-
-
Notifications
You must be signed in to change notification settings - Fork 73
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
PCR simulations are wrong. #279
Comments
Sequence should be |
@Koeng101 was this ever resolved? |
No. I fixed it in bioscript but not here. I'll port the fix when I get the chance. |
What's the status of this? @Koeng101 need help with it? |
Yes, this is actually pretty high priority as well, and I should have fixed it earlier (and haven't used this part of poly since I haven't fixed it yet) |
Will take a crack at this as a break from #297 /administrative stuff. |
Great! This is very important. |
Sneaky little bug...
|
Output:
Check here - https://pkg.go.dev/github.com/TimothyStiles/[email protected]/primers/pcr
TTATAGGTCTCATACTAATAATTACACCGAGATAACACATCATGG anneals to the beginning of the sequence, NOT TATATGGTCTCTTCATTTAAGAAAGCGCATTTTCCAGC. There is no reason why the beginning of the output sequence should be
TATA
@TimothyStiles This is a fairly critical bug we should figure out.
The text was updated successfully, but these errors were encountered: