config.yaml

# output directory
outdir: results

# location of the samples config file, needs columns
# "fastq_path": the path to the directory containing the fastq files
# "fastq_name_R1": the file name of the file containing forward reads
# "fastq_name_R2": the file name of the file containing reverse reads
# "sample_name": name of the sample, creates new directories in the project 
#   directory with these names
samples_config: support/sample-sheet.txt

# location of the wild type sequence in fasta format
gene_seq: support/MITF.fa


# adaptor sequence at the 5' end, used for trimming by cutadapt
g: CTGCCCCGCCAACCTGCCC

# cutadapt adaptor sequence at the 3' end (please specify in 5' -> 3' direction),
# used for trimming by cutadapt
a: CTGAGCCTGATCCCTAGCACCG


# location of file containting expected mutants, needs at least a column called "amplicon"
# This file is optional, put False if not provided
expected_mutants: /path/to/expected/mutants.txt


################################################################################
## Computational resources for rules
# number of threads granted to rules capable of multi-processing
threads: 4