From 36f74be9681a0677630c120a933a4cd6db25ee9c Mon Sep 17 00:00:00 2001
From: Sergey Naumenko <naumenko-sa@users.noreply.github.com>
Date: Sun, 30 Jan 2022 21:57:03 -0500
Subject: [PATCH] Update README.md

---
 README.md | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/README.md b/README.md
index 5ffe522..12dd76d 100644
--- a/README.md
+++ b/README.md
@@ -37,4 +37,5 @@ CGCCTGAATCCATATAACACTCCAATATTTGCCATAAAAAAGAAGGACAGTACTAAGTGGAGAAAATTAGTAGATTTCAG
 ## Output
 
 - DRM.xlsx - 1st sheet - DRM stats, then one sheet per sample
-- freq.xlsx - individual and top allele frequencies
+- freq.xlsx - barcode stats, per sample all and top allele frequencies
+- `_hivdrm_tmp` - intermediate files from all the steps