diff --git a/app/assets/config/manifest.js b/app/assets/config/manifest.js
index 0967ef424..b16e53d6d 100644
--- a/app/assets/config/manifest.js
+++ b/app/assets/config/manifest.js
@@ -1 +1,3 @@
-{}
+//= link_tree ../images
+//= link_directory ../javascripts .js
+//= link_directory ../stylesheets .css
diff --git a/app/assets/csvs/treasure_hunt_warm_up_results.csv b/app/assets/csvs/treasure_hunt_warm_up_results.csv
new file mode 100644
index 000000000..06b4ec2ac
--- /dev/null
+++ b/app/assets/csvs/treasure_hunt_warm_up_results.csv
@@ -0,0 +1 @@
+VARID,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50
CHROM,1,1,1,1,1,1,2,2,2,3,3,3,3,3,4,4,4,5,5,6,7,8,9,9,10,10,10,10,10,11,11,12,13,13,13,13,16,16,16,16,16,16,17,17,17,17,19,20,21,22
POS,27093043,27106406,51439612,161143427,161143694,201984364,148657316,148676143,198266831,41266085,52442586,52597407,121208445,186502465,55152090,106156565,153244142,67591073,112175182,26158586,106523590,117874090,120475316,139397775,8111542,63816961,63850750,89624241,123276898,32413529,69466026,115115435,28608148,28623570,32912707,48936946,67070639,67644795,68835746,68846132,68856070,68867224,29541466,37676280,41245089,56056604,47503717,30954203,44514767,41574281
REF,G,GGCT,AGGTGC,G,CG,ACGGGTGGATGGC,CT,AACCTGCCAT,CTTTCTG,CAGTCTTACCTGG,GATCC,AATATCATCAT,TTTA,CTAT,GAGACATCAT,A,A,TATCGAGAAA,T,G,AT,GCAGTGGCTGAT,TTTAA,C,T,TTGCCATTGG,TCCAGAGTAGAC,CAA,TATTCCCC,G,CGACGTGCGG,G,G,AGTGTAGTATCCG,TAAAG,TACAGAA,TAGAA,GGAGA,AAAGTCACGCTG,C,CACAGCAGA,C,TAGAGTCTTAC,AACAGACCCT,TTGGAACAACCA,TTGC,C,C,C,TGCAACAGCAGCA
ALT,T,G,A,A,C,A,C,A,C,C,G,A,T,C,G,AT,AAACTCCCC,T,TCTGCTAATACC,GATTC,A,G,T,CGGAAAGCGG,TTACTGAA,T,T,C,T,GT,C,GT,GTACGTGCATTTGGAAAAGTGATGAACGCAACAGCTTA,A,T,T,T,G,A,CCACCAA,C,T,T,A,T,T,A,T,CACTCAT,T
TGT VAF,0.50,0.20,0.50,0.50,0.20,0.50,0.20,0.50,0.20,0.20,0.50,0.20,0.50,0.50,0.20,0.20,0.20,0.20,0.20,0.20,0.50,0.50,0.20,0.50,0.20,0.50,0.50,0.50,0.20,0.20,0.20,0.20,0.50,0.20,0.20,0.50,0.20,0.50,0.20,0.20,0.50,0.50,0.20,0.50,0.50,0.50,0.50,0.50,0.50,0.50
TRU VAF,0.45,0.2,0.47,0.43,0.24,0.42,0.22,0.44,0.18,0.17,0.42,0.15,0.48,0.5,0.18,0.14,0.13,0.17,0.18,0.21,0.54,0.44,0.21,0.33,0.16,0.36,0.4,0.41,0.16,0.26,0.12,0.17,0.53,0.21,0.21,0.43,0.12,0.5,0.19,0.21,0.51,0.46,0.15,0.42,0.47,0.55,0.52,0.41,0.46,0.57
115 SKESA_SRPRISM,Not Found,Not Found,1,1,0.98,0.98,1,1,Not Found,Not Found,1,Not Found,1,1,Not Found,Not Found,Not Found,Not Found,1,Not Found,0.95,Not Found,1,1,Not Found,1,Not Found,0.98,Not Found,1,Not Found,Not Found,Not Found,1,1,1,Not Found,1,1,1,1,Not Found,Not Found,1,1,0.98,Not Found,Not Found,0.98,1
90 B15GATK36,0.47,0.23,0.45,0.47,0.27,0.37,0.23,0.41,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.44,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.58
89 B8GATK36,0.47,0.23,0.45,0.47,0.27,0.37,0.23,0.41,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.44,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.58
98 Saphetor4,0.47,0.23,0.45,0.47,0.27,0.37,0.23,0.39,0.21,0.18,0.43,0.13,0.51,0.5,0.14,0.15,0.14,0.17,0.21,0.22,0.54,0.36,0.25,0.37,0.2,0.34,0.44,0.41,0.17,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.48,0.52,0.14,0.39,0.44,0.44,0.51,0.43,0.47,0.52
64 BIG_CelerSNP-NA12878.vcf,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available
132 BIG_HXG-NA12878.vcf.gz,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Found,Not Available,Not Available,Not Available,Not Available,Not Found,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Found,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available
128 BIG_myPipeline-NA12878.vcf.gz,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available
62 BIG_NGSToolkit-NA12878.vcf,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available,Not Available
119 DeepVariant_LowFrequency,0.48,0.25,0.49,0.44,0.29 (Filtered),0.45,0.23,0.4,0.2,0.2,0.44,0.16,0.53,0.52,0.2,0.15,0.13 (Filtered),0.18,0.18,0.21,0.53,0.4,0.27,0.35,0.15 (Filtered),0.36,0.49,0.42,0.21,0.27,0.21,0.19 (Filtered),0.38,0.25,0.24,0.48,0.16 (Filtered),0.49,0.23,0.23,0.54,0.5,0.17,0.46,0.5,0.59,0.51,0.43,0.47,0.57
118 DeepVariant,0.48,0.25 (Filtered),0.49,0.44,0.29 (Filtered),0.45,0.23,0.4,0.2,0.2,0.44,0.16 (Filtered),0.53,0.52,0.2,0.15,0.13 (Filtered),0.18,0.18,0.21,0.53,0.4,0.27,0.35,0.15 (Filtered),0.36,0.49,0.42,0.21,0.27,0.21,0.19 (Filtered),0.38,0.25,0.24,0.48,0.16 (Filtered),0.49,0.23,0.23,0.54,0.5,0.17 (Filtered),0.46,0.5,0.59,0.51,0.43,0.47,0.57
37 DRAGEN_DNASeq_NA12878MOD_submission1,0.47,0.23,0.45,0.47,0.26,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
38 DRAGEN_DNASeq_NA12878MOD_submission2,0.47,0.23,0.45,0.47,0.26,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
39 DRAGEN_DNASeq_NA12878MOD_submission3,0.47,0.23,0.45,0.47,0.26,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,Not Found,0.51,0.43,0.47,0.54
40 DRAGEN_DNASeq_NA12878MOD_submission4,0.47,0.23,0.45,0.47,0.26,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,Not Found,0.51,0.43,0.47,0.54
41 DRAGEN_DNASeq_NA12878MOD_submission5,0.47,0.23,0.45,0.47,0.26,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
149 DRAGEN_DNASeq_NA12878MOD_submission6,0.47,0.23,0.45,0.47,0.26,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
150 DRAGEN_DNASeq_NA12878MOD_submission7b,0.47,0.23,0.45,0.47,0.26,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
96 Saphetor1,0.47,0.23,0.46,0.47,0.27,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.2,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
97 Saphetor2,0.47,0.23,0.45,0.47,0.27,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
104 Saphetor3,0.47,0.23,0.45,0.47,0.27,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
105 MySubmission2,0.47,0.24,0.45,0.47,0.26,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.53,0.39,0.25,0.37,0.2,0.34,0.45,0.44,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,Not Found,0.41,0.45,0.44,0.51,0.43,0.47,0.54
76 Experimental Unfiltered,0.48,0.22,0.45,0.46,0.26,0.37,0.22,0.4,0.2,0.18,0.43,0.13,0.51,0.51,0.14,0.15,0.13,0.17,0.19,0.21,0.54,0.36,0.25,0.37,0.18,0.33,0.43,0.42,0.18,0.28,Not Found,0.18,0.55,0.21,0.23,0.45,0.13,0.45,0.19,0.24,0.49,0.52,0.14,0.4,0.44,0.44,0.5,0.44,0.47,0.53
111 NCH_SUBMISSION2,0.47,0.23,0.45,0.49,0.27,0.36,0.21,0.39,0.21,Not Found,0.41,Not Found,0.52,0.5,Not Found,Not Found,Not Found,Not Found,Not Found,0.21,0.54,0.41,0.24,0.39,0.2,0.37,0.46,0.42,Not Found,0.23,Not Found,Not Found,0.55,0.22,0.24,0.44,Not Found,0.46,Not Found,0.23,0.5,0.49,Not Found,0.42,0.46,0.57,0.54,0.4,0.46,0.55
110 NCH_SUBMISSION1,0.47,0.23,0.45,0.49,0.27,0.36,0.21,0.39,0.21,0.16,0.41,0.14,0.52,0.5,0.16,0.15,0.14,0.17,0.19,0.21,0.54,0.41,0.24,0.39,0.2,0.37,0.46,0.42,0.18,0.23,0.13,0.2,0.55,0.22,0.24,0.44,0.14,0.46,0.2,0.23,0.5,0.49,0.14,0.42,0.46,0.57,0.54,0.4,0.46,0.55
3 JLack_CCBR_Leidos_StandardPipeline_noFilter,0.48,0.22,0.44,0.46,0.27,0.36,0.24,0.4,0.21,0.17,0.44,0.14,0.5,0.52,0.14,0.14,0.13,0.18,0.21,0.22,0.54,0.38,0.24,0.37,0.16,0.33,0.44,0.43,0.16,0.3,0.14,0.18,0.56,0.22,0.22,0.45,0.13,0.46,0.2,0.24,0.53,0.54,0.14,0.41,0.44,0.39,0.5,0.43,0.47,0.59
2 JLack_CCBR_Leidos_StandardPipeline_relaxed,0.48,0.22,0.44,0.46,0.27,0.36,0.24,0.4,0.21,0.17,0.44,0.14,0.5,0.52,0.14,0.14,0.13,0.18,0.21,0.22,0.54,0.38,0.24,0.37,0.16,0.33,0.44,0.43,0.16,0.3,0.14,0.18,0.56,0.22,0.22,0.45,0.13,0.46,0.2,0.24,0.53,0.54,0.14,0.41,0.44,0.39,0.5,0.43,0.47,0.59
155 JSLee_NA12878MOD_final_2.vcf.gz,0.48,0.22,0.46,0.44,0.27,0.37,0.23,0.42,0.21,0.17,0.44,0.15,0.51,0.5,0.16,0.15,0.14,0.16,0.21,0.22,0.54,0.39,0.25,0.38,0.19,0.34,0.44,0.42,0.18,0.28,0.15,0.18,0.57,0.21,0.23,0.45,0.13,0.46,0.2,0.24,0.5,0.49,0.14,0.4,0.46,0.42,0.5,0.42,0.48,0.55
156 JSLee_NA12878MOD_final_3.vcf.gz,0.48,0.22,0.46,0.44,0.27,0.37,0.23,0.42,0.21,0.17,0.44,Not Found,0.51,0.5,0.16,Not Found,Not Found,0.16,0.21,0.22,0.54,0.39,0.25,0.38,Not Found,0.34,0.44,0.42,0.18,0.28,Not Found,0.18,0.57,0.21,0.23,0.45,Not Found,0.46,0.2,0.24,0.5,0.49,Not Found,0.4,0.46,0.42,0.5,0.42,0.48,0.55
157 JSLee_NA12878MOD_final_4.vcf.gz,0.48,Not Found,Not Found,0.44,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,0.49,Not Found,Not Found,Not Found,Not Found,0.5,0.42,Not Found,Not Found
32 KCCG_1.7.0_HC,0.48,0.23,0.45,0.47,0.27,0.37,0.23,0.41,0.21,0.17,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.38,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.56,0.21,0.23,0.44,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.42,0.47,0.58
33 KCCG_1.7.0_VD,0.48,0.23,0.48,0.44,0.24,0.42,0.23,0.4,0.22,0.17,0.43,0.17,0.52,0.47,0.19,0.15,Not Found,0.18,0.21,0.21,0.53,0.41,0.25,0.38,0.19,0.36,0.44,0.42,0.18,0.27,Not Found,0.19,0.55,0.23,0.23,0.44,Not Found,0.45,0.21,0.23,0.5,0.49,0.15,0.42,0.49,0.3,0.51,0.42,0.47,0.56
133 Bowtie2 + GATK HaplotypeCaller depth-filtered,0.47,0.24,0.45,0.46,0.27,0.37,0.23,0.41,0.21,0.18,0.43,0.15,0.51,0.5,0.15,0.15,0.14,0.18,0.2,0.19,0.54,0.39,0.25,0.36,0.2,0.34,0.45,0.34,0.18,0.28,0.15,0.19,0.42,0.22,0.23,0.45,0.13,0.46,0.2,0.24,0.5,0.52,Not Found,0.41,0.45,0.44,0.51,0.43,0.46,0.54
131 Bowtie2 + GATK HaplotypeCaller unfiltered,0.47,0.24,0.45,0.46,0.27,0.37,0.23,0.41,0.21,0.18,0.43,0.15,0.51,0.5,0.15,0.15,0.14,0.18,0.2,0.19,0.54,0.39,0.25,0.36,0.2,0.34,0.45,0.34,0.18,0.28,0.15,0.19,0.42,0.22,0.23,0.45,0.13,0.46,0.2,0.24,0.5,0.52,Not Found,0.41,0.45,0.44,0.51,0.43,0.46,0.54
70 Challenge_submission_20170912_3,0.47,0.23,0.45,0.47,0.26,0.37,0.23,0.41,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,Not Found,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
9 GATK HaplotypeCaller depth-filtered,0.47,0.23,0.46,0.46,0.27,0.37,0.23,0.41,0.21,0.18,0.43,0.14,0.51,0.51,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.19,0.34,0.45,0.41,0.17,0.28,0.15,0.19,0.56,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.5,0.14,0.41,0.45,0.42,0.51,0.44,0.46,0.54
8 GATK HaplotypeCaller unfiltered,0.47,0.23,0.46,0.46,0.27,0.37,0.23,0.41,0.21,0.18,0.43,0.14,0.51,0.51,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.19,0.34,0.45,0.41,0.17,0.28,0.15,0.19,0.56,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.5,0.14,0.41,0.45,0.42,0.51,0.44,0.46,0.54
12 Test,0.47,0.24,0.45,0.46,0.25,0.37,0.23,0.43,0.2,0.18,0.42,0.14,0.51,0.5,0.15,0.14,0.15,0.18,0.21,0.22,0.55,0.4,0.25,0.35,0.19,0.35,0.42,0.42,0.18,0.27,0.14,0.19,0.56,0.23,0.23,0.45,0.12,0.47,0.19,0.23,0.5,0.51,0.15,0.41,0.45,0.44,0.52,0.42,0.48,0.54
124 NA12878MOD.imp.hardfilter.recode.vcf.gz,0.47,0.23,0.45,0.47,0.27,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
49 NA12878MOD.imp.v2.recode.vcf.gz,0.47,0.23,0.45,0.47,0.27,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
51 NA12878MOD.imp.v3.recode.vcf,0.47,0.23,0.45,0.47,0.27,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
34 NA12878MOD.imp.vcf.gz,0.47,0.23,0.45,0.47,0.27,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
107 Whole-exome variant calling pipeline results,0.44,Not Found,0.44,0.44,0.22,0.36,Not Found,0.45,Not Found,Not Found,0.38,Not Found,0.47,0.47,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,0.54,0.42,Not Found,0.33,Not Found,0.35,0.36,0.4,Not Found,0.25,Not Found,Not Found,Not Found,Not Found,0.22,0.42,Not Found,0.47,Not Found,Not Found,0.5,0.46,Not Found,0.38,0.44,0.33,0.52,0.41,0.46,0.53
54 ADIscan_NA12878MOD_all,0.44,0.18,0.4,0.46,0.22,0.42,0.21,0.45,0.16,Not Found,0.4,0.12,0.46,0.44,0.15,0.14,0.13,0.17,0.16,0.19,0.54,0.42,0.22,0.3,0.14,0.35,0.39,0.41,0.13,0.25,0.12,0.17,Not Found,0.21,0.21,0.4,0.1,0.48,0.19,0.2,0.47,0.48,0.12,0.37,0.45,0.29,0.51,0.4,0.44,0.55
59 ADIscan_NA12878MOD_conf,0.44,0.18,0.4,0.46,0.22,0.42,0.21,0.45,0.16,Not Found,0.4,0.12,0.46,0.44,0.15,0.14,0.13,0.17,0.16,0.19,0.54,0.42,0.22,0.3,0.14,0.35,0.39,0.41,0.13,0.25,0.12,0.17,Not Found,0.21,0.21,0.4,0.1,0.48,0.19,0.2,0.47,0.48,0.12,0.37,0.45,0.29,0.51,0.4,0.44,0.55
57 ADIscan_NA12878MOD_filtered,0.44,0.18,0.4,0.46,0.22,0.42,0.21,0.45,0.16,Not Found,0.4,0.12,0.46,0.44,0.15,0.14,0.13,0.17,0.16,0.19,0.54,0.42,0.22,0.3,0.14,0.35,0.39,0.41,0.13,0.25,0.12,0.17,Not Found,0.21,0.21,0.4,0.1,0.48,0.19,0.2,0.47,0.48,0.12,0.37,0.45,0.29,0.51,0.4,0.44,0.55
58 ADIscan_NA12878MOD_tight,0.44,0.18,0.4,0.46,0.22,0.42,0.21,0.45,0.16,Not Found,0.4,0.12,0.46,0.44,0.15,0.14,0.13,0.17,0.16,0.19,0.54,0.42,0.22,0.3,0.14,0.35,0.39,0.41,0.13,0.25,0.12,0.17,Not Found,0.21,0.21,0.4,0.1,0.48,0.19,0.2,0.47,0.48,0.12,0.37,0.45,0.29,0.51,0.4,0.44,0.55
75 HULP-germ,0.46,0.22,0.24,0.47,0.24,0.2,0.23,0.21,0.18,0.16,0.2,0.14,0.26,0.23,0.16,0.14,0.14,0.16,0.19,0.2,0.27,0.21,0.23,0.17,0.18,0.17,0.2,0.14,0.16,0.28,0.12,0.18,Not Found,0.19,0.22,0.22,0.11,0.23,0.17,0.22,0.25,0.5,Not Found,0.18,0.24,0.25,0.52,0.44,0.23,0.28
88 Submission1,0.47,0.24,0.45,0.47,0.26,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.53,0.39,0.25,0.37,0.2,0.34,0.45,0.44,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,Not Found,0.41,0.45,0.44,0.51,0.43,0.47,0.53
4 SeqsLab with GATK-based Parallelization,0.47,0.24,0.45,0.47,0.26,0.37,0.23,0.41,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,Not Found,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
5 SeqsLab with GATK-based Parallelization(conf>30),0.47,0.24,0.45,0.47,0.26,0.37,0.23,0.41,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,Not Found,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
153 NCBI_Magic_ThierryMieg_NA12878MOD.b.vcf.gz,0.49,Not Found,0.47,0.44 (Filtered),0.24 (Filtered),0.47,0.22 (Filtered),Not Found,Not Found,0.2,Not Found,Not Found,0.45,0.44,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,0.57,Not Found,0.22,Not Found,Not Found,0.38,Not Found,0.42,Not Found,0.25,Not Found,Not Found,Not Found,0.21,0.26,0.45,Not Found,Not Found,0.21,Not Found,0.54,0.5,Not Found,Not Found,Not Found,0.26,0.54,0.45,Not Found,0.59
148 BWA-MEM + GATK + SNVer,0.47,0.17,0.29,0.43,0.2,0.29,0.19,0.29,0.16,Not Found,0.3,Not Found,0.34,0.32,Not Found,0.13,Not Found,Not Found,0.17,Not Found,0.35,0.27,0.19,0.22,Not Found,0.24,0.28,0.29,Not Found,0.21,Not Found,0.17,Not Found,0.18,0.19,0.3,Not Found,0.32,0.17,0.18,0.32,0.53,Not Found,0.27,0.3,0.24,0.48,0.43,0.32,0.33
77 NovoalignFreebayes_1,0.47,0.24,0.44,0.44,0.24,0.45,0.23,0.41,0.21,0.2,0.42,Not Found,0.52,0.49,0.2,0.14,Not Found,0.17,0.17,0.21,0.51,0.39,0.24,0.33,0.15,0.34,0.46,0.39,0.18,0.25,0.16,0.19,0.4,0.24,0.22,0.43,Not Found,0.46,0.24,0.22,0.52,0.49,0.15,0.4,0.47,0.38,0.5,0.39,0.47,0.58
78 NovoalignFreebayes_2,0.45,0.16,0.41,0.41,0.21,0.39,0.2,0.36,0.17,0.18,0.38,Not Found,0.48,0.45,0.19,0.13,Not Found,0.14,Not Found,0.18,0.48,0.34,0.21,0.3,0.14,0.29,0.45,0.35,Not Found,0.23,Not Found,0.13,0.22,0.16,0.18,0.38,Not Found,0.42,0.2,0.21,0.46,0.47,Not Found,0.32,0.42,0.41,0.49,0.37,0.43,0.54
79 NovoalignGATKHC_1,0.47,0.24,0.45,0.47,0.27,0.36,0.23,0.4,0.21,0.17,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.22,0.21,0.54,0.39,0.25,0.39,0.19,0.34,0.44,0.42,0.18,0.28,0.15,0.19,0.57,0.21,0.23,0.46,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.4,0.45,0.42,0.51,0.42,0.47,0.54
81 NovoalignGATKHC_2,0.47,0.23,0.45,0.47,0.27,0.36,0.23,0.4,0.21,0.17,0.42,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.22,0.21,0.54,0.39,0.25,0.38,0.19,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.56,0.21,0.23,0.45,0.13,0.45,0.19,0.24,0.5,0.52,0.14,0.39,0.45,0.42,0.51,0.42,0.47,0.54
117 Sentieon_DNAseq_allmap_nodedup-NA12878MOD,0.45,0.21,0.42,0.46,0.24,0.36,0.21,0.45,0.17,0.16,0.41,0.11,0.48,0.49,0.14,0.14,0.14,0.17,0.18,0.2,0.54,0.42,0.22,0.33,0.17,0.34,0.39,0.42,0.16,0.26,0.12,0.17,0.53,0.2,0.22,0.43,0.11,0.48,0.17,0.21,0.47,0.48,0.14,0.39,0.43,0.41,0.52,0.41,0.45,0.54
116 Sentieon_DNAseq_allmap-NA12878MOD,0.47,0.23,0.45,0.47,0.26,0.37,0.23,0.41,0.2,0.18,0.44,0.12,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.36,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.53,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.49,0.53,0.14,0.4,0.44,0.44,0.51,0.43,0.47,0.54
35 Sentieon_DNAseq_nodecoy-NA12878MOD,0.47,0.23,0.45,0.47,0.26,0.37,0.23,0.41,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
20 Sentieon_DNAseq_std-NA12878MOD,0.47,0.23,0.45,0.47,0.26,0.37,0.23,0.41,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,0.14,0.41,0.45,0.44,0.51,0.43,0.47,0.54
123 Sentieon_Exp_nodedup-NA12878MOD,0.45,0.21,0.44,0.46,0.25,0.36,0.22,0.46,0.18,0.17,0.43,0.13,0.48,0.49,0.16,0.14,0.14,0.17,0.19,0.21,0.6,0.42,0.23,0.36,0.16,0.36,0.39,0.44,0.17,0.26,0.12,0.17,0.54,0.21,0.22,0.44,0.12,0.48,0.17,0.22,0.51,0.48,0.14,0.41,0.44,0.41,0.55,0.44,0.47,0.55
122 Sentieon_Exp-NA12878MOD,0.48,0.24,0.45,0.48,0.27,0.37,0.23,0.42,0.22,0.18,0.47,0.14,0.51,0.52,0.16,0.15,0.15,0.18,0.21,0.21,0.57,0.39,0.26,0.39,0.18,0.35,0.45,0.45,0.2,0.28,0.15,0.19,0.52,0.22,0.23,0.47,0.13,0.46,0.2,0.24,0.52,0.53,0.14,0.42,0.45,0.44,0.55,0.46,0.49,0.55
121 Sentieon_TNscope_Tonly_allmap_nodedup-NA12878MOD,0.45,0.21,0.44,0.46,0.25,0.36,0.22,0.46,0.18,0.17,0.43,0.13,0.48,0.49,0.16,0.14,0.14,0.17,0.19,0.21,0.6,0.42,0.23,0.36,0.16,0.36,0.39,0.44,0.17,0.26,0.12,0.17,0.54,0.21,0.22,0.44,0.12,0.48,0.17,0.22,0.51,0.48,0.14,0.41,0.44,0.41,0.55,0.44,0.47,0.55
120 Sentieon_TNscope_Tonly_allmap-NA12878MOD,0.48,0.24,0.45,0.48,0.27,0.37,0.23,0.42,0.22,0.18,0.47,0.14,0.51,0.52,0.16,0.15,0.15,0.18,0.21,0.21,0.57,0.39,0.26,0.39,0.18,0.35,0.45,0.45,0.2,0.28,0.15,0.19,0.52,0.22,0.23,0.47,0.13,0.46,0.2,0.24,0.52,0.53,0.14,0.42,0.45,0.44,0.55,0.46,0.49,0.55
36 Sentieon_TNscope_Tonly_nodecoy-NA12878MOD,0.48,0.24,0.45,0.48,0.28,0.37,0.23,0.42,0.22,0.18,0.46,0.15,0.52,0.52,0.16,0.15,0.15,0.18,0.21,0.21,0.57,0.4,0.26,0.38,0.18,0.35,0.44,0.45,0.2,0.28,0.15,0.19,0.54,0.22,0.23,0.47,0.13,0.47,0.2,0.24,0.53,0.53,0.15,0.42,0.46,0.44,0.55,0.46,0.49,0.55
21 Sentieon_TNscope_Tonly_std-NA12878MOD,0.48,0.24,0.45,0.48,0.28,0.37,0.23,0.42,0.22,0.18,0.46,0.15,0.52,0.52,0.16,0.15,0.15,0.18,0.21,0.21,0.57,0.4,0.26,0.38,0.18,0.35,0.44,0.45,0.2,0.28,0.15,0.19,0.54,0.22,0.23,0.47,0.13,0.47,0.2,0.24,0.53,0.53,0.15,0.42,0.46,0.44,0.55,0.46,0.49,0.55
22 SGI_1st_result,0.47 (Filtered),0.23,0.46 (Filtered),0.47,0.26 (Filtered),0.37,0.23 (Filtered),0.41,0.21 (Filtered),0.18 (Filtered),0.43,0.14 (Filtered),0.51 (Filtered),0.5,0.15 (Filtered),0.15 (Filtered),0.14 (Filtered),0.18,0.21 (Filtered),0.21,0.54,0.39,0.25 (Filtered),0.37,0.2 (Filtered),0.34 (Filtered),0.44,0.42,0.18 (Filtered),0.28 (Filtered),0.15,0.19 (Filtered),0.58 (Filtered),0.21 (Filtered),0.23 (Filtered),0.45,0.13 (Filtered),0.46,0.19 (Filtered),0.24,0.5,0.52,0.14 (Filtered),0.41,0.45 (Filtered),0.44 (Filtered),0.51,0.43,0.47,0.54
23 SGI_2nd_filtration,0.47,0.23,0.46,0.47,0.26 (Filtered),0.37,0.23 (Filtered),0.41,0.21,0.18 (Filtered),0.43,0.14 (Filtered),0.51 (Filtered),0.5,0.15 (Filtered),0.15 (Filtered),0.14 (Filtered),0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2 (Filtered),0.34,0.44,0.42,0.17 (Filtered),0.28,0.15,0.2 (Filtered),0.58 (Filtered),0.21,0.23 (Filtered),0.45,0.13 (Filtered),0.46,0.19 (Filtered),0.24,0.5,0.52,0.14 (Filtered),0.41,0.45,0.44 (Filtered),0.51,0.43,0.47,0.54
25 SGI_4th_filtration,0.47,0.23 (Filtered),0.46,0.47,0.26,0.37,0.23,0.41,0.2,0.18,0.43,0.14,0.51 (Filtered),0.52 (Filtered),0.15 (Filtered),0.15,0.14,0.18,0.21,0.21,0.53,0.38,0.24,0.38 (Filtered),0.18,0.34,0.43,0.42,0.17,0.26,0.15 (Filtered),0.17,0.58,0.2 (Filtered),0.23,0.45,0.11,0.46,0.2,0.24,0.49,0.53,0.14,0.41,0.45,0.43 (Filtered),0.49,0.43,0.47,0.59
27 SGI_3rd_filtration_rere,0.47,0.23 (Filtered),Not Available,0.47,Not Available,Not Available,Not Available,Not Available,0.21,0.18 (Filtered),Not Available,0.14 (Filtered),Not Available,Not Available,0.15 (Filtered),0.15 (Filtered),0.14 (Filtered),0.18,0.21,0.21,Not Available,Not Available,Not Available,Not Available,0.2 (Filtered),Not Available,0.44,Not Available,0.17 (Filtered),Not Available,0.15 (Filtered),0.2 (Filtered),0.58 (Filtered),Not Available,Not Available,Not Available,0.13 (Filtered),Not Available,Not Available,Not Available,Not Available,0.52,0.14 (Filtered),Not Available,Not Available,0.44 (Filtered),0.51,0.43,Not Available,0.54
112 SIB,0.45,0.2,0.42,0.44,0.22,0.41,0.23,0.39,0.19,0.18,0.42,Not Found,0.47,0.45,0.18,Not Found,Not Found,0.82,Not Found,0.2,0.48,0.4,0.2,0.29,Not Found,0.34,0.4,0.36,0.17,0.26,Not Found,Not Found,0.69,0.22,0.24,0.39,Not Found,0.45,0.2,0.21,0.48,0.49,0.2,0.33,0.45,0.23,0.53,0.44,0.44,0.51
102 MySubmission1,0.47,0.24,0.45,0.47,0.26,0.37,0.23,0.4,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.53,0.39,0.25,0.37,0.2,0.34,0.45,0.44,0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.45,0.13,0.46,0.19,0.24,0.5,0.52,Not Available,0.41,0.45,0.44,0.51,0.43,0.47,0.53
106 mySubmission_GATK,0.47,0.23 (Filtered),0.45,0.47,0.26,0.37,0.23,0.41,0.2,0.18,0.44,0.14,0.51 (Filtered),0.52 (Filtered),0.15,0.15,0.14,0.18,0.21,0.21,0.53,0.38,0.24,0.38,0.18,0.34,0.45,0.43,0.18,0.26,0.15 (Filtered),0.16,0.58,0.2,0.23,0.45,0.12,0.47,0.2,0.24,0.49,0.51,0.07,0.41,0.45,Not Found,0.49,0.43,0.47,0.28
143 Yotta1_GRCh37_liftover_from_GRCh38_sorted,0.47,0.23,0.45,0.47,0.27,0.37,0.23,0.41,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42 (Filtered),0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.44,0.13,0.46,0.19,0.24,0.5,0.52,0.14 (Filtered),0.41,0.45,0.44,0.51,0.43,0.57,0.58
146 Yotta2_GRCh37_liftover_from_GRCh38_sorted,0.45,Not Found,Not Found,0.44,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,Not Found,0.46,Not Found,Not Found,Not Found,Not Found,0.52,0.42,Not Found,Not Found
147 Yotta3_GRCh37_liftover_from_GRCh38_sorted,0.47,0.23,0.45,0.47,0.27,0.37,0.23,0.41,0.21,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.21,0.21,0.54,0.39,0.25,0.37,0.2,0.34,0.45,0.42 (Filtered),0.18,0.28,0.15,0.19,0.55,0.21,0.23,0.44,0.13,0.46,0.19,0.24,0.5,0.52,0.14 (Filtered),0.41,0.45,0.44,0.51,0.43,0.57,0.58
91 G3GATK36,0.47,0.23,0.45,0.46,0.27,0.36,0.23,0.4,0.2,0.18,0.43,0.14,0.51,0.5,0.15,0.15,0.14,0.18,0.22,0.21,0.53,0.39,0.25,0.37,0.2,0.34,0.44,0.42,0.18,0.28,0.15,0.2,0.29,0.21,0.23,0.44,0.13,0.46,0.19,0.24,0.5,0.51,0.13,0.41,0.45,0.44,0.51,0.44,0.47,0.58
87 HULP-mosaic,0.44,0.18,0.38,0.44 (Filtered),Not Found,0.35,0.22,0.39,0.16,0.18 (Filtered),0.35,Not Found,0.5,0.43,0.17,0.14,Not Found,0.13 (Filtered),Not Found,0.17 (Filtered),0.55,0.37,0.19,0.26,0.12,0.29,0.31,0.38,0.14,0.24,0.1 (Filtered),0.16,Not Found,0.18,0.21,0.36,0.11 (Filtered),0.44,0.15,0.2,0.42 (Filtered),0.48,Not Found,0.3 (Filtered),0.38,0.35,0.49,0.4 (Filtered),0.45,0.47
\ No newline at end of file
diff --git a/app/assets/images/.keep b/app/assets/images/.keep
new file mode 100644
index 000000000..e69de29bb
diff --git a/app/assets/images/apps/AppIconBlue.png b/app/assets/images/apps/AppIconBlue.png
new file mode 100644
index 000000000..c551ff9de
Binary files /dev/null and b/app/assets/images/apps/AppIconBlue.png differ
diff --git a/app/assets/images/apps/AppIconGreen.png b/app/assets/images/apps/AppIconGreen.png
new file mode 100644
index 000000000..6aafc8340
Binary files /dev/null and b/app/assets/images/apps/AppIconGreen.png differ
diff --git a/app/assets/images/apps/AppIconYellow.png b/app/assets/images/apps/AppIconYellow.png
new file mode 100644
index 000000000..0e044d949
Binary files /dev/null and b/app/assets/images/apps/AppIconYellow.png differ
diff --git a/app/assets/images/beta-release.png b/app/assets/images/beta-release.png
new file mode 100644
index 000000000..cd7cb2bfd
Binary files /dev/null and b/app/assets/images/beta-release.png differ
diff --git a/app/assets/images/navbar/NavbarBackground.png b/app/assets/images/navbar/NavbarBackground.png
new file mode 100644
index 000000000..bd8688108
Binary files /dev/null and b/app/assets/images/navbar/NavbarBackground.png differ
diff --git a/app/assets/images/navbar/gsrs-logo-round-bw.svg b/app/assets/images/navbar/gsrs-logo-round-bw.svg
new file mode 100644
index 000000000..d33ecd415
--- /dev/null
+++ b/app/assets/images/navbar/gsrs-logo-round-bw.svg
@@ -0,0 +1,20 @@
+<?xml version="1.0" encoding="UTF-8" standalone="no"?>
+<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd">
+<svg width="100%" height="100%" viewBox="0 0 24 24" version="1.1" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" xml:space="preserve" xmlns:serif="http://www.serif.com/" style="fill-rule:evenodd;clip-rule:evenodd;stroke-linejoin:round;stroke-miterlimit:2;">
+    <g transform="matrix(1,0,0,1,-101.557,-1.44017)">
+        <g id="Layer-1" serif:id="Layer 1">
+            <g id="g3044">
+                <g id="g3019">
+                    <path id="path3021" d="M125.549,13.44C125.549,6.815 120.178,1.453 113.553,1.453C106.928,1.453 101.557,6.824 101.557,13.44L125.549,13.44" style="fill:rgb(46,46,46);fill-rule:nonzero;"/>
+                    <path id="path3023" d="M101.566,13.432C101.566,20.056 106.937,25.427 113.562,25.427C120.186,25.427 125.557,20.056 125.557,13.432L101.566,13.432" style="fill:rgb(195,195,195);fill-rule:nonzero;"/>
+                    <path id="path3025" d="M106.064,13.432L106.064,9.687C106.064,9.687 106.064,6.688 108.309,6.688C110.554,6.688 110.554,9.687 110.554,9.687L110.554,13.432L106.064,13.432" style="fill:rgb(195,195,195);fill-rule:nonzero;"/>
+                    <path id="path3027" d="M110.563,13.432L110.563,17.176C110.563,17.176 110.563,20.175 108.318,20.175C106.073,20.175 106.073,17.176 106.073,17.176L106.073,13.432L110.563,13.432" style="fill:white;fill-rule:nonzero;"/>
+                    <path id="path3029" d="M111.308,13.432L111.308,9.687C111.308,9.687 111.308,6.688 113.553,6.688C115.798,6.688 115.798,9.687 115.798,9.687L115.798,13.432L111.308,13.432" style="fill:rgb(195,195,195);fill-rule:nonzero;"/>
+                    <path id="path3031" d="M115.807,13.432L115.807,17.176C115.807,17.176 115.807,20.175 113.562,20.175C111.317,20.175 111.317,17.176 111.317,17.176L111.317,13.432L115.807,13.432" style="fill:white;fill-rule:nonzero;"/>
+                    <path id="path3033" d="M116.552,13.432L116.552,9.687C116.552,9.687 116.552,6.688 118.797,6.688C121.042,6.688 121.042,9.687 121.042,9.687L121.042,13.432L116.552,13.432" style="fill:rgb(195,195,195);fill-rule:nonzero;"/>
+                    <path id="path3035" d="M121.05,13.432L121.05,17.176C121.05,17.176 121.05,20.175 118.806,20.175C116.561,20.175 116.561,17.176 116.561,17.176L116.561,13.432L121.05,13.432" style="fill:white;fill-rule:nonzero;"/>
+                </g>
+            </g>
+        </g>
+    </g>
+</svg>
diff --git a/app/assets/images/running_workstation.png b/app/assets/images/running_workstation.png
new file mode 100644
index 000000000..51221b981
Binary files /dev/null and b/app/assets/images/running_workstation.png differ
diff --git a/app/assets/javascripts/_precision/precision.app.editor.coffee b/app/assets/javascripts/_precision/precision.app.editor.coffee
index bc2c7c76d..8f0b37e85 100644
--- a/app/assets/javascripts/_precision/precision.app.editor.coffee
+++ b/app/assets/javascripts/_precision/precision.app.editor.coffee
@@ -1,5 +1,5 @@
 class AppEditorModel
-  constructor: (app, ubuntuReleases, @mode = 'edit') ->
+  constructor: (app, ubuntuReleases, @availableInstances, @mode = 'edit') ->
     @isNewApp = @mode != 'edit'
     @saving = ko.observable(false)
     @loadingAssets = ko.observable(false)
@@ -7,6 +7,7 @@ class AppEditorModel
 
