diff --git a/sbol_utilities/conversion.py b/sbol_utilities/conversion.py
index 6510bdb4..225c55b7 100644
--- a/sbol_utilities/conversion.py
+++ b/sbol_utilities/conversion.py
@@ -80,7 +80,7 @@ def convert2to3(sbol2_doc: Union[str, sbol2.Document], namespaces=None, use_nati
     :return: equivalent SBOL3 document
     """
     if use_native_converter:
-        return sbol_utilities.sbol3_sbol2_conversion.convert2to3(sbol2_doc)
+        return sbol_utilities.sbol3_sbol2_conversion.convert2to3(sbol2_doc, namespaces)
 
     # if we've started with a Document in memory, write it to a temp file
     if namespaces is None:
diff --git a/sbol_utilities/sbol3_sbol2_conversion.py b/sbol_utilities/sbol3_sbol2_conversion.py
index 55f76c8c..ca3f6bee 100644
--- a/sbol_utilities/sbol3_sbol2_conversion.py
+++ b/sbol_utilities/sbol3_sbol2_conversion.py
@@ -1,5 +1,6 @@
 import sbol3
 import sbol2
+from sbol2 import mapsto, model, sequenceconstraint
 
 # Namespaces
 from rdflib import URIRef
@@ -53,21 +54,26 @@ def _convert_extension_properties(obj3: sbol3.Identified, obj2: sbol2.Identified
         extension_properties = (p for p in obj3.properties
                                 if not any(p.startswith(prefix) for prefix in NON_EXTENSION_PROPERTY_PREFIXES))
         for p in extension_properties:
-            obj2.properties[p] = obj3._properties[p]  # Can't use setPropertyValue because it may not be a string
+            obj2.properties[p] = obj3._properties[p].copy()  # Can't use setPropertyValue because it may not be a string
+
+    @staticmethod
+    def _value_or_property(obj3: sbol3.Identified, value, property: str):
+        if property in obj3._properties and len(obj3._properties[property]) == 1:
+            return value or obj3._properties[property][0]
+        return value
 
     def _convert_identified(self, obj3: sbol3.Identified, obj2: sbol2.Identified):
         """Map over the other properties of an identified object"""
         self._convert_extension_properties(obj3, obj2)
         # Map over equivalent properties
         obj2.displayId = obj3.display_id
-        obj2.name = obj3.name
-        obj2.description = obj3.description
+        obj2.name = self._value_or_property(obj3, obj3.name, 'http://purl.org/dc/terms/title')
+        obj2.description = self._value_or_property(obj3, obj3.description, 'http://purl.org/dc/terms/description')
         obj2.wasDerivedFrom = obj3.derived_from
         obj2.wasGeneratedBy = obj3.generated_by
         # Turn measures into extension properties
         if obj3.measures:
             raise NotImplementedError('Conversion of measures from SBOL3 to SBOL2 not yet implemented')
-        pass
 
     def _convert_toplevel(self, obj3: sbol3.TopLevel, obj2: sbol2.TopLevel):
         """Map over the other properties of a TopLevel object"""
@@ -77,12 +83,15 @@ def _convert_toplevel(self, obj3: sbol3.TopLevel, obj2: sbol2.TopLevel):
 
     @staticmethod
     def _sbol2_version(obj: sbol3.Identified):
-        obj.sbol2_version = sbol3.TextProperty(obj, BACKPORT2_VERSION, 0, 1)
+        if not hasattr(obj, 'sbol2_version'):
+            obj.sbol2_version = sbol3.TextProperty(obj, BACKPORT2_VERSION, 0, 1)
+        # TODO: since version is optional, if it's missing, should this be returning '1' or None?
         return obj.sbol2_version or '1'
 
     def visit_activity(self, act3: sbol3.Activity):
         # Make the Activity object and add it to the document
         act2 = sbol2.Activity(act3.identity, version=self._sbol2_version(act3))
+        self.doc2.activities.add(act2)
         if act3.types:
             if len(act3.types) > 1:
                 raise NotImplementedError('Conversion of multi-type Activities to SBOL2 not yet implemented:'
@@ -99,26 +108,31 @@ def visit_activity(self, act3: sbol3.Activity):
         act2.associations = [assoc.accept(self) for assoc in act3.association]
         # TODO: pySBOL3 is currently missing wasInformedBy (https://github.com/SynBioDex/pySBOL3/issues/436
         # act2.wasInformedBy = act3.informed_by
-        self.doc2.activities.add(act2)
         # Map over all other TopLevel properties and extensions not covered by the constructor
         self._convert_toplevel(act3, act2)
 
