IndexDefect when using searchIndex.search

[Benjamin-Lee]

Hi @andreaferretti! I'm trying to use this awesome library for some bioinformatics but am running into a strange error:

import cello

let x = "CGGGACTTACTTGTGGTTCCTGTGGTGCACTCCTGACCCTGCCGCTTTGAAAGAAAAAGAAATGAGGCGAAGAAGTCCTTCAGGGATCCCCGGGGAAACCTGGAGGAAGTCCGACGAGATCGCGGCTGGGGCTTAGGACCCCACTCCTGCGAGACAGGAGTAATCCTAAACAGGGTTTTCACCCTTCCTTTAGTTTCCTTCCTCTCCTGGAGAGGTCTTCTGCCCTAGCCCGGTCTTCGAAGCTTCCTTTGGCTACTACCCGGTGGAAACAACTGAAGCTTCAACGCCTTTTTTTCCAATCTTCTTTAGCACCGGGCTAGGGAGTAAGCCCGTGGAACCTTAGTTTTGTTCCCT"

# works
let index2 = searchIndex(x[0..x.high-1])
echo index2.search(x[0..1])


# breaks
let index1 = searchIndex(x)
echo index1.search(x[0..1])

This specific sequence is unable to be searched, although removing the last character does allow it to be search. Do you have any idea why that could be?

[Benjamin-Lee]

Ps here's the traceback:

BenjaminLee@mbp ~/r/playground [1]> nim r monomerize.nim                        (viroid-search) 
Hint: used config file '/usr/local/Cellar/nim/1.6.0/nim/config/nim.cfg' [Conf]
Hint: used config file '/usr/local/Cellar/nim/1.6.0/nim/config/config.nims' [Conf]
....................................................................................................
CC: monomerize.nim
Hint:  [Link]
Hint: gc: refc; opt: none (DEBUG BUILD, `-d:release` generates faster code)
58492 lines; 1.388s; 93.918MiB peakmem; proj: /Users/BenjaminLee/research/playground/monomerize.nim; out: /Users/BenjaminLee/.cache/nim/monomerize_d/monomerize_4651918B165140654B6F77303C1F7E8C0EB6DBDA [SuccessX]
Hint: /Users/BenjaminLee/.cache/nim/monomerize_d/monomerize_4651918B165140654B6F77303C1F7E8C0EB6DBDA  [Exec]
@[67, 237, 111, 149, 114, 284, 120, 42, 122, 0, 312, 90, 230, 260, 330]
/Users/BenjaminLee/research/playground/monomerize.nim(12) monomerize
/Users/BenjaminLee/.nimble/pkgs/cello-0.3.0/cello.nim(802) search
/Users/BenjaminLee/.nimble/pkgs/cello-0.3.0/cello.nim(795) search
/Users/BenjaminLee/.nimble/pkgs/cello-0.3.0/cello.nim(435) rank
/Users/BenjaminLee/.nimble/pkgs/cello-0.3.0/cello.nim(434) rank
/Users/BenjaminLee/.nimble/pkgs/cello-0.3.0/cello.nim(320) rank
/usr/local/Cellar/nim/1.6.0/nim/lib/system/fatal.nim(53) sysFatal
Error: unhandled exception: index 4 not in 0 .. 3 [IndexDefect]
Error: execution of an external program failed: '/Users/BenjaminLee/.cache/nim/monomerize_d/monomerize_4651918B165140654B6F77303C1F7E8C0EB6DBDA '

[andreaferretti]

Hi @Benjamin-Lee sorry it took a while to ackowledge your issue, I recently had a newborn :-)

I am going to see what's going on here, it's definitely strange!