nextflow_schema.json

{
    "$schema": "http://json-schema.org/draft-07/schema",
    "$id": "https://raw.githubusercontent.com/nf-core/smrnaseq/master/nextflow_schema.json",
    "title": "nf-core/smrnaseq pipeline parameters",
    "description": "Small RNA-Seq Best Practice Analysis Pipeline.",
    "type": "object",
    "definitions": {
        "input_output_options": {
            "title": "Input/output options",
            "type": "object",
            "fa_icon": "fas fa-terminal",
            "description": "Define where the pipeline should find input data and save output data.",
            "required": ["input", "outdir"],
            "properties": {
                "input": {
                    "type": "string",
                    "format": "file-path",
                    "exists": true,
                    "schema": "assets/schema_input.json",
                    "mimetype": "text/csv",
                    "pattern": "^\\S+\\.csv$",
                    "description": "Path to comma-separated file containing information about the samples in the experiment.",
                    "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See [usage docs](https://nf-co.re/smrnaseq/usage#samplesheet-input).",
                    "fa_icon": "fas fa-file-csv"
                },
                "protocol": {
                    "type": "string",
                    "default": "illumina",
                    "fa_icon": "fas fa-vial",
                    "description": "Protocol for constructing smRNA-seq libraries.",
                    "help_text": "Presets for trimming parameters and 3' adapter sequence with a specified protocol.\n\n| Protocol      | Library Prep Kit                        | Trimming Parameter                      | 3' Adapter Sequence     |\n| :------------ | :-------------------------------------- | :-------------------------------------- | :---------------------  |\n| illumina      | Illumina TruSeq Small RNA               | `clip_r1 = 0` `three_prime_clip_r1 = 0` | `TGGAATTCTCGGGTGCCAAGG` |\n| nextflex      | BIOO SCIENTIFIC  NEXTFLEX Small RNA-Seq | `clip_r1 = 4` `three_prime_clip_r1 = 4` | `TGGAATTCTCGGGTGCCAAGG` |\n| qiaseq        | QIAGEN QIAseq miRNA                     | `clip_r1 = 0` `three_prime_clip_r1 = 0` | `AACTGTAGGCACCATCAAT`   |\n| cats          | Diagenode CATS Small RNA-seq            | `clip_r1 = 3` `three_prime_clip_r1 = 0` | `AAAAAAAAAAA` + `GATCGGAAGAGCACACGTCTG` (only polyA is used for trimming) |\n| custom        | user defined                            | user defined                            | user defined            |\n\n> NB: When running `--protocol custom` the user ***must define the 3' Adapter Sequence***.\n> If trimming parameters aren't provided the pipeline will deafult to `clip_R1 = 0` and `three_prime_clip_R1 = 0` (i.e. no extra clipping).",
                    "enum": ["illumina", "nextflex", "qiaseq", "cats", "custom"]
                },
                "outdir": {
                    "type": "string",
                    "format": "directory-path",
                    "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.",
                    "fa_icon": "fas fa-folder-open"
                },
                "email": {
                    "type": "string",
                    "description": "Email address for completion summary.",
                    "fa_icon": "fas fa-envelope",
                    "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$"
                },
                "multiqc_title": {
                    "type": "string",
                    "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
                    "fa_icon": "fas fa-file-signature"
                }
            }
        },
        "umi_options": {
            "title": "UMI options",
            "type": "object",
            "description": "Options for processing reads with unique molecular identifiers",
            "default": "",
            "properties": {
                "with_umi": {
                    "type": "boolean",
                    "fa_icon": "fas fa-barcode",
                    "description": "Enable UMI-based read deduplication."
                },
                "umitools_extract_method": {
                    "type": "string",
                    "default": "string",
                    "fa_icon": "fas fa-barcode",
                    "description": "UMI pattern to use. Can be either 'string' (default) or 'regex'.",
                    "help_text": "More details can be found in the [UMI-tools documentation](https://umi-tools.readthedocs.io/en/latest/reference/extract.html#extract-method).\n"
                },
                "umitools_method": {
                    "type": "string",
                    "default": "dir",
                    "description": "UMI grouping method",
                    "fa_icon": "fas fa-layer-group",
                    "help_text": "Available options are dir, cc, adj"
                },
                "skip_umi_extract_before_dedup": {
                    "type": "boolean",
                    "fa_icon": "fas fa-compress-alt",
                    "description": "Skip the UMI extraction from the reads before deduplication. Please note, if this parameter is set to false, the reads will be deduplicated solely on insert sequence. UMIs might be extracted after deduplication depending on the set umitools_bc_pattern nevertheless if with_umi is set to True.",
                    "default": true
                },
                "umitools_bc_pattern": {
                    "type": "string",
                    "fa_icon": "fas fa-barcode",
                    "help_text": "More details can be found in the [UMI-tools documentation](https://umi-tools.readthedocs.io/en/latest/reference/extract.html#extract-method).",
                    "description": "The UMI barcode pattern to use e.g. 'NNNNNN' indicates that the first 6 nucleotides of the read are from the UMI."