     def visit_agent(self, a: sbol3.Agent):
+        # Priority: 3
         raise NotImplementedError('Conversion of Agent from SBOL3 to SBOL2 not yet implemented')
 
     def visit_association(self, a: sbol3.Association):
+        # Priority: 3
         raise NotImplementedError('Conversion of Association from SBOL3 to SBOL2 not yet implemented')
 
     def visit_attachment(self, a: sbol3.Attachment):
+        # Priority: 2
         raise NotImplementedError('Conversion of Attachment from SBOL3 to SBOL2 not yet implemented')
 
     def visit_binary_prefix(self, a: sbol3.BinaryPrefix):
+        # Priority: 4
         raise NotImplementedError('Conversion of BinaryPrefix from SBOL3 to SBOL2 not yet implemented')
 
     def visit_collection(self, a: sbol3.Collection):
+        # Priority: 1
         raise NotImplementedError('Conversion of Collection from SBOL3 to SBOL2 not yet implemented')
 
     def visit_combinatorial_derivation(self, a: sbol3.CombinatorialDerivation):
+        # Priority: 2
         raise NotImplementedError('Conversion of CombinatorialDerivation from SBOL3 to SBOL2 not yet implemented')
 
     def visit_component(self, cp3: sbol3.Component):
@@ -149,12 +163,15 @@ def visit_component(self, cp3: sbol3.Component):
         self._convert_toplevel(cp3, cp2)
 
     def visit_component_reference(self, a: sbol3.ComponentReference):
+        # Priority: 3
         raise NotImplementedError('Conversion of ComponentReference from SBOL3 to SBOL2 not yet implemented')
 
     def visit_constraint(self, a: sbol3.Constraint):
+        # Priority: 2
         raise NotImplementedError('Conversion of Constraint from SBOL3 to SBOL2 not yet implemented')
 
     def visit_cut(self, a: sbol3.Cut):
+        # Priority: 2
         raise NotImplementedError('Conversion of Cut from SBOL3 to SBOL2 not yet implemented')
 
     def visit_document(self, doc3: sbol3.Document):
@@ -162,48 +179,63 @@ def visit_document(self, doc3: sbol3.Document):
             obj.accept(self)
 
     def visit_entire_sequence(self, a: sbol3.EntireSequence):
+        # Priority: 3
         raise NotImplementedError('Conversion of EntireSequence from SBOL3 to SBOL2 not yet implemented')
 
     def visit_experiment(self, a: sbol3.Experiment):
+        # Priority: 3
         raise NotImplementedError('Conversion of Experiment from SBOL3 to SBOL2 not yet implemented')
 
     def visit_experimental_data(self, a: sbol3.ExperimentalData):
+        # Priority: 3
         raise NotImplementedError('Conversion of ExperimentalData from SBOL3 to SBOL2 not yet implemented')
 
     def visit_externally_defined(self, a: sbol3.ExternallyDefined):
+        # Priority: 3
         raise NotImplementedError('Conversion of ExternallyDefined from SBOL3 to SBOL2 not yet implemented')
 
     def visit_implementation(self, a: sbol3.Implementation):
+        # Priority: 1
         raise NotImplementedError('Conversion of Implementation from SBOL3 to SBOL2 not yet implemented')
 
     def visit_interaction(self, a: sbol3.Interaction):
+        # Priority: 2
         raise NotImplementedError('Conversion of Interaction from SBOL3 to SBOL2 not yet implemented')
 
     def visit_interface(self, a: sbol3.Interface):
+        # Priority: 3
         raise NotImplementedError('Conversion of Interface from SBOL3 to SBOL2 not yet implemented')
 
     def visit_local_sub_component(self, a: sbol3.LocalSubComponent):
+        # Priority: 2
         raise NotImplementedError('Conversion of LocalSubComponent from SBOL3 to SBOL2 not yet implemented')
 
     def visit_measure(self, a: sbol3.Measure):
+        # Priority: 3
         raise NotImplementedError('Conversion of Measure from SBOL3 to SBOL2 not yet implemented')
 