     @ubuntuReleases = ko.observableArray(ubuntuReleases)
     @dxid = app?.dxid
+    @entityType = app?.entity_type
     @name = ko.observable(app?.name)
     @name.cache = ko.computed(
       read: () =>
@@ -67,7 +68,6 @@ class AppEditorModel
 
     @internetAccess = ko.observable(app?.spec?.internet_access ? false)
 
-    @availableInstances = Precision.INSTANCES
     @defaultInstanceType = app?.spec?.instance_type ? "baseline-8"
     @instanceType = ko.observable(@defaultInstanceType)
 
@@ -205,6 +205,7 @@ class AppEditorModel
       ordered_assets: @getAssetsForSave()
       packages: @packages.peek()
       code: @code.peek() ? ""
+      entity_type: @entityType
 
     Precision.api('/api/apps', params)
       .done((data) =>
diff --git a/app/assets/javascripts/_precision/precision.app.input.coffee b/app/assets/javascripts/_precision/precision.app.input.coffee
index 0afaaa20d..fb1984105 100644
--- a/app/assets/javascripts/_precision/precision.app.input.coffee
+++ b/app/assets/javascripts/_precision/precision.app.input.coffee
@@ -404,7 +404,7 @@ class AppInputModel
             data.toString()
           )
         when 'float'
-          value = _.map(value, (data) =>
+          value = _.map(value.split(','), (data) =>
             data = $.trim(data)
             parseFloat(data, 10)
           )
diff --git a/app/assets/javascripts/_precision/precision.autocomplete.coffee b/app/assets/javascripts/_precision/precision.autocomplete.coffee
index 0305777bf..6fc3e0913 100644
--- a/app/assets/javascripts/_precision/precision.autocomplete.coffee
+++ b/app/assets/javascripts/_precision/precision.autocomplete.coffee
@@ -4,18 +4,20 @@ class AutocompleteModel
   EVENTS = {
     CHANGE_EVENT: "#{PREFIX}.change",
     KEYUP: "#{PREFIX}.keyup",
-    SETVALUE: "#{PREFIX}.setvalue"
+    SETVALUE: "#{PREFIX}.setvalue",
+    OPTION_CLICK: "#{PREFIX}.optionClick"
   }
 
   createEvents = () -> {
     CHANGE_EVENT: new Event(EVENTS.CHANGE_EVENT),
     KEYUP: new Event(EVENTS.KEYUP),
-    SETVALUE: new Event(EVENTS.SETVALUE)
+    SETVALUE: new Event(EVENTS.SETVALUE),
+    OPTION_CLICK: new Event(EVENTS.OPTION_CLICK)
   }
 
-  dispatchEvent = (el, e, eName) ->
-    el.dispatchEvent(e)
-    $(el).trigger(eName)
+  dispatchEvent = (el, e, eName, data) ->
+    el.dispatchEvent(e, [data])
+    $(el).trigger(eName, [data])
 
   convertOptionValues = (options = []) ->
     simpleTypes = ['string', 'number', 'boolean']
@@ -62,13 +64,14 @@ class AutocompleteModel
 
   renderInputGroup = () ->
     inputGroup = document.createElement('div')
-    inputGroup.classList.add('#{PREFIX}--input-group')
+    inputGroup.classList.add("#{PREFIX}--input-group")
     return inputGroup
 
-  renderRootNode = () ->
+  renderRootNode = (inputNode) ->
     rootNode = document.createElement('div')
     rootNode.classList.add("#{PREFIX}")
     rootNode.classList.add("#{PREFIX}--wrapper")
+    rootNode.classList.add("#{PREFIX}--lg") if inputNode.classList.contains('input-lg')
     return rootNode
 
   renderHiddenInput = (hiddenInput) ->
@@ -127,6 +130,7 @@ class AutocompleteModel
     @value = e.target.getAttribute('data-value')
     @nodes.hiddenInput.value = @value
     @dispatchInputEvent('SETVALUE')
+    @dispatchInputEvent('OPTION_CLICK', @value)
 
   onKeyUp: (e) =>
     @dispatchInputEvent('KEYUP')
@@ -161,8 +165,8 @@ class AutocompleteModel
     if notAutocomplete and notHidden
       @nodes.optionsContainer.classList.add('hidden')
 
-  dispatchInputEvent: (event) ->
-    dispatchEvent(@nodes.inputNode, @events[event], @eventNames[event])
+  dispatchInputEvent: (event, data) ->
+    dispatchEvent(@nodes.inputNode, @events[event], @eventNames[event], data)
 
   disabled: (disabled) ->
     if disabled
@@ -175,7 +179,7 @@ class AutocompleteModel
     @eventNames = EVENTS
 
     @nodes = {}
-    @nodes.rootNode = renderRootNode()
+    @nodes.rootNode = renderRootNode(@params.inputNode)
     @nodes.inputNode = renderInputNode(@params.inputNode)
     @nodes.hiddenInput = renderHiddenInput(@params.inputNode)
     @nodes.inputGroup = renderInputGroup()
@@ -224,3 +228,9 @@ class AutocompleteModel
 
 window.Precision ||= {}
 window.Precision.autocomplete = AutocompleteModel
+
+### PARAMS ###
+# @params.inputNode - input type text (DOM Node, not JQuery) [DOM Node] [REQUIRED]
+# @params.getOptionsAsync - Promise to get options with api [function -> promise]
+# @params.disabled - disable input node [boolean]
+# @params.options - default options [Array[int|string|boolean]] | [Array[Object{value, label}]]
diff --git a/app/assets/javascripts/_precision/precision.coffee b/app/assets/javascripts/_precision/precision.coffee
index 6db799ae8..86537859e 100644
--- a/app/assets/javascripts/_precision/precision.coffee
+++ b/app/assets/javascripts/_precision/precision.coffee
@@ -31,24 +31,6 @@ window.Precision.CK_CONFIG =
   autoGrow_minHeight: 400
   autoGrow_onStartup: true
 
-window.Precision.INSTANCES = [
-  {value: "baseline-2", label: "Baseline 2"}
-  {value: "baseline-4", label: "Baseline 4"}
-  {value: "baseline-8", label: "Baseline 8"}
-  {value: "baseline-16", label: "Baseline 16"}
-  {value: "baseline-36", label: "Baseline 36"}
-  {value: "himem-2", label: "High Mem 2"}
-  {value: "himem-4", label: "High Mem 4"}
-  {value: "himem-8", label: "High Mem 8"}
-  {value: "himem-16", label: "High Mem 16"}
-  {value: "himem-32", label: "High Mem 32"}
-  {value: "hidisk-2", label: "High Disk 2"}
-  {value: "hidisk-4", label: "High Disk 4"}
-  {value: "hidisk-8", label: "High Disk 8"}
-  {value: "hidisk-16", label: "High Disk 16"}
-  {value: "hidisk-36", label: "High Disk 36"}
-]
-
 window.Precision.carousel =
   # Source: http://jsfiddle.net/technotarek/gXN2u/
   setHeight: (id) ->
diff --git a/app/assets/javascripts/_precision/precision.dataTable.coffee b/app/assets/javascripts/_precision/precision.dataTable.coffee
new file mode 100644
index 000000000..3684520c0
--- /dev/null
+++ b/app/assets/javascripts/_precision/precision.dataTable.coffee
@@ -0,0 +1,7 @@
+DataTable = $.fn.dataTable
+dom = "<'row'<'col-sm-4'l><'col-sm-12'f>><'row'<'col-sm-24'tr>><'row'<'col-sm-10'i><'col-sm-14'p>>"
+
+$.extend( true, DataTable.defaults, {
+	dom: dom,
+	renderer: 'bootstrap'
+})
diff --git a/app/assets/javascripts/_precision/precision.nav.dropdown.coffee b/app/assets/javascripts/_precision/precision.nav.dropdown.coffee
new file mode 100644
index 000000000..f5f244631
--- /dev/null
+++ b/app/assets/javascripts/_precision/precision.nav.dropdown.coffee
@@ -0,0 +1,84 @@
+TABLE_CONFIG = [
+  {
+    resource: 'Compute',
+    usage: (stats) -> stats.computeCharges,
+    bold: false,
+  },
+  {
+    resource: 'Storage',
+    usage: (stats) -> stats.storageCharges,
+    bold: false,
+  },
+  {
+    resource: 'Data Egress',
+    usage: (stats) -> stats.dataEgressCharges,
+    bold: false,
+  },
+  {
+    resource: 'Total',
+    usage: (stats) -> stats.totalCharges,
+    bold: true,
+  },
+  {
+    resource: 'Usage Limit',
+    usage: (stats) -> stats.usageLimit,
+    bold: false,
+  },
+  {
+    resource: 'Usage Available',
+    usage: (stats) -> stats.usageAvailable,
+    bold: true,
+  },
+  {
+    resource: 'Job Limit',
+    usage: (stats) -> stats.jobLimit,
+    bold: true,
+  },
+]
+
+createCloudResourceSpendingsTable = (data) ->
+  TABLE_CONFIG.map((row) -> {
+    resource: row.resource,
+    usage: "$#{row.usage(data).toFixed(2)}",
+    bold: row.bold
+  })
+class NavBarDropdownModel
+  getCloudResourcesModalElement: () ->
+    $('#cloud_resources_modal')
+  # First and foremost apologies my sincerest apologies to knockoutJS gods, this is not creation as it was originally intended
+  # these params are passed, because this fn is invoked with "afterRender" template workaround
+  # No idea what is happening
+  loadStats: (isLoadingObservable, resourceTableObservable) ->
+    error = false
+    isLoadingObservable(true)
+    $.ajax('/api/user/cloud_resources', {
+      method: 'GET',
+      contentType: 'application/json',
+      dataType: 'json',
+      jsonp: false,
+      success: (data) ->
+        data
+      error: (xhr, status, err) ->
+        Precision.alert.showAboveAll('Something went wrong while loading cloud user spendings')
+        error = true
+    }).done((data) =>
+      table = createCloudResourceSpendingsTable(data)
+      resourceTableObservable(table)
+    ).always(=>
+      isLoadingObservable(false)
+    )
+  showCloudResourcesModal: () ->
+    # Need to reinitialize element, because template rendering most likely occurs between constructor and "loadStats" call, that invalidates the ref
+    @cloudResourcesModal = @getCloudResourcesModalElement() if @cloudResourcesModal.length == 0
+    @cloudResourcesModal.modal('show')
+  constructor: (tableConfig) ->
+    @cloudResourcesModal = @getCloudResourcesModalElement()
+    @resourceTable = ko.observable()
+    @isLoading = ko.observable(false)
+
+
+$(document).ready(() =>
+  $headerContainer = $("body header")
+  viewModel = new NavBarDropdownModel()
+  ko.applyBindings(viewModel, $headerContainer[0])
+)
diff --git a/app/assets/javascripts/_precision/precision.selector.coffee b/app/assets/javascripts/_precision/precision.selector.coffee
index e3eb405f4..92c9929e7 100644
--- a/app/assets/javascripts/_precision/precision.selector.coffee
+++ b/app/assets/javascripts/_precision/precision.selector.coffee
@@ -19,7 +19,6 @@ class SelectorModel
       if element && isFile && scrolledDown && notAllLoaded && notBusy
         context.$data.getObjects(currentNumberOfObjects)
 
-
   constructor: (@opts) ->
     @id = _.uniqueId('object-selector-modal-')
     @modal = null
@@ -34,11 +33,21 @@ class SelectorModel
     @busy = ko.observable(false)
     @saving = ko.observable(false)
     @error = ko.observable()
+    @numAllObjects = ko.observable(0)
 
     @filterByOwned = ko.observable(false)
 
     @calls = []
     @callsDeferred = $.Deferred()
+    
+    @tabSelected = ko.observable('')
+    @filesTabSelected = ko.computed( =>
+      if (@tabSelected == 'file')
+        return true
+      else
+        return false
+    )
+    @filteredObjects = ko.observableArray()
 
     @selectedList = new ObjectListModel(this, {
       className: "selected"
@@ -66,6 +75,10 @@ class SelectorModel
       !@busy() && !@saving() && !_.isEmpty(@selected())
     )
 
+    @canSaveAll = ko.computed(=>
+      !@busy() && !@saving() && !_.isEmpty(@filteredObjects())
+    )
+
     @hasError = ko.computed(=>
       @error()?
     )
@@ -136,6 +149,21 @@ class SelectorModel
         @saving(false)
       )
 
+  saveAll: () =>
+    @saving(true)
+    @error(null)
+    @opts.onSave(@filteredObjects())
+      .done((data, hideModal = true) =>
+        if hideModal
+          @modal.modal('hide')
+          @saving(false)
+        @opts.onAfterSave?()
+      )
+      .fail(() =>
+        @onError()
+        @saving(false)
+      )    
+
   onError: (e) =>
     console.error(e.status, e.statusText, e.responseText)
     if e.responseText? && _.isObject(e.responseText)
@@ -158,6 +186,7 @@ class ObjectListModel
     @apiParams = config.apiParams ? {}
     @selectable = config.selectable ? false
     @totalCount = 0
+    @lastQuery = undefined
 
     @busy = ko.observable(false)
 
@@ -180,12 +209,18 @@ class ObjectListModel
       if @className != "selected"
         objects = @filterByProperty(objects, 'owned') if @selectorModel.filterByOwned()
 
-      if @className == 'file' && @totalCount != @objects().length && !_.isEmpty(@filterQuery())
+      if @className == 'file' && @totalCount != @objects().length && !_.isEmpty(@filterQuery()) && @lastQuery == undefined
         @objects.removeAll()
         @getObjects(0, @totalCount)
 
-      objects = @filterSetOfObjects(objects, @patternQuery()) if @patternQuery()?
-      objects = @filterSetOfObjects(objects, @filterQuery())
+      if @lastQuery != @filterQuery() && @name == 'Files'
+        @objects.removeAll()
+        @lastQuery = @filterQuery()
+        @getObjects(0, 1000, @lastQuery)
+      else
+        objects = @filterSetOfObjects(objects, @patternQuery()) if @patternQuery()?
+        objects = @filterSetOfObjects(objects, @filterQuery())
+        
       objects = _.sortBy(objects, 'name')
       return objects
     )
@@ -198,16 +233,23 @@ class ObjectListModel
       _.size(@activeRelatedObjects()) > 0
     )
 
+  clickTab: () ->
+    @selectorModel.tabSelected($(this)[0].className)
+
   clearActiveRelated: () ->
     @activeRelatedObjects([])
 
-  getObjects: (offset = 0, limit = 100) ->
+  getObjects: (offset = 0, limit = 100, query = '') ->
     return $.Deferred().resolve() if !@apiEndpoint?
+    @selectorModel.busy(true)
+    @busy(true)
     accessibleScope = @selectorModel.listRelatedParams.scopes
+
     if @className == 'file'
       @apiParams['offset'] = offset
       @apiParams['limit'] = limit
       @apiParams['scopes'] = accessibleScope
+      @apiParams['search_string'] = query
 
     params = _.defaults(@apiParams, {
       describe: {
@@ -220,7 +262,6 @@ class ObjectListModel
     })
 
     @objects.removeAll() unless @className == 'file'
-    @busy(true)
     Precision.api("/api/#{@apiEndpoint}", params, (result) =>
       @totalCount = result['count'] if result['count']
       objects = if result['objects'] then result['objects'] else result
@@ -229,9 +270,13 @@ class ObjectListModel
         @selectorModel.objectsHash[objectModel.uid] = objectModel
         objectModel
       )
-      @objects(@objects().concat(objectModels))
+      if (@className == 'file')
+        @selectorModel.numAllObjects(objectModels.length)
+        @selectorModel.filteredObjects(objectModels)
+      @objects(objectModels)
     ).always(=>
       @busy(false)
+      @selectorModel.busy(false)
     )
 
   filterByProperty: (objects, property) ->
diff --git a/app/assets/javascripts/_precision/precision.utils.coffee b/app/assets/javascripts/_precision/precision.utils.coffee
index 20bee696d..3ce7622b0 100644
--- a/app/assets/javascripts/_precision/precision.utils.coffee
+++ b/app/assets/javascripts/_precision/precision.utils.coffee
@@ -93,3 +93,13 @@ window.Precision.utils =
         _getData()
       scrollPos = $parentNodeDIV.scrollTop()
     $parentNodeDIV.on 'scroll', onScrollHandler
+
+  replaceSpaceSubstringWithNbsps: (string, substringLength) -> 
+    spaceFill = Array(substringLength).fill(' ').join('')
+    nbspFill = Array(substringLength).fill('\xa0').join('')
+    string.replace(spaceFill, nbspFill)
+
+  sanitizeInstanceTypeNbsp: (instanceType) -> {
+    label: @replaceSpaceSubstringWithNbsps(instanceType.label, 4)
+    value: instanceType.value
+  }
diff --git a/app/assets/javascripts/admin/invitations/invitations.coffee b/app/assets/javascripts/admin/invitations/invitations.coffee
new file mode 100644
index 000000000..9b2e0a293
--- /dev/null
+++ b/app/assets/javascripts/admin/invitations/invitations.coffee
@@ -0,0 +1,189 @@
+MAX_USERS = 5
+
+class InvitationModel
+  constructor: (@original) ->
+    @id = @original.id
+    @firstName = ko.observable(@original.first_name)
+    @lastName = ko.observable(@original.last_name)
+    @email = ko.observable(@original.email)
+    @duns = ko.observable(@original.duns)
+    @errors = ko.observableArray([])
+    @success = ko.observable(false)
+
+class PageInvitationsView
+  showGridModal: () ->
+    @gridModal.modal('show')
+    @invitationGridLoading(true)
+    @invitationsDataGrid.ajax.reload((json) =>
+      @invitationGridLoading(false)
+    )
+
+  renderSearchInvLabel: (item) ->
+    "#{item.email} | #{item.first_name} #{item.last_name}"
+
+  clearInvitations: () ->
+    @invitations.removeAll()
+
+  removeInvitation: (data) =>
+    @invitations.remove(data)
+
+  handleResponse: (data) =>
+    noErrors = true
+    @undoneInvitations().forEach((invitation) =>
+      errors = data[invitation.id].errors
+      invitation.errors(errors)
+      invitation.success(errors.length == 0)
+      noErrors = false if errors.length
+      @provisionedUsernames.push(data[invitation.id].user.username) if invitation.success()
+    )
+    return noErrors
+
+  provisionUsers: () ->
+    $('#disable-screen-modal').modal('show')
+    data = {}
+    @undoneInvitations().forEach((invitation) ->
+      data[invitation.id] = {
+        first_name: invitation.firstName(),
+        last_name: invitation.lastName(),
+        email: invitation.email(),
+        duns: invitation.duns(),
+      }
+    )
+    $.post('/admin/invitations/provision', { invitations: data })
+      .then(
+        (data) =>
+          responseIsOk = @handleResponse(data)
+
+          if responseIsOk
+            successMessage = "You have successfully provisioned the following users: " +
+                              @provisionedUsernames().join(", ")
+            Precision.alert.showAfterReload(successMessage, 'alert-success', true)
+            window.location.reload()
+          else
+            $('#disable-screen-modal').modal('hide')
+            Precision.alert.showAboveAll('Some fields filled in incorrectly.', 'alert-warning')
+          @provisionedUsernames([])
+        (error) ->
+          try
+            message = JSON.parse(error.responseText)["error"]
+          catch
+            message = null
+
+          message = message || 'Something went wrong while provisioning users'
+
+          Precision.alert.showAboveAll(message)
+          $('#disable-screen-modal').modal('hide')
+      )
+
+  selectUser: (e, invitation) ->
+    @selectedInvitations.push(invitation) if e.target.checked
+    @selectedInvitations.remove(invitation) if !e.target.checked
+
+  addSelectedUsers: () ->
+    @selectedInvitations().forEach((invitation) =>
+      @invitations.push(new InvitationModel(invitation))
+    )
+    @selectedInvitations([])
+    @gridModal.modal('hide')
+
+  constructor: (params) ->
+    @countries = params.countries.map((country) -> { id: country[1], name: country[0] })
+    @gridModal = $('#invitation_grid_modal')
+    @invitationGridLoading = ko.observable(false)
+    @selectedInvitations = ko.observableArray([])
+    @invitations = ko.observableArray([])
+    @provisionedUsernames = ko.observableArray([])
+    @undoneInvitations = ko.computed(() =>
+      @invitations().filter((invitation) -> !invitation.success())
+    )
+    @invitationsExclude = ko.computed(() =>
+      @invitations().map((invitation) -> invitation.id)
+    )
+    @addSelectedEnabled = ko.computed(() => @selectedInvitations().length)
+
+    @invitationsDataGrid = $('#invitations_data_grid').DataTable({
+      ajax: {
+        url: '/admin/invitations/browse',
+        type: 'POST',
+        data: () => { exclude: @invitationsExclude() },
+        dataSrc: ''
+      },
+      columns: [
+        { data: 'id' },
+        { data: 'first_name' },
+        { data: 'last_name' },
+        { data: 'email' },
+        { data: 'duns' },
+        { data: 'created_at' },
+      ],
+      "columnDefs": [
+        {
+          targets: 0,
+          orderable: false,
+          data: 'id',
+          render: (data) ->
+            "<input value=\"#{data}\" type=\"checkbox\" class=\"select-user\" />"
+        }
+      ],
+      order: [[ 5, "desc" ]]
+    })
+    @searchDataGridContainer = $('#invitations_data_grid_filter input', @gridModal)
+    @searchValue = document.getElementById('search_input')
+    @searchedInvitations = []
+    @search = new Precision.autocomplete({
+      inputNode: @searchValue,
+      getOptionsAsync: (searchStr) =>
+        return $.post('/admin/invitations/search', {
+          query: searchStr,
+          exclude: @invitationsExclude()
+        }).then(
+          (data) =>
+            data = data.filter((item) =>
+              filter = true
+              @invitations().forEach((inv) -> filter = false if inv.id == item.id)
+              return filter
+            )
+            @searchedInvitations = data
+            return data.map (item) => { value: item.id, label: @renderSearchInvLabel(item) }
+          (error) ->
+            Precision.alert.showAboveAll('Something went wrong while searching invitations')
+        )
+    })
+    $(@search.nodes.inputNode).on @search.eventNames.OPTION_CLICK, (e, data) =>
+      @search.clearInput()
+      _invitation = @searchedInvitations.filter((invitation) -> invitation.id.toString() == data)
+      invitation = _invitation.length and _invitation[0]
+      @invitations.push(new InvitationModel(invitation, @countries))
+
+    @selectionDisabled = ko.computed(() =>
+      disabled = @invitations().length >= MAX_USERS
+      @search.disabled(disabled)
+      return disabled
+    )
+
+    @gridModal.on 'hidden.bs.modal', () =>
+      @selectedInvitations([])
+      @invitationsDataGrid.search("").draw() if @searchDataGridContainer.val()
+
+AdminProvisionController = Paloma.controller('Admin/Invitations', {
+  index: ->
+    $container = $("body main")
+    viewModel = new PageInvitationsView(@params)
+    ko.applyBindings(viewModel, $container[0])
+
+    $('#invitations_data_grid').on 'change', 'tbody td', (e) ->
+      if e.target.classList.contains('select-user')
+        idx = viewModel.invitationsDataGrid.cell(this).index().row
+        data = viewModel.invitationsDataGrid.cells( idx, '' ).render( 'display' )
+        viewModel.selectUser(e, data.data()[idx])
+
+        invCount = viewModel.selectedInvitations().length + viewModel.invitations().length
+        disabled = invCount >= MAX_USERS
+
+        $('input.select-user').each((index, checkbox) ->
+          checkbox.setAttribute('disabled', true) if disabled and !checkbox.checked
+          checkbox.removeAttribute('disabled') if !disabled
+        )
+
+      return false
+})
diff --git a/app/assets/javascripts/analyses/new.coffee b/app/assets/javascripts/analyses/new.coffee
index 110028331..104a1685f 100644
--- a/app/assets/javascripts/analyses/new.coffee
+++ b/app/assets/javascripts/analyses/new.coffee
@@ -5,6 +5,7 @@ class WorkflowViewModel
     @errorMessage = ko.observable()
     @isRunning = ko.observable(false)
     @accessibleScope = workflow.scopes
+    @scope = workflow.scope
     @stages = ko.computed( =>
       for io in workflow.spec.input_spec.stages
         new stageModel(io, @accessibleScope)
@@ -39,6 +40,12 @@ class WorkflowViewModel
   data_inputs: (data) ->
     ko.utils.arrayFilter(data.inputs(), (input) -> !input.values.id?)
 
+  isInSpace: (scope) ->
+    return scope.startsWith('space-') if scope?
+  
+  getSpaceId: (scope) ->
+    return scope.substring(scope.indexOf('-') + 1);
+
   run_workflow: () =>
     @isRunning(true)
     inputs = []
@@ -80,7 +87,7 @@ class WorkflowViewModel
     }
     Precision.api('/api/run_workflow', params)
       .done( =>
-        window.location.replace("/home/workflows/#{@workflowUid}")
+        window.location.replace(if (@isInSpace(@scope)) then "/spaces/#{@getSpaceId(@scope)}/workflows/#{@workflowUid}" else "/home/workflows/#{@workflowUid}")
     )
       .fail((error) =>
         @isRunning(false)
diff --git a/app/assets/javascripts/application.coffee b/app/assets/javascripts/application.coffee
index 7213952d6..63b89c76d 100644
--- a/app/assets/javascripts/application.coffee
+++ b/app/assets/javascripts/application.coffee
@@ -55,4 +55,6 @@
 #= require jquery.caret.min.js
 #= require bootstrap-select/bootstrap-select.min.js
 #= require bundle.js
+#= require datatables.net
+#= require datatables.net-bs
 #= require_tree .
diff --git a/app/assets/javascripts/apps/batch_app.coffee b/app/assets/javascripts/apps/batch_app.coffee
index c5e454c70..c4de3ef81 100644
--- a/app/assets/javascripts/apps/batch_app.coffee
+++ b/app/assets/javascripts/apps/batch_app.coffee
@@ -1,10 +1,11 @@
 class BatchAppNewView
-  constructor: (app, @asset_licenses_to_accept, selectable_spaces, available_content_scopes) ->
+  constructor: (app, @asset_licenses_to_accept, selectable_spaces, available_content_scopes, instance_types) ->
     @uid = app.uid
     @inputSpec = app.spec.input_spec
     @outputSpec = app.spec.output_spec
 
-    @availableInstances = Precision.INSTANCES
+    @availableInstances = instance_types.map (instance_type) -> window.Precision.utils.sanitizeInstanceTypeNbsp(instance_type) 
+ 
     @defaultInstanceType = app.spec.instance_type
     @instanceType = ko.observable(app.spec.instance_type)
     @selectableSpaces = selectable_spaces
@@ -60,7 +61,7 @@ class BatchAppNewView
     )
 
     @isRunnable = ko.computed(() =>
-      isConfigReady = !_.isEmpty(@name())
+      isConfigReady = !_.isEmpty(@name()) && !_.isEmpty(@instanceType())
       areBatchInputsReady = _.every(@batchInputSpec(), (input) -> input.isReady())
       areOtherInputsReady = _.every(@otherInputSpec(), (input) -> input.isReady())
       areInputsReady = areBatchInputsReady && areOtherInputsReady
@@ -122,9 +123,7 @@ class BatchAppNewView
     @inputModels(newInputModels)
 
   removeItem: (item) =>
-    if @batchInputSpec()[0].defaultValue
-      selectedFiles = []
-    else if @batchInputSpec()[0].value().length > 0
+    if @batchInputSpec()[0].value().length > 0
       selectedFiles = @batchInputSpec()[0].value().filter (el) -> el.uid != item.uid
     @batchInputSpec()[0].value(selectedFiles)
 
@@ -231,7 +230,8 @@ AppsController = Paloma.controller('Apps', {
       @params.app,
       @params.licenses_to_accept,
       @params.selectable_spaces,
-      @params.content_scopes
+      @params.content_scopes,
+      @params.instance_types,
     )
     ko.applyBindings(viewModel, $container[0])
 
diff --git a/app/assets/javascripts/apps/edit.coffee b/app/assets/javascripts/apps/edit.coffee
index 5c3497c4f..2e511efab 100644
--- a/app/assets/javascripts/apps/edit.coffee
+++ b/app/assets/javascripts/apps/edit.coffee
@@ -9,7 +9,12 @@
 AppsController = Paloma.controller('Apps',
   edit: ->
     $container = $("body main")
-    viewModel = new Precision.models.AppEditorModel(@params.app, @params.ubuntu_releases, 'edit')
+    viewModel = new Precision.models.AppEditorModel(
+      @params.app,
+      @params.ubuntu_releases,
+      @params.instance_types.map (instance_type) -> window.Precision.utils.sanitizeInstanceTypeNbsp(instance_type),
+      'edit',
+    )
 
     ko.applyBindings(viewModel, $container[0])
 )
diff --git a/app/assets/javascripts/apps/fork.coffee b/app/assets/javascripts/apps/fork.coffee
index ad658b26e..1006aae7c 100644
--- a/app/assets/javascripts/apps/fork.coffee
+++ b/app/assets/javascripts/apps/fork.coffee
@@ -9,7 +9,11 @@
 AppsController = Paloma.controller('Apps',
   fork: ->
     $container = $("body main")
-    viewModel = new Precision.models.AppEditorModel(@params.app, @params.ubuntu_releases, 'fork')
-
+    viewModel = new Precision.models.AppEditorModel(
+      @params.app,
+      @params.ubuntu_releases,
+      @params.instance_types.map (instance_type) -> window.Precision.utils.sanitizeInstanceTypeNbsp(instance_type),
+      'fork'
+    )
     ko.applyBindings(viewModel, $container[0])
 )
diff --git a/app/assets/javascripts/apps/new.coffee b/app/assets/javascripts/apps/new.coffee
index 459c90cc6..622216ddf 100644
--- a/app/assets/javascripts/apps/new.coffee
+++ b/app/assets/javascripts/apps/new.coffee
@@ -150,11 +150,19 @@ class NewAppViewModel extends Precision.models.AppEditorModel
           Precision.alert.showAboveAll(text)
     })
 
+  hideAppModal: () ->
+    window.open("/home/apps/#{@newAppUid()}")
+    @importSuccessModal.modal('hide')
+
+  hideAssetModal: () ->
+    window.open("/home/assets/#{@newAssetUid()}")
+    @importSuccessModal.modal('hide')
+
   wdlTextValueOnInput: (root, e) =>
     @wdlTextValue(e.target.value)
 
-  constructor: (data, ubuntuReleases) ->
-    super(data, ubuntuReleases, 'new')
+  constructor: (data, ubuntuReleases, instanceTypes) ->
+    super(data, ubuntuReleases, instanceTypes, 'new')
     @importModal = $('#import_cwl_wdl_modal')
     @importSuccessModal = $('#import_cwl_wdl_success_modal')
     @wdlFileInput = $('#wdl_file_input')
@@ -164,8 +172,8 @@ class NewAppViewModel extends Precision.models.AppEditorModel
     @wdlTextValue = ko.observable()
     @newAppUid = ko.observable()
     @newAssetUid = ko.observable()
-    @newAppURL = ko.computed(=> "/apps/#{@newAppUid()}")
-    @newAssetURL = ko.computed(=> "/assets/#{@newAssetUid()}")
+    @newAppURL = ko.computed(=> "/home/apps/#{@newAppUid()}")
+    @newAssetURL = ko.computed(=> "/home/assets/#{@newAssetUid()}")
     @dockerImage = ko.observable(null)
     @modalTitle = ko.computed(() =>
       switch @importType()
@@ -200,6 +208,10 @@ class NewAppViewModel extends Precision.models.AppEditorModel
 AppsController = Paloma.controller('Apps', {
   new: ->
     $container = $("body main")
-    viewModel = new NewAppViewModel(@params.app, @params.ubuntu_releases)
+    viewModel = new NewAppViewModel(
+      @params.app,
+      @params.ubuntu_releases,
+      @params.instance_types.map (instance_type) -> window.Precision.utils.sanitizeInstanceTypeNbsp(instance_type),
+    )
     ko.applyBindings(viewModel, $container[0])
 })
diff --git a/app/assets/javascripts/challenges/edit_page.coffee b/app/assets/javascripts/challenges/edit_page.coffee
index 1bd8999d3..aa6f09993 100644
--- a/app/assets/javascripts/challenges/edit_page.coffee
+++ b/app/assets/javascripts/challenges/edit_page.coffee
@@ -1,17 +1,17 @@
 ### Show error for ContentTools dialog ###
-#= require ./content_tools/dialog_errors.coffee
+#= require ./content_tools/dialog_errors
 
 ### ContentTools VideoDialog Monkeypatch ###
 ### Aim - add url validation ###
-#= require ./content_tools/video_dialog.coffee
+#= require ./content_tools/video_dialog
 
 ### ContentTools ImageDialog Monkeypatch ###
 ### Aim - change upload image dialog ###
-#= require ./content_tools/image_dialog.coffee
+#= require ./content_tools/image_dialog
 
 ### ContentTools PropertiesDialog Monkeypatch ###
 ### Aim - prohibit to insert DOM nodes ###
-#= require ./content_tools/properties_dialog.coffee
+#= require ./content_tools/properties_dialog
 
 class EditorModel
 
diff --git a/app/assets/javascripts/challenges/new.coffee b/app/assets/javascripts/challenges/new.coffee
index cff03fe20..4a42202a2 100644
--- a/app/assets/javascripts/challenges/new.coffee
+++ b/app/assets/javascripts/challenges/new.coffee
@@ -128,25 +128,26 @@ init_file_form_view = (data) ->
     .on("click.files.new", ".event-upload-image", (e) -> viewModel.handleUpload(e))
     .on("click.files.new", ".event-clear-files", (e) -> viewModel.handleClear(e))
 
-init_datetimepickers = () ->
+init_datetimepickers = (data) ->
   inputs = $('.add-datetimepicker')
+  timeZone =  data.time_zone.replace(' - ', '/')
   for input in inputs
     new Precision.Datepicker(input, {
       noDefaultValue: true,
-      icon: true
-    })
-
+      icon: true,
+    }, {timeZone: timeZone})
+ 
 MainController = Paloma.controller('Challenges', {
   create: ->
-    init_datetimepickers()
+    init_datetimepickers(@params)
     init_file_form_view(@params)
   update: ->
-    init_datetimepickers()
+    init_datetimepickers(@params)
     init_file_form_view(@params)
   new: ->
-    init_datetimepickers()
+    init_datetimepickers(@params)
     init_file_form_view(@params)
   edit: ->
-    init_datetimepickers()
+    init_datetimepickers(@params)
     init_file_form_view(@params)
-})
+})
\ No newline at end of file
diff --git a/app/assets/javascripts/jobs/new.coffee b/app/assets/javascripts/jobs/new.coffee
index f3f5939b6..a13b21441 100644
--- a/app/assets/javascripts/jobs/new.coffee
+++ b/app/assets/javascripts/jobs/new.coffee
@@ -1,9 +1,11 @@
 class JobsNewView
-  constructor: (app, @asset_licenses_to_accept, selectable_spaces, available_content_scopes) ->
+  constructor: (app, @asset_licenses_to_accept, selectable_spaces, available_content_scopes, job_limit, instance_types) ->
     @uid = app.uid
     @available_content_scopes = available_content_scopes
     @inputSpec = app.spec.input_spec
     @outputSpec = app.spec.output_spec
+    @maxJobLimit = job_limit
+    @jobLimit = ko.observable(job_limit)
 
     @licenseSelector = new Precision.models.LicensesSelectorModel({
       onAcceptCallback: @run
@@ -41,20 +43,24 @@ class JobsNewView
       )
     )
 
+    @availableInstances = instance_types
+
+    @selectableSpaces = selectable_spaces
+    @defaultInstanceType = app.spec.instance_type if app.spec.instance_type in instance_types.map (instance_type) -> instance_type.value
+    @instanceType = ko.observable(app.spec.instance_type)
+
     @isRunnable = ko.computed(() =>
-      isConfigReady = !_.isEmpty(@name())
+      isConfigReady = !_.isEmpty(@name()) && !_.isEmpty(@instanceType()) && @jobLimit() != ''
+      # parsedJobLimit = parseInt(@jobLimit(), 10)
+      # isJobLimitInRange = parsedJobLimit >= 0 && parsedJobLimit <= @maxJobLimit
       areInputsReady = _.every(@inputModels(), (inputModel) ->
         inputModel.isReady()
       )
 
       return !@busy() && isConfigReady && areInputsReady
+      #&& isJobLimitInRange
     )
 
-    @availableInstances = Precision.INSTANCES
-    @selectableSpaces = selectable_spaces
-    @defaultInstanceType = app.spec.instance_type
-    @instanceType = ko.observable(app.spec.instance_type)
-
   validateLicenses: () ->
     # Reset licenses and recompute which ones to accept
     licensesToAccept = _.clone(@asset_licenses_to_accept ? [])
@@ -76,6 +82,7 @@ class JobsNewView
       params = {
         id: @uid,
         name: @name.peek(),
+        job_limit: @jobLimit(),
         inputs: {}
       }
 
