --git a/recipes/vireosnp/meta.yaml b/recipes/vireosnp/meta.yaml new file mode 100644 index 0000000000000..9e68523d7c8a4 --- /dev/null +++ b/recipes/vireosnp/meta.yaml @@ -0,0 +1,47 @@ +{% set name = "vireoSNP" %} +{% set version = "0.5.8" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/vireoSNP-{{ version }}.tar.gz + sha256: f83f00a2d398f08735fc3b5cd9326027dfe89094c746eb53a03c7f0393788c65 + +build: + entry_points: + - vireo = vireoSNP.vireo:main + - GTbarcode = vireoSNP.GTbarcode:main + noarch: python + script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation + number: 0 + run_exports: + - {{ pin_subpackage('vireosnp', max_pin="x.x.x") }} + +requirements: + host: + - python + - pip + run: + - python + - numpy >=1.9.0 + - scipy >=1.4.0 + - matplotlib-base + +test: + imports: + - vireoSNP + commands: + - pip check + - vireo --help + - GTbarcode --help + requires: + - pip + +about: + home: https://github.com/huangyh09/vireoSNP + summary: vireoSNP - donor deconvolution for multiplexed scRNA-seq data + license: Apache-2.0 + license_file: LICENSE + doc_url: https://vireosnp.readthedocs.io/en/latest/ diff --git a/recipes/viroconstrictor/meta.yaml b/recipes/viroconstrictor/meta.yaml index a1f44a2d6cd3d..d34ea1322c12f 100644 --- a/recipes/viroconstrictor/meta.yaml +++ b/recipes/viroconstrictor/meta.yaml @@ -1,5 +1,5 @@ {% set name = "ViroConstrictor" %} -{% set version = "1.4.0" %} +{% set version = "1.4.2" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/RIVM-bioinformatics/ViroConstrictor/archive/v{{ version }}.tar.gz - sha256: 56944f978fc5bb4f934d8a82be3862236552b9beab090f7e61c10023b51b8b25 + sha256: 7b7f8c0f129b9fa1ccc8c374c7436b6065f7dea87ee6e0423d75fd7f04d81d29 build: noarch: python @@ -17,7 +17,7 @@ build: - viroConstrictor = ViroConstrictor.__main__:main - Viroconstrictor = ViroConstrictor.__main__:main script: {{ PYTHON }} -m pip install . --no-deps -vvv - number: 1 + number: 0 run_exports: - {{ pin_subpackage('viroconstrictor', max_pin="x") }} diff --git a/recipes/virstrain/meta.yaml b/recipes/virstrain/meta.yaml index 6f527c19bffa1..62e80eec94e1d 100644 --- a/recipes/virstrain/meta.yaml +++ b/recipes/virstrain/meta.yaml @@ -1,5 +1,5 @@ {% set name = "virstrain" %} -{% set version = "1.14" %} +{% set version = "1.17" %} package: name: "{{ name|lower }}" @@ -7,10 +7,10 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: f9247a696892c75ded21e93ba60a2a4d6a63d3ecacd18b8d002fd8d7560227d5 + sha256: 76b71f73eb6fc92f61e495ee28ada438092bb70e33cf6f5d211c9a82922fd7a9 build: - number: 0 + number: 1 entry_points: - virstrain = VirStrain.VirStrain:main - virstrain_build = VirStrain.VirStrain_build:main @@ -31,6 +31,7 @@ requirements: - pandas ==1.0.1 - plotly ==3.10.0 - python ==3.7.3 + - bowtie2 test: imports: @@ -38,6 +39,8 @@ test: commands: - virstrain --help - virstrain_build --help + - virstrain_contig --help + - virstrain_merge --help about: home: https://github.com/liaoherui/VirStrain diff --git a/recipes/virulencefinder/meta.yaml