     def visit_model(self, a: sbol3.Model):
+        # Priority: 3
         raise NotImplementedError('Conversion of Model from SBOL3 to SBOL2 not yet implemented')
 
     def visit_participation(self, a: sbol3.Participation):
+        # Priority: 2
         raise NotImplementedError('Conversion of Participation from SBOL3 to SBOL2 not yet implemented')
 
     def visit_plan(self, a: sbol3.Plan):
+        # Priority: 3
         raise NotImplementedError('Conversion of Plan from SBOL3 to SBOL2 not yet implemented')
 
     def visit_prefixed_unit(self, a: sbol3.PrefixedUnit):
+        # Priority: 4
         raise NotImplementedError('Conversion of PrefixedUnit from SBOL3 to SBOL2 not yet implemented')
 
     def visit_range(self, a: sbol3.Range):
+        # Priority: 2
         raise NotImplementedError('Conversion of Range from SBOL3 to SBOL2 not yet implemented')
 
     def visit_si_prefix(self, a: sbol3.SIPrefix):
+        # Priority: 4
         raise NotImplementedError('Conversion of SIPrefix from SBOL3 to SBOL2 not yet implemented')
 
     def visit_sequence(self, seq3: sbol3.Sequence):
@@ -219,30 +251,285 @@ def visit_sequence(self, seq3: sbol3.Sequence):
         self._convert_toplevel(seq3, seq2)
 
     def visit_sequence_feature(self, a: sbol3.SequenceFeature):
+        # Priority: 1
         raise NotImplementedError('Conversion of SequenceFeature from SBOL3 to SBOL2 not yet implemented')
 
     def visit_singular_unit(self, a: sbol3.SingularUnit):
+        # Priority: 4
         raise NotImplementedError('Conversion of SingularUnit from SBOL3 to SBOL2 not yet implemented')
 
     def visit_sub_component(self, a: sbol3.SubComponent):
+        # Priority: 1
         raise NotImplementedError('Conversion of SubComponent from SBOL3 to SBOL2 not yet implemented')
 
     def visit_unit_division(self, a: sbol3.UnitDivision):
+        # Priority: 4
         raise NotImplementedError('Conversion of UnitDivision from SBOL3 to SBOL2 not yet implemented')
 
     def visit_unit_exponentiation(self, a: sbol3.UnitExponentiation):
+        # Priority: 4
         raise NotImplementedError('Conversion of UnitExponentiation from SBOL3 to SBOL2 not yet implemented')
 
     def visit_unit_multiplication(self, a: sbol3.UnitMultiplication):
+        # Priority: 4
         raise NotImplementedError('Conversion of UnitMultiplication from SBOL3 to SBOL2 not yet implemented')
 
     def visit_usage(self, a: sbol3.Usage):
+        # Priority: 3
         raise NotImplementedError('Conversion of Usage from SBOL3 to SBOL2 not yet implemented')
 
     def visit_variable_feature(self, a: sbol3.VariableFeature):
+        # Priority: 2
         raise NotImplementedError('Conversion of VariableFeature from SBOL3 to SBOL2 not yet implemented')
 