@@ -91,7 +98,7 @@ class JobsNewView
       Precision.api('/apps/run', params)
         .done((rs) =>
           if !rs.error?
-            window.location = if @spaceId() then "/spaces/#{@spaceId()}/jobs" else "/home/apps/#{@uid}/jobs"
+            window.location = if @spaceId() then "/spaces/#{@spaceId()}/executions/#{rs.id}" else "/home/jobs/#{rs.id}"
           else
             @busy(false)
             @running(false)
@@ -119,7 +126,9 @@ JobsController = Paloma.controller('Jobs', {
       @params.app,
       @params.licenses_to_accept,
       @params.selectable_spaces,
-      @params.content_scopes
+      @params.content_scopes,
+      @params.job_limit,
+      @params.instance_types.map (instance_type) -> window.Precision.utils.sanitizeInstanceTypeNbsp(instance_type),
     )
     ko.applyBindings(viewModel, $container[0])
 
diff --git a/app/assets/javascripts/profile/index.coffee b/app/assets/javascripts/profile/index.coffee
index 0ecd9c3e7..3d22d8bb3 100644
--- a/app/assets/javascripts/profile/index.coffee
+++ b/app/assets/javascripts/profile/index.coffee
@@ -13,25 +13,8 @@ class ProfileContactsModel
   setDefaults: (continueEditing) =>
     vals = @contactsDefaults()
 
-    @country(getCountryId(vals))
-    @countryName(getCountryName(vals))
-    $(COUNTRY_SELECT).trigger('change')
-
     @email(vals.email || '')
     @emailConfirmed(vals.email_confirmed || '')
-    @address1(vals.address1 || '')
-    @address2(vals.address2 || '')
-    @city(vals.city || '')
-    @postalCode(vals.postal_code || '')
-    @phoneCountryCodeValue(getCountryCode(vals))
-    @phoneInput.setValue(vals.phone || '')
-    @phoneInputValue(vals.phone || '')
-    @isPhoneInputValid(@phoneInput.validate(@phoneCountryCodeValue()))
-
-    @state(vals.us_state || '')
-    @phoneCountryCode(getCountryCodeId(vals))
-    # @phoneConfirmed(vals.phone_confirmed)
-    @phoneConfirmed(true)
 
     @isLoading(false)
     if !continueEditing
@@ -126,140 +109,32 @@ class ProfileContactsModel
             @authCredentialsModal.isLoading(false)
       })
 
-  phoneInputOnChange: (value = '') =>
-    @phoneInputValue(value)
-    @isPhoneInputValid(@phoneInput.validate(@phoneCountryCodeValue()))
-    # @phoneConfirmed(false)
-
-  saveMobilePhone: (phoneModal) =>
-    if @phoneConfirmed()
-      @isLoading(true)
-      $.ajax({
-        method: 'PUT',
-        url: '',
-        contentType: 'multipart/form-data',
-        data: {
-          profile: {
-            phone: @phoneInputValue(),
-            phone_country_id: @phoneCountryCode()
-            phone_confirmed: true
-          }
-        },
-        success: (data) =>
-          Precision.alert.showAboveAll('Phone successfully verified and saved!', 'alert-success')
-          phoneModal.modal.modal('hide')
-          @contactsDefaults(data)
-          @setDefaults(true)
-        error: (data) =>
-          try
-            errors = JSON.parse(data.responseText)
-            errorText = ''
-            for field, error of errors
-              errorText += "<b>Error: </b>#{field} #{error}<br>"
-            Precision.alert.showAboveAll(errorText)
-          catch
-            Precision.alert.showAboveAll('Something went wrong.')
-          finally
-            phoneModal.modal.modal('hide')
-            phoneModal.isLoading(false)
-            @isLoading(false)
-      })
-
   showCredentialsModal: (root, e) ->
     e.preventDefault()
     @authCredentialsModal.showModal()
 
   constructor: (params, contactsDefaults = {}) ->
     @contactsForm = $('#profile_form')
-    @phoneForm = $('#profile_phone_form')
     @isEditing = ko.observable(false)
     @isLoading = ko.observable(false)
     @pristin = ko.observable(true)
     @contactsDefaults = ko.observable(contactsDefaults)
 
-    @address1 = ko.observable('')
-    @address2 = ko.observable('')
-    @city = ko.observable('')
-    @country = ko.observable('')
-    @countryName = ko.observable('')
-    @state = ko.observable('')
-    @postalCode = ko.observable('')
-
     ### Email Edit ###
     @authCredentialsModal = new Precision.AuthCredentialsModal(@sendRequest)
     @email = ko.observable('')
     @emailConfirmed = ko.observable(false)
     ### Email Edit ###
 
-    ### Phone ###
-    @phoneInputValue = ko.observable('')
-    @phoneConfirmed = ko.observable(true)
-    @phoneCountryCode = ko.observable('')
-    @phoneCountryCodeValue = ko.observable('')
-    @isPhoneInputValid = ko.observable(false)
-    @phoneFullValue = ko.computed( =>
-      # @phoneConfirmed(false)
-      return "#{@phoneCountryCodeValue().replace(/\s/g, '')}#{@phoneInputValue()}"
-    )
-
-    @phoneInput = new Precision.PhoneInput($(PHONE_INPUT)[0], {
-      onChange: @phoneInputOnChange
-    })
-
-    @disableConfirmPhoneButton = ko.computed(() =>
-      return !@isPhoneInputValid() or !@phoneCountryCodeValue().length
-    )
-    @showConfirmPhoneButton = ko.computed( => @phoneInputValue().length and !@phoneConfirmed())
-    ### Phone ###
 
     @contactsForm.on 'input', (e) =>
       $(e.target).parent().parent().removeClass('has-error')
       @pristin(false)
 
     @emailLabel = ko.computed(=> @email())
-    @address1Label = ko.computed(=> @address1())
-    @address2Label = ko.computed(=> @address2())
-    @cityLabel = ko.computed(=>
-      country = if @country() then "#{@countryName()}, " else ''
-      state = if @state() then "#{@state()}, " else ''
-      city = if @city() then "#{@city()}, " else ''
-      postalCode = if @postalCode() then "#{@postalCode()}" else ''
-      return "#{country}#{state}#{city}#{postalCode}"
-    )
-    @phoneLabel = ko.computed(=> "#{@phoneCountryCodeValue()} #{@phoneInputValue()}")
-
-    $(COUNTRY_SELECT).on 'change', (e) ->
-      e.preventDefault()
-      value = e.target.value
-      $state = $(US_STATE)
-      $code = $(PHONE_COUNTRY_CODE)
-
-      code = Precision.utils.findCountryCode(params.country_codes, value)
-      $code.find('option').each (i, option) ->
-        if option.label == code
-          $code.val(option.value)
-          $code.trigger('change')
-
-      if value == params.usa_id.toString()
-        $state.attr('required', 'required')
-        $state.removeAttr('disabled')
-      else
-        $state.removeAttr('required')
-        $state.attr('disabled', 'disabled')
-        $state.val('')
-
-    $(PHONE_COUNTRY_CODE).on 'change', (e) =>
-      option = $(e.target).find("[value=\"#{e.target.value}\"]")
-      @phoneCountryCodeValue(option[0].label) if option and option[0]
-      @isPhoneInputValid(@phoneInput.validate(@phoneCountryCodeValue()))
-
     @setDefaults()
 
 class ProfilePageView
-  showConfirmPhoneModal: (root, e) ->
-    e.preventDefault()
-    @phoneConfirm.requestCode(root, e)
-
   showEditOrgNameModal: (root, e) ->
     e.preventDefault()
     @editOrgNameModalValue(@orgNameValue.text())
@@ -369,14 +244,6 @@ class ProfilePageView
     @orgId = params.org_id
     @contacts = new ProfileContactsModel(params, contactsDefaults)
     @authCredentialsModal = @contacts.authCredentialsModal
-    @phoneConfirm = new Precision.ConfirmPhoneModal(
-      @contacts.phoneInputValue,
-      @contacts.phoneCountryCodeValue,
-      @contacts.phoneConfirmed,
-      {
-        onSuccessVerify: @contacts.saveMobilePhone
-      }
-    )
 
     ### Deactivate user###
     @deactivateUserModal = new Precision.DeactivateUserModal()
diff --git a/app/assets/javascripts/submissions/new.coffee b/app/assets/javascripts/submissions/new.coffee
index cba6bb8a6..7f570ad01 100644
--- a/app/assets/javascripts/submissions/new.coffee
+++ b/app/assets/javascripts/submissions/new.coffee
@@ -1,5 +1,5 @@
 class SubmissionsView
-  constructor: (app, scopes_permitted, @asset_licenses_to_accept) ->
+  constructor: (app, scopes_permitted, instance_types, @asset_licenses_to_accept) ->
     @contentScopes = ko.observable(scopes_permitted)
     @dxid = app.dxid
     @inputSpec = app.spec.input_spec
@@ -26,7 +26,7 @@ class SubmissionsView
       return !@busy() && areInputsReady && !_.isEmpty(@name()) && !_.isEmpty(@desc())
     )
 
-    @availableInstances = Precision.INSTANCES
+    @availableInstances = instance_types
     @defaultInstanceType = app.spec.instance_type
     @instanceType = ko.observable(app.spec.instance_type)
 
@@ -68,7 +68,13 @@ class SubmissionsView
 ChallengeSubmissionsController = Paloma.controller('Submissions',
   new: ->
     $container = $("body main")
-    viewModel = new SubmissionsView(@params.app, @params.scopes_permitted, @params.licenses_to_accept)
+    viewModel = new SubmissionsView(
+      @params.app,
+      @params.scopes_permitted,
+      @params.instance_types.map (instance_type) -> window.Precision.utils.sanitizeInstanceTypeNbsp(instance_type),
+      @params.licenses_to_accept,
+    )
+    #
     ko.applyBindings(viewModel, $container[0])
 
     $affixContainer = $container.find(".affix-container")
diff --git a/app/assets/javascripts/workflows/edit.coffee b/app/assets/javascripts/workflows/edit.coffee
index 1afb67eb8..fa7da4782 100644
--- a/app/assets/javascripts/workflows/edit.coffee
+++ b/app/assets/javascripts/workflows/edit.coffee
@@ -14,6 +14,7 @@ WorkflowsController = Paloma.controller('Workflows', {
       @params.apps,
       @params.workflow,
       @params.scope,
+      @params.instance_types.map (instance_type) -> window.Precision.utils.sanitizeInstanceTypeNbsp(instance_type),
       'edit'
     )
     ko.applyBindings(viewModel, $container[0])
diff --git a/app/assets/javascripts/workflows/editor/editor.model.coffee b/app/assets/javascripts/workflows/editor/editor.model.coffee
index 38bde8f81..cb820d287 100644
--- a/app/assets/javascripts/workflows/editor/editor.model.coffee
+++ b/app/assets/javascripts/workflows/editor/editor.model.coffee
@@ -259,10 +259,10 @@ class WorkflowEditorModel
         @loadingAllApps(false)
     )
 
-  constructor: (apps, @workflow, scope, @mode = EDIT_MODE) ->
+  constructor: (apps, @workflow, scope, instance_types, @mode = EDIT_MODE) ->
     editableModes = [EDIT_MODE, FORK_MODE]
     isNewModes = [CREATE_MODE, FORK_MODE]
-    @instanceTypes = Precision.INSTANCES
+    @instanceTypes = instance_types
     @readme = ko.observable(@workflow?.readme)
     @readmePreview = ko.computed(=>
       Precision.md.render(@readme())
diff --git a/app/assets/javascripts/workflows/fork.coffee b/app/assets/javascripts/workflows/fork.coffee
index 6551a7b39..242eec046 100644
--- a/app/assets/javascripts/workflows/fork.coffee
+++ b/app/assets/javascripts/workflows/fork.coffee
@@ -14,6 +14,7 @@ WorkflowsController = Paloma.controller('Workflows', {
       @params.apps,
       @params.workflow,
       @params.scope,
+      @params.instance_types,
       'fork'
     )
     ko.applyBindings(viewModel, $container[0])
diff --git a/app/assets/javascripts/workflows/new.coffee b/app/assets/javascripts/workflows/new.coffee
index 6307b5312..ecfa96a4e 100644
--- a/app/assets/javascripts/workflows/new.coffee
+++ b/app/assets/javascripts/workflows/new.coffee
@@ -169,11 +169,19 @@ class NewWorkflowView extends Precision.wfEditor.WorkflowEditorModel
           Precision.alert.showAboveAll(text)
     })
 
+  hideWorkflowModal: () ->
+    window.open("/home/workflows/#{@newWorkflowUid()}")
+    @importSuccessModal.modal('hide')
+
+  hideAssetModal: (data) ->
+    window.open("/home/assets/#{data}")
+    @importSuccessModal.modal('hide')
+
   wdlTextValueOnInput: (root, e) =>
     @wdlTextValue(e.target.value)
 
-  constructor: (apps, scope) ->
-    super(apps, null, scope, 'new')
+  constructor: (apps, scope, instance_types) ->
+    super(apps, null, scope, instance_types, 'new')
     @importModal = $('#import_cwl_wdl_modal')
     @importSuccessModal = $('#import_cwl_wdl_success_modal')
     @wdlFileInput = $('#wdl_file_input')
@@ -183,7 +191,7 @@ class NewWorkflowView extends Precision.wfEditor.WorkflowEditorModel
     @wdlTextValue = ko.observable()
     @newWorkflowUid = ko.observable()
     @newAssetUids = ko.observableArray()
-    @newWorkflowURL = ko.computed(=> "/workflows/#{@newWorkflowUid()}")
+    @newWorkflowURL = ko.computed(=> "/home/workflows/#{@newWorkflowUid()}")
     @dockerImage = ko.observable(null)
     @dockerImagesArray = ko.observableArray([])
     @modalTitle = ko.computed(() =>
@@ -219,7 +227,11 @@ class NewWorkflowView extends Precision.wfEditor.WorkflowEditorModel
 WorkflowsController = Paloma.controller('Workflows', {
   new: ->
     $container = $("body main")
-    viewModel = new NewWorkflowView(@params.apps, @params.scope)
+    viewModel = new NewWorkflowView(
+      @params.apps,
+      @params.scope,
+      @params.instance_types.map (instance_type) -> window.Precision.utils.sanitizeInstanceTypeNbsp(instance_type)
+    )
     ko.applyBindings(viewModel, $container[0])
     Precision.wfEditor.addLoadAppsOnScroll(viewModel)
 })
diff --git a/app/assets/javascripts/workflows/old_editor.coffee b/app/assets/javascripts/workflows/old_editor.coffee
index 3212941a4..1180221fc 100644
--- a/app/assets/javascripts/workflows/old_editor.coffee
+++ b/app/assets/javascripts/workflows/old_editor.coffee
@@ -32,7 +32,7 @@ class WorkflowEditorModel
               inputs: inputs,
               outputs: outputs
             }
-            new_slot = new slotModel(spec, this, stage, true)
+            new_slot = new slotModel(spec, this, @availableInstances, stage, true)
             @slots.push(new_slot)
             if spec.outputs.length > 0
               @eligibleSlots.push(new_slot)
@@ -49,7 +49,7 @@ class WorkflowEditorModel
         current_slot[0].nextSlot(next_slot[0])
       @checkConfiguredSlots()
 
-  constructor: (apps, workflow, @mode = 'edit') ->
+  constructor: (apps, workflow, instance_types, @mode = 'edit') ->
     @workflow = workflow
     @all_apps = ko.observableArray(apps.private_apps.concat(apps.public_apps).sort((a, b) -> a.id - b.id) )
     @private_apps = ko.observableArray(apps.private_apps)
@@ -79,7 +79,7 @@ class WorkflowEditorModel
     @updatingWorkflow = ko.observableArray(false)
     @inputBeingEdited = ko.observableArray()
     @eligibleSlots = ko.observableArray()
-    @availableInstances = Precision.INSTANCES
+    @availableInstances = instance_types
     @numberStagesUnConfigured = ko.computed(=>
       ko.utils.arrayFilter(@slots(), (slot) ->
         if slot.inputs().length > 0
@@ -336,7 +336,7 @@ class WorkflowEditorModel
             revision: app.revision
             inputs: inputs
             outputs: outputs
-          new_slot = new slotModel(spec, this)
+          new_slot = new slotModel(spec, this, @availableInstances)
           @slots.push(new_slot)
           if spec.outputs.length > 0
             @eligibleSlots.push(new_slot)
@@ -481,7 +481,7 @@ class IOModel
       'Set'
 
 class slotModel
-  constructor: (spec, viewModel, stage = null, configured = false) ->
+  constructor: (spec, viewModel, instanceTypes ,stage = null, configured = false) ->
     @id = spec.dxid
     @uid = spec.uid
     @slotId = ko.computed( () ->
@@ -494,7 +494,7 @@ class slotModel
     @name = ko.observable(spec.name)
     @originalName = spec.originalName || spec.name
     @revision = spec.revision
-    @instanceTypes = Precision.INSTANCES
+    @instanceTypes = instanceTypes
     @instanceType = ko.observable(stage?.instanceType || spec?.instanceType)
     @inputs = ko.observableArray()
     @addInputs = ko.computed(=>
diff --git a/app/assets/stylesheets/application.sass b/app/assets/stylesheets/application.sass
index 4e5b90d51..aed751f95 100644
--- a/app/assets/stylesheets/application.sass
+++ b/app/assets/stylesheets/application.sass
@@ -11,6 +11,7 @@
  * file per style scope.
  *= require content-tools.min
  *= require bundle
+ *= require datatables.net-bs/css/dataTables.bootstrap.min
  *= require_self
  *= require_tree .
  *
diff --git a/app/assets/stylesheets/components/autocomplete.sass b/app/assets/stylesheets/components/autocomplete.sass
index dc5058ed9..876aaaa21 100644
--- a/app/assets/stylesheets/components/autocomplete.sass
+++ b/app/assets/stylesheets/components/autocomplete.sass
@@ -58,3 +58,17 @@
         display: block
       &.fa-times
         display: none
+  &--lg
+    .pfda-autocomplete--icon
+      margin-top: 15px
+      font-size: 18px
+    .pfda-autocomplete--icon.fa-times
+      height: 46px
+      margin-top: -46px
+    .pfda-autocomplete--icon.fa-spinner
+      margin-top: -32px
+    .pfda-autocomplete--option
+      padding: 10px 15px
+      height: 46px
+      font-size: 18px
+      line-height: 1.3333333
diff --git a/app/assets/stylesheets/components/nav.sass b/app/assets/stylesheets/components/nav.sass
index 6e2665096..2cb93a7cb 100644
--- a/app/assets/stylesheets/components/nav.sass
+++ b/app/assets/stylesheets/components/nav.sass
@@ -1,8 +1,9 @@
 @import "_common"
 
 .navbar
+  background-color: $navbar-bg-color
   padding-left: $navbar-padding-horizontal
-  padding-right: $navbar-padding-horizontal
+  padding-right: $navbar-padding-horizontal-react
 
   .nav-icon
     color: $navbar-inverse-link-color
@@ -10,6 +11,8 @@
 .navbar-brand
   font-family: $brand-font-family
   font-weight: 300
+  padding-top: 10px
+  padding-bottom: 10px
   font-size: 20px
   letter-spacing: -1px
   display: block
@@ -22,33 +25,49 @@
   li > a
     color: $navbar-inverse-link-color
     font-weight: 400
+    color: #fff
 
     .nav-icon
-      font-size: 28px
+      font-size: 16px
+      color: #fff
 
     &:hover, &:hover .nav-icon
-      color: $brand-blue-subtler
+      color: $brand-blue-tertiary
+
+  li.active > a
+    background-color: $navbar-active-color
 
-  li.active
-    > a, > a:hover, > a:focus
-      background-color: transparent
+    &:hover, &:hover .nav-icon
+      color: #fff
+
+  .dropdown-menu
+    li > a, p 
+      color: $gray-dark
+    // li > p is a workaround
+    li > p
+      margin: 0
+      padding: 3px 20px
+      &:hover
+        cursor: pointer
+        background-color: #f5f5f5
+      
+  .dropdown-toggle
+    li > a
+      background-color: none !important
       color: #fff
-      .nav-icon
-        color: $brand-red-primary
 
 .navbar-nav
   @media (min-width: $grid-float-breakpoint)
     > li
       > a
-        padding-top:    10px
-        padding-bottom: 10px
+        padding: 14px 6px
 
 .nav-spacer
   margin: 10px 0
   padding: 24px 0
-  padding-left: $padding-base-horizontal
-  margin-right: $padding-base-horizontal
-  border-right: 1px solid lighten($brand-blue-primary, 5%)
+  padding-left: $padding-base-horizontal/2
+  margin-right: $padding-base-horizontal/2
+  border-right: 1px solid $navbar-spacer-color
 
 @media (max-width: $screen-sm-min)
   .nav > li.nav-spacer
@@ -58,15 +77,12 @@
   .navbar-nav, .navbar-nav .dropdown a
     text-align: center
 
-  .navbar-brand
-    padding-top: 10px
-    padding-bottom: 10px
 
 @media (min-width: $screen-sm-min)
   .navbar-brand
     height: auto
-    padding-top: 10px
-    padding-bottom: 20px
+    padding-top: 15px
+    padding-bottom: 10px
 
 @media (max-width: $screen-sm-max)
   .navbar-inverse .navbar-nav.nav-links
diff --git a/app/assets/stylesheets/components/track.sass b/app/assets/stylesheets/components/track.sass
index 2d6316234..8fa0608b3 100644
--- a/app/assets/stylesheets/components/track.sass
+++ b/app/assets/stylesheets/components/track.sass
@@ -1,4 +1,6 @@
 @import "_common"
+@import "../../../client/src/styles/variables.sass"
+
 
 $track_private-color: $gray-light
 $track_public-color: $brand-green-primary
@@ -19,6 +21,12 @@ $track_not_yours-color: $brand-red-primary
 .track-intro
   margin-bottom: $padding-large-vertical
 
+.alert-help-remediated
+  color: $color-text-medium-grey !important
+
+.review-doc-text
+  color: $color-darkblueOnLightBlue !important
+
 svg.track-canvas
   .node rect
     fill: transparent
diff --git a/app/assets/stylesheets/site.sass b/app/assets/stylesheets/site.sass
index 3a6ff3ec6..d0f613c10 100644
--- a/app/assets/stylesheets/site.sass
+++ b/app/assets/stylesheets/site.sass
@@ -1,6 +1,5 @@
 @import "_common"
 
-
 html, body
   height: 100%
 
@@ -283,6 +282,13 @@ table.table-nowrap
     .modal-footer
       visibility: hidden
 
+.wide-modal
+  .modal-dialog
+    width: auto
+    max-width: 90%
+  .modal-body
+    overflow: auto
+
 #confirm_phone_modal
   .modal-body
     padding-top: 30px
@@ -322,3 +328,6 @@ table.table-nowrap
     overflow: hidden
     max-width: 200px
     line-height: 24px
+
+div.dataTables_wrapper div.dataTables_filter
+  text-align: left
diff --git a/app/assets/stylesheets/variables/_brand_variables.scss b/app/assets/stylesheets/variables/_brand_variables.scss
index 40e7b39c3..b29faffda 100644
--- a/app/assets/stylesheets/variables/_brand_variables.scss
+++ b/app/assets/stylesheets/variables/_brand_variables.scss
@@ -34,6 +34,10 @@ $link-muted-hover-color: darken($brand-blue-secondary, 10%);
 $brand-font-family:  "Quicksand", "Lato", "Helvetica Neue", Helvetica, Arial, sans-serif !default;
 
 $nav-height: 74px;
+$navbar-padding-horizontal-react:  32px !default;
+$navbar-bg-color :#343E4D;
+$navbar-active-color: #2f5373;
+$navbar-spacer-color: #5f768a;
 
 $border-header-color: darken($brand-blue-subtler, 4%);
 $border-default-color: #ddd;
diff --git a/app/assets/stylesheets/views/challenges.sass b/app/assets/stylesheets/views/challenges.sass
index b92e4415f..96252c209 100644
--- a/app/assets/stylesheets/views/challenges.sass
+++ b/app/assets/stylesheets/views/challenges.sass
@@ -1,4 +1,6 @@
 @import "_common"
+@import "../../../client/src/styles/variables.sass"
+@import "../variables/_brand_variables.scss"
 
 .pfda-controller-challenges.pfda-action-edit_page
   [data-editable].container
@@ -297,4 +299,33 @@ th.ce-element--type-table-cell
       text-shadow: 0px 0px 50px #aaa
 
   .challenge-description
-    font-weight: 300
\ No newline at end of file
+    font-weight: 300
+  
+select[disabled].disabledTextColor, input[disabled].disabledTextColor
+  color: $color-disabledBlackTextOnGrey
+
+.challenges-description
+  color: $color-blacktextOnWhite !important
+
+.challenge-upload-image-text
+  color: $color-blacktextOnWhite !important
+
+.challenges-announce-result
+  background-color: $color-brownOnWhite !important
+  border-color: $color-borderBrownOnWhite !important
+
+.remediation-page-header
+  font-weight: 500
+  color: $color-darkGreyOnGrey !important
+
+.upload-modal-remediated-color
+  color: $color-darkblueOnLightBlue !important
+
+.remediated-uploadbutton-color
+  background-color: $color-buttonGreenOnWhite !important
+
+.tab-label.navigation-header-grey
+  color: $color-greyOnLightBlue !important
+
+.active a.tab-label.navigation-header-grey
+  color: $brand-blue-primary !important
diff --git a/app/assets/stylesheets/views/experts.sass b/app/assets/stylesheets/views/experts.sass
index 246c3a51a..d7288cc9a 100644
--- a/app/assets/stylesheets/views/experts.sass
+++ b/app/assets/stylesheets/views/experts.sass
@@ -1,4 +1,5 @@
 @import "_common"
+@import "../../../client/src/styles/variables.sass"
 
 .expert-question
   margin-top: 10px
@@ -28,3 +29,34 @@
   color: black
   line-height: 1.7
   font-weight: normal
+
+.ff-label-color
+  color: $color-greyTextOnWhite !important
+
+.expert-upload-image-text
+  color: $color-blacktextOnWhite !important
+
+.private-button
+  background-color: $color-brownOnWhite !important
+
+.closed-button
+  background-color: #737373 !important
+
+.open-button
+  background-color: $color-buttonGreenOnWhite !important
+
+.remediated-text-grey
+  color: $color-greyTextOnWhite !important
+
+.introduction-text
+  color: $color-greyOnLightBlue !important
+
+.remediated-question-blue
+  color: $color-blueOnWhite !important
+
+.expert-header-remediation h1
+  font-weight: 400
+  font-size: 30px
+  margin: 0
+  word-wrap: break-word
+  color: $color-darkGreyOnGrey !important
diff --git a/app/assets/stylesheets/views/invitations.sass b/app/assets/stylesheets/views/invitations.sass
new file mode 100644
index 000000000..6785f2ee8
--- /dev/null
+++ b/app/assets/stylesheets/views/invitations.sass
@@ -0,0 +1,39 @@
+@import "_common"
+
+$invitations-search-width: 900px
+
+.pfda-controller-invitations.pfda-action-index
+  .invitations-search
+    width: 100%
+    clear: both
+    display: table
+    &-input
+      max-width: $invitations-search-width
+      width: 100%
+      margin-right: 10px
+    &-show-pending
+      padding-bottom: 16px
+    &-info
+      max-width: $invitations-search-width
+      margin: 16px
+      margin-top: 0px
+  .invitations
+    table
+      select.form-control
+        padding: 6px 8px
+    &-original-values
+      td
+        margin-right: 20px
+        padding-top: 5px
+        padding-left: 20px
+        padding-bottom: 10px
+        white-space: nowrap
+  #invitations-search-input
+    position: relative
+  #invitations-back-btn
+    float: right
+    margin-top: 7px
+  .wide-modal
+    .table
+      width: 100% !important
+      white-space: nowrap
diff --git a/app/assets/stylesheets/views/jobs.sass b/app/assets/stylesheets/views/jobs.sass
index 63791fda2..803d6846d 100644
--- a/app/assets/stylesheets/views/jobs.sass
+++ b/app/assets/stylesheets/views/jobs.sass
@@ -4,6 +4,20 @@
   form
     .control-label
       font-weight: normal
+
+    [for=job_limit]
+      margin-right: 20px
+
+    input[name=job_limit]
+      text-align: center
+
+    @media (max-width: $screen-sm-min - 1)
+      [for=job_limit]
+        margin-top: 15px
+
+      input[name=job_limit]
+        text-align: left
+
     .required .control-label
       font-weight: bold
 
diff --git a/app/assets/stylesheets/views/news_items.sass b/app/assets/stylesheets/views/news_items.sass
index 7c37764ef..8d72e9b62 100644
--- a/app/assets/stylesheets/views/news_items.sass
+++ b/app/assets/stylesheets/views/news_items.sass
@@ -2,3 +2,6 @@
 
 .new_news_item_btn
   font-family: $font-family-sans-serif
+
+.news_item_private
+  background-color: #C66
diff --git a/app/assets/stylesheets/views/request_access.sass b/app/assets/stylesheets/views/request_access.sass
index ba56f0f32..807292872 100644
--- a/app/assets/stylesheets/views/request_access.sass
+++ b/app/assets/stylesheets/views/request_access.sass
@@ -1,8 +1,8 @@
 @import "_common"
 .row
-  .col-sm-offset-5 
-    .description   
-      p  
+  .col-sm-offset-5
+    .description
+      p
         color: #4b74a0
 .row
   .form-horizontal
@@ -16,4 +16,7 @@
       .request_data_text_custom
         color: #333333
         font-weight: 400
-        
\ No newline at end of file
+
+#new_invitation
+  .intended-use
+    padding-bottom: 1em
diff --git a/app/controllers/admin/admin_memberships_controller.rb b/app/controllers/admin/admin_memberships_controller.rb
index daf6b563c..9cc5e7d11 100644
--- a/app/controllers/admin/admin_memberships_controller.rb
+++ b/app/controllers/admin/admin_memberships_controller.rb
@@ -43,9 +43,11 @@ def create
       membership.transaction do
         membership.save!
         add_user_to_org(user.dxid) if admin_group.site?
-        flash[:alert] = "User has been added."
-      rescue StandardError
+        add_to_admin_spaces(user) if admin_group.site?
+        flash[:alert] = "User #{user.dxuser} has been added."
+      rescue StandardError => e
         flash[:error] = "Couldn't provision a new #{admin_group.role.titleize} admin!"
+        Rails.logger.error(e.message)
         raise ActiveRecord::Rollback
       end
 
@@ -58,9 +60,11 @@ def destroy
       membership.transaction do
         membership.destroy!
         remove_user_from_org(membership.user.dxid) if membership.site?
-        flash[:alert] = "User has been removed."
-      rescue StandardError
-        flash[:error] = "User couldn't be removed!"
+        remove_from_admin_spaces(membership.user) if membership.site?
+        flash[:alert] = "User #{membership.user.dxuser} has been removed from admin group #{membership.admin_group_id}."
+      rescue StandardError => e
+        flash[:error] = "User #{membership.user.dxuser} couldn't be removed!"
+        Rails.logger.error(e.message)
         raise ActiveRecord::Rollback
       end
 
@@ -88,7 +92,63 @@ def remove_user_from_org(dxid)
     # Adds a user to the site admins organization.
     def add_user_to_org(dxid)
       admin_member_processor = DIContainer.resolve("orgs.admin_member_provisioner")
-      admin_member_processor.call(dxid)
+      result = admin_member_processor.call(dxid)
+      logger.info("AdminMembershipsController: Site admin org invite API call result: #{result}")
+      result
+    end
+
+    # Adding new site admin to all existing Administrator Spaces
+    def add_to_admin_spaces(user)
+      api = DIContainer.resolve("api.user")
+
+      Space.admin_spaces.each do |space|
+        logger.info("Adding site admin #{user.dxuser} to admin space #{space.id}")
+        admin_membership = space.space_memberships.find_by(user: space.host_lead)
+
+        membership = space.space_memberships.active.where(user_id: user.id).first_or_initialize
+        membership.attributes = { role: SpaceMembership::ROLE_ADMIN, side: admin_membership.side }
+
+        logger.info("AdminMembershipsController: Org invite API call using api.user, org: #{space.host_dxorg}, user: #{user.dxid}")
+
+        result = api.org_invite(
+          space.host_dxorg,
+          user.dxid,
+          level: DNAnexusAPI::ORG_MEMBERSHIP_ADMIN,
+          suppressEmailNotification: true,
+        )
+
+        logger.info("AdminMembershipsController: Org invite API call result #{result}")
+
+        project_dxid = space.host_project
+        logger.info("AdminMembershipsController: Project invite API call using api.user, project: #{project_dxid}, org: #{Setting.review_app_developers_org}")
+
+        result2 = api.project_invite(
+          project_dxid,
+          Setting.review_app_developers_org,
+          DNAnexusAPI::PROJECT_ACCESS_CONTRIBUTE,
+          suppressEmailNotification: true,
+          suppressAllNotifications: true,
+        )
+
+        logger.info("AdminMembershipsController: Project invite API call result #{result2}")
+
+        space.space_memberships << membership
+        space.save!
+      end
+    end
+
+    # Removing site admin from all existing Administrator Spaces
+    def remove_from_admin_spaces(user)
+      admin_api = DIContainer.resolve("api.admin")
+      user_api = DIContainer.resolve("api.user")
+
+      Space.admin_spaces.each do |space|
+        logger.info("Removing site admin #{user.dxuser} from admin space #{space.id}")
+        user_membership = space.space_memberships.find_by(user: user)
+        admin_membership = space.space_memberships.find_by(user: space.host_lead)
+
+        SpaceMembershipService::Delete.call(admin_api, user_api, space, user_membership, admin_membership)
+      end
     end
   end
 end
diff --git a/app/controllers/admin/base_controller.rb b/app/controllers/admin/base_controller.rb
index 5042f2a33..c8ca5da7e 100644
--- a/app/controllers/admin/base_controller.rb
+++ b/app/controllers/admin/base_controller.rb
@@ -3,9 +3,7 @@ class BaseController < ApplicationController
     before_action :check_admin
 
     def check_admin
-      return if current_context.can_administer_site?
-
-      head :forbidden
+      redirect_to root_path unless current_context.can_administer_site?
     end
   end
 end
diff --git a/app/controllers/admin/invitations_controller.rb b/app/controllers/admin/invitations_controller.rb
new file mode 100644
index 000000000..7003e96a8
--- /dev/null
+++ b/app/controllers/admin/invitations_controller.rb
@@ -0,0 +1,116 @@
+module Admin
+  # Responsible for users provisioning.
+  class InvitationsController < BaseController
+    include ErrorProcessable
+    include Naming
+
+    ERROR_KEYS = %i(first_name last_name email org org_handle username).freeze
+    WARNING_KEYS = %i(org org_handle username).freeze
+
+    before_action :redirect_to_list,
+                  only: %i(search provision browse),
+                  unless: -> { request.xhr? }
+
+    # GET
+    # Lists invitations.
+    def index
+      js countries: Country.pluck(:name, :id)
+    end
+
+    # POST
+    # Searches invitations.
+    def search
+      query = unsafe_params[:query]
+      exclude = unsafe_params[:exclude]
+
+      render_invitations(query, exclude)
+    end
+
+    # POST
+    # Responsible for users provision.
+    def provision
+      results = {}
+
+      # rubocop:todo Lint/NonLocalExitFromIterator
+      Utils.each_with_delay(unsafe_params[:invitations].to_a, rand(1..1.5)) do |inv_params|
+        invitation_id = inv_params.first
+        opts = inv_params.last
+
+        invitation = Invitation.find(invitation_id)
+
+        begin
+          results[invitation_id] = provision_user(invitation, opts)
+        rescue DXClient::Errors::TooManyRequestsError => e
+          render(json: { error: e.message }, status: :bad_request) && return
+        end
+      end
+      # rubocop:enable Lint/NonLocalExitFromIterator
+
+      render json: results
+    end
+
+    # POST
+    # Renders list of invitations for browsing.
+    def browse
+      render_invitations(nil, unsafe_params[:exclude])
+    end
+
+    private
+
+    # Searches and renders invitations.
+    # @param query [String] Query to search invitations.
+    # @param exclude [Array<Integer>] Invitations ids to exclude from search.
+    def render_invitations(query, exclude)
+      invitations = InvitationSearcher.call(query, exclude)
+      serialized = invitations.map { |invitation| InvitationSerializer.call(invitation) }
+
+      render json: serialized
+    end
+
+    # Redirects to invitations index page.
+    def redirect_to_list
+      redirect_to admin_invitations_path
+    end
+
+    # Provisions user.
+    # @param invitation [Invitation] Invitation to use for provision.
+    # @param opts [Hash] Options to use for provision.
+    # @return [Hash] Hash containing array of errors if any.
+    def provision_user(invitation, opts)
+      first_name = opts[:first_name]
+      last_name = opts[:last_name]
+
+      username = find_unused_username(User.construct_username(first_name, last_name))
+      org_name = username.titleize.gsub(".", " ")
+
+      full_opts = opts.merge(
+        username: username,
+        org: org_name,
+        org_handle: find_unused_orgname(username),
+      )
+
+      result = { errors: errors(full_opts), user: { username: username } }
+
+      return result if result[:errors].present?
+
+      save_user(invitation, full_opts)
+
+      result
+    end
+
+    # Validates provided opts.
+    # @param opts [Hash] Options to validate.
+    def errors(opts)
+      add_errors(opts.slice(*ERROR_KEYS))
+    end
+
+    # Performs user provisioning.
+    # @param invitation [Invitation] Invitation to use for provision.
+    # @param opts [Hash] Options to use for provision.
+    def save_user(invitation, opts)
+      service = DIContainer.resolve("orgs.provisioner")
+      user_params = opts.merge(singular: true)
+      service.call(@context.user, invitation, user_params)
+    end
+  end
+end
diff --git a/app/controllers/admin/organizations_controller.rb b/app/controllers/admin/organizations_controller.rb
index 68d5c6a82..b735ec844 100644
--- a/app/controllers/admin/organizations_controller.rb
+++ b/app/controllers/admin/organizations_controller.rb
@@ -25,7 +25,7 @@ def show
         else
           @can_change_admin = false
         end
-      rescue Net::HTTPClientException
+      rescue DXClient::Errors::DXClientError
         @can_change_admin = false # likely no access to that group
       end
 
diff --git a/app/controllers/admin/users_controller.rb b/app/controllers/admin/users_controller.rb
index 51ef280a5..1f833f908 100644
--- a/app/controllers/admin/users_controller.rb
+++ b/app/controllers/admin/users_controller.rb
@@ -1,21 +1,38 @@
 module Admin
+  # Responsible for users related actions.
   class UsersController < BaseController
     skip_before_action  :check_admin, only: :toggle_activate_user
+    layout "react", only: %i(index)
 
+    # GET
+    # Renders users.
     def index
-      @users = User.all
-      @users_grid = initialize_grid(@users)
+      response = https_apps_client.users_list(
+        unsafe_params[:page],
+        unsafe_params[:per_page],
+        unsafe_params[:order_by],
+        unsafe_params[:order_dir],
+        unsafe_params[:filters],
+      )
+      # render json: response, adapter: :json
+      respond_to do |format|
+        format.html { render "admin/users/index" }
+        format.json { render json: response }
+      end
     end
 
+    # TODO(samuel) unify this method
+    # POST
+    # Toggles user's active status.
     def toggle_activate_user
-      user = User.find_by_dxuser(unsafe_params[:dxuser])
+      user = User.find_by(dxuser: unsafe_params[:dxuser])
 
       if !current_user.can_administer_site? && !user_org_admin?(user)
-         redirect_to root_path and return
+        redirect_to root_path && return
       end
 
       if user == current_user
-        redirect_back(fallback_location: user_path(user), alert: "Cannot disable self.") and return
+        redirect_back(fallback_location: user_path(user), alert: "Cannot disable self.") && return
       end
 
       state = unsafe_params[:state]
@@ -24,15 +41,20 @@ def toggle_activate_user
       when "enabled"
         state = "deactivated"
         user.disable_message = unsafe_params[:message]
-        user.email = Base64.encode64(user.email).sub("\n","") + DNANEXUS_INVALID_EMAIL
-        user.normalized_email = Base64.encode64(user.normalized_email).sub("\n","") + DNANEXUS_INVALID_EMAIL
+        user.email = Base64.encode64(user.email).sub("\n", "") + DNANEXUS_INVALID_EMAIL
+
+        user.normalized_email = Base64.
+          encode64(user.normalized_email).sub("\n", "") + DNANEXUS_INVALID_EMAIL
 
       when "deactivated"
-        if state != ''
+        if state != ""
           state = "enabled"
           user.disable_message = nil
           user.email = Base64.decode64(user.email.sub(DNANEXUS_INVALID_EMAIL, "\n"))
-          user.normalized_email = Base64.decode64(user.normalized_email.sub(DNANEXUS_INVALID_EMAIL, "\n"))
+
+          user.normalized_email = Base64.decode64(
+            user.normalized_email.sub(DNANEXUS_INVALID_EMAIL, "\n"),
+          )
         end
       end
 
@@ -41,111 +63,215 @@ def toggle_activate_user
         user.save!(validate: false)
         redirect_back(
           fallback_location: user_path(user),
-          alert: "User has been #{state == 'enabled' ? 're-activated':'de-activated'}"
+          alert: "User has been #{state == 'enabled' ? 're-activated' : 'de-activated'}",
         )
       else
+        errors = user.errors.map { |_k, v| v }.join(",\n")
+
         redirect_back(
           fallback_location: user_path(user),
-          error: "There was an error locking the user: #{ user.errors.map{|k,v| v }.join(",\n") }"
+          error: "There was an error locking the user: #{errors}",
         )
       end
     end
 
+    # ┌───────────────────────────────────────────────────────────┐
+    # │                                                           │
+    # │   Bulk methods implemented in https-apps-api begin here   │
+    # │                                                           │
+    # └───────────────────────────────────────────────────────────┘
+
+    def set_total_limit
+      response = https_apps_client.users_set_total_limit(
+        unsafe_params[:ids],
+        unsafe_params[:totalLimit],
+      )
+      respond_to do |format|
+        format.json { render json: response }
+      end
+    end
+
+    def set_job_limit
+      response = https_apps_client.users_set_job_limit(
+        unsafe_params[:ids],
+        unsafe_params[:jobLimit],
+      )
+      respond_to do |format|
+        format.json { render json: response }
+      end
+    end
+
+    def bulk_reset_2fa
+      response = https_apps_client.users_reset_2fa(
+        unsafe_params[:ids],
+      )
+      respond_to do |format|
+        format.json { render json: response }
+      end
+    end
+
+    def bulk_unlock
+      response = https_apps_client.users_unlock(
+        unsafe_params[:ids],
+      )
+      respond_to do |format|
+        format.json { render json: response }
+      end
+    end
+
+    def bulk_activate
+      response = https_apps_client.users_activate(
+        unsafe_params[:ids],
+      )
+      respond_to do |format|
+        format.json { render json: response }
+      end
+    end
+
+    def bulk_deactivate
+      response = https_apps_client.users_deactivate(
+        unsafe_params[:ids],
+      )
+      respond_to do |format|
+        format.json { render json: response }
+      end
+    end
+
+    def bulk_enable_resource
+      response = https_apps_client.users_enable_resource(
+        unsafe_params[:ids],
+        unsafe_params[:resource],
+      )
+      respond_to do |format|
+        format.json { render json: response }
+      end
+    end
+
+    def bulk_enable_all_resources
+      response = https_apps_client.users_enable_all_resources(unsafe_params[:ids])
+      respond_to do |format|
+        format.json { render json: response }
+      end
+    end
+
+    def bulk_disable_resource
+      response = https_apps_client.users_disable_resource(
+        unsafe_params[:ids],
+        unsafe_params[:resource],
+      )
+      respond_to do |format|
+        format.json { render json: response }
+      end
+    end
+
+    def bulk_disable_all_resources
+      response = https_apps_client.users_disable_all_resources(unsafe_params[:ids])
+      respond_to do |format|
+        format.json { render json: response }
+      end
+    end
+
+    # ┌───────────────────────────────────────────────────────┐
+    # │                                                       │
+    # │  Bulk methods implemented in https-apps-api end here  │
+    # │                                                       │
+    # └───────────────────────────────────────────────────────┘
+
+    # GET
+    # Renders deactivated users.
     def deactivated_users
       @users = User.deactivated
       @users_grid = initialize_grid(@users)
 
       respond_to do |format|
-       format.html { render 'admin/users/deactivated' }
-       format.json { render json: { users: @users } }
+        format.html { render "admin/users/deactivated" }
+        format.json { render json: { users: @users } }
       end
     end
 
+    # GET
+    # Renders pending users.
     def pending_users
       @users = User.where(private_files_project: nil)
 
       @users_grid = initialize_grid(@users)
-      render 'admin/users/pending'
+      render "admin/users/pending"
     end
 
+    # POST
+    # Sends activation email.
     def resend_activation_email
-      if @context.user.can_administer_site?
-        user = User.find_by_dxuser(unsafe_params[:dxuser])
-
-        begin
-          api = DNAnexusAPI.new(ADMIN_TOKEN, DNANEXUS_AUTHSERVER_URI)
-          result = api.call(
-              'account',
-             "resendActivationEmail",
-              usernameOrEmail: user.dxid
-            )
-        rescue Net::HTTPClientException => e
-          redirect_back(fallback_location: user_path(user), error: "There was a platform error")
-        else
-          redirect_back(
-            fallback_location: user_path(user),
-            success: "Activation email has been resent"
-          )
-        end
+      user = User.find_by(dxuser: unsafe_params[:dxuser])
+
+      begin
+        api = DNAnexusAPI.new(ADMIN_TOKEN, DNANEXUS_AUTHSERVER_URI)
+        api.call("account", "resendActivationEmail", usernameOrEmail: user.dxid)
+      rescue DXClient::Errors::DXClientError
+        redirect_back(fallback_location: user_path(user), error: "There was a platform error")
+      else
+        redirect_back(
+          fallback_location: user_path(user),
+          success: "Activation email has been resent",
+        )
       end
     end
 
+    # POST
+    # Resets 2FA.
     def reset_2fa
-      if @context.user.can_administer_site?
-        user = User.find_by_dxuser(unsafe_params[:dxuser])
-        begin
-          api = DNAnexusAPI.new(ADMIN_TOKEN, DNANEXUS_AUTHSERVER_URI)
-          result = api.call(
-            user.dxid,
-           "resetUserMFA",
-            user_id: user.dxid,
-            org_id: ORG_EVERYONE
+      user = User.find_by(dxuser: unsafe_params[:dxuser])
+
+      begin
+        api = DNAnexusAPI.new(ADMIN_TOKEN, DNANEXUS_AUTHSERVER_URI)
+        api.call(user.dxid, "resetUserMFA", user_id: user.dxid, org_id: ORG_EVERYONE)
+      rescue DXClient::Errors::DXClientError => e
+        if e.message =~ /MFA is already reset/
+          redirect_back(
+            fallback_location: user_path(user),
+            alert: "MFA is already reset or not yet configured for the user",
           )
-        rescue Net::HTTPClientException => e
-          if e.message =~ /MFA is already reset/
-            redirect_back(
-              fallback_location: user_path(user),
-              alert: "MFA is already reset or not yet configured for the user"
-            )
-          else
-            redirect_back(
-              fallback_location: user_path(user),
-              alert: "There was a server error, please try again"
-            )
-          end
         else
-          redirect_back(fallback_location: user_path(user), alert: "Reset successfully")
+          redirect_back(
+            fallback_location: user_path(user),
+            alert: "There was a server error, please try again",
+          )
         end
+      else
+        redirect_back(fallback_location: user_path(user), alert: "Reset successfully")
       end
     end
 
+    # POST
+    # Unlocks user.
     def unlock_user
-        user = User.find_by_dxuser(unsafe_params[:dxuser])
-        begin
-          api = DNAnexusAPI.new(ADMIN_TOKEN, DNANEXUS_AUTHSERVER_URI)
-          result = api.call(
-              @context.user.dxid,
-              "unlockUserAccount",
-              user_id: user.dxid,
-              org_id: ORG_EVERYONE
-          )
-        rescue Net::HTTPClientException => e
-          if request.method == 'POST'
-            render json: { ok: 'error' }, status: 403
-          else
-            error = "There was an error, please try again later."
-            if e.message =~ /must be an admin/
-              error = "permission denied, must be a user of the org."
-            end
-            redirect_back(fallback_location: user_path(user), alert: error)
-          end
+      user = User.find_by(dxuser: unsafe_params[:dxuser])
+
+      begin
+        api = DNAnexusAPI.new(ADMIN_TOKEN, DNANEXUS_AUTHSERVER_URI)
+        api.call(
+          @context.user.dxid,
+          "unlockUserAccount",
+          user_id: user.dxid,
+          org_id: ORG_EVERYONE,
+        )
+      rescue DXClient::Errors::DXClientError => e
+        if request.post?
+          render json: { ok: "error" }, status: :forbidden
         else
-          redirect_back(fallback_location: user_path(user), alert: "User has been unlocked")
+          error = "There was an error, please try again later."
+          error = "permission denied, must be a user of the org." if e.message =~ /must be an admin/
+
+          redirect_back(fallback_location: user_path(user), alert: error)
         end
+      else
+        redirect_back(fallback_location: user_path(user), alert: "User has been unlocked")
+      end
     end
 
+    # GET
+    # Exports active users to CSV.
     def active
-      date_string = Time.now.strftime("%Y-%m-%d")
+      date_string = Time.zone.now.strftime("%Y-%m-%d")
       csv_data = UsersCsvExporter.export_active_users
 
       send_data csv_data,
@@ -154,30 +280,18 @@ def active
                 type: "text/csv"
     end
 
-    def edit
-      # 1. get information from dnanexusAPI
-      # 2. set information to dnanexusAUTH server
-
-      @user = User.find_by_dxuser(unsafe_params[:dxuser])
-    end
-
-    def update
-      @user = User.find_by_dxuser(unsafe_params[:dxuser])
-    end
-
-    # Selects all users, according search string for the given org.
-    # Users selected are not in 'pending' state.
-    # @param search [String] - search string
-    # @param org [String] - org handle string
-    # @return users [Array of User objects] - an array of users, searched by search string match.
-    def all_users
-      users = User.org_members(params[:search], params[:org])
-
-      render json: { users: users }
-    end
+    private
 
+    # Checks if current user is organization admin.
+    # @param user [User] User to check.
+    # @return [Boolean] Returns true if current user is organization admin, false otherwise.
     def user_org_admin?(user)
       current_user.id == user.org.admin_id
     end
+
+    # TODO(samuel) ask about better way to implement this
+    def https_apps_client
+      DIContainer.resolve("https_apps_client")
+    end
   end
 end
diff --git a/app/controllers/analyses_controller.rb b/app/controllers/analyses_controller.rb
index 7c688b778..91fec69e7 100644
--- a/app/controllers/analyses_controller.rb
+++ b/app/controllers/analyses_controller.rb
@@ -1,12 +1,17 @@
 class AnalysesController < ApplicationController
+  include CloudResourcesConcern
+
+  before_action :check_total_charges_limit, only: :new
+
   def new
-    @workflow = Workflow.accessible_by(@context).find_by_uid(unsafe_params[:workflow_id])
-    if @workflow.nil?
-      flash[:error] = "Sorry, this workflow does not exist or is not accessible by you"
+    @workflow = Workflow.accessible_by(@context).find_by(uid: unsafe_params[:workflow_id])
+
+    unless @workflow
+      flash[:error] = I18n.t("workflow_not_accessible")
       redirect_to workflows_path
       return
     end
 
-    js workflow: @workflow.slice(:uid, :spec, :title).merge(scopes: @workflow.accessible_scopes)
+    js workflow: @workflow.slice(:uid, :spec, :title, :scope).merge(scopes: @workflow.accessible_scopes)
   end
 end
diff --git a/app/controllers/api/apps_controller.rb b/app/controllers/api/apps_controller.rb
index f39d87d3e..622cc936f 100644
--- a/app/controllers/api/apps_controller.rb
+++ b/app/controllers/api/apps_controller.rb
@@ -12,7 +12,10 @@ class AppsController < ApiController
     include Sortable
     include ErrorProcessable
     include Scopes
+    include CloudResourcesConcern
 
+    skip_before_action :require_api_login, only: %i(everybody featured)
+    before_action :require_api_login_or_guest, only: %i(everybody featured)
     before_action :validate_app, only: :create
     before_action :can_copy_to_scope?, only: %i(copy)
     before_action :user_notes_objects, only: %i(index spaces everybody)
@@ -27,23 +30,19 @@ class AppsController < ApiController
     # @return apps [App] Array of Apps objects if they exist OR apps: [].
     def index
       apps = []
-      page_meta = {}
+      filters = params[:filters]
 
       if params[:space_id]
         if find_user_space
-          apps = @space.latest_revision_apps.unremoved.
-            eager_load(:app_series, :user).includes(:taggings).
-            search_by_tags(params.dig(:filters, :tags)).
-            order(order_from_params).page(page_from_params).per(PAGE_SIZE)
-          apps = AppSeriesService::AppSeriesFilter.call(apps, params[:filters])
-
-          page_meta = { pagination: pagination_dict(apps) }
+          apps = @space.latest_revision_apps.unremoved.eager_load(:app_series, :user).includes(:taggings)
+          apps = filter_apps(apps, filters)
         end
       else
-        apps_series = AppSeries.accessible_by(@context).accessible_by_private.unremoved.
+        apps_series = AppSeries.
+          accessible_by(@context).
+          unremoved.
           eager_load(latest_revision_app: [user: :org], latest_version_app: [user: :org])
 
-        filters = params[:filters]
         apps = apps_series.map do |series|
           latest = series.latest_accessible(@context)
           if (latest&.scope == "private") && AppSeriesService::AppSeriesFilter.
@@ -51,12 +50,12 @@ def index
             latest
           end
         end.compact
-
-        apps = sort_array_by_fields(apps)
-        page_meta = pagination_meta(apps.count)
-        apps = paginate_array(apps)
       end
 
+      apps = sort_array_by_fields(apps)
+      page_meta = pagination_meta(apps.count)
+      apps = paginate_array(apps)
+
       render_apps_list(apps, page_meta)
     end
 
@@ -88,7 +87,9 @@ def featured
     # @param order_by, order_dir [String] Params for ordering.
     # @return apps [App] Array of Apps objects if they exist OR apps: [].
     def everybody
-      apps_series = AppSeries.unremoved.
+      apps_series = AppSeries.
+        unremoved.
+        accessible_by_public.
         eager_load(latest_revision_app: [user: :org], latest_version_app: [user: :org])
 
       filters = params[:filters]
@@ -137,7 +138,11 @@ def spaces
     # @param apps [Array] Array of App objects.
     # @param add_meta [Hash] Hash of additional meta params.
     def render_apps_list(apps, add_meta = {})
-      render json: apps, root: "apps", meta: apps_meta(apps).merge(add_meta), adapter: :json
+      if show_count
+        render plain: add_meta.dig(:pagination, :total_count) || 0
+      else
+        render json: apps, root: "apps", meta: apps_meta(apps).merge(add_meta), adapter: :json
+      end
     end
 
     # GET /api/apps/:id (show)
@@ -151,14 +156,14 @@ def show
       load_relations(@app)
       load_challenges
 
-      User.sync_jobs!(@context)
+      Job.sync_jobs!(@context)
 
       render json:
         @app, adapter: :json,
         meta:  {
           spec: @app.spec,
           revisions: @revisions,
-          jobs: @app.editable_jobs(@context),
+          jobs: @app.accessible_jobs(@context),
           assigned_challenges: @app.user == @context.user ? @assigned_challenges : [],
           challenges: @assignable_challenges.select do |ch|
             ch.accessible_by?(@context) || ch.app_owner == @context.user
@@ -219,7 +224,7 @@ def create
       app = create_app(unsafe_params)
 
       render json: { id: app.uid }
-    rescue DXClient::Errors::ChargesMismatchError => e
+    rescue DXClient::Errors::ChargesMismatchError, DXClient::Errors::DXClientError => e
       render json: { error: { message: e.message } }, status: :unprocessable_entity
     rescue StandardError => e
       logger.error([e.message, e.backtrace.join("\n")].join("\n"))
@@ -250,7 +255,7 @@ def import
       end
     rescue Psych::SyntaxError
       render json: { errors: ["CWL has incorrect format"] }, status: :unprocessable_entity
-    rescue DXClient::Errors::ChargesMismatchError => e
+    rescue DXClient::Errors::ChargesMismatchError, DXClient::Errors::DXClientError => e
       render json: { errors: [e.message] }, status: :unprocessable_entity
     rescue StandardError => e
       logger.error e.message
@@ -307,8 +312,21 @@ def accessible_apps # rubocop:disable Metrics/MethodLength
       render json: apps
     end
 
+    def user_compute_resources
+      render json: user_compute_resource_labels
+    end
+
     private
 
+    def filter_apps(apps, filters)
+      apps.map do |app|
+        if AppSeriesService::AppSeriesFilter.
+            match(app, filters)
+          app
+        end
+      end.compact
+    end
+
     # Add Rdoc
     def apps_meta(apps)
       { links: {}, count: {}, notes: {}, answers: {}, discussions: {} }.tap do |meta|
diff --git a/app/controllers/api/assets_controller.rb b/app/controllers/api/assets_controller.rb
index 5068e227a..6ee450c8f 100644
--- a/app/controllers/api/assets_controller.rb
+++ b/app/controllers/api/assets_controller.rb
@@ -25,7 +25,13 @@ class AssetsController < ApiController
       "username" => %w(users.first_name users.last_name),
     }.freeze
 
-    PAGE_SIZE = Paginationable::PAGE_SIZE
+    SORT_FIELDS = {
+      "created_at" => ->(left, right) { left.created_at <=> right.created_at },
+      "name" => ->(left, right) { left.name <=> right.name },
+      "location" => ->(left, right) { left.location.downcase <=> right.location.downcase },
+      "size" => ->(left, right) { left.file_size <=> right.file_size },
+      "username" => ->(left, right) { left.user.full_name <=> right.user.full_name },
+    }.freeze
 
     # GET /api/assets
     # api_assets_path
@@ -38,10 +44,7 @@ def index
         accessible_by_private.
         eager_load(user: :org).
         includes(:taggings).
-        search_by_tags(params.dig(:filters, :tags)).
-        order(order_from_params).
-        page(page_from_params).per(PAGE_SIZE)
-      assets = FileService::FilesFilter.call(assets, params[:filters])
+        search_by_tags(params.dig(:filters, :tags))
 
       render_assets_list assets
     end
@@ -55,10 +58,7 @@ def featured
         accessible_by_public.
         eager_load(user: :org).
         includes(:taggings).
-        search_by_tags(params.dig(:filters, :tags)).
-        order(order_from_params).
-        page(page_from_params).per(PAGE_SIZE)
-      assets = FileService::FilesFilter.call(assets, params[:filters])
+        search_by_tags(params.dig(:filters, :tags))
 
       render_assets_list assets
     end
@@ -73,10 +73,7 @@ def everybody
         accessible_by_public.
         eager_load(user: :org).
         includes(:taggings).
-        search_by_tags(params.dig(:filters, :tags)).
-        order(order_from_params).
-        page(page_from_params).per(PAGE_SIZE)
-      assets = FileService::FilesFilter.call(assets, params[:filters])
+        search_by_tags(params.dig(:filters, :tags))
 
       render_assets_list assets
     end
@@ -92,23 +89,19 @@ def spaces
         editable_by(@context).where.not(scope: [SCOPE_PUBLIC, SCOPE_PRIVATE]).
         eager_load(user: :org).
         includes(:taggings).
-        search_by_tags(params.dig(:filters, :tags)).
-        order(order_from_params).
-        page(page_from_params).per(PAGE_SIZE)
-      assets = FileService::FilesFilter.call(assets, params[:filters])
+        search_by_tags(params.dig(:filters, :tags))
 
-      render_assets_list assets
-    end
+      assets = FileService::FilesFilter.call(assets, params[:filters]).to_a
 
-    # A common method for assets list json rendering.
-    # @param assets [Array] Array of Asset objects.
-    # @return render assets as json with meta
-    def render_assets_list(assets)
-      page_dict = pagination_dict(assets)
-      render json: assets, root: "assets", adapter: :json,
-             meta: assets_meta.
-               merge(count(page_dict[:total_count])).
-               merge({ pagination: page_dict })
+      if show_count
+        render plain: assets.count
+      else
+        assets = sort_array_by_fields(assets, "created_at")
+        page_meta = pagination_meta(assets.count)
+        assets = paginate_array(assets)
+
+        render json: assets, meta: page_meta, root: "assets", adapter: :json
+      end
     end
 
     # GET /api/asset/:id  api_asset_path
@@ -124,8 +117,8 @@ def show
       comments_data(@asset)
       load_licenses(@asset)
 
-      render json:
-               @asset, adapter: :json,
+      render json: @asset,
+             adapter: :json,
              meta: {
                user_licenses: @licenses,
                object_license: @license,
@@ -222,6 +215,28 @@ def rename
 
     private
 
+    # A common method for assets list json rendering.
+    # @param assets [Array] Array of Asset objects.
+    # @return render assets as json with meta
+    def render_assets_list(assets)
+      filtered_assets = FileService::FilesFilter.call(assets, params[:filters]).
+        order(order_from_params).
+        page(page_from_params).
+        per(page_size)
+
+      page_dict = pagination_dict(filtered_assets)
+
+      return render(plain: page_dict[:total_count]) if show_count
+
+      render json: filtered_assets,
+             root: Asset.model_name.plural,
+             adapter: :json,
+             meta: assets_meta.merge(
+               count: page_dict[:total_count],
+               pagination: page_dict,
+             )
+    end
+
     # Refresh state of assets, if needed
     def sync_assets
       User.sync_assets!(@context)
diff --git a/app/controllers/api/base_controller.rb b/app/controllers/api/base_controller.rb
index fce290244..ec33ba045 100644
--- a/app/controllers/api/base_controller.rb
+++ b/app/controllers/api/base_controller.rb
@@ -1,6 +1,5 @@
 module Api
   class BaseController < ApplicationController
-
     skip_before_action :require_login
     before_action :require_api_login
 
diff --git a/app/controllers/api/challenges_controller.rb b/app/controllers/api/challenges_controller.rb
index 9e0a976e9..fb21835e5 100644
--- a/app/controllers/api/challenges_controller.rb
+++ b/app/controllers/api/challenges_controller.rb
@@ -1,10 +1,151 @@
 module Api
+  # Challenges API controller.
   class ChallengesController < BaseController
+    include Paginationable
+    include ChallengesHelper
 
-    before_action :check_admin
+    skip_before_action :require_api_login, except: :save_editor_page
+    before_action :check_admin, only: :save_editor_page
+
+    CHALLENGE_UPCOMING = "upcoming".freeze
+    CHALLENGE_CURRENT = "current".freeze
+    CHALLENGE_ENDED = "ended".freeze
+
+    TIME_STATUSES = [CHALLENGE_UPCOMING, CHALLENGE_CURRENT, CHALLENGE_ENDED].freeze
+
+    def index
+      challenges = filter_challenges
+
+      render json: challenges,
+             meta: pagination_dict(challenges),
+             adapter: :json
+    end
+
+    def create
+      ActiveRecord::Base.transaction do
+        @challenge = Challenge.new(challenge_params)
+        if @challenge.save
+
+          @challenge.update_card_image_url!
+          @challenge.provision_space!(
+            @context,
+            challenge_params[:host_lead_dxuser],
+            challenge_params[:guest_lead_dxuser],
+          )
+          render json: @challenge, adapter: :json
+        end
+      end
+    end
+
+    def update
+      @challenge = Challenge.find(params[:id])
+
+      ActiveRecord::Base.transaction do
+        if @challenge.update(update_challenge_params)
+          @challenge.update_card_image_url!
+          @challenge.update_order(challenge_params["replacement_id"])
+
+          unless @challenge.space
+            @challenge.provision_space!(
+              @context,
+              challenge_params[:host_lead_dxuser],
+              challenge_params[:guest_lead_dxuser],
+            )
+          end
+        else
+          render json: @challenge.errors, status: :unprocessable_entity
+          return
+        end
+      end
+      render json: @challenge, adapter: :json
+    end
+
+    def show
+      challenge = accessible_challenges.find_by(id: params[:id])
+
+      unless challenge
+        render json: { error: I18n.t("api.challenges.not_found_or_forbidden") }, status: :not_found
+        return
+      end
+
+      if params[:custom]
+        render json: challenge, adapter: :json, serializer: CustomChallengeSerializer
+      else
+        render json: challenge, adapter: :json
+      end
+    end
+
+    def scoring_app_users
+      render json: app_owners_for_select
+    end
+
+    def host_lead_users
+      render json: host_lead_dxusers
+    end
+
+    def guest_lead_users
+      render json: guest_lead_dxusers
+    end
+
+    def challenges_for_select
+      render json: challenge_order_for_select
+    end
+
+    def scopes_for_select
+      challenge = Challenge.new
+      if params[:id]
+        challenge = Challenge.find(params[:id])
+      end
+      render json: spaces_for_select(@context, challenge)
+    end
+
+    def challenge_params
+      params.require(:challenge).
+        permit(
+          :name,
+          :description,
+          :scope,
+          :app_owner_id,
+          :start_at,
+          :end_at,
+          :status,
+          :regions,
+          :card_image_id,
+          :card_image_url,
+          :replacement_id,
+          :host_lead_dxuser,
+          :guest_lead_dxuser,
+          :pre_registration_url,
+        )
+    end
+
+    def update_challenge_params
+      params.require(:challenge).
+        permit(
+          :name,
+          :description,
+          :scope,
+          :app_owner_id,
+          :start_at,
+          :end_at,
+          :status,
+          :card_image_id,
+          :card_image_url,
+          :replacement_id,
+          :pre_registration_url,
+        )
+    end
+
+    def years
+      all_years = accessible_challenges.order(start_at: :desc).pluck(:start_at).map(&:year).uniq
+
+      render json: all_years
+    end
 
     def save_editor_page
-      return if unsafe_params[:regions].blank?
+      return if params[:regions].blank?
+
+      challenge = Challenge.find(params[:id])
 
       if challenge.nil?
         render json: { error: "The challenge not found." }.to_json, status: 404
@@ -21,11 +162,41 @@ def save_editor_page
       end
     end
 
-    private
+    def accessible_challenges
+      Challenge.accessible_by(@context)
+    end
 
-    def challenge
-      @challenge ||= Challenge.find(unsafe_params[:id])
+    def propose
+      proposal = unsafe_params.slice(:name, :email, :organisation,
+                                     :specific_question, :specific_question_text,
+                                     :data_details, :data_details_text)
+      NotificationsMailer.challenge_proposal_received(proposal).deliver_now
+      render json: {}
     end
 
+    private
+
+    def filter_challenges
+      page = params[:page].presence || 1
+      year = params[:year] =~ /\A\d+\Z/ ? params[:year].to_i : nil
+
+      time_status = params[:time_status] if TIME_STATUSES.include?(params[:time_status].presence)
+
+      challenges = accessible_challenges.order(end_at: :desc).page(page)
+      challenges = Challenge.where(Arel.sql("YEAR(start_at) = #{year}")) if year
+
+      current_time = Time.current
+
+      case time_status
+      when CHALLENGE_UPCOMING
+        challenges.where("start_at > ?", current_time)
+      when CHALLENGE_CURRENT
+        challenges.where("start_at < ?", current_time).where("end_at > ?", current_time)
+      when CHALLENGE_ENDED
+        challenges.where("end_at < ?", current_time)
+      else
+        challenges
+      end
+    end
   end
 end
diff --git a/app/controllers/api/counters_controller.rb b/app/controllers/api/counters_controller.rb
new file mode 100644
index 000000000..58a8bf901
--- /dev/null
+++ b/app/controllers/api/counters_controller.rb
@@ -0,0 +1,51 @@
+module Api
+  # Front controller that delegates call for Count per Section.
+  class CountersController < ApiController
+    CONTROLLERS = {
+      "apps" => AppsController,
+      "assets" => AssetsController,
+      "dbclusters" => DbClustersController,
+      "jobs" => JobsController,
+      "files" => FilesController,
+      "workflows" => WorkflowsController,
+    }.freeze
+
+    def index
+      call_controller(:index)
+    end
+
+    def featured
+      call_controller(:featured)
+    end
+
+    def everybody
+      call_controller(:everybody)
+    end
+
+    def spaces
+      call_controller(:spaces)
+    end
+
+    private
+
+    def call_controller(method_name)
+      counters = {}.tap do |count|
+        CONTROLLERS.each do |key, controller|
+          count[key] = init_controller(controller).send(method_name)
+        end
+      end
+
+      render json: counters
+    end
+
+    def init_controller(controller)
+      controller.new.tap do |co|
+        co.context = @context
+        co.show_count = true
+
+        co.request = request
+        co.response = response
+      end
+    end
+  end
+end
diff --git a/app/controllers/api/db_clusters_controller.rb b/app/controllers/api/db_clusters_controller.rb
new file mode 100644
index 000000000..eccd8042b
--- /dev/null
+++ b/app/controllers/api/db_clusters_controller.rb
@@ -0,0 +1,118 @@
+module Api
+  # DB Clusters API controller.
+  class DbClustersController < ApiController
+    include Paginationable
+    include Sortable
+
+    before_action :find_db_cluster, only: %i(show update)
+    # TODO(samuel) disabled now wait until database resources are specified in next iteration of cloud governance
+    # before_action :check_total_charges_limit, only: %i(create)
+
+    rescue_from DXClient::Errors::DXClientError,
+                HttpsAppsClient::Error,
+                with: :render_error
+
+    ORDER_FIELDS = {
+      "name" => "name",
+      "status" => "status",
+      "engine" => "engine",
+      "instance" => "dx_instance_class",
+      "created_at" => "created_at",
+    }.freeze
+
+    def index
+      dbclusters = DbCluster.accessible_by_user(current_user).
+        includes(:user).
+        search_by_tags(params.dig(:filters, :tags)).
+        order(order_from_params).
+        page(page_from_params)
+
+      dbclusters = DbClusters::Filter.call(dbclusters, params[:filters])
+
+      page_dict = pagination_dict(dbclusters.reload)
+
+      return render(plain: page_dict[:total_count]) if show_count
+
+      render json: dbclusters,
+             meta: count(page_dict[:total_count]).merge({ pagination: page_dict }),
+             root: "dbclusters",
+             adapter: :json
+    end
+
+    def everybody; end
+
+    def featured; end
+
+    def spaces; end
+
+    def show
+      render json: @dbcluster, adapter: :json
+    end
+
+    def create
+      opts = dbcluster_create_params.merge(
+        project: current_user.private_files_project,
+        scope: Scopes::SCOPE_PRIVATE,
+      ).except(:ddl_file_uid)
+      opts[:name]&.strip!
+
+      response = https_apps_client.dbcluster_create(opts)
+      dbcluster = DbCluster.find_by!(dxid: response[:dxid])
+
+      render json: dbcluster, adapter: :json
+    end
+
+    def update
+      @dbcluster.assign_attributes(dbcluster_update_params)
+      @dbcluster.save!
+
+      render json: @dbcluster, adapter: :json
+    end
+
+    # Used for start, stop and terminate actions.
+    def run
+      https_apps_client.dbcluster_action(params[:dxids], params[:api_method])
+
+      render json: {}, status: :no_content
+    end
+
+    def allowed_db_instances_by_user
+      render json: user_database_resource_labels
+    end
+
+    private
+
+    def find_db_cluster
+      @dbcluster = DbCluster.accessible_by_user(current_user).find_by(dxid: params[:dxid])
+
+      raise ApiError, "#{params[:dxid]} is not found" unless @dbcluster
+    end
+
+    def dbcluster_create_params
+      params.require(:db_cluster).permit(:name, :description, :adminPassword, :engine,
+                                         :engineVersion, :dxInstanceClass, :ddl_file_uid)
+    end
+
+    def dbcluster_update_params
+      params.require(:db_cluster).permit(:name, :description)
+    end
+
+    def order_from_params(default_order = "created")
+      if %w(status engine instance).include?(params[:order_by])
+        query = DbCluster.order_by_enum_query(
+          ORDER_FIELDS[params[:order_by]],
+          order_direction(params[:order_dir]),
+          params[:order_by] == "instance" ? DbCluster::DX_INSTANCE_CLASSES.invert : nil,
+        )
+        return Arel.sql(query)
+      end
+
+      super
+    end
+
+    def render_error(exception)
+      json = { error: { type: "Error", code: exception.error_code, message: exception.message } }
+      render json: json, status: :unprocessable_entity
+    end
+  end
+end
diff --git a/app/controllers/api/experts_controller.rb b/app/controllers/api/experts_controller.rb
new file mode 100644
index 000000000..46f73516e
--- /dev/null
+++ b/app/controllers/api/experts_controller.rb
@@ -0,0 +1,88 @@
+module Api
+  # Experts API controller.
+  class ExpertsController < ApiController
+    include Paginationable
+    include RecaptchaHelper
+
+    skip_before_action :require_api_login
+    before_action :find_expert, only: %i(show update ask_question blog)
+
+    rescue_from ApiError do |exception|
+      render_error(exception)
+    end
+
+    def index
+      page = params[:page].presence || 1
+      limit = params[:limit].presence || 10
+      year = params[:year] =~ /\A\d+\Z/ ? params[:year].to_i : nil
+
+      experts = https_apps_client.experts_list(page, limit, year)
+      render json: experts,
+             adapter: :json
+    end
+
+    def years
+      all_years = https_apps_client.experts_years
+      render json: all_years
+    end
+
+    def blog
+      render json: @expert, adapter: :json
+    end
+
+    def show
+      # to be updated later, when all expert's pages will be rafactored,
+      # including questions & answers
+      # unless @expert.is_public?
+      #   if @expert.editable_by?(@context)
+      #
+      #     raise ApiError, "This Expert Q&A Session is private and not viewable by the public"
+      #   end
+      # end
+      render json: @expert, adapter: :json
+    end
+
+    def update; end
+
+    def ask_question
+      if @context.logged_in?
+        exp_question = ExpertQuestion.provision(@expert, @context, params[:question])
+      elsif verify_captcha_assessment(params[:captchaValue], "question")
+        exp_question = ExpertQuestion.new(
+          user_id: nil,
+          expert_id: @expert.id,
+          state: "open",
+          body: params[:question],
+          _original: params[:question],
+          _edited: false.to_s,
+        )
+        exp_question.save!
+      else
+        raise ApiError,
+              "Your question was not submitted because of ReCaptcha validation failed, Please try again."
+      end
+
+      unless exp_question
+        raise ApiError,
+              "Your question was not submitted because of an unknown reason, Please try again."
+      end
+
+      NotificationsMailer.new_expert_question_email(@expert, exp_question).deliver_now!
+
+      render json: @expert, adapter: :json
+    end
+
+    private
+
+    def find_expert
+      @expert = Expert.find_by(id: params[:id])
+
+      raise ApiError, "Expert with id: #{params[:id]} is not found" unless @expert
+    end
+
+    def render_error(exception)
+      json = { error: { type: "Error", message: exception } }
+      render json: json, status: :unprocessable_entity
+    end
+  end
+end
diff --git a/app/controllers/api/files_controller.rb b/app/controllers/api/files_controller.rb
index e1850f9e4..7132b0a34 100644
--- a/app/controllers/api/files_controller.rb
+++ b/app/controllers/api/files_controller.rb
@@ -4,7 +4,6 @@ module Api
   class FilesController < ApiController
     include SpaceConcern
     include CommonConcern
-    include FilesConcern
     include Paginationable
     include Sortable
     include Scopes
@@ -16,6 +15,7 @@ class FilesController < ApiController
     before_action :sync_files, only: %i(index)
 
     DOWNLOAD_ACTION = "download".freeze
+    OPEN_ACTION = "open".freeze
     PUBLISH_ACTION = "publish".freeze
     DELETE_ACTION = "delete".freeze
     COPY_ACTION = "copy".freeze
@@ -29,63 +29,54 @@ class FilesController < ApiController
       "username" => %w(users.first_name users.last_name),
     }.freeze
 
+    SORT_FIELDS = {
+      "created_at" => ->(left, right) { left.created_at <=> right.created_at },
+      "name" => ->(left, right) { left.name <=> right.name },
+      "location" => ->(left, right) { left.location.downcase <=> right.location.downcase },
+      "size" => ->(left, right) { left.file_size <=> right.file_size },
+      "username" => ->(left, right) { left.user.full_name <=> right.user.full_name },
+    }.freeze
+
     # GET /api/files or GET /api/files/?space_id=params[:space_id]
     # A common UserFies fetch method for space and home pages, depends upon @params[:space_id].
     # @param space_id [Integer] Space id for files fetch. When it is nil, then fetching for
     #   all files, editable by current user.
     # @param order_by, order_dir [String] Params for ordering.
     # @return files [UserFile] Array of UserFile objects if they exist OR files: [].
-    # rubocop:disable Metrics/MethodLength
     def index
       # Fetches space files.
-      if params[:space_id]
-        nodes = []
-        if find_user_space
-          folder_id = params[:folder_id]
-          nodes = @space.nodes.files_and_folders.
-            where(scoped_parent_folder_id: folder_id).
-            includes(:taggings).eager_load(user: :org).
-            search_by_tags(params.dig(:filters, :tags)).
-            order(order_from_params).
-            page(page_from_params).per(PAGE_SIZE)
-          nodes = FileService::FilesFilter.call(nodes, params[:filters])
-        end
+      respond_with_space_files && return if params[:space_id]
 
-        page_dict = pagination_dict(nodes)
+      # Fetches all user 'private' files.
+      filter_tags = params.dig(:filters, :tags)
 
-        render json: {
-          entries: nodes.map { |node| helpers.client_file(node, @space, current_user) },
-          meta: files_meta.merge(count(page_dict[:total_count])).
-            merge({ pagination: page_dict }),
-        }, root: "files"
-      else
-        # Fetches all user 'private' files.
-        filter_tags = params.dig(:filters, :tags)
-
-        files = UserFile.
-          real_files.
-          editable_by(@context).
-          where(parent_folder_id: @parent_folder_id).
-          accessible_by_private.
-          where.not(parent_type: ["Comparison", nil]).
-          includes(:taggings).eager_load(user: :org).
-          search_by_tags(filter_tags)
-        files = FileService::FilesFilter.call(files, params[:filters])
+      files = UserFile.
+        real_files.
+        editable_by(@context).
+        accessible_by_private.
+        where.not(parent_type: ["Comparison", nil]).
+        includes(:taggings).
+        eager_load(user: :org).
+        search_by_tags(filter_tags)
 
-        folders = private_folders(@parent_folder_id).includes(:taggings).
-          eager_load(user: :org).search_by_tags(filter_tags)
-        folders = FileService::FilesFilter.call(folders, params[:filters])
+      return render(plain: files.size) if show_count
 
-        user_files = Node.eager_load(user: :org).where(id: (files + folders).map(&:id)).
-          order(order_from_params).page(page_from_params).per(PAGE_SIZE)
+      files = files.where(parent_folder_id: @parent_folder_id)
+      files = FileService::FilesFilter.call(files, params[:filters])
 
-        render json: user_files, root: "files", adapter: :json,
-          meta: files_meta.
-            merge(count(UserFile.private_count(@context.user))).
-            merge({ pagination: pagination_dict(user_files) })
-      end
+      folders = private_folders(@parent_folder_id).includes(:taggings).
+        eager_load(user: :org).search_by_tags(filter_tags)
+      folders = FileService::FilesFilter.call(folders, params[:filters])
+
+      user_files = Node.eager_load(user: :org).where(id: (files + folders).map(&:id)).
+        order(order_params).page(page_from_params).per(page_size)
+      page_dict = pagination_dict(user_files)
+
+      render json: user_files, root: "files", adapter: :json,
+             meta: files_meta.
+               merge(count(UserFile.private_count(@context.user))).
+               merge({ pagination: page_dict })
     end
-    # rubocop:enable Metrics/MethodLength
 
     # GET /api/files/featured
     # A fetch method for files, accessible by public and with user taggings.
@@ -96,26 +87,21 @@ def featured
 
       files = UserFile.real_files.
         featured.accessible_by(@context).
+        where(parent_folder_id: @parent_folder_id).
         includes(:user, :taggings).eager_load(user: :org).
         search_by_tags(filter_tags)
       files = FileService::FilesFilter.call(files, params[:filters])
 
       folders = Folder.
-        featured.accessible_by(@context).
-        includes(:taggings).eager_load(user: :org).
+        featured.
+        accessible_by(@context).
+        where(parent_folder_id: @parent_folder_id).
+        includes(:taggings).
         eager_load(user: :org).
         search_by_tags(filter_tags)
       folders = FileService::FilesFilter.call(folders, params[:filters])
 
-      user_files = Node.eager_load(user: :org).where(id: (files + folders).map(&:id)).
-        order(order_from_params).page(page_from_params).per(PAGE_SIZE)
-
-      page_dict = pagination_dict(user_files)
-
-      render json: user_files, root: "files", adapter: :json,
-        meta: files_meta.
-          merge(count(page_dict[:total_count])).
-          merge({ pagination: page_dict })
+      render_files_list(files: files, folders: folders)
     end
 
     # GET /api/files/everybody
@@ -129,22 +115,16 @@ def everybody
         UserFile.real_files.
           accessible_by_public.
           includes(:taggings).eager_load(user: :org).
-          where(parent_folder_id: @parent_folder_id).
           search_by_tags(filter_tags)
+
+      files = files.where(parent_folder_id: @parent_folder_id) unless show_count
       files = FileService::FilesFilter.call(files, params[:filters])
 
       folders = explore_folders(@parent_folder_id).includes(:taggings).
         eager_load(user: :org).search_by_tags(filter_tags)
       folders = FileService::FilesFilter.call(folders, params[:filters])
 
-      user_files = Node.where(id: (files + folders).map(&:id)).eager_load(user: :org).
-        order(order_from_params).page(page_from_params).per(PAGE_SIZE)
-      page_dict = pagination_dict(user_files)
-
-      render json: user_files, root: "files", adapter: :json,
-        meta: files_meta.
-          merge(count(page_dict[:total_count])).
-          merge({ pagination: page_dict })
+      render_files_list(files: files, folders: folders)
     end
 
     # GET /api/files/spaces
@@ -160,8 +140,9 @@ def spaces
         where.not(scope: [SCOPE_PUBLIC, SCOPE_PRIVATE]).
         accessible_by(@context).
         includes(:taggings).eager_load(user: :org).
-        where(scoped_parent_folder_id: @parent_folder_id).
         search_by_tags(filter_tags)
+
+      files = files.where(scoped_parent_folder_id: @parent_folder_id) unless show_count
       files = FileService::FilesFilter.call(files, params[:filters])
 
       folders = Folder.
@@ -172,14 +153,17 @@ def spaces
         search_by_tags(filter_tags)
       folders = FileService::FilesFilter.call(folders, params[:filters])
 
-      user_files = Node.where(id: (files + folders).map(&:id)).eager_load(user: :org).
-        order(order_from_params).page(page_from_params).per(PAGE_SIZE)
-      page_dict = pagination_dict(user_files)
+      if show_count
+        render plain: files.size
+      else
+        nodes = Node.where(id: files + folders).eager_load(user: :org).to_a
 
-      render json: user_files, root: "files", adapter: :json,
-        meta: files_meta.
-          merge(count(page_dict[:total_count])).
-          merge({ pagination: page_dict })
+        nodes = sort_array_by_fields(nodes, "created_at")
+        page_meta = pagination_meta(nodes.count)
+        nodes = paginate_array(nodes)
+
+        render json: nodes, root: "files", adapter: :json, meta: files_meta.merge(page_meta)
+      end
     end
 
     # GET /api/files/:id
@@ -194,12 +178,12 @@ def show
       load_licenses(@file)
 
       # TODO: move common data to common_concern.rb
-      comparison = if @file.parent_type != "Comparison"
+      comparison = if @file.parent_type == "Comparison"
+        @file.parent.slice(:id, :user_id, :scope, :state)
+      else
         synchronizer = DIContainer.resolve("comparisons.sync.synchronizer")
         synchronizer.sync_comparisons!(@context.user)
         @file.comparisons.accessible_by(@context).includes(:taggings)
-      else
-        @file.parent.slice(:id, :user_id, :scope, :state)
       end
 
       comments = if @file.in_space?
@@ -222,16 +206,16 @@ def show
         discussions.order(id: :desc).page(params[:discussions_page])
 
       render json: @file, root: "files", adapter: :json,
-        meta: {
-          user_licenses: @licenses,
-          object_license: @license,
-          comments: comments,
-          discussions: discussions,
-          answers: answers,
-          notes: notes,
-          comparisons: comparison,
-          links: meta_links(@file),
-        }
+             meta: {
+               user_licenses: @licenses,
+               object_license: @license,
+               comments: comments,
+               discussions: discussions,
+               answers: answers,
+               notes: notes,
+               comparisons: comparison,
+               links: meta_links(@file),
+             }
     end
     # rubocop:enable Metrics/MethodLength
 
@@ -250,38 +234,30 @@ def update
     def copy
       nodes = Node.accessible_by(@context).where(id: params[:item_ids])
 
-      copies = node_copier.copy(nodes, params[:scope])
-
-      # TODO: change old UI to handle json-response!
-      respond_to do |format|
-        messages = build_copy_messages(copies)
-
-        format.html do
-          success_msg = messages.find { |msg| msg[:type] == "success" }&.fetch(:message, nil)
-          warn_msg = messages.find { |msg| msg[:type] == "warning" }&.fetch(:message, nil)
-
-          flash[:success] = success_msg if success_msg
-          flash[:alert] = warn_msg if warn_msg
-
-          redirect_to pathify(nodes.first)
-        end
+      NodeCopyWorker.perform_async(
+        params[:scope],
+        nodes.pluck(:id),
+        session_auth_params,
+      )
 
-        format.json do
-          render json: copies.all, root: "nodes", adapter: :json, meta: { messages: messages }
-        end
-      end
+      render json: nodes, root: "nodes", adapter: :json,
+             meta: {
+               messages: [{
+                 type: "success",
+                 message: I18n.t("api.files.copy.files_are_copying"),
+               }],
+             }
     end
 
     # POST /api/files/download_list
     # Responds with the files list.
-    # TODO: the similar route exists in old Files Controller. Both should be merged into one.
-    #   This only works for Spaces now.
+    # This only works for Spaces now.
     def download_list
       task = params[:task]
       files = []
 
       case task
-      when DOWNLOAD_ACTION, COPY_ACTION, COPY_TO_PRIVATE_ACTION
+      when DOWNLOAD_ACTION, OPEN_ACTION, COPY_ACTION, COPY_TO_PRIVATE_ACTION
         nodes = Node.accessible_by(@context).where(id: params[:ids])
         nodes.each { |node| files += node.is_a?(Folder) ? node.all_files : [node] }
       when PUBLISH_ACTION
@@ -299,18 +275,19 @@ def download_list
         nodes = Node.editable_by(@context).where(id: params[:ids]).to_a
         files += nodes
         nodes.each { |node| files += node.all_children if node.is_a?(Folder) }
+        files.filter! { |file| file.scope == params[:scope] }
       else
         raise ApiError, "Parameter 'task' is not defined!"
       end
 
-      render json: files, each_serializer: FileActionsSerializer,
-        scope_name: params[:scope] || SCOPE_PRIVATE,
-        action_name: task
+      render json: files,
+             each_serializer: FileActionsSerializer,
+             scope_name: params[:scope] || SCOPE_PRIVATE,
+             action_name: task
     end
 
     # GET /api/files/download
     # Responds with a link to download a file.
-    # TODO: the similar route exists in old Files Controller. Both should be merged into one.
     def download
       file = UserFile.exist_refresh_state(@context, params[:uid])
 
@@ -324,19 +301,32 @@ def download
 
       file_url = file.file_url(@context, params[:inline])
 
-      redirect_to URI.parse(file_url).to_s
+      respond_to do |format|
+        format.html do
+          redirect_to URI.parse(file_url).to_s
+        end
+
+        format.json do
+          render json: {
+            file_url: file_url,
+            file_size: file.file_size,
+          }, adapter: :json
+        end
+      end
     end
 
     # POST /api/files/create_folder - create_folder_api_files_path
     # Creates a folder.
     # @param :public [Boolean] True/False
     # @param :parent_folder_id [Integer] Folder id - nil for root folder
+    # @param :space_id [Integer] id of the target space, if specified the public attribute is ignored
     # @param :name [String] a new folder name
     # @return json { path: path(), message: { type: type, text: text } }
     def create_folder
-      is_public_folder = params[:public] == "true"
-
-      if is_public_folder
+      if params[:space_id] && find_user_space
+        scope = @space.uid
+        parent_folder = Folder.editable_by(@context).find_by(id: params[:parent_folder_id])
+      elsif params[:public] == "true"
         if @context.user.can_administer_site?
           parent_folder = Folder.accessible_by_public.find_by(id: params[:parent_folder_id])
           scope = "public"
@@ -344,7 +334,6 @@ def create_folder
           path = everybody_api_files_path
           type = :error
           text = "You are not allowed to create public folders"
-
           render json: { path: path, message: { type: type, text: text } }, adapter: :json
           return
         end
@@ -357,7 +346,7 @@ def create_folder
 
       if result.failure?
         type = :error
-        text = result.value.values
+        text = result.value[:name]
       else
         type = :success
         text = "Folder '#{result.value.name}' successfully created."
@@ -368,7 +357,6 @@ def create_folder
       else
         scope == "public" ? everybody_api_files_path : api_files_path
       end
-
       render json: { path: path, message: { type: type, text: text } }, adapter: :json
     end
 
@@ -379,7 +367,8 @@ def create_folder
     # @return { path: path, message: { type: type, text: text } } - standard path object
     def move
       target_folder_id = params[:target_id] == "root" ? nil : params[:target_id]
-      target_folder = target_folder_id ? Folder.editable_by(@context).find(target_folder_id) : nil
+      target_folder =
+        target_folder_id ? Folder.accessible_by_user(@context.user).find(target_folder_id) : nil
       service = FolderService.new(@context)
 
       result = service.move(
@@ -412,23 +401,85 @@ def move
     # @param scope [String] - 'public', 'private' or 'space-XX'.
     def remove
       service = FolderService.new(@context)
-      files = Node.editable_by(@context).where(id: unsafe_params[:ids])
-      res = service.remove(files)
+      nodes = Node.editable_by(@context).where(id: unsafe_params[:ids])
+      result = service.remove(nodes)
 
-      if res.success?
+      if result.success?
         type = :success
         text = "Node(s) successfully removed."
       else
         type = :error
-        text = "Error when Node(s) removing: '#{res.value.values}'."
+        text = "Error when Node(s) removing: #{result.value[:message]}."
       end
-      path = unsafe_params[:scope] == "public" ? everybody_api_files_path : api_files_path
+
+      path = params[:scope] == Scopes::SCOPE_PUBLIC ? everybody_api_files_path : api_files_path
 
       render json: { path: path, message: { type: type, text: text } }, adapter: :json
     end
 
+    # Overridden version: it accepts not only file-uids, but also folder id.
+    # Result of this operation not only invert flag of folder(s),
+    # but also all PUBLIC children items.
+    # @param item_ids [Array] array of [String] uid-s.
+    # @param featured [Boolean] new 'feature' value, false if empty.
+    # @return items [Array] list of folder/files with inverted 'feature' flag
+    def update_feature_flag
+      raise ApiExceptionHandler, Message.not_allowed unless @context.user.site_admin?
+
+      FileService::ToggleFeaturePublicFolderService.new(params, @context).call
+    end
+
     private
 
+    def respond_with_space_files
+      nodes = []
+
+      if find_user_space
+        folder_id = params[:folder_id]
+        nodes = @space.nodes.files_and_folders.
+          where(scoped_parent_folder_id: folder_id).
+          includes(:taggings).eager_load(user: :org).
+          search_by_tags(params.dig(:filters, :tags)).
+          order(order_params).
+          page(page_from_params).per(page_size)
+        nodes = FileService::FilesFilter.call(nodes, params[:filters])
+      end
+
+      page_dict = pagination_dict(nodes)
+
+      return render(plain: page_dict[:total_count]) if show_count
+
+      render json: nodes, root: "files", adapter: :json,
+             meta: files_meta.merge(count(page_dict[:total_count])).
+             merge({ pagination: page_dict })
+    end
+
+    def render_files_list(files:, folders:)
+      files_size = files.size
+
+      return render(plain: files_size) if show_count
+
+      user_files = Node.where(id: (files + folders).map(&:id)).eager_load(user: :org).
+        order(order_params).page(page_from_params).per(page_size)
+
+      page_dict = pagination_dict(user_files)
+      page_dict[:total_count] = files_size
+
+      render json: user_files, root: "files", adapter: :json,
+             meta: files_meta.
+               merge(count(page_dict[:total_count])).
+               merge({ pagination: page_dict })
+    end
+
+    # Default to reverse chronological order unless overriden by params
+    def order_params
+      if params[:order_by]
+        order_from_params
+      else
+        { created_at: Sortable::DIRECTION_DESC }
+      end
+    end
+
     # Get a FolderService new instance for a current context
     def folder_service
       @folder_service ||= FolderService.new(@context)
@@ -495,8 +546,10 @@ def find_file
     end
 
     def find_user_file
-      @file = UserFile.not_assets.accessible_by(@context).
+      @file = UserFile.where.not(parent_type: "Asset").accessible_by(@context).
         includes(:user).find_by!(uid: params[:uid])
+    rescue ActiveRecord::RecordNotFound => e
+      raise ApiError, Message.not_found(e.exception.model)
     end
 
     def can_edit?
@@ -520,53 +573,6 @@ def can_copy_to_scope?
 
       raise ApiError, "You have no permissions to copy files to the scope '#{scope}'"
     end
-
-    # TODO: move message building away from the controller?
-    # Builds response notifications for the copy action.
-    # @param copies [CopyService::Copies] Copies
-    # @return [Array<Hash>] Array of notifications.
-    # rubocop:disable Metrics/MethodLength
-    def build_copy_messages(copies)
-      copied_count = copies.select(&:copied).size
-      messages = []
-
-      if copied_count.positive?
-        messages << {
-          type: "success",
-          message: I18n.t("api.files.copy.success", count: copied_count),
-        }
-      end
-
-      not_copied_files =
-        copies.select { |copy| copy.object.is_a?(UserFile) && !copy.copied }.map(&:object)
-      not_copied_folders =
-        copies.select { |copy| copy.object.is_a?(Folder) && !copy.copied }.map(&:object)
-
-      if not_copied_files.present?
-        messages << {
-          type: "warning",
-          message: I18n.t(
-            "api.files.copy.files_not_copied",
-            count: not_copied_files.size,
-            files: not_copied_files.map(&:name).join(", "),
-          ),
-        }
-      end
-
-      if not_copied_folders.present?
-        messages << {
-          type: "warning",
-          message: I18n.t(
-            "api.files.copy.folders_not_copied",
-            count: not_copied_folders.size,
-            folders: not_copied_folders.map(&:name).join(", "),
-          ),
-        }
-      end
-
-      messages
-    end
-    # rubocop:enable Metrics/MethodLength
   end
   # rubocop:enable Metrics/ClassLength
 end
diff --git a/app/controllers/api/folders_controller.rb b/app/controllers/api/folders_controller.rb
index 2809c08c8..88307c72c 100644
--- a/app/controllers/api/folders_controller.rb
+++ b/app/controllers/api/folders_controller.rb
@@ -8,8 +8,14 @@ class FoldersController < ApiController
     def children
       params[:scope] ||= "private"
 
-      children = @folder&.children ||
-                 current_user.nodes.where(parent_folder_id: nil)
+      children = if params[:scope] == Scopes::SCOPE_PRIVATE
+        @folder&.children ||
+          current_user.nodes.where(parent_folder_id: nil)
+      elsif params[:scope] == Scopes::SCOPE_PUBLIC
+        @folder&.children ||
+          Node.where(scope: params[:scope], parent_folder_id: nil)
+      end
+
       if [Scopes::SCOPE_PRIVATE, Scopes::SCOPE_PUBLIC].include?(params[:scope])
         children = children.where.not(sti_type: "Asset")
       end
@@ -21,16 +27,34 @@ def children
 
     # POST /api/folders/publish_folders
     # Makes selected folder(s) and all them children files publishable.
+    # Check, whether folder(s) to be published already exist.
+    # If yes - publish is stopped with appropriate warning.
+    # @param ids [Array of Integers] - array of folders ids
+    # @return count [Object] - qty of folders published or
+    #   warning message when no any folders were published.
     def publish_folders
       return unless @context.can_administer_site?
 
-      folders = Folder.where(id: params[:ids], user_id: @context.user_id)
+      folders = Folder.where(id: params[:ids])
       head(:unprocessable_entity) && return unless folders.exists?
       files = folders.flat_map(&:all_children)
 
-      count = UserFile.publish(folders + files, @context, UserFile::SCOPE_PUBLIC)
-
-      render json: { count: count }
+      names_match = folder_service.find_match_names(folders)
+      if names_match.empty?
+        count = UserFile.publish(folders + files, @context, UserFile::SCOPE_PUBLIC)
+
+        render json: { count: count }
+      else
+        type = :warning
+        text =
+          if names_match.size > 1
+            "Unable to publish: folders with names '#{names_match.join('\', \'')}' already exists"
+          else
+            "Unable to publish: folder with name '#{names_match.first}' already exists"
+          end
+
+        render json: { messages: [{ type: type, text: text }] }
+      end
     end
 
     # POST /api/folders/rename_folder
@@ -38,7 +62,7 @@ def publish_folders
     def rename_folder
       result = folder_service.rename(@folder, params[:name])
 
-      raise ApiError, result.value.values if result.failure?
+      raise ApiError, result.value[:message] if result.failure?
 
       render json: result.value, adapter: :json
     end
@@ -53,6 +77,7 @@ def find_folder
       head(:forbidden) unless @folder&.accessible_by?(@context)
     end
 
+    # Get a FolderService new instance for a current context
     def folder_service
       @folder_service ||= FolderService.new(@context)
     end
diff --git a/app/controllers/api/jobs_controller.rb b/app/controllers/api/jobs_controller.rb
index 179f1525d..a38e60f70 100644
--- a/app/controllers/api/jobs_controller.rb
+++ b/app/controllers/api/jobs_controller.rb
@@ -18,25 +18,20 @@ class JobsController < ApiController
     ORDER_FIELDS = { # we use this order-fields Hash for simple filtering (JobService::JobFilter)
       "created_at" => %w(created_at),
       "name" => %w(name),
-      "apptitle" => %w(apps.title),
+      "app_title" => %w(apps.title),
       "username" => %w(users.first_name users.last_name),
-    }.freeze
-
-    ORDER_GROUP_FIELDS = { # we use this order-fields Hash for advanced filtering with grouping
-      "analyses.batch_id" => Sortable::DIRECTION_DESC,
-      "workflows.id" => Sortable::DIRECTION_DESC,
+      "workflow" => %w(workflows.title),
     }.freeze
 
     SORT_FIELDS = { # additional sorting for grouped and serialized values (see render_jobs_list)
       "created_at" => ->(left, right) { left.created_at_date_time <=> right.created_at_date_time },
       "launched_on" => ->(left, right) { left.launched_on <=> right.launched_on },
       "name" => ->(left, right) { left.name <=> right.name },
-      "apptitle" => ->(left, right) { left.app_title <=> right.app_title },
+      "app_title" => ->(left, right) { left.app_title <=> right.app_title },
       "username" => ->(left, right) { left.launched_by <=> right.launched_by },
+      "location" => ->(left, right) { left.location.downcase <=> right.location.downcase },
     }.freeze
 
-    PAGE_SIZE = Paginationable::PAGE_SIZE
-
     # GET /api/jobs or GET /api/jobs?space_id=params[:space_id]
     # api_jobs_path
     # A common Job fetch method for space and home pages, depends upon @params[:space_id].
@@ -54,18 +49,22 @@ def index
             eager_load(:app, user: :org, analysis: :workflow).
             includes(:taggings).
             search_by_tags(params.dig(:filters, :tags)).
-            order(order_from_params).page(page_from_params).per(PAGE_SIZE)
+            order(order_from_params).page(page_from_params).per(page_size)
           jobs.each { |job| job.current_user = @context.user }
 
           jobs = JobService::JobsFilter.call(jobs, params[:filters])
-
           sync_jobs(jobs)
         end
 
         page_dict = pagination_dict(jobs)
 
-        render json: jobs, root: "jobs", meta: count(page_dict[:total_count]).
-          merge({ pagination: page_dict }), adapter: :json
+        if show_count
+          render plain: page_dict[:total_count]
+        else
+          render json: jobs, root: Job.model_name.plural,
+                 meta: { count: page_dict[:total_count], pagination: page_dict },
+                 adapter: :json
+        end
       else
         # Fetches all user 'private' jobs.
         jobs = Job.
@@ -73,90 +72,16 @@ def index
           accessible_by_private.
           eager_load(:app, user: :org, analysis: :workflow).
           includes(:taggings).
-          search_by_tags(params.dig(:filters, :tags)).
-          order(ORDER_GROUP_FIELDS)
+          search_by_tags(params.dig(:filters, :tags))
+
         jobs = JobService::JobsFilter.call(jobs, params[:filters])
+        sync_jobs(jobs)
 
         render_jobs_list(jobs)
       end
     end
     # rubocop:enable Metrics/MethodLength
 
-    # A common method for apps list json rendering.
-    # Added a virtual attribute `current_user` - to use in serializer
-    # @param jobs [Array] Array of Job objects.
-    # @return array [Array] Array of 1. workflow + its jobs Workflow[Jobs]
-    # or 2. just single job [Job]
-    # rubocop:disable Metrics/MethodLength
-    def render_jobs_list(jobs)
-      workflow_with_jobs = []
-      workflow_batch = {}
-
-      jobs.each do |job|
-        analysis = job&.analysis
-        job.current_user = current_user
-        workflow = analysis&.workflow
-        slot = workflow_with_jobs.last
-
-        if slot.nil? || slot[:analysis_dxid] != analysis&.dxid ||
-           slot[:workflow]&.dxid != workflow&.dxid
-          workflow_with_jobs << { analysis_dxid: analysis&.dxid,
-                                  batch_id: analysis&.batch_id,
-                                  workflow: workflow, jobs: [job] }
-          fill_batch_with_workflows(workflow_batch, workflow, analysis)
-        else
-          slot[:jobs] << job
-        end
-      end
-
-      workflow_with_jobs.map! do |slot|
-        if slot[:workflow].nil?
-          slot[:jobs].map do |job|
-            job_serialized = JobSerializer.new(job)
-            job_serialized.launched_on = job.analysis&.created_at || job.created_at
-            job_serialized
-          end
-        else
-          slot[:workflow].current_user = current_user
-
-          workflow_serialized = WorkflowSerializer.new(slot[:workflow])
-          number_workflows_in_batch(workflow_batch[slot[:batch_id]],
-                                    workflow_serialized, slot[:analysis_dxid])
-          workflow_serialized.jobs = slot[:jobs].map do |job|
-            job_serialized = JobSerializer.new(job)
-
-            launched_on = job.analysis&.created_at || job.created_at
-            job_serialized.launched_on = launched_on
-            if workflow_serialized.launched_on.nil? ||
-               launched_on < workflow_serialized.launched_on
-              workflow_serialized.launched_on = launched_on
-            end
-
-            job_serialized
-          end
-
-          workflow_serialized.launched_on ||= Time.current
-          workflow_serialized
-        end
-      end.flatten!
-
-      page_array = paginate_array(sort_array_by_fields(workflow_with_jobs))
-      page_meta = pagination_meta(workflow_with_jobs.count)
-      page_meta[:count] = page_meta.dig(:pagination, :total_count)
-
-      render json: { jobs: page_array, meta: page_meta }, adapter: :json
-    end
-    # rubocop:enable Metrics/MethodLength
-
-    # Create meta data for jobs json
-    # @param jobs [Array] Array of Job objects.
-    def jobs_meta(jobs)
-      { count: {} }.tap do |meta|
-        # jobs count
-        meta[:count] = jobs.count
-      end
-    end
-
     # GET /api/jobs/featured
     # A fetch method for jobs, accessible by public and with admin taggings.
     # @param created_at [String] Param for ordering.
@@ -166,9 +91,10 @@ def featured
         accessible_by_public.
         eager_load(:app, user: :org, analysis: :workflow).
         includes(:taggings).
-        search_by_tags(params.dig(:filters, :tags)).
-        order(ORDER_GROUP_FIELDS)
+        search_by_tags(params.dig(:filters, :tags))
+
       jobs = JobService::JobsFilter.call(jobs, params[:filters])
+      sync_jobs(jobs)
 
       render_jobs_list(jobs)
     end
@@ -183,32 +109,52 @@ def everybody
         accessible_by_public.
         eager_load(:app, user: :org, analysis: :workflow).
         includes(:taggings).
-        search_by_tags(params.dig(:filters, :tags)).
-        order(ORDER_GROUP_FIELDS)
+        search_by_tags(params.dig(:filters, :tags))
+
       jobs = JobService::JobsFilter.call(jobs, params[:filters])
+      sync_jobs(jobs)
 
       render_jobs_list(jobs)
     end
 
+    # GET /api/workflows/:id/jobs
+    # A fetch method for jobs from apps.
+    # @param uid [Integer] Param for Workflows fetch.
+    # @return jobs [Job] Array of Job objects if they exist OR jobs: [].
+    def workflow
+      workflow = Workflow.find_by(uid: unsafe_params[:id])
+      analyses = workflow.analyses.
+        eager_load(:jobs, :workflow, :batch_items)
+
+      presenter = Presenters::WorkflowExecutionsPresenter.
+        new(analyses, @context, unsafe_params).call
+      payload = { jobs: presenter.response, meta: pagination_meta(presenter.size) }
+
+      render json: payload, adapter: :json
+    rescue StandardError => e
+      raise ApiError, Message.bad_request(e.message)
+    end
+
     # GET /api/apps/:id/jobs
     # A fetch method for jobs from apps.
     # @param uid [Integer] Param for App fetch.
     # @return jobs [Job] Array of Job objects if they exist OR jobs: [].
     def app
       jobs = App.find_by(uid: unsafe_params[:id]).
-        app_series.jobs.editable_by(@context).
+        app_series.jobs.accessible_by(@context).
         eager_load(:app, user: :org, analysis: :workflow).
         includes(:taggings).
         search_by_tags(params.dig(:filters, :tags)).
-        order(order_from_params).page(page_from_params).per(PAGE_SIZE)
-      jobs.each { |job| job.current_user = @context.user }
+        order(order_from_params).page(page_from_params).per(page_size)
 
       jobs = JobService::JobsFilter.call(jobs, params[:filters])
+      jobs.each { |job| job.current_user = @context.user }
 
       page_dict = pagination_dict(jobs)
 
-      render json: jobs, root: "jobs", meta: count(page_dict[:total_count]).
-        merge({ pagination: page_dict }), adapter: :json
+      render json: jobs, root: Job.model_name.plural,
+             meta: { count: page_dict[:total_count], pagination: page_dict },
+             adapter: :json
     end
 
     # GET /api/jobs/spaces
@@ -222,10 +168,10 @@ def spaces
         accessible_by_user(@context.user).
         eager_load(:app, user: :org, analysis: :workflow).
         includes(:taggings).
-        search_by_tags(params.dig(:filters, :tags)).
-        order(order_from_params)
+        search_by_tags(params.dig(:filters, :tags))
 
       jobs = JobService::JobsFilter.call(jobs, params[:filters])
+      sync_jobs(jobs)
 
       render_jobs_list(jobs)
     rescue StandardError => e
@@ -262,26 +208,10 @@ def show
     # Provide a call to DNAnexusAPI - to terminate an accessible job.
     # @param id [Integer] Param for job fetch.
     def terminate
-      find_job
-      if @job.nil?
-        type = :error
-        text = "Sorry, this job does not exist or is not accessible by you"
-        path = api_jobs_path
+      service = Jobs::TerminateService.call(unsafe_params.dig(:job, :id), @context)
+      raise ApiError, service.message unless service.success?
 
-        render json: { path: path, message: { type: type, text: text } }, adapter: :json
-        return
-      end
-      if !@job.terminal?
-        DNAnexusAPI.new(@context.token).call(@job.dxid, "terminate")
-        type = :success
-        text = "Job was successfully terminated"
-      else
-        type = :warning
-        text = "Job is in terminal state and can not be terminated"
-      end
-      path = api_job_path(@job)
-
-      render json: { path: path, message: { type: type, text: text } }, adapter: :json
+      render json: { message: { type: service.status, text: service.message } }
     end
 
     # POST /api/jobs/copy
@@ -292,12 +222,112 @@ def copy
         copies.push(object: job_copier.copy(job, params[:scope]), source: nil)
       end
 
-      render json: copies.all, root: "jobs", adapter: :json,
+      render json: copies.all, root: Job.model_name.plural, adapter: :json,
              meta: { messages: build_copy_messages(copies) }
     end
 
+    # Open HTTPS external job url.
+    def open_external
+      job = Job.accessible_by(@context).find_by(uid: params[:id])
+
+      raise ApiError, "You have no permissions to access this job" unless job
+
+      redirect_back(fallback_location: job_path(job)) && return unless job.https? && job.running?
+      redirect_to(job.https_job_external_url) && return if Utils.development_or_test?
+
+      api = DIContainer.resolve("api.auth_user")
+      code = api.get_https_job_auth_token(job)
+      authorized_job_uri = URI.join(
+        job.https_job_external_url,
+        "oauth2/access",
+        "?#{URI.encode_www_form(code: code)}",
+      )
+
+      redirect_to authorized_job_uri.to_s
+    end
+
+    # Trigger files sync from a running workstation
+    def sync_files
+      service = Jobs::SyncFilesService.call(params[:id], @context)
+      raise ApiError, service.message unless service.success?
+
+      render json: { message: { type: service.status, text: service.message } }
+    end
+
     private
 
+    # A common method for apps list json rendering.
+    # Added a virtual attribute `current_user` - to use in serializer
+    # @param jobs [Array] Array of Job objects.
+    # @return array [Array] Array of 1. workflow + its jobs Workflow[Jobs]
+    # or 2. just single job [Job]
+    # rubocop:disable Metrics/MethodLength
+    def render_jobs_list(jobs)
+      jobs_size = jobs.size
+
+      render :plain && (return jobs_size) if show_count
+
+      workflow_with_jobs = []
+      workflow_batch = {}
+
+      jobs.each do |job|
+        analysis = job&.analysis
+        job.current_user = current_user
+        workflow = analysis&.workflow
+        slot = workflow_with_jobs.last
+
+        if slot.nil? || slot[:analysis_dxid] != analysis&.dxid ||
+           slot[:workflow]&.dxid != workflow&.dxid
+          workflow_with_jobs << { analysis_dxid: analysis&.dxid,
+                                  batch_id: analysis&.batch_id,
+                                  workflow: workflow, jobs: [job] }
+          fill_batch_with_workflows(workflow_batch, workflow, analysis)
+        else
+          slot[:jobs] << job
+        end
+      end
+
+      workflow_with_jobs.map! do |slot|
+        if slot[:workflow].nil?
+          slot[:jobs].map do |job|
+            job_serialized = JobSerializer.new(job)
+            job_serialized.launched_on = job.analysis&.created_at || job.created_at
+            job_serialized
+          end
+        else
+          slot[:workflow].current_user = current_user
+
+          workflow_serialized = WorkflowSerializer.new(slot[:workflow])
+          number_workflows_in_batch(workflow_batch[slot[:batch_id]],
+                                    workflow_serialized, slot[:analysis_dxid])
+          workflow_serialized.jobs = slot[:jobs].map do |job|
+            job_serialized = JobSerializer.new(job)
+
+            launched_on = job.analysis&.created_at || job.created_at
+            job_serialized.launched_on = launched_on
+            if workflow_serialized.launched_on.nil? ||
+               launched_on < workflow_serialized.launched_on
+              workflow_serialized.launched_on = launched_on
+            end
+
+            job_serialized
+          end
+
+          workflow_serialized.launched_on ||= Time.current
+          workflow_serialized
+        end
+      end.flatten!
+
+      page_array = paginate_array(sort_array_by_fields(workflow_with_jobs))
+      page_meta = pagination_meta(workflow_with_jobs.count)
+
+      page_meta[:pagination][:total_count] = jobs_size
+      page_meta[:count] = jobs_size
+
+      render json: { jobs: page_array, meta: page_meta }, adapter: :json
+    end
+    # rubocop:enable Metrics/MethodLength
+
     def job_copier
       @job_copier ||= CopyService::JobCopier.new(api: @context.api, user: current_user)
     end
@@ -365,6 +395,10 @@ def fill_batch_with_workflows(workflow_batch, workflow, analysis)
       workflow_batch[analysis.batch_id].insert(insert_at, new_item)
     end
 
+    def order_dir
+      unsafe_params[:order_dir] || :DESC
+    end
+
     # Enumerate Workflow title based on batch side (like "Title (1 of 3)")
     # @param batch [Array] array with workflow_id ordered by created_at
     # @param serialized_workflow [WorkflowSerializer] Serialized version of WorkFlow
diff --git a/app/controllers/api/licenses_controller.rb b/app/controllers/api/licenses_controller.rb
index d35ef5056..333991370 100644
--- a/app/controllers/api/licenses_controller.rb
+++ b/app/controllers/api/licenses_controller.rb
@@ -1,5 +1,6 @@
 module Api
   # Home API controller for Licenses.
+  # rubocop:disable Metrics/ClassLength
   class LicensesController < ApiController
     # GET - Returns user accessible list_licenses according to input filters.
     #   Used in license dialogs.
@@ -21,7 +22,7 @@ def index
     # GET /api/licenses/:id
     # A fetch method for licenses by file :id, editable by a current user.
     # @param id [Integer] Param for license fetch.
-    # @return @license []License object]
+    # @return @license [] License object
     def show
       find_license
 
@@ -50,7 +51,7 @@ def license_item
       if license.editable_by?(@context) && item.editable_by?(@context)
         LicensedItem.transaction do
           licensed_item = LicensedItem.find_by(licenseable: item)
-          licensed_item&.destroy # unless licensed_item.nil?
+          licensed_item&.destroy
 
           if LicensedItem.create!(license_id: license.id, licenseable: item)
             type = :success
@@ -87,7 +88,7 @@ def find_license
     # POST remove_item_api_license
     # detach license from an object
     # @param id [Integer] - license :id
-    # @param :item_uid [Integer] - object :uid
+    # @param item_uid [Integer] - object :uid
     def remove_item
       license = License.find(params[:id])
       item = item_from_uid(params[:item_uid])
@@ -116,5 +117,85 @@ def remove_item
         render json: { path: path, message: { type: type, text: text } }, adapter: :json
       end
     end
+
+    # POST "/licenses/6-license-title/request_approval" - send a request to approve a license
+    # @param accepted_license [Object] - { "message" => "Approve 4444" },
+    # @param id [Integer] - license :id - "6-license-title".
+    # GET "/licenses/6-license-title/request_approval" - return a license approval
+    # rubocop:disable Metrics/MethodLength
+    def request_approval
+      accessible_license
+      path = api_license_path(license&.id)
+
+      if @license.nil?
+        type = :warning
+        text = "Sorry, this license does not exist or is not accessible by you"
+
+        render json: { path: path, message: { type: type, text: text } }, adapter: :json
+        return
+      end
+      message = !params[:accepted_license].nil? ? params[:accepted_license][:message] : nil
+
+      if request.post? && !message.nil? && message.is_a?(String)
+        accepted_license = AcceptedLicense.create!({
+          license_id: @license.id,
+          user_id: @context.user_id,
+          state: "pending",
+          message: message,
+        })
+        if accepted_license.persisted?
+          NotificationsMailer.license_request_email(license, @context.user, message).deliver_now!
+          type = :success
+          text = "License \"#{@license.title}\" approval requested"
+        else
+          type = :warning
+          text = "You cannot approve this License \"#{@license.title}\", since its acceptance" \
+            " does not exist"
+        end
+
+        render json:
+               accepted_license, root: "accepted_licens", adapter: :json,
+               path: path, message: { type: type, text: text }
+      else
+        accepted_license = AcceptedLicense.new({
+          license_id: @license.id,
+          user_id: @context.user_id,
+          state: "pending",
+          message: message,
+        })
+        text = "License acception was created"
+
+        render json:
+                 accepted_license, root: "accepted_licens", adapter: :json,
+               path: license_path(@license), message: { type: :success, text: text }
+      end
+    end
+    # rubocop:enable Metrics/MethodLength
+
+    #
+    # POST accept_api_license /api/licenses/:id/accept
+    # Called from license#show, file#show, asset#show
+    # Accept a single license for file/asset
+    # @param id [Integer] - license :id - "6-license-title".
+    def accept
+      accessible_license
+
+      if AcceptedLicense.find_or_create_by(license_id: @license.id, user_id: @context.user_id)
+        type = :success
+        text = "License \"#{@license.title}\" accepted"
+      else
+        type = :error
+        text = "Sorry, license \"#{@license.title}\" does not exist or is not accessible by you"
+      end
+
+      render json: { message: { type: type, text: text } }, adapter: :json
+    end
+
+    private
+
+    def accessible_license
+      @license = License.accessible_by(@context).find(params[:id])
+    end
   end
 end
+# rubocop:enable Metrics/ClassLength
diff --git a/app/controllers/api/news_items_controller.rb b/app/controllers/api/news_items_controller.rb
new file mode 100644
index 000000000..47d8d6c77
--- /dev/null
+++ b/app/controllers/api/news_items_controller.rb
@@ -0,0 +1,25 @@
+module Api
+  # News Items API controller.
+  class NewsItemsController < BaseController
+    include Paginationable
+
+    skip_before_action :require_api_login
+
+    def index
+      page = params[:page].presence || 1
+      year = params[:year] =~ /\A\d+\Z/ ? params[:year].to_i : nil
+
+      news_items = NewsItem.published.order(created_at: :desc).page(page)
+      news_items = news_items.where(Arel.sql("YEAR(created_at) = #{year}")) if year
+
+      render json: news_items,
+             meta: pagination_dict(news_items),
+             adapter: :json
+    end
+
+    def years
+      all_years = NewsItem.published.order(created_at: :desc).pluck(:created_at).map(&:year).uniq
+      render json: all_years
+    end
+  end
+end
diff --git a/app/controllers/api/notification_preferences_controller.rb b/app/controllers/api/notification_preferences_controller.rb
new file mode 100644
index 000000000..b8fbf1a04
--- /dev/null
+++ b/app/controllers/api/notification_preferences_controller.rb
@@ -0,0 +1,29 @@
+module Api
+  # Notification Preferences API controller.
+  class NotificationPreferencesController < ApiController
+    def index
+      render json: { preference: preference.all_attributes }
+    end
+
+    def change
+      preference.attributes = permitted_params
+      render json: { success: preference.save }
+    end
+
+    private
+
+    def preference
+      @preference ||= NotificationPreference.find_or_initialize_by(user_id: @context.user_id)
+    end
+
+    def permitted_params
+      params.require(:notification_preference).permit(*preference.available_keys)
+    end
+
+    def check_user
+      return if UserPolicy.access_notification_preference?(current_user)
+
+      redirect_to root_url
+    end
+  end
+end
diff --git a/app/controllers/api/participants_controller.rb b/app/controllers/api/participants_controller.rb
new file mode 100644
index 000000000..7cdcd2bc4
--- /dev/null
+++ b/app/controllers/api/participants_controller.rb
@@ -0,0 +1,16 @@
+module Api
+  # Participants API controller.
+  class ParticipantsController < BaseController
+    skip_before_action :require_api_login
+
+    def index
+      orgs = Participant.org.positioned
+      orgs = orgs.each { |pnt| pnt.image_url = view_context.image_path(pnt.image_url) }
+      persons = Participant.person.positioned
+      persons = persons.each { |pnt| pnt.image_url = view_context.image_path(pnt.image_url) }
+
+      render json: { "orgs": orgs, "persons": persons },
+             adapter: :json
+    end
+  end
+end
diff --git a/app/controllers/api/spaces/files_controller.rb b/app/controllers/api/spaces/files_controller.rb
index 70e407928..b9d0531f6 100644
--- a/app/controllers/api/spaces/files_controller.rb
+++ b/app/controllers/api/spaces/files_controller.rb
@@ -8,15 +8,12 @@ class FilesController < ApiController
       before_action :can_edit?, except: %i(subfolders)
 
       # POST /api/spaces/:space_id/files/publish_files
-      # Makes selected files/folders public.
+      # Makes selected files public.
       def publish_files
         files = @space.files.where(id: params[:ids])
-        folders = @space.folders.where(id: params[:ids])
-        head(:unprocessable_entity) && return unless files.exists? && folders.exists?
-        folder_children = folders.flat_map(&:all_children)
+        head(:unprocessable_entity) && return unless files.exists?
 
-        count = UserFile.publish(files + folders + folder_children,
-                                 @context, UserFile::SCOPE_PUBLIC)
+        count = UserFile.publish(files, @context, UserFile::SCOPE_PUBLIC)
 
         render json: { count: count }
       end
@@ -30,7 +27,7 @@ def move
         result = folder_service.move(
           nodes,
           target_folder,
-          @space.uid,
+          target_folder&.scope || @space.uid,
         )
 
         raise ApiError, result.value[:message] if result.failure?
@@ -56,16 +53,11 @@ def remove
           nodes.where(sti_type: "Folder").find_each do |folder|
             folder.all_children.each { |node| node.update!(state: UserFile::STATE_REMOVING) }
           end
-
-          Array(nodes.pluck(:id)).in_groups_of(1000, false) do |ids|
-            job_args = ids.map do |node_id|
-              [node_id, session_auth_params]
-            end
-
-            Sidekiq::Client.push_bulk("class" => RemoveNodeWorker, "args" => job_args)
-          end
         end
 
+        job_args = nodes.pluck(:id).in_groups_of(1, false).map { |id| id << session_auth_params }
+        RemoveNodeWorker.perform_bulk(job_args, batch_size: 100)
+
         head :ok
       end
 
@@ -74,7 +66,8 @@ def remove
       def create_folder
         parent_folder = @space.folders.find_by(id: params[:parent_folder_id])
 
-        result = folder_service.add_folder(params[:name], parent_folder, @space.uid)
+        scope = parent_folder&.scope || @space.uid
+        result = folder_service.add_folder(params[:name], parent_folder, scope)
 
         raise ApiError, result.value.values.flatten.first if result.failure?
 
diff --git a/app/controllers/api/spaces/memberships_controller.rb b/app/controllers/api/spaces/memberships_controller.rb
index 3c387b700..165ce96f7 100644
--- a/app/controllers/api/spaces/memberships_controller.rb
+++ b/app/controllers/api/spaces/memberships_controller.rb
@@ -12,14 +12,26 @@ class MembershipsController < ApiController
       # POST /api/spaces/:id/invite
       # Creates new space members.
       def invite
-        space_invite_form = SpaceInviteForm.new(space_invite_params.merge(space: @space))
+        space_invite_form = SpaceInviteForm.new(space_invite_params.merge(
+          space: @space,
+          current_user: @context.user,
+        ))
 
         if space_invite_form.valid?
-          api = @membership.persisted? ? @context.api : DNAnexusAPI.for_admin
+          membership =
+            if @membership.nil? && @context.user.review_space_admin?
+              @space.space_memberships.active.find_by(user: @space.host_lead)
+            else
+              @membership
+            end
+
+          api = membership.persisted? ? @context.api : DIContainer.resolve("api.admin")
+
           begin
-            invited_emails = space_invite_form.invite(@membership, api)
-          rescue StandardError
-            error = "An error has occurred during inviting"
+            invited_emails = space_invite_form.invite(membership, api)
+          rescue StandardError => e
+            error = e.message
+            logger.error error
           end
 
           if invited_emails.present?
@@ -44,7 +56,7 @@ def update
           end
         end
 
-        render json: { member: member.user.full_name, role: role }, adapter: :json
+        render json: { member: member.user.dxuser, role: role }, adapter: :json
       end
 
       private
@@ -53,12 +65,12 @@ def update
       def fetch_membership
         @membership = @space.space_memberships.active.find_by(user: current_user)
 
-        head(:forbidden) unless @membership
+        head(:forbidden) unless @membership || current_user.review_space_admin?
       end
 
       # Adds invitees attributes to fit SpaceInviteForm.
       def space_invite_params
-        params.permit(:invitees, :invitees_role, :space_id)
+        params.permit(:invitees, :invitees_role, :space_id, :side)
       end
 
       # Collects validation errors from SpaceInviteForm.
diff --git a/app/controllers/api/spaces_controller.rb b/app/controllers/api/spaces_controller.rb
index af95ebe19..62676bded 100644
--- a/app/controllers/api/spaces_controller.rb
+++ b/app/controllers/api/spaces_controller.rb
@@ -26,7 +26,6 @@ class SpacesController < ApiController
     # Activates a space.
     def accept
       membership = @space.space_memberships.find_by(user: current_user)
-
       if SpaceMembershipPolicy.can_accept?(@space, membership)
         SpaceService::Accept.call(api, @space, membership)
 
@@ -68,16 +67,21 @@ def editable_spaces
     # Fetches spaces list.
     def index
       allowed_orderings = %w(created_at name space_type updated_at).freeze
-      page = params[:page].presence || 1
 
       order = order_query(params[:order_by], params[:order_dir], allowed_orderings)
 
       spaces = SpaceService::SpacesFilter.
-        call(@context.user, unsafe_params[:query]).
-        order(order).
-        page(page)
+        call(@context.user, unsafe_params[:filters]).
+        includes(:taggings).
+        search_by_tags(params.dig(:filters, :tags)).
+        order(order).page(page_from_params).per(page_size)
+
+      page_dict = pagination_dict(spaces)
+      spaces = sort_array_by_fields(spaces)
+      page_meta = pagination_meta(spaces.count)
 
-      render json: spaces, meta: pagination_dict(spaces).merge(order: order), adapter: :json
+      render json: spaces, root: "spaces", adapter: :json,
+             meta: page_meta.merge({ pagination: page_dict })
     end
 
     # GET /api/spaces/info
@@ -94,14 +98,36 @@ def show
 
     # PUT /api/spaces/:id
     # Updates a space.
+    # @param id [String] - space id in a string form: id: "9-spacename"
+    # @param update_space_params [Object] - space params from SpaceEditForm
     def update
       space = Space.undeleted.find(params[:id])
 
       head(:forbidden) && return unless space.updatable_by?(current_user)
 
-      space.update!(update_space_params)
+      space_edit_params = update_space_params.merge(
+        current_user: current_user,
+        space_host_lead: space.host_lead_dxuser,
+        source_space_id: space.id,
+      )
 
-      render json: space, adapter: :json
+      space_edit_params = space_edit_params.merge(space_guest_lead: space.guest_lead_dxuser) unless space.exclusive?
+      space_update_form = SpaceEditForm.new(space_edit_params)
+
+      if space_update_form.valid?
+        space.update!(update_space_naming_params)
+        space.confidential_spaces.each { |confidential_space| confidential_space.update!(update_space_naming_params) }
+        api = DIContainer.resolve("api.admin")
+
+        space.leads_updates(space_update_form, api)
+
+        render json: space, adapter: :json
+      else
+        errors = [space_update_form.errors&.full_messages&.join("\n ")]
+
+        render json: { errors: { messages: errors } },
+               status: :unprocessable_entity, adapter: :json
+      end
     end
 
     # GET /api/spaces/:id/members
@@ -136,7 +162,7 @@ def jobs
 
       jobs = @space.jobs.order(order)
 
-      User.sync_jobs!(@context, jobs)
+      Job.sync_jobs!(@context, jobs)
 
       render json: jobs, adapter: :json
     end
@@ -147,45 +173,52 @@ def add_data
       head(:forbidden) && return unless @space.editable_by?(current_user)
 
       grouped = @items.group_by(&:klass)
-
       user_files, assets, apps, workflows = grouped.values_at("file", "asset", "app", "workflow")
       files = Array(user_files) + Array(assets)
-      apps ||= []
-
-      copied_files = nil
-
-      if files.present?
-        destination_project = UserFile.publication_project!(current_user, @space.scope)
-
-        UserFile.transaction do
-          # create initial copies of files with a COPYING state, in order to show them in the UI.
-          copied_files = files.map do |file|
-            CopyService::FileCopier.copy_record(
-              file,
-              @space.scope,
-              destination_project,
-              state: UserFile::STATE_COPYING,
-              scoped_parent_folder_id: params[:folder_id],
-            )
-          end
-
-          FileCopyWorker.perform_async(
-            @space.scope,
-            files.map(&:id),
-            params[:folder_id],
-            session_auth_params,
-          )
-        end
-      end
-
+      copy_files_to_space(files)
       workflows&.each { |workflow| copy_service.copy(workflow, @space.scope) }
-      apps.each { |app| copy_service.copy(app, @space.scope) }
+      apps&.each { |app| copy_service.copy(app, @space.scope) }
 
       head :ok
     end
 
     private
 
+    # Copy files to a space using the worker.
+    def copy_files_to_space(files)
+      return if files.blank?
+
+      prepare_files_to_copy(files)
+
+      FileCopyWorker.perform_async(
+        @space.scope,
+        files.map(&:id),
+        params[:folder_id],
+        session_auth_params,
+      )
+    end
+
+    # Create initial copies of files with a COPYING state, in order to show them in the UI.
+    def prepare_files_to_copy(files)
+      destination_project = UserFile.publication_project!(current_user, @space.scope)
+
+      UserFile.transaction do
+        files.each do |file|
+          next if !file.closed? ||
+                  file.project == destination_project ||
+                  UserFile.exists?(dxid: file.dxid, project: destination_project)
+
+          CopyService::FileCopier.copy_record(
+            file,
+            @space.scope,
+            destination_project,
+            state: UserFile::STATE_COPYING,
+            scoped_parent_folder_id: params[:folder_id],
+          )
+        end
+      end
+    end
+
     def sync_files
       User.sync_files!(@context)
     end
@@ -210,8 +243,11 @@ def api
 
     def space_types
       [].tap do |types|
+        types << :private_type
         types << :groups if @context.can_administer_site?
+        types << :government if @context.gov_user?
         types << :review if @context.review_space_admin?
+        types << :administrator if @context.can_administer_site?
       end
     end
 
@@ -220,7 +256,8 @@ def space_types
     def find_space
       @space = Space.undeleted.find(params[:id])
 
-      return if @space.accessible_by_user?(current_user)
+      return if @space.accessible_by_user?(current_user) ||
+                (current_user.review_space_admin? && @space.review?)
 
       raise ApiError, "The space is locked." if @space.visible_by?(current_user) && @space.locked?
 
@@ -272,10 +309,15 @@ def workflows_meta
       end
     end
 
-    def update_space_params
+    def update_space_naming_params
       params.require(:space).permit(:name, :description, :cts)
     end
 
+    def update_space_params
+      params.require(:space).permit(:name, :description, :cts, :space_type, :current_user,
+                                    :host_lead_dxuser, :guest_lead_dxuser, :sponsor_lead_dxuser)
+    end
+
     def create_space_params
       params.require(:space).permit(:name, :description, :host_lead_dxuser, :guest_lead_dxuser,
                                     :space_type, :cts, :sponsor_org_handle, :source_space_id,
diff --git a/app/controllers/api/submissions_controller.rb b/app/controllers/api/submissions_controller.rb
new file mode 100644
index 000000000..c32d0d278
--- /dev/null
+++ b/app/controllers/api/submissions_controller.rb
@@ -0,0 +1,41 @@
+module Api
+  # Submissions API controller.
+  class SubmissionsController < BaseController
+    skip_before_action :require_api_login
+    before_action :require_api_login_or_guest
+
+    def index
+      challenge_id = params[:challenge_id]
+      challenge = accessible_challenges.find_by(id: challenge_id)
+
+      unless challenge
+        render json: { error: I18n.t("api.challenges.not_found_or_forbidden") }
+        return
+      end
+
+      submissions = challenge.submissions.accessible_by_public.order(id: :desc)
+
+      render json: submissions,
+             adapter: :json
+    end
+
+    def my_entries
+      challenge_id = params[:challenge_id]
+      challenge = accessible_challenges.find_by(id: challenge_id)
+
+      unless challenge
+        render json: { error: I18n.t("api.challenges.not_found_or_forbidden") }
+        return
+      end
+
+      submissions = challenge.submissions.editable_by(@context).order(id: :desc)
+
+      render json: submissions,
+             adapter: :json
+    end
+
+    def accessible_challenges
+      Challenge.accessible_by(@context)
+    end
+  end
+end
diff --git a/app/controllers/api/users_controller.rb b/app/controllers/api/users_controller.rb
index f4cc55656..ccb87f96a 100644
--- a/app/controllers/api/users_controller.rb
+++ b/app/controllers/api/users_controller.rb
@@ -1,21 +1,54 @@
 module Api
   # Responsible for user-related information.
   class UsersController < BaseController
+    skip_before_action :require_api_login, only: :show
+    before_action :require_api_login_or_guest, only: :show
+
+    before_action :check_admin, only: %i(update)
+
     def show
       render json: current_user, meta: meta, adapter: :json
     end
 
+    def update
+      user = User.find(params[:id])
+      user.update(update_user_params)
+
+      render json: user, adapter: :json
+    end
+
+    def cloud_resources
+      api = DIContainer.resolve("api.user")
+
+      resources = Users::ChargesFetcher.fetch(api, current_user)
+
+      resources[:usageLimit] = current_user.total_limit
+      resources[:jobLimit] = current_user.job_limit
+      resources[:usageAvailable] = [resources[:usageLimit] - resources[:totalCharges], 0].max
+
+      render json: resources
+    end
+
     private
 
     def meta
-      @meta ||= { links: {} }.tap do |meta|
-        meta[:links][:space_create] = api_spaces_path if current_user.can_create_spaces?
+      links = { links: {} }
+
+      return links if @context.guest?
+
+      links.tap do |meta|
+        meta[:links][:space_create] = api_spaces_path
         meta[:links][:space_info] = info_api_spaces_path
         meta[:links][:accessible_spaces] = editable_spaces_api_spaces_path
         meta[:links][:accessible_apps] = api_list_apps_path
         meta[:links][:accessible_workflows] = api_list_workflows_path
         meta[:links][:accessible_files] = api_list_files_path
+        meta[:links][:challenge_new] = new_challenge_path if current_user.can_create_challenges?
       end
     end
+
+    def update_user_params
+      params.require(:user).permit(:job_limit, :resources, :total_limit)
+    end
   end
 end
diff --git a/app/controllers/api/workflows_controller.rb b/app/controllers/api/workflows_controller.rb
index 3678c284f..8e185dcef 100644
--- a/app/controllers/api/workflows_controller.rb
+++ b/app/controllers/api/workflows_controller.rb
@@ -9,8 +9,6 @@ class WorkflowsController < ApiController
     include SpaceConcern
     include Scopes
 
-    PAGE_SIZE = Paginationable::PAGE_SIZE
-
     # GET /api/workflows
     # A common Workflow fetch method for space and home pages, depends upon @params[:space_id].
     # @param space_id [Integer] Space id for workflows fetch. When it is nil, then fetching for
@@ -19,44 +17,46 @@ class WorkflowsController < ApiController
     # @return workflows [App] Array of workflows objects if they exist OR workflows: [].
     # rubocop:disable Metrics/MethodLength
     def index
-      page_meta = {}
-      workflows = []
-
       if params[:space_id]
+        workflows = []
+        filters = params[:filters]
+
         if find_user_space
-          workflows = @space.workflows.unremoved.
-            eager_load(:workflow_series, :user).includes(:taggings).
-            search_by_tags(params.dig(:filters, :tags)).
-            order(order_from_params).
-            page(page_from_params).per(PAGE_SIZE)
-          workflows = Workflows::WorkflowFilter.call(workflows, params[:filters])
+          workflows = @space.latest_revision_workflows.unremoved.
+            eager_load(:workflow_series, :user).includes(:taggings)
+          workflows = filter_workflows(workflows, filters)
           workflows.each { |workflow| workflow.current_user = @context.user }
-
-          page_meta = { pagination: pagination_dict(workflows) }
+          workflows = sort_array_by_fields(workflows)
+          page_meta = pagination_meta(workflows.count)
+          workflows = paginate_array(workflows)
         end
 
-        render json: workflows, root: "workflows",
-               meta: workflows_meta.merge(page_meta), adapter: :json
-      else
-        filters = params[:filters]
-        workflows = WorkflowSeries.accessible_by(@context).
-          eager_load(latest_revision_workflow: [user: :org]).
-          accessible_by_private.unremoved.
-          includes(latest_revision_workflow: [user: :org]).
-          order(order_from_params).
-          includes(:taggings).
-          map do |series|
-            latest = series.latest_accessible(@context)
-            latest if Workflows::WorkflowFilter.match(latest, filters)
-          end.compact
-        workflows.each { |workflow| workflow.current_user = @context.user }
+        page_dict = pagination_dict(workflows)
 
-        workflows = sort_array_by_fields(workflows)
-        page_meta = pagination_meta(workflows.count)
-        workflows = paginate_array(workflows)
+        if show_count
+          render plain: page_dict[:total_count]
+        else
+          render json: workflows,
+                 root: Workflow.model_name.plural,
+                 meta: workflows_meta.merge(page_meta),
+                 adapter: :json
+        end
 
-        render json: workflows, meta: page_meta, root: "workflows", adapter: :json
+        return
       end
+
+      workflows = WorkflowSeries.accessible_by(@context).
+        eager_load(latest_revision_workflow: [user: :org]).
+        accessible_by_private.unremoved.
+        includes(latest_revision_workflow: [user: :org]).
+        includes(:taggings).
+        order(order_from_params).
+        map do |series|
+          latest = series.latest_accessible(@context)
+          latest if Workflows::WorkflowFilter.match(latest, filters)
+        end.compact
+
+      render_workflows_list workflows
     end
     # rubocop:enable Metrics/MethodLength
 
@@ -68,17 +68,13 @@ def featured
       filters = params[:filters]
       workflows = WorkflowSeries.featured.unremoved.
         accessible_by_public.eager_load(:user, :taggings).
+        order(order_from_params).
         search_by_tags(params.dig(:filters, :tags)).map do |series|
           latest = series.latest_accessible(@context)
           latest if Workflows::WorkflowFilter.match(latest, filters)
         end.compact
-      workflows.each { |workflow| workflow.current_user = @context.user }
-
-      workflows = sort_array_by_fields(workflows)
-      page_meta = pagination_meta(workflows.count)
-      workflows = paginate_array(workflows)
 
-      render json: workflows, meta: page_meta, root: "workflows", adapter: :json
+      render_workflows_list workflows
     end
 
     # GET /api/workflows/everybody
@@ -92,17 +88,13 @@ def everybody
         accessible_by_public.
         eager_load(latest_revision_workflow: [user: :org]).
         includes(:taggings).
+        order(order_from_params).
         map do |series|
           latest = series.latest_accessible(@context)
           latest if Workflows::WorkflowFilter.match(latest, filters)
         end.compact
-      workflows.each { |workflow| workflow.current_user = @context.user }
 
-      workflows = sort_array_by_fields(workflows)
-      page_meta = pagination_meta(workflows.count)
-      workflows = paginate_array(workflows)
-
-      render json: workflows, meta: page_meta, root: "workflows", adapter: :json
+      render_workflows_list workflows
     end
 
     # GET /api/workflows/spaces
@@ -112,26 +104,19 @@ def everybody
     #   which scope is not 'private' or 'public', i.e.
     #   workflows scope is one of 'space-...', if they exist OR workflows: [].
     def spaces
-      filters = params[:filters]
       workflows = WorkflowSeries.accessible_by(@context).
         eager_load(latest_revision_workflow: [user: :org]).
         where.not(scope: [SCOPE_PUBLIC, SCOPE_PRIVATE]).
         unremoved.includes(:taggings).
-        order(order_from_params).
         map do |series|
           series_wf = series.latest_accessible(@context)
           if series_wf.in_space? && Workflows::WorkflowFilter.
-              match(series_wf, filters)
+              match(series_wf, params[:filters])
             series_wf
           end
         end.compact
-      workflows.each { |workflow| workflow.current_user = @context.user }
 
-      workflows = sort_array_by_fields(workflows)
-      page_meta = pagination_meta(workflows.count)
-      workflows = paginate_array(workflows)
-
-      render json: workflows, meta: page_meta, root: "workflows", adapter: :json
+      render_workflows_list workflows
     end
 
     # GET /api/workflows/:id (show)
@@ -197,7 +182,7 @@ def copy
                       success: "The workflow has been published successfully!"
         end
 
-        format.json { render json: new_workflows, root: "workflows", adapter: :json }
+        format.json { render json: new_workflows, root: Workflow.model_name.plural, adapter: :json }
       end
     rescue StandardError => e
       raise ApiError, Message.bad_request(e.message)
@@ -209,7 +194,8 @@ def create
           workflow = Workflows::Builder.call(presenter)
           render json: { id: workflow.uid, asset_uids: presenter.assets.map(&:uid) }
         else
-          render json: { errors: presenter.errors.full_messages }, status: :unprocessable_entity
+          render json: { error: { message: presenter.errors.full_messages.first } },
+                 status: :unprocessable_entity
         end
       end
     rescue StandardError => e
@@ -221,11 +207,40 @@ def create
         e.message
       end
 
-      render json: { errors: [message] }, status: :unprocessable_entity
+      render json: { error: { message: message } }, status: :unprocessable_entity
+    end
+
+    def diagram
+      workflow = Workflow.accessible_by(@context).find_by!(uid: unsafe_params[:id])
+
+      render json: WorkflowDiagramPresenter.call(workflow)
+    rescue ActiveRecord::RecordNotFound => e
+      raise ApiError, Message.bad_request(e.message)
     end
 
     private
 
+    def filter_workflows(workflows, filters)
+      workflows.map do |workflow|
+        if Workflows::WorkflowFilter.
+            match(workflow, filters)
+          workflow
+        end
+      end.compact
+    end
+
+    def render_workflows_list(workflows)
+      if show_count
+        render plain: workflows.count
+      else
+        workflows.each { |workflow| workflow.current_user = @context.user }
+        page_meta = pagination_meta(workflows.count)
+        workflows = paginate_array(workflows)
+
+        render json: workflows, meta: page_meta, root: Workflow.model_name.plural, adapter: :json
+      end
+    end
+
     def presenter
       @presenter ||= begin
         klass = if unsafe_params[:file]
diff --git a/app/controllers/api_controller.rb b/app/controllers/api_controller.rb
index dcba28515..eab242141 100644
--- a/app/controllers/api_controller.rb
+++ b/app/controllers/api_controller.rb
@@ -1,13 +1,15 @@
+# rubocop:todo Style/SignalException
 class ApiController < ApplicationController
   include ErrorProcessable
   include WorkflowConcern
   include FilesConcern
   include UidFindable
   include ApiExceptionHandler
+  include CloudResourcesConcern
 
   skip_before_action :verify_authenticity_token
   skip_before_action :require_login
-  # rubocop:disable Rails/LexicallyScopedActionFilter
+  # rubocop:todo Rails/LexicallyScopedActionFilter
   before_action :require_api_login,
                 except: %i(
                   destroy
@@ -36,12 +38,15 @@ class ApiController < ApplicationController
                   search_assets
                 )
   before_action :validate_create_asset, only: :create_asset
+  before_action :check_total_and_job_charges_limit, only: %i(run_workflow)
+  before_action :check_total_charges_limit, only: %i(create_file create_asset)
   before_action :validate_create_file, only: :create_file
   before_action :validate_get_upload_url, only: :get_upload_url
 
   rescue_from ApiError, with: :render_error_method
 
-  # rubocop:disable Style/SignalException
+  attr_accessor :show_count
+  attr_writer :context
 
   # A common method to add Objects count into api response
   # @param count [Integer] Object's count
@@ -50,52 +55,6 @@ def count(count)
     { count: count }
   end
 
-  # Collects an Array of children for object in params.
-  # @param uid [Object Id].
-  # @param scope [String] A scope to be published into.
-  # @return [Hash with Array value] An Array of relative children for a given Object.
-  def related_to_publish
-    id = unsafe_params[:uid]
-    raise "Missing id in publish route" unless id.is_a?(String) && id.present?
-
-    item = item_from_uid(id)
-    raise "You do not have permission to access #{id}" unless item.accessible_by?(@context)
-
-    publishing_service = SpaceService::Publishing.new(@context)
-    check_result = publishing_service.scope_check(unsafe_params[:scope])
-    scope = check_result[:scope]
-
-    relatives_graph = GraphDecorator.for_publisher(@context, item, scope).to_json
-    children = children_to_publish(relatives_graph)
-
-    render json: children
-  end
-
-  # Collects an array of children from a relatives graph.
-  # Filtering by private objects only to be included into children array.
-  # Prepare values for 'path' and 'fa_class' attributes.
-  # @param relatives_graph [Array of Objects] From GraphDecorator.
-  # @return children [Array of Objects] With the following example content:
-  #  {
-  #    \"uid\"=>\"app-0b9811c31ff0812273068d54-1\",
-  #    \"klass\"=>\"app\", \"title\"=>\"default_title\", \"owned\"=>false,
-  #    \"public\"=>true, \"in_space\"=>false, \"publishable\"=>false,
-  #    \"children\"=>[]
-  #  }
-  def children_to_publish(relatives_graph)
-    all_children = JSON.parse(relatives_graph)[0]["children"]
-    children = []
-    all_children.uniq.each do |child|
-      next if child["in_space"] || child["public"]
-
-      object = item_from_uid(child["uid"])
-      child["path"] = object.accessible_by?(@context) ? pathify(object) : nil
-      child["fa_class"] = view_context.fa_class(object)
-      children << child
-    end
-    children
-  end
-
   # Inputs
   #
   # workflow_id (string, required): the dxid of the workflow to run
@@ -296,7 +255,6 @@ def folder_tree
   #     Files inside folders are also sorted.
   #  uids: array of all found file's uid values
   #
-  # rubocop:disable Style/SignalException
   def files_regex_search
     page = params[:page].to_i.positive? ? params[:page] : 1
     files = user_real_files(params, @context).files_conditions
@@ -323,7 +281,6 @@ def files_regex_search
     rescue RegexpError => e
       fail "RegEx Invalid: #{e}"
     end
-    # rubocop:enable Style/SignalException
   end
 
   # Inputs:
@@ -334,6 +291,8 @@ def files_regex_search
   #   leave blank for all
   # editable (Boolean, optional): if filtering for only editable_by the context user,
   #   otherwise accessible_by
+  # search_string (string, optional): if specified, file names are matched to this string
+  #   (wildcard on both ends)
   # describe (object, optional)
   #     fields (array, optional):
   #         Array containing field name [field_1, field_2, ...]
@@ -356,17 +315,19 @@ def list_files
     User.sync_files!(@context)
     files = user_real_files(params, @context)
 
-    count = files.count if unsafe_params[:offset] == 0
-
     if unsafe_params[:limit] && unsafe_params[:offset]
       files = files.limit(unsafe_params[:limit]).offset(unsafe_params[:offset])
     end
 
-    result = files.eager_load(:license, user: :org).order(id: :desc).map do |file|
+    search_string = params[:search_string].presence || ""
+
+    result = files.eager_load(:license, user: :org).
+      where("nodes.name LIKE ?", "%#{search_string}%").
+      order(id: :desc).map do |file|
       describe_for_api(file, unsafe_params[:describe])
-    end
+    end.compact
 
-    render json: unsafe_params[:offset] == 0 ? { objects: result, count: count } : result
+    render json: unsafe_params[:offset]&.zero? ? { objects: result, count: result.length } : result
   end
 
   # Inputs
@@ -773,6 +734,7 @@ def license_items
   #
   # name (string, required, nonempty)
   # description (string, optional)
+  # scope (string, optional) 'public' | 'private' | <SPACE_ID>
   #
   # Outputs:
   #
@@ -802,9 +764,8 @@ def create_file
   # Creates a challenge logo - to be visible as a challenge card image
   # @return [Hash] - a uid of a file uploaded as a card image
   #
-  # rubocop:disable Style/SignalException
   def create_challenge_card_image
-    return unless @context.can_administer_site? || @context.challenge_admin?
+    return unless current_user.site_or_challenge_admin?
 
     name = unsafe_params[:name]
     fail "File name needs to be a non-empty String" unless name.is_a?(String) && name != ""
@@ -829,7 +790,6 @@ def create_challenge_card_image
       scope: "public",
     )
 
-    # rubocop:enable Style/SignalException
     render json: { id: file.uid }
   end
 
@@ -843,7 +803,7 @@ def create_challenge_card_image
   # id (string, "file-xxxx")
   #
   def create_challenge_resource
-    return unless @context.challenge_admin?
+    return unless current_user.site_or_challenge_admin?
 
     challenge = Challenge.find_by!(id: unsafe_params[:challenge_id])
     unless challenge.editable_by?(@context)
@@ -914,7 +874,7 @@ def create_resource_link
 
     url = DNAnexusAPI.new(CHALLENGE_BOT_TOKEN).generate_permanent_link(file)
 
-    resource.update_attributes(url: url)
+    resource.update(url: url)
 
     render json: { id: file.uid, url: url }
   end
@@ -929,12 +889,10 @@ def get_file_link
     if file.state != "closed"
       if file.parent_type == "Asset"
         User.sync_asset!(@context, file.id)
+      elsif file.created_by_challenge_bot? && current_user.site_or_challenge_admin?
+        User.sync_challenge_file!(file.id)
       else
-        if file.created_by_challenge_bot? && (@context.can_administer_site? || @context.challenge_admin?)
-          User.sync_challenge_file!(file.id)
-        else
-          User.sync_file!(@context, file.id)
-        end
+        User.sync_file!(@context, file.id)
       end
       file.reload
     end
@@ -952,7 +910,7 @@ def get_file_link
       # So we may have to store a reference to the file and generate
       # a shorter duration url each time it is rendered
 
-      token = if file.created_by_challenge_bot? && (@context.can_administer_site? || @context.challenge_admin?)
+      token = if file.created_by_challenge_bot? && current_user.site_or_challenge_admin?
         CHALLENGE_BOT_TOKEN
       else
         @context.token
@@ -1019,11 +977,10 @@ def close_file
     file = UserFile.where(parent_type: "User").find_by_uid!(id)
     token = @context.token
     if file.user_id != @context.user_id
-      if file.created_by_challenge_bot? && (@context.user.can_administer_site? || @context.user.is_challenge_admin?)
-        token = CHALLENGE_BOT_TOKEN
-      else
-        fail "The current user does not have access to the file."
-      end
+      have_access = file.created_by_challenge_bot? && current_user.site_or_challenge_admin?
+      raise "The current user does not have access to the file." unless have_access
+
+      token = CHALLENGE_BOT_TOKEN
     end
 
     if file.state == "open"
@@ -1149,7 +1106,7 @@ def search_assets
   #
   # note_uids (Array[String], required): array of note, discussion, answer uids
   # item (Array[Object], required): array of items with id, type
-  #     item.type (String): type of string from App, Comparison, Job, or UserFile
+  #     item.type (String): type of string from App, Comparison, Job, UserFile or Asset
   #
   # Outputs:
   #
@@ -1157,14 +1114,23 @@ def search_assets
   # items_added (Array[Integer])
   #
   def attach_to_notes
+    items = unsafe_params[:items]
     note_uids = unsafe_params[:note_uids]
-    unless note_uids.is_a?(Array) && note_uids.all? { |uid| uid =~ /^(note|discussion|answer)-(\d+)$/ }
+
+    unless note_uids.all? { |uid| uid =~ /^(note|discussion|answer)-(\d+)$/ }
       fail "Parameter 'note_uids' need to be an Array of Note, Answer, or Discussion uids"
     end
 
-    items = unsafe_params[:items]
-    unless items.is_a?(Array) && items.all? { |item| item[:id].is_a?(Numeric) && item[:type].is_a?(String) && %w(App Comparison Job UserFile).include?(item[:type]) }
-      fail "Items need to be an array of objects with id and type (one of App, Comparison, Job, or UserFile)"
+    valid_items =
+      items.all? do |item|
+        item[:id].is_a?(Numeric) &&
+          item[:type].is_a?(String) &&
+          %w(App Asset Comparison Job UserFile).include?(item[:type])
+      end
+
+    unless valid_items
+      fail "Items need to be an array of objects with id and type " \
+           "(one of App, Comparison, Job, UserFile or Asset)"
     end
 
     notes_added = {}
@@ -1174,7 +1140,7 @@ def attach_to_notes
       note_uids.each do |note_uid|
         note_item = item_from_uid(note_uid)
 
-        next unless !note_item.nil? && note_item.editable_by?(@context)
+        next unless note_item&.editable_by?(@context)
 
         items.each do |item|
           item[:type] = if item[:type].blank?
@@ -1246,7 +1212,6 @@ def assign_app
   # Outputs:
   # id: the submission id
   #
-  # rubocop:disable Style/SignalException
   def update_submission
     id = unsafe_params[:id].to_i
     fail "id needs to be an Integer" unless id.is_a?(Integer)
@@ -1269,7 +1234,6 @@ def update_submission
       id: submission.id,
     }
   end
-  # rubocop:enable Style/SignalException
 
   # Inputs
   #
@@ -1465,15 +1429,7 @@ def update_time_zone
   def invert_feature
     raise ApiError, "Only Site Admin can perform this action" unless @context.can_administer_site?
 
-    featured = !params[:featured].nil?
-    items = pick_values(params[:item_ids]).map do |uid|
-      item = item_from_uid(uid)
-      next unless item.scope == Scopes::SCOPE_PUBLIC && item.featured ^ featured
-
-      item.update(featured: featured)
-      item.current_user = @context.user
-      item
-    end.compact
+    items = update_feature_flag
 
     messages =
       if items.count.positive?
@@ -1491,11 +1447,27 @@ def invert_feature
     render json: items, root: "items", adapter: :json, meta: messages
   end
 
+  # Iterate over params[:item_ids], try to find items by uid and feature/un-feature PUBLIC
+  # @param item_ids [Array] array of [String] uid-s.
+  # @param featured [Boolean] new 'feature' value, false if empty.
+  # @return items [Array] list of items with inverted 'feature' flag
+  def update_feature_flag
+    featured = !params[:featured].nil?
+    Array(params[:item_ids]).map do |uid|
+      item = item_from_uid(uid)
+      next unless item.scope == Scopes::SCOPE_PUBLIC && item.featured ^ featured
+
+      item.update(featured: featured)
+      item.current_user = @context.user
+      item
+    end.compact
+  end
+
   # Soft-deletion for Items.
   # @param item_ids [Array] array of [String] uid-s.
   # @return items [Array] list of deleted items (active: false)
   def soft_delete
-    items = pick_values(params[:item_ids]).map do |uid|
+    items = Array(params[:item_ids]).map do |uid|
       item = item_from_uid(uid)
       if item.editable_by?(@context)
         item.update(deleted: true)
@@ -1571,21 +1543,10 @@ def validate_create_asset
       fail "Asset path should be a non-empty String of size less than 4096"
     end
   end
-  # rubocop:enable Style/SignalException
 
   # Validates and initializes parameters for a file creation.
-  # rubocop:disable Metrics/MethodLength
+  # rubocop:todo Metrics/MethodLength
   def validate_create_file
-    file_name = params[:name].presence
-    if file_name.blank? || !file_name.is_a?(String)
-      raise_api_error "File name needs to be a non-empty String"
-    end
-
-    description = params[:description].presence
-    if description && !description.is_a?(String)
-      raise_api_error "File description needs to be a String"
-    end
-
     folder_id = params[:folder_id].presence
     @folder =
       begin
@@ -1598,6 +1559,18 @@ def validate_create_file
       raise_api_error "You don't have permissions to add files to the folder."
     end
 
+    raise_api_error "You're not allowed to create a file in an HTTPS folder." if @folder&.https?
+
+    file_name = params[:name].presence
+    if file_name.blank? || !file_name.is_a?(String)
+      raise_api_error "File name needs to be a non-empty String"
+    end
+
+    description = params[:description].presence
+    if description && !description.is_a?(String)
+      raise_api_error "File description needs to be a String"
+    end
+
     @scope = if ActiveModel::Type::Boolean.new.cast(params[:public_scope])
       Scopes::SCOPE_PUBLIC
     else
@@ -1617,18 +1590,10 @@ def validate_create_file
 
     raise_api_error "The folder doesn't belong to a scope #{@scope}."
   end
+  # rubocop:enable Metrics/MethodLength
 
-  private
-
-  # Convert input value to array.
-  # @param order
-  # @return [Array] with order inside.
-  def pick_values(order)
-    case order
-    when Array then order
-    when String then [order]
-    else []
-    end
+  def https_apps_client
+    DIContainer.resolve("https_apps_client")
   end
-  # rubocop:enable all
+  # rubocop:enable Style/SignalException
 end
diff --git a/app/controllers/application_controller.rb b/app/controllers/application_controller.rb
index b1b03d2e6..f9abd9553 100644
--- a/app/controllers/application_controller.rb
+++ b/app/controllers/application_controller.rb
@@ -4,8 +4,9 @@ class ApplicationController < ActionController::Base
   include UidFindable
 
   # Prevent CSRF attacks by raising an exception.
+  # N.B.: GET and HEAD requests are not checked
   # For APIs, you may want to use :null_session instead.
-  protect_from_forgery with: :exception
+  protect_from_forgery with: :exception, unless: -> { Rails.env.development? || Rails.env.dev? }
 
   # if we have some invalid forms redirect to root page.
   rescue_from ActionController::InvalidAuthenticityToken, with: :invalid_token
@@ -102,19 +103,26 @@ def save_session(user_id, username, token, expiration, org_id)
 
   # Redirects user to login page if user is not logged in.
   def require_login
-    redirect_to login_url unless @context.logged_in?
+    redirect_to return_to_login_url unless @context.logged_in?
   end
 
   # Redirect user to login page if user is not either guest or logged in.
   def require_login_or_guest
-    redirect_to login_url unless @context.logged_in_or_guest?
+    redirect_to return_to_login_url unless @context.logged_in_or_guest?
+  end
+
+  def return_to_login_url
+    URI.join(
+      login_url,
+      "?#{URI.encode_www_form(user_return_to: request.original_fullpath)}",
+    ).to_s
   end
 
   # Tries to authorize user if the user is not authorized or guest one yet.
   # Renders Unauthorized if it was unable to authorize user.
   def require_api_login_or_guest
     if @context.logged_in_or_guest?
-      return if verified_request?
+      return if verified_request? || Rails.env.development? || Rails.env.dev?
     else
       process_authorization_header
       return if @context.logged_in?
@@ -127,7 +135,7 @@ def require_api_login_or_guest
   # Renders Unauthorized if it was unable to authorize user.
   def require_api_login
     if @context.logged_in?
-      return if verified_request?
+      return if verified_request? || Rails.env.development? || Rails.env.dev?
     else
       process_authorization_header
       return if @context.logged_in?
@@ -152,6 +160,8 @@ def process_authorization_header
         decrypted = JSON.parse(rails_encryptor.decrypt_and_verify(key))
         if decrypted.is_a?(Hash) && decrypted["context"].is_a?(Hash)
           fields = %w(user_id username token expiration org_id).map { |f| decrypted["context"][f] }
+          # Flag indicating, that user is calling from CLI
+          fields.push(true)
           init_context(*fields)
         end
       rescue
@@ -165,8 +175,8 @@ def process_authorization_header
   # @param token [String] User's token.
   # @param expiration [Integer] Token's expiration.
   # @param org_id [Integer] User org's ID.
-  def init_context(user_id, username, token, expiration, org_id)
-    @context = Context.new(user_id, username, token, expiration, org_id)
+  def init_context(user_id, username, token, expiration, org_id, cli_client = false)
+    @context = Context.new(user_id, username, token, expiration, org_id, cli_client)
     DIContainer.configure(@context.user, token) unless @context.guest?
   end
 
@@ -198,7 +208,7 @@ def describe_for_api(object, opts = {})
       owned: object.owned_by?(@context),
       editable: object.editable_by?(@context),
       accessible: accessible,
-      file_path: object.is_a?(UserFile) ? object.file_full_path(scope) : nil,
+      file_path: object.is_a?(UserFile) ? object.full_path(scope) : nil,
       parent_folder_name: object.is_a?(UserFile) ? object.parent_folder_name(scope) : nil,
       public: object.public?,
       private: object.private?,
@@ -257,7 +267,7 @@ def describe_for_api(object, opts = {})
 
   # Concat item path with '/home' to create a link to Home - for specific items
   def concat_path(item)
-    if %w(file folder app app-series job asset workflow workflow-series).include? item.klass
+    if %w(app app-series job workflow workflow-series).include?(item.klass)
       "/home".concat(pathify(item))
     else
       pathify(item)
diff --git a/app/controllers/apps_controller.rb b/app/controllers/apps_controller.rb
index 451a1b0ea..7ba6a4127 100644
--- a/app/controllers/apps_controller.rb
+++ b/app/controllers/apps_controller.rb
@@ -1,10 +1,12 @@
 # Responsible for apps-related actions.
 class AppsController < ApplicationController
   include ErrorProcessable
+  include CloudResourcesConcern
 
   skip_before_action :require_login, only: %i(index featured explore show fork new)
   before_action :require_login_or_guest, only: %i(index featured explore show fork new)
   before_action :validate_app_before_export, only: %i(export cwl_export wdl_export)
+  before_action :check_total_and_job_charges_limit, only: %i(batch_app run)
 
   def index
     if @context.guest?
@@ -51,7 +53,7 @@ def index
       where(jobs: { user_id: @context.user_id }).
       map { |series| series.latest_accessible(@context) }.compact
 
-    User.sync_jobs!(@context)
+    Job.sync_jobs!(@context)
 
     jobs = if @app.present?
       @app.app_series.jobs.origin.editable_by(@context).order(created_at: :desc)
@@ -136,7 +138,7 @@ def show
         page(unsafe_params[:comments_page])
     end
 
-    User.sync_jobs!(@context)
+    Job.sync_jobs!(@context)
 
     jobs = @app.app_series.jobs.editable_by(@context).includes(:taggings).order(created_at: :desc)
     @jobs_grid = jobs_grid(jobs)
@@ -153,17 +155,27 @@ def update
   end
 
   def edit
+    if user_has_no_compute_resources_allowed
+      flash[:error] = I18n.t("api.errors.no_allowed_instance_types")
+      redirect_to apps_path
+      return
+    end
+
     @app = App.find_by(uid: unsafe_params[:id])
     @app = nil unless @app.editable_by?(@context)
 
     if @app.nil?
       flash[:error] = I18n.t("app_not_accessible")
-      redirect_to apps_path && return
+      redirect_to(apps_path) && return
     elsif @app.id != @app.app_series.latest_revision_app_id
       redirect_to edit_app_path(@app.app_series.latest_revision_app) && return
     else
-      attrs = %i(dxid name scope title version revision readme spec internal release)
-      js(app: @app.slice(*attrs), ubuntu_releases: UBUNTU_RELEASES)
+      attrs = %i(dxid name scope title version revision readme spec internal release entity_type)
+      js(
+        app: @app.slice(*attrs),
+        instance_types: user_compute_resource_labels,
+        ubuntu_releases: UBUNTU_RELEASES,
+      )
     end
   end
 
@@ -173,11 +185,27 @@ def new
       return
     end
 
-    js(ubuntu_releases: UBUNTU_RELEASES, app: { release: UBUNTU_16 })
+    if user_has_no_compute_resources_allowed
+      flash[:error] = I18n.t("api.errors.no_allowed_instance_types")
+      redirect_to apps_path
+      return
+    end
+
+    js(
+      ubuntu_releases: UBUNTU_RELEASES,
+      app: { release: UBUNTU_16 },
+      instance_types: user_compute_resource_labels,
+    )
   end
 
   # rubocop:disable Metrics/MethodLength
   def batch_app
+    if user_has_no_compute_resources_allowed
+      flash[:error] = I18n.t("api.errors.no_allowed_instance_types")
+      redirect_to apps_path
+      return
+    end
+
     @app = App.accessible_by(@context).find_by(uid: unsafe_params[:id])
 
     if @app.nil?
@@ -221,22 +249,34 @@ def batch_app
       licenses_accepted: licenses_accepted,
       selectable_spaces: selectable_spaces,
       content_scopes: content_scopes,
+      instance_types: user_compute_resource_labels,
     )
   end
   # rubocop:enable Metrics/MethodLength
 
   def fork
+    if user_has_no_compute_resources_allowed
+      flash[:error] = I18n.t("api.errors.no_allowed_instance_types")
+      redirect_to apps_path
+      return
+    end
+
     @app = App.accessible_by(@context).find_by(uid: unsafe_params[:id])
 
     if @app.nil?
       flash[:error] = I18n.t("app_fork_forbidden")
       redirect_to apps_path && return
-    else
-      attrs = %i(dxid name title version revision readme spec internal release)
-      js(app: @app.slice(*attrs), ubuntu_releases: UBUNTU_RELEASES)
     end
+
+    attrs = %i(dxid name title version revision readme spec internal release entity_type)
+    js(
+      app: @app.slice(*attrs),
+      ubuntu_releases: UBUNTU_RELEASES,
+      instance_types: user_compute_resource_labels,
+    )
   end
 
+  # TODO: do refactoring of this method later!
   # Inputs
   #
   # id (string, required): the dxid of the app to run
@@ -251,6 +291,7 @@ def fork
   def run
     # rubocop:disable Style/SignalException
     # Parameter 'id' should be of type String
+
     id = unsafe_params[:id]
     fail "App ID is not a string" unless id.is_a?(String) && id != ""
 
@@ -262,6 +303,13 @@ def run
     inputs = unsafe_params["inputs"]
     fail "Inputs should be a hash" unless inputs.is_a?(Hash)
 
+    job_limit = params[:job_limit].to_f.zero? ? current_user.job_limit : params[:job_limit].to_f
+    fail "Job limit exceeds maximum user setting - #{current_user.job_limit}" if job_limit > current_user.job_limit
+
+    run_instance_type = unsafe_params[:instance_type]
+
+    fail I18n.t("app_instance_type_forbidden") unless current_user.resources.include?(run_instance_type)
+
     # App should exist and be accessible and runnable by a user.
     @app = App.find_by!(uid: id)
 
@@ -272,6 +320,32 @@ def run
       fail "Asset licenses must be accepted"
     end
 
+    # Call JupiterLab service if https app is running
+    if @app.https?
+      https_apps_client = DIContainer.resolve("https_apps_client")
+      input_info = input_spec_preparer.run(@app, inputs)
+
+      fail input_spec_preparer.first_error unless input_spec_preparer.valid?
+
+      result =
+        begin
+          https_apps_client.app_run(
+            @app.dxid,
+            name: name,
+            instanceType: run_instance_type,
+            jobLimit: job_limit,
+            scope: Scopes::SCOPE_PRIVATE,
+            input: input_info.run_inputs,
+          )
+        rescue HttpsAppsClient::Error => e
+          fail e.message
+        end
+
+      job = Job.find_by!(dxid: result["dxid"])
+
+      render(json: { id: job.uid }) && return
+    end
+
     space_id = unsafe_params[:space_id]
 
     fail "Invalid space_id" if space_id && !@app.can_run_in_space?(@context.user, space_id)
@@ -283,13 +357,6 @@ def run
 
     fail input_spec_preparer.first_error unless input_spec_preparer.valid?
 
-    run_instance_type = unsafe_params[:instance_type]
-
-    # User can override the instance type
-    if run_instance_type
-      fail "Invalid instance type selected" unless Job::INSTANCE_TYPES.key?(run_instance_type)
-    end
-
     if space
       project = space.project_for_user(@context.user)
       permission = space.have_permission?(project, @context.user)
@@ -303,6 +370,7 @@ def run
       name: name,
       input_info: input_info,
       run_instance_type: run_instance_type,
+      job_limit: job_limit,
       scope: space&.uid,
     )
 
diff --git a/app/controllers/assets_controller.rb b/app/controllers/assets_controller.rb
index 9507f5cd5..bd5bc8604 100644
--- a/app/controllers/assets_controller.rb
+++ b/app/controllers/assets_controller.rb
@@ -1,147 +1,4 @@
 class AssetsController < ApplicationController
-  skip_before_action :require_login,     only: [:index, :featured, :explore, :show, :new]
-  before_action :require_login_or_guest, only: [:index, :featured, :explore, :show, :new]
-  def index
-    if @context.guest?
-      redirect_to explore_assets_path
-      return
-    end
-
-    # Refresh state of assets, if needed
-    User.sync_assets!(@context)
-
-    # Wice seems to not like the default_scope of Asset
-    assets = Asset.unscoped.editable_by(@context)
-    @assets_grid = assets_grid_for(assets)
-  end
-
-  def featured
-    org = Org.featured
-    if org
-      assets = Asset.unscoped.accessible_by(@context).joins(:user).where(:users => { :org_id => org.id })
-      @assets_grid = assets_grid_for(assets)
-    end
-    render :index
-  end
-
-  def explore
-    assets = Asset.unscoped.accessible_by_public
-    @assets_grid = assets_grid_for(assets)
-    render :index
-  end
-
-  def new
-  end
-
-  def show
-    @asset = Asset.accessible_by(@context).includes(:archive_entries).find_by_uid!(unsafe_params[:id])
-
-    # Refresh state of asset, if needed
-    if @asset.state != "closed"
-      User.sync_asset!(@context, @asset.id)
-      @asset.reload
-    end
-
-    @items_from_params = [@asset]
-    @item_path = pathify(@asset)
-    @item_comments_path = pathify_comments(@asset)
-    if @asset.in_space?
-      space = item_from_uid(@asset.scope)
-      @comments = Comment.where(commentable: space, content_object: @asset).order(id: :desc).page unsafe_params[:comments_page]
-    else
-      @comments = @asset.root_comments.order(id: :desc).page unsafe_params[:comments_page]
-    end
-
-    @notes = @asset.notes.real_notes.accessible_by(@context).order(id: :desc).page unsafe_params[:notes_page]
-    @answers = @asset.notes.accessible_by(@context).answers.order(id: :desc).page unsafe_params[:answers_page]
-    @discussions = @asset.notes.accessible_by(@context).discussions.order(id: :desc).page unsafe_params[:discussions_page]
-
-    if @asset.editable_by?(@context)
-      @licenses = License.editable_by(@context)
-    end
-
-    js asset: @asset.slice(:id, :description), license: @asset.license ? @asset.license.slice(:uid, :content) : nil
-  end
-
-  def edit
-    @asset = Asset.includes(:archive_entries).find_by_uid!(unsafe_params[:id])
-    redirect_to asset_path(@asset) unless @asset.editable_by?(@context)
-
-    js asset: @asset.slice(:id, :description)
-  end
-
-  def rename
-    @asset = Asset.find_by_uid!(unsafe_params[:id])
-    redirect_to asset_path(@asset) unless @asset.editable_by?(@context)
-
-    title = asset_params[:title]
-    if title.is_a?(String) && title != ""
-      name = title + @asset.suffix
-      description = asset_params[:description] || @asset.description
-      if @asset.rename(name, description, @context)
-        @asset.reload
-        flash[:success] = "Asset renamed to \"#{@asset.name}\""
-      else
-        flash[:error] = "Asset \"#{@asset.name}\" could not be renamed."
-      end
-    else
-      flash[:error] = "The new name is not a valid string"
-    end
-
-    redirect_to asset_path(@asset)
-  end
-
-  def update
-    @asset = Asset.includes(:archive_entries).find_by_uid!(unsafe_params[:id])
-    redirect_to asset_path(@asset) unless @asset.editable_by?(@context)
-
-    Asset.transaction do
-      @asset.reload
-      if @asset.update(asset_params)
-        # Handle a successful update.
-        flash[:success] = "Asset updated"
-        redirect_to asset_path(@asset)
-      else
-        flash[:error] = "Error: Could not update the asset. Please try again."
-        render 'edit'
-      end
-    end
-  end
-
-  def destroy
-    @file = Asset.find_by_uid!(unsafe_params[:id])
-    redirect_to asset_path(@file) unless @file.editable_by?(@context)
-
-    UserFile.transaction do
-      @file.reload
-
-      if @file.license.present? && !@file.apps.empty?
-        flash[:error] = "This asset contains a license, and has been included in one or more apps. Deleting it would render the license inaccessible to these apps, breaking reproducibility. You can either first remove the license (allowing these existing apps to run without requiring a license) or contact the precisionFDA team to discuss other options."
-        redirect_to asset_path(@file)
-        return
-      end
-      @file.destroy
-    end
-
-    DNAnexusAPI.new(@context.token).call(@file.project, "removeObjects", objects: [@file.dxid])
-
-    flash[:success] = "Asset \"#{@file.prefix}\" has been successfully deleted"
-    redirect_to assets_path
-  end
-
-  private
-
-  def asset_params
-    params.require(:asset).permit(:description, :title)
-  end
-
-  def assets_grid_for(assets)
-    initialize_grid(assets.includes(:taggings),{
-      name: "assets",
-      order: "name",
-      order_direction: "asc",
-      per_page: 100,
-      include: [:user, { user: :org }, { taggings: :tag }]
-    })
-  end
+  skip_before_action :require_login
+  before_action :require_login_or_guest
 end
diff --git a/app/controllers/challenges_controller.rb b/app/controllers/challenges_controller.rb
index 127d17bb5..909cb682b 100644
--- a/app/controllers/challenges_controller.rb
+++ b/app/controllers/challenges_controller.rb
@@ -1,22 +1,20 @@
 # Challenges controller.
 # rubocop:todo Metrics/ClassLength
 class ChallengesController < ApplicationController
-  skip_before_action :require_login, only: %i(index consistency truth appathons join show)
+  skip_before_action :require_login,
+                     only: %i(index consistency truth appathons join show treasure_old)
   before_action :require_login_or_guest, only: []
   before_action :check_on_challenge_admin, only: %i(new create)
   before_action :find_editable_challenge, only: %i(edit update edit_page announce_result)
   before_action :check_scope_accessibility, only: %i(create update)
+  layout "react", only: %i(index show)
 
-  def index
-    @consistency_challenge = FixedChallenge.consistency(@context)
-    @truth_challenge = FixedChallenge.truth(@context)
-    @appathons_challenge = FixedChallenge.appathons(@context)
-    @featured_challenges = Challenge.featured(@context)
-    @challenges = [@appathons_challenge, @truth_challenge, @consistency_challenge] + challenge_cards
-  end
+  def index; end
 
   def new
     @challenge = Challenge.new
+    time_zone = ActiveSupport::TimeZone.find_tzinfo(@context.user.time_zone).to_s
+    js time_zone: time_zone
   end
 
   def create
@@ -39,7 +37,8 @@ def create
   end
 
   def edit
-    js card_image_url: @challenge.card_image_url, card_image_id: @challenge.card_image_id
+    time_zone = ActiveSupport::TimeZone.find_tzinfo(@context.user.time_zone).to_s
+    js card_image_url: @challenge.card_image_url, card_image_id: @challenge.card_image_id, time_zone: time_zone
   end
 
   def update
@@ -59,7 +58,8 @@ def update
         flash[:success] = "The challenge was updated successfully."
         redirect_to challenge_path(@challenge)
       else
-        js update_challenge_params.to_h
+        time_zone = ActiveSupport::TimeZone.find_tzinfo(@context.user.time_zone).to_s
+        js update_challenge_params.to_h, time_zone: time_zone
         render action: :edit
       end
     end
@@ -74,7 +74,7 @@ def show
       return
     end
 
-    User.sync_challenge_jobs!
+    Job.sync_challenge_jobs!
     @tab = unsafe_params[:tab]
     @submissions = Submission.none
     @my_entries = false
@@ -137,11 +137,86 @@ def show
 
     js submissions: @submissions.map { |s| s.slice(:id, :name, :desc) }
   end
-  # rubocop:enable Metrics/MethodLength
+
+  # rubocop:todo Metrics/MethodLength
+  def treasure_old
+    @challenge = Challenge.find_by(name: "Hidden Treasures - Warm Up")
+
+    if @challenge.nil?
+      redirect_to challenges_path, alert: "Challenge was not found"
+      return
+    end
+
+    unless @challenge.accessible_by?(@context)
+      redirect_to challenges_path, alert: "You don't have permissions to view this challenge"
+      return
+    end
+
+    Job.sync_challenge_jobs!
+    @tab = unsafe_params[:tab]
+    @submissions = Submission.none
+    @my_entries = false
+    @csv = nil
+    @csv_names = nil
+    @csv_ids = nil
+    @headers = nil
+    @keys = nil
+
+    case @tab
+    when "submissions"
+      @submissions = @challenge.submissions.accessible_by_public
+    when "results"
+      unless @challenge.can_show_results?(@context)
+        redirect_to challenges_path
+        return
+      end
+
+      @submissions = @challenge.submissions.accessible_by_public
+      if @challenge.automated?
+        @results = @challenge.completed_submissions
+        @result_columns = @challenge.output_names
+      else
+        @csv = CSV.open(
+          Rails.root.join("app/assets/csvs/treasure_hunt_warm_up_results.csv"),
+          encoding: "bom|utf-8",
+        ).read
+
+        @vaf_spotter_ids = [8, 9, 12, 20, 21, 22, 23, 25, 32, 34, 35, 36, 37, 38, 41,
+                            49, 51, 79, 81, 89, 90, 96, 97, 98, 104, 110, 116, 120,
+                            122, 124, 143, 147, 149, 150, 155, 156, 157]
+        @headers = @csv.shift(7)
+        @keys = @headers.map(&:first)
+        @csv_ids, @csv_names = @csv.map { |row| row.shift.split(" ", 2) }.
+          map { |id, name| [id.to_i, name.to_s] }.transpose
+        # @vaf_submissions is no longer an ActiveRecord relation,
+        #   careful if you want to use wice_grid.
+        @vaf_results = @submissions.select { |s| @csv_ids.include?(s.id) }.
+          sort_by { |s| @csv_ids.index s.id }
+      end
+    when "my_entries"
+      @submissions = @challenge.submissions.editable_by(@context)
+      @my_entries = true
+    else
+      return
+    end
+
+    @submissions_grid = initialize_grid(@submissions,
+                                        name: "submissions",
+                                        order: "submissions.id",
+                                        order_direction: "desc",
+                                        per_page: 100)
+
+    @resources_grid = initialize_grid(@challenge.challenge_resources,
+                                      name: "resources",
+                                      order: "challenge_resources.updated_at",
+                                      order_direction: "desc",
+                                      per_page: 100)
+
+    js submissions: @submissions.map { |s| s.slice(:id, :name, :desc) }
+  end
 
   def announce_result
     @challenge.jobs.find_each do |job|
-      job.update!(scope: Scopes::SCOPE_PUBLIC) if job.publishable_by_user?(User.challenge_bot)
       file_publisher.publish(job.output_files)
     end
 
@@ -349,6 +424,7 @@ def challenge_params
         :replacement_id,
         :host_lead_dxuser,
         :guest_lead_dxuser,
+        :pre_registration_url,
       )
   end
 
@@ -365,6 +441,7 @@ def update_challenge_params
         :card_image_id,
         :card_image_url,
         :replacement_id,
+        :pre_registration_url,
       )
   end
 
@@ -378,7 +455,7 @@ def filter_and_order_state_as_hash(grid)
     }
   end
 
-  def challenge_cards
+  def archived_challenges
     Challenge.accessible_by(@context).archived.map do |challenge|
       ChallengeCard.by_context(challenge, @context)
     end
diff --git a/app/controllers/comments_controller.rb b/app/controllers/comments_controller.rb
index c366cbf85..c2341de63 100644
--- a/app/controllers/comments_controller.rb
+++ b/app/controllers/comments_controller.rb
@@ -8,7 +8,17 @@ def index
     if @item.accessible_by?(@context)
       @item_path = pathify(@item)
       @item_comments_path = pathify_comments(@item)
-      @comments = @item.root_comments.page(unsafe_params[:comments_page])
+      if @item.in_space?
+        space = item_from_uid(@item.scope)
+        @comments = Comment.
+          where(commentable: space, content_object: @item).
+          order(id: :desc).
+          page(unsafe_params[:comments_page])
+      else
+        @comments = @item.
+          root_comments.order(id: :desc).
+          page unsafe_params[:comments_page]
+      end
     else
       flash[:error] = "You do not have permissions to comment on this item"
       redirect_to root_url
@@ -35,12 +45,6 @@ def edit
     if @item.accessible_by?(@context) && @comment.active?
       @item_path = pathify(@item)
       @item_comments_path = pathify_comments(@item)
-      if @item.klass == "space"
-        user_ids = @item.space_memberships.active.map(&:user_id)
-        users = User.find(user_ids).map {|u| {name: u.dxuser} }
-      else
-        users = nil
-      end
     elsif @item.accessible_by?(@context) && @comment.deleted?
       redirect_to root_url
     else
@@ -48,14 +52,14 @@ def edit
       redirect_to root_url
     end
 
-    js klass: @item.klass, users: users
+    js klass: @item.klass
   end
 
   def create
     items_from_params = get_item_array_from_params
     item = items_from_params.last
     if item.present? && item.accessible_by?(@context)
-      if space_content_item?(item)
+      if comment_inside_space?(item)
         space = item_from_uid(item.scope)
         comment = Comment.build_from(space, @context.user_id, comment_params[:body])
         comment.content_object = item
@@ -80,25 +84,26 @@ def update
     items_from_params = get_item_array_from_params
     item = items_from_params.last
     comment = Comment.find_by(id: unsafe_params[:id], user_id: @context.user_id)
-    if !comment.nil?
-      if comment.update_attributes(comment_params)
-        log_space_event(comment, item, "comment_edited") if comment_inside_space?(item)
-        redirect_to pathify_comments_redirect(item)
-        return
-      else
-        render 'edit'
-      end
+
+    return unless comment
+
+    if comment.update(comment_params)
+      log_space_event(comment, item, "comment_edited") if comment_inside_space?(item)
+      redirect_to pathify_comments_redirect(item)
+      return
     end
+
+    render "edit"
   end
 
   def destroy
     items_from_params = get_item_array_from_params
     item =  items_from_params.last
     comment = Comment.find_by(id: unsafe_params[:id], user_id: @context.user_id)
-    if !comment.nil? && comment_inside_space?(item)
+    if comment && comment_inside_space?(item)
       comment.deleted!
-      log_space_event(comment, item, "comment_deleted") if comment_inside_space?(item)
-    elsif !comment.nil?
+      log_space_event(comment, item, "comment_deleted")
+    elsif comment
       comment.destroy
     else
       flash[:error] = "This comment could not be deleted"
@@ -129,12 +134,8 @@ def attach_content(comment)
     comment
   end
 
-  def space_content_item?(item)
-    (item.klass != "space") && item.respond_to?(:scope) && item.in_space?
-  end
-
   def comment_inside_space?(item)
-    ["space", "task"].include?(item.klass) || item.respond_to?(:scope) && item.in_space?
+    item.respond_to?(:scope) && item.in_space?
   end
 
   def move_to_child(comment)
@@ -148,14 +149,7 @@ def move_to_child(comment)
   end
 
   def log_space_event(comment, item, event)
-    space =
-      if item.klass == "space"
-        item
-      elsif item.klass == "task"
-        item.space
-      else
-        item_from_uid(item.scope)
-      end
+    space = item_from_uid(item.scope)
     SpaceEventService.call(space.id, @context.user_id, nil, comment, event.to_sym)
   end
 
@@ -175,7 +169,7 @@ def get_item_array_from_params
 
       user = User.find_by!(dxuser: unsafe_params[:answer_id])
       answer = Answer.find_by!(discussion_id: unsafe_params[:discussion_id], user_id: user.id)
-      return [discussion, answer]
+      [discussion, answer]
     elsif unsafe_params[:meta_appathon_id].present?
       meta_appathon = MetaAppathon.find(unsafe_params[:meta_appathon_id])
 
@@ -186,26 +180,21 @@ def get_item_array_from_params
         id: unsafe_params[:appathon_id],
       )
 
-      return [meta_appathon, appathon]
+      [meta_appathon, appathon]
     elsif unsafe_params[:appathon_id].present?
-      return [Appathon.find(unsafe_params[:appathon_id])]
+      [Appathon.find(unsafe_params[:appathon_id])]
     elsif unsafe_params[:note_id].present?
-      return [Note.find(unsafe_params[:note_id])]
-    elsif unsafe_params[:task_id].present?
-      task = Task.find(unsafe_params[:task_id])
-      return [task.space, task]
-    elsif unsafe_params[:space_id].present?
-      return [Space.find(unsafe_params[:space_id])]
+      [Note.find(unsafe_params[:note_id])]
     elsif unsafe_params[:comparison_id].present?
-      return [Comparison.find(unsafe_params[:comparison_id])]
+      [Comparison.find(unsafe_params[:comparison_id])]
     elsif unsafe_params[:file_id].present?
-      return [UserFile.find_by!(uid: unsafe_params[:file_id])]
+      [UserFile.find_by!(uid: unsafe_params[:file_id])]
     elsif unsafe_params[:asset_id].present?
-      return [Asset.find_by!(uid: unsafe_params[:asset_id])]
+      [Asset.find_by!(uid: unsafe_params[:asset_id])]
     elsif unsafe_params[:job_id].present?
-      return [Job.find_by!(uid: unsafe_params[:job_id])]
+      [Job.find_by!(uid: unsafe_params[:job_id])]
     elsif unsafe_params[:app_id].present?
-      return [App.find_by!(uid: unsafe_params[:app_id])]
+      [App.find_by!(uid: unsafe_params[:app_id])]
     elsif unsafe_params[:expert_id].present?
       expert = Expert.find(unsafe_params[:expert_id])
 
@@ -213,7 +202,7 @@ def get_item_array_from_params
         return [expert, ExpertQuestion.find(unsafe_params[:expert_question_id])]
       end
 
-      return [expert]
+      [expert]
     end
   end
 end
diff --git a/app/controllers/comparisons_controller.rb b/app/controllers/comparisons_controller.rb
index af3ff2abc..1c3d8d86e 100644
--- a/app/controllers/comparisons_controller.rb
+++ b/app/controllers/comparisons_controller.rb
@@ -226,6 +226,7 @@ def show
     else
       user_files = UserFile.arel_table
       files = @comparison.outputs.where(user_files[:description].matches("%html_report"))
+      @comparator_app = comparator_app(@comparison.app_dxid)
 
       @output_files = files.map do |file|
         { name: file.name, url: file.file_url(@context, "true", false) }
@@ -479,6 +480,13 @@ def destroy
 
   private
 
+  # find a non-default comparator app by its :dxid
+  # @param app_dxid [String] - @comparison.app_dxid
+  # @return @comparator_app [App Object]
+  def comparator_app(app_dxid)
+    App.find_by(dxid: app_dxid)
+  end
+
   # Renders array of errors returning bad request status.
   # @param errors [Array<String>] Array of errors.
   def render_errors(errors)
diff --git a/app/controllers/concerns/cloud_resources_concern.rb b/app/controllers/concerns/cloud_resources_concern.rb
new file mode 100644
index 000000000..38120e4f9
--- /dev/null
+++ b/app/controllers/concerns/cloud_resources_concern.rb
@@ -0,0 +1,101 @@
+# Concern of cloud resources
+module CloudResourcesConcern
+  COMPUTE_RESOURCE_LABELS = [
+    { value: "baseline-2", label: "Baseline 2", pricing: 0.286 },
+    { value: "baseline-4", label: "Baseline 4", pricing: 0.572 },
+    { value: "baseline-8", label: "Baseline 8", pricing: 1.144 },
+    { value: "baseline-16", label: "Baseline 16", pricing: 2.288 },
+    { value: "baseline-36", label: "Baseline 36", pricing: 5.148 },
+    { value: "himem-2", label: "High Mem 2", pricing: 0.474 },
+    { value: "himem-4", label: "High Mem 4", pricing: 0.948 },
+    { value: "himem-8", label: "High Mem 8", pricing: 1.896 },
+    { value: "himem-16", label: "High Mem 16", pricing: 3.792 },
+    { value: "himem-32", label: "High Mem 32", pricing: 7.584 },
+    { value: "hidisk-2", label: "High Disk 2", pricing: 0.372 },
+    { value: "hidisk-4", label: "High Disk 4", pricing: 0.744 },
+    { value: "hidisk-8", label: "High Disk 8", pricing: 1.488 },
+    { value: "hidisk-16", label: "High Disk 16", pricing: 2.976 },
+    { value: "hidisk-36", label: "High Disk 36", pricing: 6.696 },
+    { value: "gpu-8", label: "GPU 8", pricing: 7.584 },
+  ].freeze
+
+  # TODO(samuel) define 
+  # https://confluence.internal.dnanexus.com/display/PFDA/Cloud+Resource+Governance+and+Enhanced+User+Administration#CloudResourceGovernanceandEnhancedUserAdministration-ConstrainDatabaseInstanceTypesandPresentPrice
+  DATABASE_RESOURCE_LABELS = [
+    { value: "db_std1_x2", label: "DB Baseline 1 x 2", pricing: 0.273 },
+    { value: "db_mem1_x2", label: "DB Mem 1 x 2", pricing: 0.967 },
+    { value: "db_mem1_x4", label: "DB Mem 1 x 4", pricing: 1.933 },
+    { value: "db_mem1_x8", label: "DB Mem 1 x 8", pricing: 3.867 },
+    { value: "db_mem1_x16", label: "DB Mem 1 x 16", pricing: 7.733 },
+    { value: "db_mem1_x32", label: "DB Mem 1 x 32", pricing: 15.467 },
+    { value: "db_mem1_x48", label: "DB Mem 1 x 48", pricing: 23.200 },
+    { value: "db_mem1_x64", label: "DB Mem 1 x 64", pricing: 30.933 },
+  ].freeze
+
+  def user_compute_resource_labels
+    format_resource_labels_by_whitelist(
+      COMPUTE_RESOURCE_LABELS,
+      @context.user.resources.intersection(Job::INSTANCE_TYPES.keys),
+    )
+  end
+
+  def user_database_resource_labels
+    format_resource_labels_by_whitelist(
+      DATABASE_RESOURCE_LABELS,
+      @context.user.resources.intersection(DbCluster::DX_INSTANCE_CLASSES.keys),
+    )
+  end
+
+  def format_resource_labels_by_whitelist(labels, allowed_keys)
+    user_labels = labels.select { |label| allowed_keys.include?(label[:value]) }
+    user_labels.map { |label| { value: label[:value], label: "#{label[:label]}    #{label[:pricing]}$/hour" } }
+  end
+
+  def user_has_no_compute_resources_allowed
+    @context.user.resources.intersection(Job::INSTANCE_TYPES.keys).empty?
+  end
+
+  def user_has_no_database_resources_allowed
+    @context.user.resources.intersection(DbCluster::DX_INSTANCE_CLASSES.keys).empty?
+  end
+
+  # +-----------------------------+
+  # |                             |
+  # | Charges checkers start here |
+  # |                             |
+  # +-----------------------------+
+
+  def check_total_charges_limit
+    check_charges_limit([validate_total_limit])
+  end
+
+  def check_total_and_job_charges_limit
+    check_charges_limit([validate_job_limit, validate_total_limit])
+  end
+
+  def check_charges_limit(charges_validation_results)
+    charges_errors = charges_validation_results.compact
+    return if charges_errors.empty?
+
+    respond_to do |format|
+      e_msg = charges_errors.join("\n")
+
+      format.html do
+        flash[:error] = e_msg
+        redirect_back(fallback_location: root_path)
+      end
+
+      # Normally I would pass array, but the message gets stringified along the way
+      format.json { raise_api_error e_msg }
+    end
+  end
+
+  def validate_total_limit
+    api = DIContainer.resolve("api.user")
+    I18n.t("api.errors.exceeded_charges_limit") if Users::ChargesFetcher.exceeded_charges_limit?(api, current_user)
+  end
+
+  def validate_job_limit
+    I18n.t("api.errors.job_limit_zero") unless current_user.can_run_jobs?
+  end
+end
diff --git a/app/controllers/concerns/error_processable.rb b/app/controllers/concerns/error_processable.rb
index 56ba33dc3..aeadcb12f 100644
--- a/app/controllers/concerns/error_processable.rb
+++ b/app/controllers/concerns/error_processable.rb
@@ -18,15 +18,14 @@ def fail(msg, data = {})
   alias_method :raise_api_error, :fail
 
   def add_errors(attributes)
-    first_name = attributes[:first_name]
-    last_name = attributes[:last_name]
-    email = attributes[:email]
+    username = attributes[:username] ||
+               User.construct_username(attributes[:first_name], attributes[:last_name])
 
     errors = []
-    errors += user_invalid_errors(first_name: first_name, last_name: last_name, email: email)
-    errors << user_name_pattern_error(first_name, last_name)
+    errors << username_pattern_error(username)
+    errors += user_invalid_errors(attributes.slice(:first_name, :last_name, :email))
     errors += org_errors(attributes[:org], attributes[:org_handle])
-    errors << email_exists_error(email)
+    errors << email_exists_error(attributes[:email])
     errors.reject(&:blank?)
   end
 