b/recipes/virulencefinder/meta.yaml index 0393ba33a0f8d..e57a9257fee59 100644 --- a/recipes/virulencefinder/meta.yaml +++ b/recipes/virulencefinder/meta.yaml @@ -11,8 +11,10 @@ source: sha256: {{ sha256 }} build: - number: 0 + number: 1 noarch: generic + run_exports: + - {{ pin_subpackage('virulencefinder', max_pin="x") }} requirements: run: @@ -22,10 +24,12 @@ requirements: - tabulate - cgecore - blast + - git test: commands: - virulencefinder.py --help + - git --help about: home: https://bitbucket.org/genomicepidemiology/virulencefinder diff --git a/recipes/virusrecom/meta.yaml b/recipes/virusrecom/meta.yaml index bafd8ea722121..c6bd13b6864e9 100644 --- a/recipes/virusrecom/meta.yaml +++ b/recipes/virusrecom/meta.yaml @@ -1,5 +1,5 @@ {% set name = "virusrecom" %} -{% set version = "1.1.3" %} +{% set version = "1.1.5" %} package: name: "{{ name }}" @@ -7,10 +7,10 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: 1950537ea6f2cf83dcfc44dd31b5c524a8e5b6988ca284c1ed291a2234d692c7 + sha256: 88747b2590163526baa57115d649db6e0310ace792fab9e6b50275d71265f2ee build: - number: 1 + number: 0 noarch: python run_exports: - {{ pin_subpackage('virusrecom', max_pin="x") }} diff --git a/recipes/vsearch/meta.yaml b/recipes/vsearch/meta.yaml index fdfb483ba13ff..c1aa24bd39cde 100644 --- a/recipes/vsearch/meta.yaml +++ b/recipes/vsearch/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.26.1" %} -{% set sha256 = "dc8513376405fc01ca3742624177113752870b05bb682fe1bf62d190d0a696bd" %} +{% set version = "2.28.1" %} +{% set sha256 = "4f8bf0ad43fef77e573d152b59f55a1f81eb84c22d6545911757e6108f8de21c" %} package: name: vsearch @@ -43,6 +43,8 @@ about: summary: A versatile open source tool for metagenomics (USEARCH alternative) extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:vsearch - doi:10.7717/peerj.2584 diff --git a/recipes/vsnp3/meta.yaml b/recipes/vsnp3/meta.yaml index 9fe286418fdbe..2e02a9566043c 100644 --- a/recipes/vsnp3/meta.yaml +++ b/recipes/vsnp3/meta.yaml @@ -1,7 +1,7 @@ {% set user = "USDA-VS" %} {% set name = "vsnp3" %} -{% set version = "3.18" %} -{% set sha256 = "46c6d760d4e7ad6e437bbd1096cd9ae681a33c90c1be7c410439b0a1a0ba7769" %} +{% set version = "3.20" %} +{% set sha256 = "cb255d9e5381dcfe516bc92e35ecd3735b5447bfae74323392462579997c7a77" %} package: name: {{ name|lower }} diff --git a/recipes/vt/meta.yaml b/recipes/vt/meta.yaml index b2f9584f8b7f0..d4d1cefbc1bdc 100644 --- a/recipes/vt/meta.yaml +++ b/recipes/vt/meta.yaml @@ -10,7 +10,9 @@ source: sha256: 8f06d464ec5458539cfa30f81a034f47fe7f801146fe8ca80c14a3816b704e17 build: - number: 9 + number: 10 + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} requirements: build: @@ -38,3 +40,7 @@ about: home: https://genome.sph.umich.edu/wiki/Vt license: MIT summary: A tool set for manipulating and generating VCF files + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/weeder/meta.yaml b/recipes/weeder/meta.yaml index c41db324ee25e..5cbce18083ea8 100644 --- a/recipes/weeder/meta.yaml +++ b/recipes/weeder/meta.yaml @@ -7,8 +7,10 @@ source: md5: 3401675b24ca928b7cc54ce9ebf18b6a build: - number: 8 + number: 9 skip: True # [osx] + run_exports: + - {{ pin_subpackage('weeder', max_pin="x") }} requirements: build: @@ -26,6 +28,8 @@ about: summary: "Motif (transcription factor binding sites) discovery in sequences from coregulated genes of a single species. This is a new Weeder release rewritten to be faster and optimized for large ChIP-Seq data." extra: + additional-platforms: + - linux-aarch64 notes: "Includes a simple wrapper script to be able to run weeder from any directory. It passes arguments transparently to the weeder2 executable." identifiers: - biotools:weeder diff --git a/recipes/wfa2-lib/build.sh b/recipes/wfa2-lib/build.sh index 523f810bac3b2..1c1d621252dc4 100644 --- a/recipes/wfa2-lib/build.sh +++ b/recipes/wfa2-lib/build.sh @@ -5,13 +5,21 @@ export C_INCLUDE_PATH="${PREFIX}/include" export LIBRARY_PATH="${PREFIX}/lib" export LDFLAGS="${LDFLAGS} -L${PREFIX}/lib" +ARCH=$(uname -m) + +if [ "${ARCH}" == "aarch64" ]; then + export EXTRA_FLAGS="-ftree-vectorize" +else + export EXTRA_FLAGS="-ftree-vectorize -msse2 -mfpmath=sse" +fi + cmake -S . -B build \ -DCMAKE_CXX_COMPILER="${CXX}" \ -DCMAKE_C_COMPILER="${CC}" \ - -DCMAKE_CXX_FLAGS="-O3 -D_FILE_OFFSET_BITS=64 -I${PREFIX}/include ${LDFLAGS}" \ - -DEXTRA_FLAGS="-ftree-vectorize -msse2 -mfpmath=sse" \ + -DCMAKE_CXX_FLAGS="${CXXFLAGS} -O3 -D_FILE_OFFSET_BITS=64 -I${PREFIX}/include ${LDFLAGS}" \ + -DEXTRA_FLAGS="${EXTRA_FLAGS}" \ -DCMAKE_BUILD_TYPE=Release \ -DCMAKE_INSTALL_PREFIX="${PREFIX}" \ - -DBUILD_SHARED_LIBS=ON + -DOPENMP=TRUE -cmake --build build/ --target install -v +cmake --build build/ --target install -j ${CPU_COUNT} -v diff --git a/recipes/wfa2-lib/meta.yaml b/recipes/wfa2-lib/meta.yaml index d5ceb2b683486..dc5ce51a913f7 100644 --- a/recipes/wfa2-lib/meta.yaml +++ b/recipes/wfa2-lib/meta.yaml @@ -1,6 +1,6 @@ {% set name = "wfa2-lib" %} -{% set version = "2.3.4" %} -{% set sha256 = "3a02d19b45c7efcdcabdd956421b1e449e771fca0b0f072e02d7aa65ebb29f23" %} +{% set version = "2.3.5" %} +{% set sha256 = "2609d5f267f4dd91dce1776385b5a24a2f1aa625ac844ce0c3571c69178afe6e" %} package: name: {{ name|lower }} @@ -9,8 +9,6 @@ package: source: url: https://github.com/smarco/WFA2-lib/archive/refs/tags/v{{ version }}.tar.gz sha256: {{ sha256 }} - patches: - - patches/1-macOS_endian.patch # [osx] build: number: 0 @@ -25,6 +23,8 @@ requirements: host: - pkg-config - rhash # [osx] + - libgomp # [linux] + - llvm-openmp # [osx] test: commands: @@ -37,8 +37,12 @@ about: license_family: MIT license_file: LICENSE summary: "Wavefront alignment algorithm library v2" + dev_url: "https://github.com/smarco/WFA2-lib" + doc_url: "https://github.com/smarco/WFA2-lib/blob/main/README.md" extra: identifiers: - doi:10.1093/bioinformatics/btaa777 - doi:10.1101/2022.04.14.488380 + additional-platforms: + - linux-aarch64 diff --git a/recipes/wfa2-lib/patches/1-macOS_endian.patch b/recipes/wfa2-lib/patches/1-macOS_endian.patch deleted file mode 100644 index 5e6f8206b8b9b..0000000000000 --- a/recipes/wfa2-lib/patches/1-macOS_endian.patch +++ /dev/null @@ -1,16 +0,0 @@ -index 7600442..a1fab79 100644 ---- a/wavefront/wavefront_extend_kernels.c -+++ b/wavefront/wavefront_extend_kernels.c -@@ -29,7 +29,11 @@ - * DESCRIPTION: WFA module for the "extension" of exact matches - */ - --#include -+#ifdef __APPLE__ || defined(__FreeBSD__) -+ #include // __BYTE_ORDER -+ #else -+ #include // __BYTE_ORDER -+ #endif - - #include "wavefront_extend_kernels.h" - #include "wavefront_termination.h" diff --git a/recipes/wfmash/meta.yaml b/recipes/wfmash/meta.yaml index 6aa9d544dff40..29722f9ff046e 100644 --- a/recipes/wfmash/meta.yaml +++ b/recipes/wfmash/meta.yaml @@ -1,5 +1,5 @@ {% set name = "wfmash" %} -{% set version = "0.10.5" %} +{% set version = "0.13.0" %} package: name: "{{ name }}" @@ -7,7 +7,7 @@ package: source: url: https://github.com/waveygang/{{ name }}/releases/download/v{{ version }}/{{ name }}-v{{ version }}.tar.gz - sha256: 04c779f3e378c64543deefaa14ede67f16d1207d15e21128c9714012a0b55bcb + sha256: d358dfadef8efa32c923de9a7c35891f7178efc70c0de08234db58bc3ab8c82c build: skip: True # [osx] @@ -30,6 +30,7 @@ requirements: - libblas run: - llvm-openmp # [osx] + - python >=3.7 test: commands: diff --git a/recipes/wgatools/build.sh b/recipes/wgatools/build.sh new file mode 100644 index 0000000000000..2fd3e311f3e0a --- /dev/null +++ b/recipes/wgatools/build.sh @@ -0,0 +1,14 @@ +#!/bin/bash -euo + +# Add workaround for SSH-based Git connections from Rust/cargo. See https://github.com/rust-lang/cargo/issues/2078 for details. +# We set CARGO_HOME because we don't pass on HOME to conda-build, thus rendering the default "${HOME}/.cargo" defunct. +export CARGO_NET_GIT_FETCH_WITH_CLI=true CARGO_HOME="${BUILD_PREFIX}/.cargo" + +export LIBRARY_PATH="${PREFIX}/lib" +export INCLUDE_PATH="${PREFIX}/include" +export LDFLAGS="${LDFLAGS} -L${PREFIX}/lib" +export CXXFLAGS="${CXXFLAGS} -O3 -I${PREFIX}/include" + +# build statically linked binary with Rust +RUST_BACKTRACE=1 +cargo install --verbose --path . --root ${PREFIX} diff --git a/recipes/wgatools/meta.yaml b/recipes/wgatools/meta.yaml new file mode 100644 index 0000000000000..7b3eeaf7aaf9c --- /dev/null +++ b/recipes/wgatools/meta.yaml @@ -0,0 +1,43 @@ +{% set name = "wgatools" %} +{% set version = "0.1.0" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/wjwei-handsome/{{ name }}/archive/refs/tags/v{{ version }}.tar.gz + sha256: a03f0b6c843f8566aebaa9486292fbcb37d7e900c2f1c4691b0c9340b96fd892 + +build: + number: 0 + run_exports: + - {{ pin_subpackage(name, max_pin='x.x') }} + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('rust') }} + - make + - cmake + - pkg-config + host: + - openssl + run: + - perl + +test: + commands: + - wgatools --help + +about: + home: https://github.com/wjwei-handsome/{{ name }} + license: MIT + license_family: MIT + license_file: LICENSE + summary: "A Rust library and tools for whole genome alignment files" + dev_url: https://github.com/wjwei-handsome/{{ name }} + +extra: + recipe-maintainers: + - AndreaGuarracino diff --git a/recipes/wgd/meta.yaml b/recipes/wgd/meta.yaml index c67fb54a19082..9e7ab5e50ff1c 100644 --- a/recipes/wgd/meta.yaml +++ b/recipes/wgd/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.0.24" %} +{% set version = "2.0.34" %} package: name: "wgd" @@ -6,7 +6,7 @@ package: source: url: https://pypi.io/packages/source/w/wgd/wgd-{{ version }}.tar.gz - sha256: 60c986d848cacff15037567e02931c908d7644306e201ba48952810c1ff0545a + sha256: e0afe1ab8b1cd220519d1f562cb899f63d0bdce4ed7664589479a999f66f4d1a build: number: 0 diff --git a/recipes/whatshap/meta.yaml b/recipes/whatshap/meta.yaml index 7c3aeef9ad35c..1367cf81832b3 100644 --- a/recipes/whatshap/meta.yaml +++ b/recipes/whatshap/meta.yaml @@ -1,13 +1,13 @@ package: name: whatshap - version: "2.1" + version: "2.2" source: - url: https://files.pythonhosted.org/packages/35/1a/d6fedb787eac8d616ec598f6a42cf2289bcc11dbbfdeae65afdf1dcb7bfc/whatshap-2.1.tar.gz - sha256: 9b61812eda1dd5251ba8d02db16d7ddda152ccc813cb3db6a1ec796f1865fe8d + url: https://files.pythonhosted.org/packages/00/f3/2e2c850755629a151c2027b636f253745bbbfeee052870f03e99f94a4996/whatshap-2.2.tar.gz + sha256: 4cd34e9b82930c4f42e9e6b7dce2e321e4c81f934fdb980b6093ad91a06ae30a build: - number: 0 + number: 1 script: python -m pip install --no-deps --ignore-installed . run_exports: - {{ pin_subpackage('whatshap', max_pin="x") }} @@ -46,6 +46,8 @@ about: summary: 'phase genomic variants using DNA sequencing reads (haplotype assembly)' extra: + additional-platforms: + - linux-aarch64 identifiers: - biotools:whatshap - doi:10.1089/cmb.2014.0157 diff --git a/recipes/wisecondorx/meta.yaml b/recipes/wisecondorx/meta.yaml index bcfd7b6e9b74d..c32c17e5562fa 100644 --- a/recipes/wisecondorx/meta.yaml +++ b/recipes/wisecondorx/meta.yaml @@ -1,25 +1,26 @@ -{% set version="1.2.5" %} +{% set version="1.2.7" %} package: name: wisecondorx version: {{ version }} source: url: https://github.com/CenterForMedicalGeneticsGhent/wisecondorX/archive/v{{ version }}.tar.gz - sha256: be60c95630cd89977f445b68f11560360ef10d6c994ea3028c0d0295fc7452c9 + sha256: 4597377e664afd5b4d78f92061d854186bbaba92ba9951f034e9e7ce4c2d1c29 build: number: 0 noarch: python script: "{{ PYTHON }} -m pip install . --no-deps -vv" + run_exports: + - {{ pin_subpackage('wisecondorx', max_pin="x") }} requirements: host: - - python + - python >=3.6 - setuptools run: - - python + - python >=3.6 - pysam - - futures # [not py3k] - scipy - scikit-learn - numpy @@ -30,7 +31,7 @@ requirements: test: imports: - - wisecondorX + - wisecondorx commands: - WisecondorX --help - WisecondorX convert --help diff --git a/recipes/woltka/meta.yaml b/recipes/woltka/meta.yaml index 0eb7ddeaedf5b..f5fdbff852898 100644 --- a/recipes/woltka/meta.yaml +++ b/recipes/woltka/meta.yaml @@ -1,5 +1,5 @@ {% set name = "woltka" %} -{% set version = "0.1.5" %} +{% set version = "0.1.6" %} package: name: "{{ name|lower }}" @@ -7,14 +7,16 @@ package: source: url: "https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz" - sha256: e97f84ba5044aec8aae7f54dc42a4172c0972a3ca008e4cf7909d364496fa16d + sha256: d1ffe069515284f6350e3129b5fa3a65b4a583105282c5af0a3997c30b7f8e99 build: number: 0 noarch: python entry_points: - woltka=woltka.cli:cli - script: "{{ PYTHON }} -m pip install . -vv" + script: "{{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation" + run_exports: + - {{ pin_subpackage("woltka", max_pin="x.x") }} requirements: host: @@ -37,9 +39,9 @@ test: about: home: "https://github.com/qiyunzhu/woltka" - license: BSD + license: BSD-3-Clause license_family: BSD - license_file: + license_file: LICENSE summary: "versatile meta-omic data classifier" doc_url: dev_url: diff --git a/recipes/xxmotif/conda_build_config.yaml b/recipes/xxmotif/conda_build_config.yaml new file mode 100644 index 0000000000000..8caf245450f76 --- /dev/null +++ b/recipes/xxmotif/conda_build_config.yaml @@ -0,0 +1,5 @@ +c_compiler_version: + - 10 # [linux] + +cxx_compiler_version: + - 10 # [linux] diff --git a/recipes/xxmotif/fix-build.patch b/recipes/xxmotif/fix-build.patch new file mode 100644 index 0000000000000..def99e58bc24e --- /dev/null +++ b/recipes/xxmotif/fix-build.patch @@ -0,0 +1,32 @@ +diff --git CMakeLists.txt CMakeLists.txt +index 85c64b6..100a843 100644 +--- CMakeLists.txt ++++ CMakeLists.txt +@@ -9,7 +9,7 @@ set(XXMOTIF_PATCH_VERSION 6) + set(XXMOTIF_VERSION ${XXMOTIF_MAJOR_VERSION}.${XXMOTIF_MINOR_VERSION}.${XXMOTIF_PATCH_VERSION}) + + +-set(CMAKE_CXX_FLAGS "-std=c++11 -DLOG_MAX_LEVEL=0 -D__GXX_EXPERIMENTAL_CXX0X__ -O3 -g3 -pedantic -pedantic-errors -Wall -fmessage-length=0 -fno-strict-aliasing -Wconversion") ++set(CMAKE_CXX_FLAGS "-std=c99 -DLOG_MAX_LEVEL=0 -D__GXX_EXPERIMENTAL_CXX0X__ -O3 -g3 -pedantic -pedantic-errors -Wall -fmessage-length=0 -fno-strict-aliasing -Wconversion") + + set(CMAKE_C_FLAGS "-D__GXX_EXPERIMENTAL_CXX0X__ -O3 -pedantic -pedantic-errors -Wall -fmessage-length=0 -Wconversion") + +diff --git src/memoryPool/pool_alloc.h src/memoryPool/pool_alloc.h +index c1fe05b..925f31d 100644 +--- src/memoryPool/pool_alloc.h ++++ src/memoryPool/pool_alloc.h +@@ -90,4 +90,14 @@ private: + + template Pool Pool_alloc::mem(sizeof(T)); + ++template ++inline bool operator==(const Pool_alloc& a, const Pool_alloc& b){ ++ return &a == &b; ++} ++ ++template ++inline bool operator!=(const Pool_alloc& a, const Pool_alloc& b){ ++ return &a != &b; ++} ++ + #endif /* POOL_ALLOC_H */ diff --git a/recipes/xxmotif/meta.yaml b/recipes/xxmotif/meta.yaml index 8b48a8ae15c6d..d5711f3c9b718 100644 --- a/recipes/xxmotif/meta.yaml +++ b/recipes/xxmotif/meta.yaml @@ -7,10 +7,14 @@ package: source: url: https://github.com/soedinglab/xxmotif/archive/{{ version }}.tar.gz sha256: 235eb8ad562c4757a549751bb290f443ff70c29a142edbff0f03440f097b61cb + patches: + - fix-build.patch build: - number: 3 + number: 4 skip: True # [osx] + run_exports: + - {{ pin_subpackage('xxmotif', max_pin="x") }} requirements: build: @@ -29,3 +33,7 @@ about: test: commands: - test -f ${PREFIX}/bin/XXmotif + +extra: + additional-platforms: + - linux-aarch64 \ No newline at end of file diff --git a/recipes/yacht/meta.yaml b/recipes/yacht/meta.yaml index c7f12473b7254..660b5f47c822d 100644 --- a/recipes/yacht/meta.yaml +++ b/recipes/yacht/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.1.0" %} +{% set version = "1.2.2" %} package: name: yacht @@ -6,13 +6,13 @@ package: source: url: https://github.com/KoslickiLab/YACHT/releases/download/v{{ version }}/yacht-{{ version }}.tar.gz - sha256: 0655301d2ecb949fe75799b8ee67b4032e8a778a03f2edc3572b48066d0e4007 + sha256: a5c97eecac7aee24e5850f29537cfe5f0b3647ac2766b7876321d369e8bdf514 build: number: 0 noarch: python skip: True # [win or osx] - script: "{{ PYTHON }} -m pip install . --ignore-installed --no-cache-dir -vvv" + script: "{{ PYTHON }} -m pip install . --no-deps --no-build-isolation --no-cache-dir -vvv" run_exports: - {{ pin_subpackage('yacht', max_pin="x") }} @@ -20,7 +20,14 @@ requirements: host: - python >3.6 - pip - - setuptools + - pandas + - pytaxonkit + - scipy + - sourmash + - loguru + - tqdm + - biom-format + - numpy run: - python >3.6 - sourmash >=4.8.3,<5 @@ -46,6 +53,8 @@ about: home: https://github.com/KoslickiLab/YACHT summary: 'YACHT is a mathematically rigorous hypothesis test for the presence or absence of organisms in a metagenomic sample, based on average nucleotide identity (ANI).' license: MIT + license_family: MIT + license_file: LICENSE.txt dev_url: https://github.com/KoslickiLab/YACHT doc_url: https://github.com/KoslickiLab/YACHT/wiki diff --git a/recipes/zdb/meta.yaml b/recipes/zdb/meta.yaml index d410159bdd9f4..508c74054ba0c 100644 --- a/recipes/zdb/meta.yaml +++ b/recipes/zdb/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.2.1" %} +{% set version = "1.2.3" %} package: name: zdb @@ -6,13 +6,13 @@ package: build: noarch: generic - number: 1 + number: 0 run_exports: - {{ pin_subpackage('zdb', max_pin="x.x") }} source: - url: https://github.com/metagenlab/zDB/archive/refs/tags/v1.2.1.tar.gz - sha256: 621146aa73de7bf04dd05da4e226eb558d07eb1f79e04760456c84e00ae9be0c + url: https://github.com/metagenlab/zDB/archive/refs/tags/v1.2.3.tar.gz + sha256: b73a72cce424c1db28ccb0f1be20cbf61855260bb957e2829a6d9f991a20c029 requirements: run: diff --git a/recipes/zol/meta.yaml b/recipes/zol/meta.yaml index ce26b14a3821b..ec2a9f1b68aa6 100644 --- a/recipes/zol/meta.yaml +++ b/recipes/zol/meta.yaml @@ -1,5 +1,5 @@ {% set name = "zol" %} -{% set version = "1.3.17" %} +{% set version = "1.3.20" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://github.com/Kalan-Lab/zol/archive/refs/tags/v{{ version }}.tar.gz - sha256: 71205d5144d4489d863d63dd0e4eb5b4341e66b71bf4bc7fc186e9bed98fa17b + sha256: 0f2ac63b09bfad5f0cf701911e32284d3e031983100fb391b3311f67bb3c883d build: number: 0