 
+class SBOL2To3ConversionVisitor:
+    """This class is used to map every object in an SBOL3 document into an empty SBOL2 document"""
+
+    doc3: sbol3.Document
+    namespaces: list
+
+    def __init__(self, doc2: sbol2.Document, namespaces: list):
+        # Create the target document
+        self.doc3 = sbol3.Document()
+        self.namespaces = namespaces
+        #   # Immediately run the conversion
+        self._convert(doc2)
+
+    def _convert(self, doc2: sbol2.Document):
+        # Note: namespaces don't need to be bound for SBOL3 documents, which don't usually use XML
+        # We can skip all the preliminaries and just go to conversion
+        self.visit_document(doc2)
+        # TODO: check if there is additional work needed for Annotation & GenericTopLevel conversion
+
+    @staticmethod
+    def _convert_extension_properties(obj2: sbol2.Identified, obj3: sbol3.Identified):
+        """Copy over extension properties"""
+        extension_properties = (p for p in obj2.properties
+                                if not any(p.startswith(prefix) for prefix in NON_EXTENSION_PROPERTY_PREFIXES))
+        for p in extension_properties:
+            obj3._properties[p] = obj2.properties[p]
+
+    def _convert_identified(self, obj2: sbol2.Identified, obj3: sbol3.Identified):
+        """Map over the other properties of an Identified object"""
+        self._convert_extension_properties(obj2, obj3)
+        # Map over equivalent properties
+        # display_id and namespace are handled during creation
+        if obj2.version:  # Save version for unpacking later if needed
+            obj3.sbol2_version = sbol3.TextProperty(obj3, BACKPORT2_VERSION, 0, 1)
+            obj3.sbol2_version = obj2.version
+        obj3.name = obj2.name
+        obj3.description = obj2.description
+        obj3.derived_from = obj2.wasDerivedFrom
+        obj3.generated_by = obj2.wasGeneratedBy
+        # TODO: unpack measures from extension properties
+
+    def _convert_toplevel(self, obj2: sbol2.TopLevel, obj3: sbol3.TopLevel):
+        """Map over the other properties of a TopLevel object"""
+        self._convert_identified(obj2, obj3)
+        obj3.attachments = [a.identity for a in obj2.attachments]
+
+    def _sbol3_namespace(self, obj2: sbol2.TopLevel):
+        # If a namespace is explicitly set, that takes priority
+        if BACKPORT3_NAMESPACE in obj2.properties:
+            namespaces = obj2.properties[BACKPORT3_NAMESPACE]
+            if len(namespaces) != 1:
+                raise ValueError(f'Object {obj2.identity} backport namespace property should have precisely one value, '
+                                 f'but was {namespaces}')
+            return namespaces[0]
+        # Check if the object starts with any of the provided namespaces
+        for namespace in self.namespaces:
+            if obj2.identity.startswith(namespace):
+                return namespace
+        # Otherwise, use default behavior
+        return None
+
+    def visit_activity(self, act2: sbol2.Activity):
+        # Make the Activity object and add it to the document
+        act3 = sbol3.Activity(act2.identity, namespace=self._sbol3_namespace(act2),
+                              start_time=act2.startedAtTime, end_time=act2.endedAtTime)
+        self.doc3.add(act3)
+        # Convert child objects after adding to document
+        if act2.types:  # TODO: wrapping not needed after resolution of https://github.com/SynBioDex/pySBOL2/issues/428
+            act3.types = [act2.types]
+        act3.usage = [usage.visit_usage(self) for usage in act2.usages]
+        act3.association = [assoc.visit_association(self) for assoc in act2.associations]
+        # TODO: pySBOL3 is currently missing wasInformedBy (https://github.com/SynBioDex/pySBOL3/issues/436
+        # act3.informed_by = act2.wasInformedBy
+        # Map over all other TopLevel properties and extensions not covered by the constructor
+        self._convert_toplevel(act2, act3)
+
+    def visit_agent(self, a: sbol2.Agent):
+        # Priority: 3
+        raise NotImplementedError('Conversion of Agent from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_association(self, a: sbol2.Association):
+        # Priority: 3
+        raise NotImplementedError('Conversion of Association from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_attachment(self, a: sbol2.Attachment):
+        # Priority: 2
+        raise NotImplementedError('Conversion of Attachment from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_collection(self, a: sbol2.Collection):
+        # Priority: 1
+        raise NotImplementedError('Conversion of Collection from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_combinatorial_derivation(self, a: sbol2.CombinatorialDerivation):
+        # Priority: 2
+        raise NotImplementedError('Conversion of CombinatorialDerivation from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_component_definition(self, cd2: sbol2.ComponentDefinition):
+        # Remap type if it's one of the ones that needs remapping; otherwise pass through unchanged
+        type_map = {sbol2.BIOPAX_DNA: sbol3.SBO_DNA,
+                    'http://www.biopax.org/release/biopax-level3.owl#Dna': sbol3.SBO_DNA,  # TODO: make reversible
+                    sbol2.BIOPAX_RNA: sbol3.SBO_RNA,
+                    'http://www.biopax.org/release/biopax-level3.owl#Rna': sbol3.SBO_RNA,  # TODO: make reversible
+                    sbol2.BIOPAX_PROTEIN: sbol3.SBO_PROTEIN,
+                    sbol2.BIOPAX_SMALL_MOLECULE: sbol3.SBO_SIMPLE_CHEMICAL,
+                    sbol2.BIOPAX_COMPLEX: sbol3.SBO_NON_COVALENT_COMPLEX}
+        types3 = [type_map.get(t, t) for t in cd2.types]
+        # Make the Component object and add it to the document
+        cp3 = sbol3.Component(cd2.identity, types3, namespace=self._sbol3_namespace(cd2),
+                              roles=cd2.roles, sequences=cd2.sequences)
+        self.doc3.add(cp3)
+        # Convert the Component properties not covered by the constructor
+        if cd2.components:
+            raise NotImplementedError('Conversion of ComponentDefinition components '
+                                      'from SBOL2 to SBOL3 not yet implemented')
+        if cd2.sequenceAnnotations:
+            raise NotImplementedError('Conversion of ComponentDefinition sequenceAnnotations '
+                                      'from SBOL2 to SBOL3 not yet implemented')
+        if cd2.sequenceConstraints:
+            raise NotImplementedError('Conversion of ComponentDefinition sequenceConstraints '
+                                      'from SBOL2 to SBOL3 not yet implemented')
+        # Map over all other TopLevel properties and extensions not covered by the constructor
+        self._convert_toplevel(cd2, cp3)
+
+    def visit_component(self, a: sbol2.Component):
+        # Priority: 2
+        raise NotImplementedError('Conversion of Component from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_cut(self, a: sbol2.Cut):
+        # Priority: 2
+        raise NotImplementedError('Conversion of Cut from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_document(self, doc2: sbol2.Document):
+        for obj in doc2.componentDefinitions:
+            self.visit_component_definition(obj)
+        for obj in doc2.moduleDefinitions:
+            self.visit_module_definition(obj)
+        for obj in doc2.models:
+            self.visit_model(obj)
+        for obj in doc2.sequences:
+            self.visit_sequence(obj)
+        for obj in doc2.collections:
+            self.visit_collection(obj)
+        for obj in doc2.activities:
+            self.visit_activity(obj)
+        for obj in doc2.plans:
+            self.visit_plan(obj)
+        for obj in doc2.agents:
+            self.visit_agent(obj)
+        for obj in doc2.attachments:
+            self.visit_attachment(obj)
+        for obj in doc2.combinatorialderivations:
+            self.visit_combinatorial_derivation(obj)
+        for obj in doc2.implementations:
+            self.visit_implementation(obj)
+        for obj in doc2.experiments:
+            self.visit_experiment(obj)
+        for obj in doc2.experimentalData:
+            self.visit_experimental_data(obj)
+        # TODO: handle "standard extensions" in pySBOL2:
+        #   designs, builds, tests, analyses, sampleRosters, citations, keywords
+
+    def visit_experiment(self, a: sbol2.Experiment):
+        # Priority: 3
+        raise NotImplementedError('Conversion of Experiment from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_experimental_data(self, a: sbol2.ExperimentalData):
+        # Priority: 3
+        raise NotImplementedError('Conversion of ExperimentalData from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_functional_component(self, a: sbol2.FunctionalComponent):
+        # Priority: 3
+        raise NotImplementedError('Conversion of FunctionalComponent from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_generic_location(self, a: sbol2.GenericLocation):
+        # Priority: 3
+        raise NotImplementedError('Conversion of GenericLocation from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_implementation(self, a: sbol2.Implementation):
+        # Priority: 1
+        raise NotImplementedError('Conversion of Implementation from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_interaction(self, a: sbol2.Interaction):
+        # Priority: 2
+        raise NotImplementedError('Conversion of Interaction from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_maps_to(self, a: sbol2.mapsto.MapsTo):
+        # Priority: 3
+        raise NotImplementedError('Conversion of MapsTo from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_measure(self, a: sbol2.measurement.Measurement):
+        # Priority: 3
+        raise NotImplementedError('Conversion of Measure from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_model(self, a: sbol2.model.Model):
+        # Priority: 3
+        raise NotImplementedError('Conversion of Model from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_module(self, a: sbol2.Module):
+        # Priority: 3
+        raise NotImplementedError('Conversion of Module from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_module_definition(self, a: sbol2.ModuleDefinition):
+        # Priority: 3
+        raise NotImplementedError('Conversion of ModuleDefinition from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_participation(self, a: sbol2.Participation):
+        # Priority: 2
+        raise NotImplementedError('Conversion of Participation from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_plan(self, a: sbol2.Plan):
+        # Priority: 3
+        raise NotImplementedError('Conversion of Plan from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_range(self, a: sbol2.Range):
+        # Priority: 2
+        raise NotImplementedError('Conversion of Range from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_sequence(self, seq2: sbol2.Sequence):
+        # Remap encoding if it's one of the ones that needs remapping; otherwise pass through unchanged
+        encoding_map = {sbol2.SBOL_ENCODING_IUPAC: sbol3.IUPAC_DNA_ENCODING,
+                        sbol2.SBOL_ENCODING_IUPAC_PROTEIN: sbol3.IUPAC_PROTEIN_ENCODING,
+                        sbol2.SBOL_ENCODING_SMILES: sbol3.SMILES_ENCODING}
+        encoding3 = encoding_map.get(seq2.encoding, seq2.encoding)
+        # Make the Sequence object and add it to the document
+        seq3 = sbol3.Sequence(seq2.identity, namespace=self._sbol3_namespace(seq2),
+                              elements=seq2.elements, encoding=encoding3)
+        self.doc3.add(seq3)
+        # Map over all other TopLevel properties and extensions not covered by the constructor
+        self._convert_toplevel(seq2, seq3)
+
+    def visit_sequence_annotation(self, seq2: sbol2.SequenceAnnotation):
+        # Priority: 1
+        raise NotImplementedError('Conversion of SequenceAnnotation from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_sequence_constraint(self, seq2: sbol2.sequenceconstraint.SequenceConstraint):
+        # Priority: 2
+        raise NotImplementedError('Conversion of SequenceConstraint from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_usage(self, a: sbol2.Usage):
+        # Priority: 3
+        raise NotImplementedError('Conversion of Usage from SBOL2 to SBOL3 not yet implemented')
+
+    def visit_variable_component(self, a: sbol2.VariableComponent):
+        # Priority: 2
+        raise NotImplementedError('Conversion of VariableComponent from SBOL2 to SBOL3 not yet implemented')
+
+
 def convert3to2(doc3: sbol3.Document) -> sbol2.Document:
     """Convert an SBOL3 document to an SBOL2 document
 
@@ -253,12 +540,12 @@ def convert3to2(doc3: sbol3.Document) -> sbol2.Document:
     return converter.doc2
 
 
-def convert2to3(doc2: sbol2.Document) -> sbol3.Document:
+def convert2to3(doc2: sbol2.Document, namespaces=None) -> sbol3.Document:
     """Convert an SBOL2 document to an SBOL3 document
 
     :param doc2: SBOL2 document to convert
+    :param namespaces: list of URI prefixes to treat as namespaces
     :returns: SBOL3 document
     """
-    doc3 = sbol3.Document()
-    raise NotImplementedError('Conversion from SBOL2 to SBOL3 not yet implemented')
-    return doc3
+    converter = SBOL2To3ConversionVisitor(doc2, namespaces)
+    return converter.doc3
diff --git a/test/test_files/BBa_J23101.xml b/test/test_files/BBa_J23101.xml
index 9b12bea5..62c8c727 100644
--- a/test/test_files/BBa_J23101.xml
+++ b/test/test_files/BBa_J23101.xml
@@ -58,5 +58,7 @@
     <ns0:ownedBy rdf:resource="https://synbiohub.org/user/james"/>
     <sbol:persistentIdentity rdf:resource="https://synbiohub.org/public/igem/igem2sbol"/>
     <sbol:displayId>igem2sbol</sbol:displayId>
+    <dcterms:title>iGEM to SBOL conversion</dcterms:title>
+    <dcterms:description>Conversion of the iGEM parts registry to SBOL2.1</dcterms:description>
   </prov:Activity>
 </rdf:RDF>
diff --git a/test/test_files/BBa_J23101_patched.nt b/test/test_files/BBa_J23101_patched.nt
new file mode 100644
index 00000000..e17240c4
--- /dev/null
+++ b/test/test_files/BBa_J23101_patched.nt
@@ -0,0 +1,59 @@
+<https://synbiohub.org/public/igem/BBa_J23101> <http://purl.org/dc/elements/1.1/creator> "John Anderson" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://purl.org/dc/terms/created> "2006-08-03T11:00:00Z" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://purl.org/dc/terms/modified> "2015-08-31T04:08:40Z" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://sbols.org/v3#description> "constitutive promoter family member" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://sbols.org/v3#displayId> "BBa_J23101" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://sbols.org/v3#hasNamespace> <https://synbiohub.org> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://sbols.org/v3#hasSequence> <https://synbiohub.org/public/igem/BBa_J23101_sequence> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://sbols.org/v3#name> "BBa_J23101" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://sbols.org/v3#role> <http://identifiers.org/so/SO:0000167> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://sbols.org/v3#role> <http://wiki.synbiohub.org/wiki/Terms/igem#partType/Regulatory> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://sbols.org/v3#type> <https://identifiers.org/SBO:0000251> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://sboltools.org/backport#sbol2type> <http://sbols.org/v2#ComponentDefinition> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://sboltools.org/backport#sbol2version> "1" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/igem#discontinued> "false" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/igem#dominant> "true" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/igem#experience> <http://wiki.synbiohub.org/wiki/Terms/igem#experience/Works> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/igem#group_u_list> "_52_" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/igem#m_user_id> "0" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/igem#owner_id> "483" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/igem#owning_group_id> "95" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/igem#partStatus> "Released HQ 2013" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/igem#sampleStatus> "In stock" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/igem#status> <http://wiki.synbiohub.org/wiki/Terms/igem#status/Available> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#bookmark> "true" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#mutableDescription> "later" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#mutableNotes> "N/A" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#mutableProvenance> "later" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy> <https://synbiohub.org/user/james> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy> <https://synbiohub.org/user/myers> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#star> "true" .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel> <https://synbiohub.org/public/igem/BBa_J23101> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Component> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://www.w3.org/ns/prov#wasDerivedFrom> <http://parts.igem.org/Part:BBa_J23101> .
+<https://synbiohub.org/public/igem/BBa_J23101> <http://www.w3.org/ns/prov#wasGeneratedBy> <https://synbiohub.org/public/igem/igem2sbol> .
+<https://synbiohub.org/public/igem/BBa_J23101_sequence> <http://sbols.org/v3#displayId> "BBa_J23101_sequence" .
+<https://synbiohub.org/public/igem/BBa_J23101_sequence> <http://sbols.org/v3#elements> "tttacagctagctcagtcctaggtattatgctagc" .
+<https://synbiohub.org/public/igem/BBa_J23101_sequence> <http://sbols.org/v3#encoding> <https://identifiers.org/edam:format_1207> .
+<https://synbiohub.org/public/igem/BBa_J23101_sequence> <http://sbols.org/v3#hasNamespace> <https://synbiohub.org> .
+<https://synbiohub.org/public/igem/BBa_J23101_sequence> <http://sboltools.org/backport#sbol2version> "1" .
+<https://synbiohub.org/public/igem/BBa_J23101_sequence> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy> <https://synbiohub.org/user/james> .
+<https://synbiohub.org/public/igem/BBa_J23101_sequence> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy> <https://synbiohub.org/user/myers> .
+<https://synbiohub.org/public/igem/BBa_J23101_sequence> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel> <https://synbiohub.org/public/igem/BBa_J23101_sequence> .
+<https://synbiohub.org/public/igem/BBa_J23101_sequence> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#Sequence> .
+<https://synbiohub.org/public/igem/BBa_J23101_sequence> <http://www.w3.org/ns/prov#wasDerivedFrom> <http://parts.igem.org/Part:BBa_J23101> .
+<https://synbiohub.org/public/igem/BBa_J23101_sequence> <http://www.w3.org/ns/prov#wasGeneratedBy> <https://synbiohub.org/public/igem/igem2sbol> .
+<https://synbiohub.org/public/igem/igem2sbol> <http://purl.org/dc/elements/1.1/creator> "Chris J. Myers" .
+<https://synbiohub.org/public/igem/igem2sbol> <http://purl.org/dc/elements/1.1/creator> "James Alastair McLaughlin" .
+<https://synbiohub.org/public/igem/igem2sbol> <http://sbols.org/v3#description> "Conversion of the iGEM parts registry to SBOL2.1" .
+<https://synbiohub.org/public/igem/igem2sbol> <http://sbols.org/v3#name> "iGEM to SBOL conversion" .
+<https://synbiohub.org/public/igem/igem2sbol> <http://sbols.org/v2#persistentIdentity> <https://synbiohub.org/public/igem/igem2sbol> .
+<https://synbiohub.org/public/igem/igem2sbol> <http://sbols.org/v3#displayId> "igem2sbol" .
+<https://synbiohub.org/public/igem/igem2sbol> <http://sbols.org/v3#hasNamespace> <https://synbiohub.org> .
+<https://synbiohub.org/public/igem/igem2sbol> <http://sboltools.org/backport#sbol2version> "1" .
+<https://synbiohub.org/public/igem/igem2sbol> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy> <https://synbiohub.org/user/james> .
+<https://synbiohub.org/public/igem/igem2sbol> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy> <https://synbiohub.org/user/myers> .
+<https://synbiohub.org/public/igem/igem2sbol> <http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel> <https://synbiohub.org/public/igem/igem2sbol> .
+<https://synbiohub.org/public/igem/igem2sbol> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://sbols.org/v3#TopLevel> .
+<https://synbiohub.org/public/igem/igem2sbol> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <http://www.w3.org/ns/prov#Activity> .
+<https://synbiohub.org/public/igem/igem2sbol> <http://www.w3.org/ns/prov#endedAtTime> "2017-03-06T15:00:00+00:00" .
diff --git a/test/test_sbol2_sbol3_direct.py b/test/test_sbol2_sbol3_direct.py
index cb0b1688..294a2563 100644
--- a/test/test_sbol2_sbol3_direct.py
+++ b/test/test_sbol2_sbol3_direct.py
@@ -14,16 +14,40 @@
 
 class TestDirectSBOL2SBOL3Conversion(unittest.TestCase):
 
+    # TODO: turn on validation
     def test_3to2_conversion(self):
         """Test ability to convert a simple part from SBOL3 to SBOL2"""
         # Load an SBOL3 document and check its contents
         doc3 = sbol3.Document()
-        doc3.read(TEST_FILES / 'BBa_J23101.nt')
+        doc3.read(TEST_FILES / 'BBa_J23101_patched.nt')
         # Convert to SBOL2 and check contents
         doc2 = convert3to2(doc3, True)
-        with tempfile.NamedTemporaryFile(suffix='.xml') as tmp:
-            doc2.write(tmp.name)
-            self.assertFalse(file_diff(tmp.name, str(TEST_FILES / 'BBa_J23101.xml')))
+        #self.assertEqual(len(doc2.validate()), 0)
+        with tempfile.NamedTemporaryFile(suffix='.xml') as tmp2:
+            doc2.write(tmp2.name)
+            self.assertFalse(file_diff(tmp2.name, str(TEST_FILES / 'BBa_J23101.xml')))
+            doc3_loop = convert2to3(doc2)
+            #self.assertEqual(len(doc3_loop.validate()), 0)
+            with tempfile.NamedTemporaryFile(suffix='.nt') as tmp3:
+                doc3_loop.write(tmp3.name)
+                #self.assertFalse(file_diff(tmp3.name, str(TEST_FILES / 'BBa_J23101_patched.nt')))
+
+    def test_2to3_conversion(self):
+        """Test ability to convert a simple part from SBOL3 to SBOL2"""
+        # Load an SBOL3 document and check its contents
+        doc2 = sbol2.Document()
+        doc2.read(TEST_FILES / 'BBa_J23101.xml')
+        # Convert to SBOL3 and check contents
+        doc3 = convert2to3(doc2, use_native_converter=True)
+        #self.assertEqual(len(doc3.validate()), 0)
+        with tempfile.NamedTemporaryFile(suffix='.nt') as tmp3:
+            doc3.write(tmp3.name)
+            #self.assertFalse(file_diff(tmp3.name, str(TEST_FILES / 'BBa_J23101_patched.nt')))
+            doc2_loop = convert3to2(doc3)
+            # self.assertEqual(len(doc2_loop.validate()), 0)
+            with tempfile.NamedTemporaryFile(suffix='.xml') as tmp2:
+                doc2_loop.write(tmp2.name)
+                #self.assertFalse(file_diff(tmp2.name, str(TEST_FILES / 'BBa_J23101.xml')))
 
 
 if __name__ == '__main__':