diff --git a/README.md b/README.md
index 7d4323e..918233e 100644
--- a/README.md
+++ b/README.md
@@ -29,12 +29,13 @@ not via mail to developers.
 ## Background
 *Lima* can demultiplex samples that have a unique per-sample barcode pair and
 have been pooled and sequenced on the same SMRT cell.
-There are three different methods to associate barcodes with a sample,
+There are four different methods to associate barcodes with a sample,
 by PCR or ligation:
 
 1. Sequence-specific primers
 2. Barcoded universal primers
 3. Barcoded adapters
+4. Probe-based linear barcoded adapters
 
 <img src="img/barcoding-schemes.png" width="886px">
 
@@ -83,6 +84,11 @@ The sort order is defined by the barcode indices, lowest first.
 
 ## Changelog
 
+ * 1.5.0: Support spacer sequence between adapter and barcode
+ * 1.4.0:
+   * Minimum reference span requirements
+   * Single-side library improvements
+ * 1.3.0: --peek-guess uses only full-length ZMWs
  * 1.2.0:
    * Streaming of split BAM files
    * New fat binary build approach
@@ -861,6 +867,28 @@ Even if you only want to remove IsoSeq primers, *lima* is the tool of choice.
     demux.Forward_P5--SampleLiver_P3.bam
 ```
 
+### What is a universal spacer sequence and how does it affect demultiplexing?
+For library designs that include an identical sequence between adapter
+and barcode, e.g. probe-based linear barcoded adapters samples,
+*lima* offers a special mode that is activated if it finds a shared prefix
+sequence among all provided barcode sequences. Example:
+
+```
+    >custombc1
+    ACATGACTGTGACTATCTCACACATATCAGAGTGCG
+    >custombc2
+    ACATGACTGTGACTATCTCAACACACAGACTGTGAG
+```
+
+In this case, *lima* detects the shared prefix `ACATGACTGTGACTATCTCA` and
+removes it internally from all barcodes. Subsequently, it increases the
+window size by the length `L` of the prefix sequence.
+If `--window-size-bp N` is used, the actual window size is `L + N`.
+If `--window-size-mult M` is used, the actual window size is `(L + |bc|) * M`.
+
+Because the alignment is semi-global, a leading reference gap can be added
+without any penalty to the barcode score.
+
 ### Why do most of my ZMWs get filtered by the score lead threshold?
 The score lead measures how close the best barcode call is to the second best.
 Possible solutions without seeing your data:
diff --git a/img/barcoding-schemes.png b/img/barcoding-schemes.png
index a078bc1..bfa16f4 100644
Binary files a/img/barcoding-schemes.png and b/img/barcoding-schemes.png differ