                },
                "umi_discard_read": {
                    "type": "integer",
                    "fa_icon": "fas fa-barcode",
                    "description": "After UMI barcode extraction discard either R1 or R2 by setting this parameter to 1 or 2, respectively."
                },
                "save_umi_intermeds": {
                    "type": "boolean",
                    "fa_icon": "fas fa-save",
                    "description": "If this option is specified, intermediate FastQ and BAM files produced by UMI-tools are also saved in the results directory."
                }
            },
            "fa_icon": "fas fa-barcode"
        },
        "reference_genome_options": {
            "title": "Reference genome options",
            "type": "object",
            "fa_icon": "fas fa-dna",
            "description": "Reference genome related files and options required for the workflow.",
            "properties": {
                "genome": {
                    "type": "string",
                    "description": "Name of iGenomes reference.",
                    "fa_icon": "fas fa-book",
                    "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details."
                },
                "mirgenedb": {
                    "type": "boolean",
                    "description": "Boolean whether MirGeneDB should be used instead of miRBase",
                    "help_text": "This allows you to use MirGeneDB instead of miRBase as the database. \n Note that you will need to set the additional flags `--mirgenedb_species`, `--mirgenedb_gff`, `--mirgenedb_mature` and `--mirgenedb_hairpin`"
                },
                "mirtrace_species": {
                    "type": "string",
                    "description": "Species for miRTrace.",
                    "help_text": "This is automatically set when using `--genome`. Example values: `hsa`, `mmu`...\n Note that mirTrace relies on miRBase for its species reference. See available references [here](https://www.mirbase.org/help/genome_summary.shtml).",
                    "fa_icon": "fas fa-journal-whills"
                },
                "mirgenedb_species": {
                    "type": "string",
                    "description": "Species of MirGeneDB.",
                    "help_text": "This replaces the value of `--mirtrace_species` if `--mirgenedb` is used. \n Note the difference in case for species names used in MirGeneDB and miRBase. See https://www.mirgenedb.org/browse for more information."
                },
                "fasta": {
                    "type": "string",
                    "format": "file-path",
                    "exists": true,
                    "mimetype": "text/plain",
                    "pattern": "^\\S+\\.fn?a(sta)?(\\.gz)?$",
                    "description": "Path to FASTA genome file.",
                    "help_text": "This parameter is *mandatory* if `--genome` is not specified. If you don't have a BWA index available this will be generated for you automatically. Combine with `--save_reference` to save BWA index for future runs.",
                    "fa_icon": "far fa-file-code"
                },
                "mirna_gtf": {
                    "type": "string",
                    "description": "GFF/GTF file with coordinates positions of precursor and miRNAs.",
                    "help_text": "miRBase `.gff3` file, typically downloaded from [`https://mirbase.org/download/CURRENT/genomes/`](https://mirbase.org/download/CURRENT/genomes/)\n\nIf using iGenomes with `--genome` this file will be downloaded from miRBase automatically during the pipeline run.\n\n",
                    "fa_icon": "fas fa-address-book"
                },
                "mirgenedb_gff": {
                    "type": "string",
                    "description": "GFF/GTF file with coordinates positions of precursor and miRNAs.",
                    "help_text": "MirGeneDB `.gff3` file, typically downloaded from [`https://mirgenedb.org/download`]. This replaces the value of --mirna_gff if --mirgenedb is used."
                },
                "mature": {
                    "type": "string",
                    "description": "Path to FASTA file with mature miRNAs.",
                    "fa_icon": "fas fa-wheelchair",
                    "help_text": "Typically this will be the `mature.fa` file from miRBase. Can be given either as a plain text `.fa` file or a compressed `.gz` file.\n\nDefaults to the current miRBase release URL, from which the file will be downloaded.",
                    "default": "https://mirbase.org/download/mature.fa"
                },
                "mirgenedb_mature": {
                    "type": "string",
                    "description": "Path to FASTA file with MirGeneDB mature miRNAs.",
                    "help_text": "This file needs to be downloaded from [`https://mirgenedb.org/download`]. Can be given either as a plain text `.fa` file or a compressed `.gz` file."
                },
                "hairpin": {
                    "type": "string",
                    "description": "Path to FASTA file with miRNAs precursors.",
                    "fa_icon": "fab fa-cuttlefish",
                    "help_text": "Typically this will be the `mature.fa` file from miRBase. Can be given either as a plain text `.fa` file or a compressed `.gz` file.\n\nDefaults to the current miRBase release URL, from which the file will be downloaded.",
                    "default": "https://mirbase.org/download/hairpin.fa"
                },
                "mirgenedb_hairpin": {
                    "type": "string",
                    "description": "Path to FASTA file with miRNAs precursors.",
                    "help_text": "This file needs to be downloaded from [`https://mirgenedb.org/download`]. Can be given either as a plain text `.fa` file or a compressed `.gz` file.\nNote that MirGeneDB does not have a dedicated hairpin file. The equivalent is the `Precursor sequences`."
                },
                "bowtie_index": {
                    "type": "string",
                    "description": "Path to a Bowtie 1 index directory",
                    "fa_icon": "fas fa-book",
                    "help_text": "Point to the directory created by Bowtie 1 when indexing. Bowtie 1 indices consist of six files:\n\n```bash\ngenome.1.ebwt, genome.2.ebwt, genome.3.ebwt, genome.4.ebwt, genome.rev.1.ebwt, genome.rev.2.ebwt\n```\n"
                },
                "save_reference": {
                    "type": "boolean",
                    "description": "Save generated reference genome files to results.",
                    "help_text": "Saving generated references means that you can use them for future pipeline runs, reducing processing times.",
                    "fa_icon": "fas fa-save"
                },
                "save_aligned": {
                    "type": "boolean",
                    "fa_icon": "fas fa-save",
                    "help_text": "Save aligned reads of initial bowtie mapping.",
                    "description": "Save aligned reads of initial mapping in bam format."
                },
                "save_aligned_mirna_quant": {
                    "type": "boolean",
                    "fa_icon": "fas fa-save",
                    "default": true,
                    "help_text": "Save aligned reads of the bowtie runs in BOWTIE_MAP_MATURE, BOWTIE_MAP_HAIRPIN, and BOWTIE_MAP_SEQCLUSTER.",
                    "description": "Save aligned reads of miRNA quant subworkflow in bam format."
                },
                "igenomes_ignore": {
                    "type": "boolean",
                    "description": "Do not load the iGenomes reference config.",
                    "fa_icon": "fas fa-ban",
                    "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`.",
                    "hidden": true
                }
            }
        },
        "trimming_options": {
            "title": "Trimming options",
            "type": "object",
            "description": "Options for trimming reads and primers.",
            "fa_icon": "fas fa-cut",
            "properties": {
                "clip_r1": {
                    "type": "integer",
                    "fa_icon": "fas fa-cut",
                    "description": "The number of basepairs to remove from the 5' end of read 1."
                },
                "three_prime_clip_r1": {
                    "type": "integer",
                    "fa_icon": "fas fa-cut",
                    "description": "The number of basepairs to remove from the 3' end of read 1 AFTER adapter/quality trimming has been performed."
                },
                "three_prime_adapter": {
                    "type": "string",
                    "fa_icon": "fas fa-text-width",
                    "description": "Sequencing adapter sequence to use for trimming.",
                    "default": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"
                },
                "trim_fastq": {
                    "type": "boolean",
                    "default": true,
                    "fa_icon": "fas fa-hand-scissors",
                    "description": "Trim FastQ files"
                },
                "fastp_min_length": {
                    "type": "integer",
                    "default": 17,
                    "description": "Minimum filter length for raw reads.",
                    "fa_icon": "fas fa-ruler-horizontal"
                },
                "fastp_max_length": {
                    "type": "integer",
                    "default": 100,
                    "description": "Maximum filter length for raw reads.",
                    "fa_icon": "fas fa-ruler-horizontal"
                },
                "save_trimmed_fail": {
                    "type": "boolean",
                    "fa_icon": "fas fa-cloud-download-alt",
                    "description": "Save reads failing trimming"
                },
                "fastp_known_mirna_adapters": {
                    "type": "string",
                    "format": "file-path",
                    "exists": true,
                    "mimetype": "text/plain",
                    "default": "${projectDir}/assets/known_adapters.fa",
                    "description": "FastA with known miRNA adapter sequences for adapter trimming",
                    "fa_icon": "far fa-question-circle"
                },
                "min_trimmed_reads": {
                    "type": "integer",
                    "default": 10,
                    "fa_icon": "far fa-window-minimize",
                    "description": "Minimum number of reads required in input file to use it"
                },
                "save_merged": {
                    "type": "boolean",
                    "description": "Save merged reads.",
                    "default": true
                },
                "phred_offset": {
                    "type": "integer",
                    "default": 33,
                    "description": "The PHRED quality offset to be used for any input fastq files. Default is 33, standard Illumina 1.8+ format."
                }
            }
        },
        "contamination_filtering": {
            "title": "Contamination filter options",
            "type": "object",
            "description": "Options to remove contamination from the reads.",
            "fa_icon": "fas fa-cut",
            "properties": {
                "filter_contamination": {
                    "type": "boolean",
                    "description": "Enables the contamination filtering."
                },
                "rrna": {
                    "type": "string",
                    "format": "file-path",
                    "description": "Path to the rRNA fasta file to be used as contamination database."
                },
                "trna": {
                    "type": "string",
                    "format": "file-path",
                    "description": "Path to the tRNA fasta file to be used as contamination database."
                },
                "cdna": {
                    "type": "string",
                    "format": "file-path",
                    "description": "Path to the cDNA fasta file to be used as contamination database."
                },
                "ncrna": {
                    "type": "string",
                    "format": "file-path",
                    "description": "Path to the ncRNA fasta file to be used as contamination database."
                },
                "pirna": {
                    "type": "string",
                    "format": "file-path",
                    "description": "Path to the piRNA fasta file to be used as contamination database."
                },
                "other_contamination": {
                    "type": "string",
                    "format": "file-path",
                    "description": "Path to an additional fasta file to be used as contamination database."
                }
            }
        },
        "skipping_pipeline_steps": {
            "title": "Skipping pipeline steps",
            "type": "object",
            "description": "Switches to skip specific pipeline steps, if desired.",
            "fa_icon": "fas fa-fast-forward",
            "properties": {
                "skip_fastqc": {
                    "type": "boolean",
                    "fa_icon": "fas fa-fast-forward",
                    "description": "Skip FastQC"
                },
                "skip_mirdeep": {
                    "type": "boolean",
                    "fa_icon": "fas fa-fast-forward",
                    "description": "Skip miRDeep"
                },
                "skip_multiqc": {
                    "type": "boolean",
                    "fa_icon": "fas fa-fast-forward",
                    "description": "Skip MultiQC"
                },
                "skip_fastp": {
                    "type": "boolean",
                    "description": "Skip FastP",
                    "fa_icon": "fas fa-forward"
                }
            }
        },
        "institutional_config_options": {
            "title": "Institutional config options",
            "type": "object",
            "fa_icon": "fas fa-university",
            "description": "Parameters used to describe centralised config profiles. These should not be edited.",
            "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
            "properties": {
                "custom_config_version": {
                    "type": "string",
                    "description": "Git commit id for Institutional configs.",
                    "default": "master",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                },
                "custom_config_base": {
                    "type": "string",
                    "description": "Base directory for Institutional configs.",
                    "default": "https://raw.githubusercontent.com/nf-core/configs/master",
                    "hidden": true,
                    "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
                    "fa_icon": "fas fa-users-cog"
                },
                "config_profile_name": {
                    "type": "string",
                    "description": "Institutional config name.",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                },
                "config_profile_description": {
                    "type": "string",
                    "description": "Institutional config description.",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                },
                "config_profile_contact": {
                    "type": "string",
                    "description": "Institutional config contact information.",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                },
                "config_profile_url": {
                    "type": "string",
                    "description": "Institutional config URL link.",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                }
            }
        },
        "max_job_request_options": {
            "title": "Max job request options",
            "type": "object",
            "fa_icon": "fab fa-acquisitions-incorporated",
            "description": "Set the top limit for requested resources for any single job.",
            "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.",
            "properties": {
                "max_cpus": {
                    "type": "integer",
                    "description": "Maximum number of CPUs that can be requested for any single job.",
                    "default": 16,
                    "fa_icon": "fas fa-microchip",
                    "hidden": true,
                    "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`"
                },
                "max_memory": {
                    "type": "string",
                    "description": "Maximum amount of memory that can be requested for any single job.",
                    "default": "128.GB",
                    "fa_icon": "fas fa-memory",
                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
                    "hidden": true,
                    "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`"
                },
                "max_time": {
                    "type": "string",
                    "description": "Maximum amount of time that can be requested for any single job.",
                    "default": "240.h",
                    "fa_icon": "far fa-clock",
                    "pattern": "^(\\d+\\.?\\s*(s|m|h|d|day)\\s*)+$",
                    "hidden": true,
                    "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`"
                }
            }
        },
        "generic_options": {
            "title": "Generic options",
            "type": "object",
            "fa_icon": "fas fa-file-import",
            "description": "Less common options for the pipeline, typically set in a config file.",
            "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
            "properties": {
                "help": {
                    "type": "boolean",
                    "description": "Display help text.",
                    "fa_icon": "fas fa-question-circle",
                    "hidden": true
                },
                "version": {
                    "type": "boolean",
                    "description": "Display version and exit.",
                    "fa_icon": "fas fa-question-circle",
                    "hidden": true
                },
                "publish_dir_mode": {
                    "type": "string",
                    "default": "copy",
                    "description": "Method used to save pipeline results to output directory.",
                    "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
                    "fa_icon": "fas fa-copy",
                    "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"],
                    "hidden": true
                },
                "email_on_fail": {
                    "type": "string",
                    "description": "Email address for completion summary, only when pipeline fails.",
                    "fa_icon": "fas fa-exclamation-triangle",
                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$",
                    "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.",
                    "hidden": true
                },
                "plaintext_email": {
                    "type": "boolean",
                    "description": "Send plain-text email instead of HTML.",
                    "fa_icon": "fas fa-remove-format",
                    "hidden": true
                },
                "max_multiqc_email_size": {
                    "type": "string",
                    "description": "File size limit when attaching MultiQC reports to summary emails.",
                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
                    "default": "25.MB",
                    "fa_icon": "fas fa-file-upload",
                    "hidden": true
                },
                "monochrome_logs": {
                    "type": "boolean",
                    "description": "Do not use coloured log outputs.",
                    "fa_icon": "fas fa-palette",
                    "hidden": true
                },
                "hook_url": {
                    "type": "string",
                    "description": "Incoming hook URL for messaging service",
                    "fa_icon": "fas fa-people-group",
                    "help_text": "Incoming hook URL for messaging service. Currently, MS Teams and Slack are supported.",
                    "hidden": true
                },
                "multiqc_config": {
                    "type": "string",
                    "format": "file-path",
                    "description": "Custom config file to supply to MultiQC.",
                    "fa_icon": "fas fa-cog",
                    "hidden": true
                },
                "multiqc_logo": {
                    "type": "string",
                    "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file",
                    "fa_icon": "fas fa-image",
                    "hidden": true
                },
                "multiqc_methods_description": {
                    "type": "string",
                    "description": "Custom MultiQC yaml file containing HTML including a methods description.",
                    "fa_icon": "fas fa-cog"
                },
                "validate_params": {
                    "type": "boolean",
                    "description": "Boolean whether to validate parameters against the schema at runtime",
                    "default": true,
                    "fa_icon": "fas fa-check-square",
                    "hidden": true
                },
                "validationShowHiddenParams": {
                    "type": "boolean",
                    "fa_icon": "far fa-eye-slash",
                    "description": "Show all params when using `--help`",
                    "hidden": true,
                    "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters."
                },
                "validationFailUnrecognisedParams": {
                    "type": "boolean",
                    "fa_icon": "far fa-check-circle",
                    "description": "Validation of parameters fails when an unrecognised parameter is found.",
                    "hidden": true,
                    "help_text": "By default, when an unrecognised parameter is found, it returns a warinig."
                },
                "validationLenientMode": {
                    "type": "boolean",
                    "fa_icon": "far fa-check-circle",
                    "description": "Validation of parameters in lenient more.",
                    "hidden": true,
                    "help_text": "Allows string values that are parseable as numbers or booleans. For further information see [JSONSchema docs](https://github.com/everit-org/json-schema#lenient-mode)."
                }
            }
        }
    },
    "allOf": [
        {
            "$ref": "#/definitions/input_output_options"
        },
        {
            "$ref": "#/definitions/umi_options"
        },
        {
            "$ref": "#/definitions/reference_genome_options"
        },
        {
            "$ref": "#/definitions/trimming_options"
        },
        {
            "$ref": "#/definitions/contamination_filtering"
        },
        {
            "$ref": "#/definitions/skipping_pipeline_steps"
        },
        {
            "$ref": "#/definitions/institutional_config_options"
        },
        {
            "$ref": "#/definitions/max_job_request_options"
        },
        {
            "$ref": "#/definitions/generic_options"
        }
    ]
}