@@ -35,14 +34,13 @@ def user_invalid_errors(opts = {})
     new_user.invalid? ? new_user.errors.full_messages : []
   end
 
-  def user_name_pattern_error(first_name, last_name)
-    username = User.construct_username(first_name, last_name)
+  def username_pattern_error(username)
     return if User.authserver_acceptable?(username)
 
     "Internal precisionFDA policies require that usernames be formed according" \
     "to the pattern <first_name>.<last_name> using only lowercase English letters. " \
-    "\nBased on the name provided (#{first_name} #{last_name}), the constructed username" \
-    " ('#{username}') would not have been acceptable. \nPlease adjust the name accordingly."
+    "\nThe constructed username ('#{username}') would not have been acceptable. \nPlease " \
+    "adjust the name accordingly."
   end
 
   def org_errors(org, org_handle)
@@ -84,7 +82,43 @@ def email_exists_error(email)
     return if email.blank? || !DNAnexusAPI.email_exists?(email)
 
     name = User.find_by(email: email) ? "precisionFDA" : "DNAnexus"
-    "Error: This email address is already being used for a #{name} account." \
-    "Please choose a different email address for precisionFDA."
+    I18n.t("email_taken", side: name)
+  end
+
+  def add_warnings(invitation, org, org_handle, suggested_username)
+    warnings = []
+
+    if User.find_by(dxuser: suggested_username).present?
+      link = view_context.link_to(
+        I18n.t("provision.profile_link"),
+        user_path(suggested_username),
+        target: "_blank",
+        rel: "noopener",
+      )
+
+      warnings << I18n.t("provision.dxuser_already_used", link: link, username: suggested_username)
+    end
+
+    if invitation.singular && invitation.org.present?
+      warnings << I18n.t("provision.org_invitation_but_self_represented_on")
+    end
+
+    if invitation.singular && invitation.organization_admin
+      warnings << I18n.t("provision.both_org_admin_and_self_represented_on")
+    end
+
+    if invitation.singular && invitation.org.blank? && org.present?
+      warnings << I18n.t("provision.self_represented_on_but_org")
+    end
+
+    if !invitation.singular && invitation.org.present? && org.blank? && org_handle.blank?
+      warnings << I18n.t("provision.org_but_self_represented_on")
+    end
+
+    if invitation.organization_admin && org.blank?
+      warnings << I18n.t("provision.org_admin_but_self_represented_on")
+    end
+
+    warnings
   end
 end
diff --git a/app/controllers/concerns/files_concern.rb b/app/controllers/concerns/files_concern.rb
index 2ed48b366..0a46498d5 100644
--- a/app/controllers/concerns/files_concern.rb
+++ b/app/controllers/concerns/files_concern.rb
@@ -2,6 +2,7 @@
 #
 module FilesConcern
   include ActiveSupport::Concern
+  include ActionView::Helpers::NumberHelper
 
   def user_real_files(params, context)
     # rubocop:disable Style/SignalException
diff --git a/app/controllers/concerns/jobs_concern.rb b/app/controllers/concerns/jobs_concern.rb
index 9f70d451c..bbfbfbc0a 100644
--- a/app/controllers/concerns/jobs_concern.rb
+++ b/app/controllers/concerns/jobs_concern.rb
@@ -17,14 +17,14 @@ def sync_job!
     return if @job.terminal?
 
     if @job.from_submission?
-      User.sync_challenge_job!(@job.id)
+      Job.sync_challenge_job!(@job.id)
     else
-      User.sync_job!(@context, @job.id)
+      Job.sync_job!(@context, @job.id)
     end
   end
 
   # Refresh state of jobs, if needed
   def sync_jobs(jobs)
-    User.sync_jobs!(@context, jobs)
+    Job.sync_jobs!(@context, jobs)
   end
 end
diff --git a/app/controllers/concerns/naming.rb b/app/controllers/concerns/naming.rb
new file mode 100644
index 000000000..4e5b25faf
--- /dev/null
+++ b/app/controllers/concerns/naming.rb
@@ -0,0 +1,22 @@
+# Provides username-related methods.
+module Naming
+  extend ActiveSupport::Concern
+
+  included do
+    # Tries to find unused username.
+    # @param username [String] Base name.
+    # @return [String] Unused username.
+    def find_unused_username(username)
+      api = DIContainer.resolve("api.user")
+      UnusedUsernameGenerator.new(api).call(username)
+    end
+
+    # Tries to find unused org handle.
+    # @param username [String] Base name.
+    # @return [String] Unused org handle.
+    def find_unused_orgname(username)
+      service = DIContainer.resolve("orgs.unused_orgname_generator")
+      service.call(username)
+    end
+  end
+end
diff --git a/app/controllers/concerns/paginationable.rb b/app/controllers/concerns/paginationable.rb
index df11e8fc9..9785a655f 100644
--- a/app/controllers/concerns/paginationable.rb
+++ b/app/controllers/concerns/paginationable.rb
@@ -3,13 +3,14 @@ module Paginationable
   extend ActiveSupport::Concern
 
   PAGE_SIZE = 10
+  DEFAULT_PAGE = 1
 
   # Emulate pagination for simple array and return some meta.
   # @param total_count [Int] count of array.
   # @return [Hash] Object that contains current/next/prev/total pages.
   def pagination_meta(total_count)
     current_page = page_from_params.to_i
-    total_pages = (total_count / PAGE_SIZE.to_f).ceil
+    total_pages = (total_count / page_size.to_f).ceil
     {
       count: total_count,
       pagination: {
@@ -27,7 +28,7 @@ def pagination_meta(total_count)
   # @return [Hash] Object that contains current/next/prev/total pages.
   def pagination_dict(collection)
     {
-      current_page: collection.try(:current_page) || 1,
+      current_page: collection.try(:current_page) || DEFAULT_PAGE,
       next_page: collection.try(:next_page),
       prev_page: collection.try(:prev_page),
       total_pages: collection.try(:total_pages) || 0,
@@ -38,7 +39,9 @@ def pagination_dict(collection)
   # Get Page from params.
   # @return 1 if no param values provided.
   def page_from_params
-    (params["page"] || 1).to_i
+    page_num = params[:page].to_i
+
+    page_num.zero? ? DEFAULT_PAGE : page_num
   end
 
   # Manually 'paginate' array of Apps
@@ -46,9 +49,14 @@ def page_from_params
   # @return apps [App] sub-array of Apps in page range.
   def paginate_array(apps)
     current_page = page_from_params
-    from = (current_page - 1) * PAGE_SIZE
-    to = [current_page * PAGE_SIZE, apps.count].min - 1
+    from = (current_page - 1) * page_size
+    to = [current_page * page_size, apps.count].min - 1
 
     apps.values_at(from..to)
   end
+
+  def page_size
+    per_page = params[:per_page].to_i
+    per_page.zero? ? PAGE_SIZE : per_page
+  end
 end
diff --git a/app/controllers/concerns/sortable.rb b/app/controllers/concerns/sortable.rb
index 5db0a754e..276cc172e 100644
--- a/app/controllers/concerns/sortable.rb
+++ b/app/controllers/concerns/sortable.rb
@@ -18,6 +18,7 @@ module Sortable
     "title" => ->(left, right) { left.title <=> right.title },
     "username" => ->(left, right) { left.user.full_name <=> right.user.full_name },
     "revision" => ->(left, right) { left.revision <=> right.revision },
+    "location" => ->(left, right) { left.location.downcase <=> right.location.downcase },
   }.freeze
 
   def order_direction(candidate)
@@ -38,18 +39,19 @@ def order_query(candidates_by, candidate_dir, allowed_orderings)
   # @param array input arrays of objects for sort.
   # @param sort_fields list of lambdas.
   # @return sorted array.
-  def sort_array_by_fields(array)
-    sort_by = self.class::SORT_FIELDS[params[:order_by] || "created_at"]
+  def sort_array_by_fields(array, default_order = "launched_on")
+    sort_by = self.class::SORT_FIELDS[params[:order_by] || default_order]
     array = array.sort(&sort_by)
 
     params[:order_dir] != Sortable::DIRECTION_ASC ? array.reverse : array
   end
 
   # Prepare Order/OrderDirection pair from params (only allowed values).
-  # @return { order => order_dir }, { :created_at => 'DESC' } if no param values provided.
-  def order_from_params
+  # @return { order => order_dir }, { :launched_on => 'DESC' }
+  #   if no param values provided.
+  def order_from_params(default_order = "launched_on")
     order_field_values = self.class::ORDER_FIELDS.values.flatten
-    order_query(self.class::ORDER_FIELDS[params[:order_by] || "created_at"],
+    order_query(self.class::ORDER_FIELDS[params[:order_by] || default_order],
                 params[:order_dir], order_field_values)
   end
 
diff --git a/app/controllers/concerns/space_concern.rb b/app/controllers/concerns/space_concern.rb
index 5f2171f4a..215a7d971 100644
--- a/app/controllers/concerns/space_concern.rb
+++ b/app/controllers/concerns/space_concern.rb
@@ -5,7 +5,7 @@ module SpaceConcern
   def find_space
     @space = Space.find(params[:space_id])
 
-    head(:forbidden) unless @space.accessible_by?(@context)
+    head(:forbidden) unless @context.user.review_space_admin? || @space.accessible_by?(@context)
   end
 
   # Finds a space by id, accessible by current user.
@@ -16,13 +16,13 @@ def find_user_space
     @space = Space.undeleted.find(params[:space_id])
     raise ApiError, "The space is locked." if @space.visible_by?(current_user) && @space.locked?
 
-    return nil unless @space.accessible_by_user?(current_user)
+    return unless @space.accessible_by_user?(current_user)
 
     @space
   end
 
   # Checks if user is able to modify content of a space.
   def can_edit?
-    head(:forbidden) unless @space.editable_by?(current_user)
+    head(:forbidden) unless current_user.review_space_admin? || @space.editable_by?(current_user)
   end
 end
diff --git a/app/controllers/concerns/workflow_concern.rb b/app/controllers/concerns/workflow_concern.rb
index 7b744091c..50f8d8ce0 100644
--- a/app/controllers/concerns/workflow_concern.rb
+++ b/app/controllers/concerns/workflow_concern.rb
@@ -23,10 +23,10 @@ def revisions_data
   # Proceed with workflow jobs sync
   def jobs_sync
     if @workflow.in_space?
-      User.sync_jobs!(@context, @workflow.jobs, @workflow.project)
+      Job.sync_jobs!(@context, @workflow.jobs, @workflow.project)
       @space = @workflow.space_object
     else
-      User.sync_jobs!(@context)
+      Job.sync_jobs!(@context)
     end
   end
 
@@ -63,6 +63,10 @@ def run_workflow_once(workflow_params)
     inputs = workflow_params["inputs"] || []
     fail "If provided, the workflow 'inputs' must be an array of hashes." unless inputs.is_a?(Array) && inputs.all? { |s| s.is_a?(Hash) }
 
+    unless workflow.stages.all? { |stage| @context.user.resources.include?(stage[:instanceType]) }
+      raise_api_error I18n.t("workflows.errors.unsupported_instance_types", name: workflow.name)
+    end
+
     workflow_input_spec = workflow.input_spec_hash
     unseen_workflow_inputs = workflow.unused_input_spec_hash
 
@@ -137,7 +141,7 @@ def run_workflow_once(workflow_params)
 
     analysis_dxid = response["id"]
     analysis = Analysis.create!(
-      name: analysis_name, workflow_id: workflow.id, dxid: analysis_dxid, user_id: current_user.id
+      name: analysis_name, workflow_id: workflow.id, dxid: analysis_dxid, user_id: current_user.id,
     )
 
     response["stages"].each_with_index do |job_id, idx|
@@ -150,7 +154,7 @@ def run_workflow_once(workflow_params)
         if input_value.is_a?(Hash)
           if input_value["$dnanexus_link"].is_a?(String) && /^file-/.match(input_value["$dnanexus_link"])
             input_file_dxids << input_value["$dnanexus_link"]
-            run_inputs[input_name] = input_value["$dnanexus_link"]
+            run_inputs[input_name] = inputs.dig(idx, :input_value)
           end
         else
           run_inputs[input_name] = input_value
diff --git a/app/controllers/expert_questions_controller.rb b/app/controllers/expert_questions_controller.rb
index d73545969..20e9644de 100644
--- a/app/controllers/expert_questions_controller.rb
+++ b/app/controllers/expert_questions_controller.rb
@@ -52,10 +52,15 @@ def update
       else
         new_state = "open"
       end
-      raise unless @selected_question.update_attributes(
-         :state => new_state,
-         :body => unsafe_params[:expert_question][:body])
+
+      unless @selected_question.update(
+        state: new_state,
+        body: unsafe_params[:expert_question][:body],
+      )
+        raise
+      end
     end
+
     flash[:success] = "Question/answer information updated successfully."
     redirect_to expert_edit_question_path(@expert, @selected_question)
 
diff --git a/app/controllers/experts_controller.rb b/app/controllers/experts_controller.rb
index d2f86f3ed..f81a76dc3 100644
--- a/app/controllers/experts_controller.rb
+++ b/app/controllers/experts_controller.rb
@@ -1,7 +1,11 @@
 class ExpertsController < ApplicationController
-  skip_before_action :require_login,     only: [:index, :show, :ask_question, :blog]
+  include RecaptchaHelper
+
+  skip_before_action :require_login,     only: %i(index show qa ask_question blog)
   before_action :require_login_or_guest, only: [:edit, :update, :create, :new]
 
+  layout "react", only: %i(index show blog)
+
   def index
     @experts = Expert.viewable_by(@context).order(id: :desc)
   end
@@ -98,6 +102,7 @@ def close
   end
 
   def ask_question
+    # to take away this method
     expert = Expert.find(unsafe_params[:id])
     redirect_to experts_path and return unless expert.askable?
 
@@ -118,7 +123,10 @@ def ask_question
           :_original => unsafe_params[:expert][:question],
           :_edited => false.to_s
       )
-      if verify_recaptcha(model: @exp_question) && @exp_question.save!
+      token = unsafe_params.dig("g-recaptcha-response-data", :question)
+      result = verify_captcha_assessment(token, "question")
+
+      if result && @exp_question.save!
         NotificationsMailer.new_expert_question_email(expert, @exp_question).deliver_now!
         flash[:success] = "Your question was submitted successfully."
       else
@@ -140,8 +148,34 @@ def dashboard
   end
 
   def show
+    # to take away this method
     @expert = Expert.find(unsafe_params[:id])
-    if !@expert.is_public?
+
+    unless @expert.is_public?
+      if @expert.editable_by?(@context)
+        flash.now[:warning] =
+          "This Expert Q&A Session is currently private and not viewable by the public."
+      else
+        redirect_to experts_path && return
+      end
+    end
+
+    @answered_questions = @expert.
+      answered_questions.
+      sort_by { |q| q.expert_answer.updated_at }.
+      reverse
+    # rubocop:disable Layout/LineLength
+    @user_questions =
+      @context.logged_in? && !@context.guest? ? @expert.questions_by_user_id(@context.user_id).sort_by(&:created_at).reverse : []
+    # rubocop:enable Layout/LineLength
+  end
+
+  def qa
+    # to take away this method - temporal decision until a Dashboard component
+    # will be ready
+    @expert = Expert.find(unsafe_params[:id])
+
+    unless @expert.is_public?
       if !@expert.editable_by?(@context)
         redirect_to experts_path and return
       else
diff --git a/app/controllers/ginas_controller.rb b/app/controllers/ginas_controller.rb
new file mode 100644
index 000000000..64a198523
--- /dev/null
+++ b/app/controllers/ginas_controller.rb
@@ -0,0 +1,87 @@
+# The controller is used for proxying all GSRS requests.
+class GinasController < ApplicationController
+  include ReverseProxy::Controller
+
+  GSRS_DEFAULT_URL = "http://localhost:9000".freeze
+  GSRS_HEADER_USER_NAME =
+    ENV.fetch("GSRS_AUTHENTICATION_HEADER_NAME", "AUTHENTICATION_HEADER_NAME")
+  GSRS_HEADER_USER_EMAIL =
+    ENV.fetch("GSRS_AUTHENTICATION_HEADER_NAME_EMAIL", "AUTHENTICATION_HEADER_NAME_EMAIL")
+  GSRS_URL = ENV.fetch("GSRS_URL", GSRS_DEFAULT_URL)
+  BETA_ROUTES = %w(
+    /ginas/app
+    /ginas/app/styles.+\.css # fixme: Remove this hack, see PFDA-2815
+    /ginas/app/webjars/.+
+    /ginas/app/assets/.+
+    /ginas/app/lock
+    /ginas/app/register
+    /ginas/app/structure
+    /ginas/app/structureSearch
+    /ginas/app/sequence
+    /ginas/app/wizard
+    /ginas/app/structureSearch
+    /ginas/app/substance
+    /ginas/app/substance/.+
+    /ginas/app/substances
+    /ginas/app/load
+    /ginas/app/loadSDF
+    /ginas/app/loadSDF/.+
+    /ginas/app/monitor
+    /ginas/app/monitor/.+
+    /ginas/app/relationships/[^\/]+
+    /ginas/app/cv
+    /ginas/app/cv/.+
+    /ginas/app/_updateIndex
+    /ginas/app/_updateIndex/.+
+    /ginas/app/admin
+    /ginas/app/admin/.+
+    /ginas/app/profile
+    /ginas/app/myDownloads
+    /ginas/app/myDownloads/.+
+  ).freeze
+
+  skip_before_action :verify_authenticity_token
+  before_action :beta_redirect, if: -> { beta_redirectable? }
+
+  def index
+    reverse_proxy GSRS_URL,
+                  path: request.fullpath,
+                  headers: {
+                    GSRS_HEADER_USER_NAME => current_user.username,
+                    GSRS_HEADER_USER_EMAIL => current_user.email,
+                  } do |config|
+                    config.on_error do |code, response|
+                      logger.error "Received GSRS error for path #{request.fullpath}: " \
+                                   "#{response.body}, code: #{code}"
+                    end
+                  end
+  end
+
+  def substances
+    substance_creator = Ginas::SubstanceFileCreator.new(@context)
+
+    begin
+      file = substance_creator.create_and_upload_file(request)
+    rescue StandardError
+      msg = "Can't create a substance file for #{current_user.full_name}"
+      logger.error msg
+      render(plain: msg, status: :unprocessable_entity) && return
+    end
+
+    render json: { fileUrl: "#{HOST}/home/files/#{file.uid}" }
+  end
+
+  def skip_request
+    head :ok
+  end
+
+  private
+
+  def beta_redirect
+    redirect_to request.fullpath.sub("/ginas/app", "/ginas/app/beta")
+  end
+
+  def beta_redirectable?
+    BETA_ROUTES.find { |route| Regexp.new("^#{route}$") =~ request.path.chomp("/") }
+  end
+end
diff --git a/app/controllers/home_controller.rb b/app/controllers/home_controller.rb
index 5ed544c6c..845cb4e4a 100644
--- a/app/controllers/home_controller.rb
+++ b/app/controllers/home_controller.rb
@@ -1,3 +1,4 @@
 # Home - will be the main client enter to the pFDA
 class HomeController < ApplicationController
+  layout "react"
 end
diff --git a/app/controllers/jobs_controller.rb b/app/controllers/jobs_controller.rb
index 175184077..212a61a9d 100644
--- a/app/controllers/jobs_controller.rb
+++ b/app/controllers/jobs_controller.rb
@@ -1,9 +1,15 @@
+# Jobs controller
+
 class JobsController < ApplicationController
+  include ErrorProcessable
+  include CloudResourcesConcern
+
   skip_before_action :require_login,     only: [:show]
   before_action :require_login_or_guest, only: [:show]
+  before_action :check_total_and_job_charges_limit, only: :new
 
   def show
-    @job = Job.accessible_by(@context).includes(:user).find_by_uid(unsafe_params[:id])
+    @job = Job.accessible_by(@context).includes(:user).find_by(uid: params[:id])
 
     if @job.nil?
       flash[:error] = "Sorry, this job does not exist or is not accessible by you"
@@ -16,6 +22,7 @@ def show
     @items_from_params = [@job]
     @item_path = pathify(@job)
     @item_comments_path = pathify_comments(@job)
+
     if @job.in_space?
       space = item_from_uid(@job.scope)
       @comments = Comment.where(commentable: space, content_object: @job).order(id: :desc).page unsafe_params[:comments_page]
@@ -26,15 +33,15 @@ def show
     @notes = @job.notes.real_notes.accessible_by(@context).order(id: :desc).page unsafe_params[:notes_page]
     @answers = @job.notes.accessible_by(@context).answers.order(id: :desc).page unsafe_params[:answers_page]
     @discussions = @job.notes.accessible_by(@context).discussions.order(id: :desc).page unsafe_params[:discussions_page]
+
     js id: @job.id, desc: @job.from_submission? ? @job.submission.desc : ""
   end
 
   def log
-    @job = Job.accessible_by(@context).find_by_uid(unsafe_params[:id])
+    @job = Job.accessible_by(@context).find_by(uid: params[:id])
 
     if @job.nil? || @job.log_unaccessible?(@context)
       flash[:error] = "Sorry, this job does not exist or its log is not accessible by you"
-      redirect_to apps_path
       return
     end
 
@@ -75,7 +82,6 @@ def log
         json = JSON.parse(msg.to_s)
         # source, msg, timestamp, level, job, line|
         # source=SYSTEM, msg=END_LOG
-
         if json["code"]
           flash[:error] = "Sorry, something went wrong. Please, try later"
           return
@@ -91,7 +97,7 @@ def log
   end
 
   def new
-    @app = App.find_by!(uid: unsafe_params[:app_id])
+    @app = App.find_by!(uid: params[:app_id])
 
     unless @app.runnable_by?(current_user)
       redirect_back(
@@ -99,6 +105,13 @@ def new
         flash: { error: I18n.t("app_not_accessible_or_runnable") },
       ) && return
     end
+    if user_has_no_compute_resources_allowed
+      redirect_back(
+        fallback_location: apps_path,
+        flash: { error: I18n.t("api.errors.no_allowed_instance_types") },
+      ) && return
+    end
+
 
     licenses_to_accept = []
     @app.assets.each do |asset|
@@ -133,31 +146,37 @@ def new
        licenses_to_accept: licenses_to_accept.uniq(&:id),
        licenses_accepted: licenses_accepted,
        selectable_spaces: selectable_spaces,
-       content_scopes: content_scopes
+       content_scopes: content_scopes,
+       instance_types: user_compute_resource_labels,
+       job_limit: current_user.job_limit
   end
 
   def destroy
-    @job = Job.where(user_id: @context.user_id).find_by_uid(unsafe_params[:id])
+    @job = Job.where(user_id: @context.user_id).find_by(uid: params[:id])
+
     if @job.nil?
       flash[:error] = "Sorry, this job does not exist or is not accessible by you"
       redirect_to apps_path
       return
     end
-    if !@job.terminal?
-      DNAnexusAPI.new(@context.token).call(@job.dxid, "terminate")
+
+    unless @job.terminal?
+      api = @job.https? ? DIContainer.resolve("https_apps_client") : DIContainer.resolve("api.user")
+      api.job_terminate(@job.dxid)
     end
+
     redirect_to job_path(@job)
   end
 
   private
 
   def sync_job!
-    return if @job.terminal?
+    return if @job.terminal? || @job.https?
 
     if @job.from_submission?
-      User.sync_challenge_job!(@job.id)
+      Job.sync_challenge_job!(@job.id)
     else
-      User.sync_job!(@context, @job.id)
+      Job.sync_job!(@context, @job.id)
     end
   end
 end
diff --git a/app/controllers/licenses_controller.rb b/app/controllers/licenses_controller.rb
index 41275a671..adbce87c2 100644
--- a/app/controllers/licenses_controller.rb
+++ b/app/controllers/licenses_controller.rb
@@ -210,7 +210,7 @@ def approve_user
       AcceptedLicense.transaction do
         accepted_license = license.accepted_licenses.find_by(user_id: user.id)
         if !accepted_license.nil?
-          accepted_license.update_attributes(state: 'active')
+          accepted_license.update(state: "active")
           accepted_license.reload
           NotificationsMailer.license_approved_email(license, user).deliver_now!
         end
diff --git a/app/controllers/main_controller.rb b/app/controllers/main_controller.rb
index bf800785b..3cafd35c2 100644
--- a/app/controllers/main_controller.rb
+++ b/app/controllers/main_controller.rb
@@ -1,6 +1,7 @@
 # rubocop:todo Style/Documentation
 class MainController < ApplicationController # rubocop:todo Metrics/ClassLength
   include Recaptcha::Adapters::ControllerMethods
+  include RecaptchaHelper
 
   # rubocop:todo Rails/LexicallyScopedActionFilter
   skip_before_action :require_login, only: %i( # rubocop:todo Rails/LexicallyScopedActionFilter
@@ -16,15 +17,15 @@ class MainController < ApplicationController # rubocop:todo Metrics/ClassLength
                                                destroy
                                                presskit
                                                news
-                                               mislabeling)
+                                               mislabeling
+                                               track)
   # rubocop:enable Rails/LexicallyScopedActionFilter
 
-  # rubocop:todo Rails/LexicallyScopedActionFilter
-  skip_before_action :require_login, only: %i(track ae_anomaly_detection)
-  # rubocop:enable Rails/LexicallyScopedActionFilter
   before_action :require_login_or_guest, only: %i(track)
   before_action :init_countries, only: %i(request_access create_request_access)
 
+  layout "react", only: %i(about index)
+
   def index # rubocop:todo Metrics/MethodLength
     show_guidelines = false
     @consistency_discussion = Discussion.accessible_by_public.find_by(id: CONSISTENCY_DISCUSSION_ID)
@@ -67,7 +68,7 @@ def index # rubocop:todo Metrics/MethodLength
         end
 
         login_tasks_processor = DIContainer.resolve("orgs.login_tasks_processor")
-        login_tasks_processor.call(@context.user)
+        login_tasks_processor.call(@context.user, @context.api)
       else
         @tutorials = [
           {
@@ -79,7 +80,7 @@ def index # rubocop:todo Metrics/MethodLength
           },
           {
             title: "Explore files",
-            path: Rails.application.routes.url_helpers.explore_files_path,
+            path: "/home/files/everybody",
             help_label: "Learn",
             help_path: Rails.application.routes.url_helpers.show_docs_path("files"),
             description: "Browse the datasets have been publicly shared with the precisionFDA community",
@@ -100,7 +101,7 @@ def index # rubocop:todo Metrics/MethodLength
           },
           {
             title: "Browse Assets",
-            path: Rails.application.routes.url_helpers.explore_assets_path,
+            path: "/home/assets/everybody",
             help_label: "Learn",
             help_path: Rails.application.routes.url_helpers.show_docs_path("creating_apps") + "#dev-assets",
             description: "Browse the collection of software assets that are used as building blocks in apps.",
@@ -204,9 +205,25 @@ def presskit # rubocop:todo Metrics/MethodLength
 
   def login
     if @context.guest?
-      render "_partials/_error", status: :forbidden, locals: { message: "You are currently browsing precisionFDA as a guest. To log in and complete this action, your user account must be provisioned. Your account is currently being reviewed by an FDA administrator for provisioning. If you do not receive full access within 14 days, please contact precisionfda@fda.hhs.gov to request an upgraded account with end-level access." }
+      render "_partials/_error", status: :forbidden,
+                                 locals: { message: I18n.t("main.login_as_guest_warning") }
     else
-      redirect_to "#{DNANEXUS_AUTHSERVER_URI}oauth2/authorize?response_type=code&client_id=#{OAUTH2_CLIENT_ID}&redirect_uri=#{URI.encode_www_form_component(OAUTH2_REDIRECT_URI)}"
+      user_return_to = params[:user_return_to].presence
+
+      uri_attrs = [oauth2_redirect_url]
+      uri_attrs << "?#{URI.encode_www_form(redirect_uri: user_return_to)}" if user_return_to
+
+      query_params = URI.encode_www_form(
+        response_type: "code",
+        client_id: OAUTH2_CLIENT_ID,
+        redirect_uri: URI.join(*uri_attrs),
+      )
+
+      redirect_to URI.join(
+        DNANEXUS_AUTHSERVER_URI,
+        "oauth2/authorize",
+        "?#{query_params}",
+      ).to_s
     end
   end
 
@@ -218,7 +235,7 @@ def return_from_login # rubocop:todo Metrics/MethodLength
 
     # Exchange the code for a token
     result = DNAnexusAuth.new(DNANEXUS_AUTHSERVER_URI).
-      fetch_token(unsafe_params[:code])
+      fetch_token(unsafe_params[:code], oauth2_redirect_url)
 
     if result["access_token"].blank? ||
        result["token_type"] != "bearer"
@@ -302,24 +319,49 @@ def return_from_login # rubocop:todo Metrics/MethodLength
           user.last_login = Time.zone.now
           user.save(validate: false)
         end
+
+        post_login_checks user, token
       end
 
       Session.delete_expired
 
+      redirect_url = root_url
+
       if Session.limit_reached?(user)
         flash[:error] = "You have reached a limit for login. You can use only #{SESSIONS_LIMIT} active sessions."
       else
+        redirect_url = params[:redirect_uri].presence || redirect_url
         Session.where(key: session_id).delete_all
         reset_session
         save_session(user.id, username, token, expiration_time, user.org_id)
         log_session("User #{username} logged in")
         Event::UserLoggedIn.create_for(user)
       end
+
       distribute_results user, token
-      redirect_to root_url
+      redirect_to redirect_url
     end
   end
 
+  def post_login_checks(user, token)
+    # User logged in successfully, a good time to run user checkup with the new token
+    https_apps_client = HttpsAppsClient.new(token, user)
+    https_apps_client.user_checkup
+  rescue StandardError => e
+    # Error in requesting a user checkup shouldn't interrupt the login process
+    Rails.logger.error("Error requesting user checkup: #{e.message}")
+  end
+
+  def check_webapp
+    job_dxid = (params[:redirect_uri].presence || "")[/job-[^\.]+/]
+    head(:unprocessable_entity) && return unless job_dxid
+
+    job = Job.accessible_by(@context).find_by(dxid: job_dxid)
+    head(:forbidden) && return unless job
+
+    redirect_to open_external_api_job_path(job)
+  end
+
   def distribute_results(user, token) # rubocop:todo Metrics/MethodLength
     user_api = DNAnexusAPI.new(token)
     api = DNAnexusAPI.for_challenge_bot
@@ -373,7 +415,9 @@ def request_access
   def create_request_access
     @invitation = Invitation.new
 
-    if verify_recaptcha(model: @invitation)
+    token = unsafe_params.dig("g-recaptcha-response-data", :registration)
+
+    if verify_captcha_assessment(token, "registration")
       @invitation = RequestAccessService.create_request_for_access(invitation_params)
     end
 
@@ -399,7 +443,13 @@ def browse_access
     end
 
     if request.post? # rubocop:todo Style/GuardClause
-      save_session(-1, "Guest-#{@invitation.id}", "INVALID", @invitation.expires_at.to_i, -1)
+      save_session(
+        -1,
+        "Guest-#{@invitation.id}",
+        Context::INVALID_TOKEN,
+        @invitation.expires_at.to_i,
+        -1,
+      )
       auditor_data = {
         action: "create",
         record_type: "Access Request",
@@ -577,12 +627,42 @@ def set_tags
     end
   end
 
+  # This action is only for backward compatibility with the old pages and was moved here from
+  # the old Spaces Controller. It copies an item from a current confidential space to cooperative.
+  # Only needed for the old Comparisons and Notes pages.
+  def copy_to_cooperative
+    space = Space.confidential.accessible_by(current_user).find(unsafe_params[:id])
+    object = item_from_uid(unsafe_params[:object_id])
+    copy_service = CopyService.new(api: @context.api, user: @context.user)
+
+    if space.editable_by?(current_user) && space.member_in_cooperative?(@context.user_id)
+      copy_service.copy(object, space.shared_space.uid).each do |new_object|
+        SpaceEventService.call(
+          space.shared_space.id,
+          @context.user_id,
+          nil,
+          new_object,
+          "copy_to_cooperative",
+        )
+      end
+
+      flash[:success] = "#{object.class} successfully copied"
+    else
+      flash[:warning] = "You have no permission to copy object(s) to cooperative."
+    end
+
+    redirect_back(fallback_location: _space_path(space))
+  end
+
   private
 
+  def oauth2_redirect_url
+    URI.join(request.base_url, "/return_from_login").to_s
+  end
+
   # Concat item path with '/home' to create a link to Home - for specific items
   def concat_path(item)
-    if ["file", "folder", "app", "app-series", "job", "asset", "workflow", "workflow-series"].
-        include? item.klass
+    if ["app", "app-series", "job", "workflow", "workflow-series"].include?(item.klass)
       "/home".concat(pathify(item))
     else
       pathify(item)
diff --git a/app/controllers/news_items_controller.rb b/app/controllers/news_items_controller.rb
index c4e4a03fe..53a10d1c4 100644
--- a/app/controllers/news_items_controller.rb
+++ b/app/controllers/news_items_controller.rb
@@ -1,12 +1,5 @@
 class NewsItemsController < ApplicationController
-  skip_before_action :require_login, {only: [:index]}
+  skip_before_action :require_login, only: %i(index)
 
-  def index
-    @news_items = NewsItem.published.positioned || []
-
-    respond_to do |r|
-      r.html
-      r.json { render json: @news_items}
-    end
-  end
+  def index; end
 end
diff --git a/app/controllers/notification_preferences_controller.rb b/app/controllers/notification_preferences_controller.rb
index 853c29d69..e71d00840 100644
--- a/app/controllers/notification_preferences_controller.rb
+++ b/app/controllers/notification_preferences_controller.rb
@@ -1,6 +1,6 @@
 class NotificationPreferencesController < ApplicationController
-
   before_action :check_user
+  layout "react"
 
   def index
     render json: { preference: preference.all_attributes }
@@ -21,11 +21,9 @@ def permitted_params
     params.permit(*preference.available_keys)
   end
 
-  private
-
   def check_user
     return if UserPolicy.access_notification_preference?(current_user)
+
     redirect_to root_url
   end
-
 end
diff --git a/app/controllers/profile_controller.rb b/app/controllers/profile_controller.rb
index a834880b2..bb38fccf4 100644
--- a/app/controllers/profile_controller.rb
+++ b/app/controllers/profile_controller.rb
@@ -1,11 +1,13 @@
 # TODO: to be refactored
 #
 class ProfileController < ApplicationController
-  # rubocop:disable Metrics/MethodLength
   include ErrorProcessable
+  include Naming
+
   helper_method :time_zones
-  before_action :find_admin, only: %i(provision_org provision_new_user)
+  before_action :find_admin, only: %i(provision_org)
 
+  # rubocop:disable Metrics/MethodLength
   def index
     usa_id = Country.find_by(name: "United States").id
     @user = User.includes(:org).find(@context.user_id)
@@ -39,86 +41,6 @@ def update
     end
   end
 
-  def provision_new_user
-    if request.get?
-      @invitations = Invitation.
-        order(id: :desc).
-        page(params[:page])
-      @state = "step1"
-      return
-    end
-
-    @inv = unsafe_params[:inv]
-    @invitation = Invitation.find(@inv)
-
-    if @invitation.user
-      editable_params = User.provision_params(@invitation.user_id)
-      @first_name = (unsafe_params[:first_name] || editable_params[:first_name]).to_s.strip
-      @last_name = (unsafe_params[:last_name] || editable_params[:last_name]).to_s.strip
-      @email = (unsafe_params[:email] || editable_params[:email]).to_s.strip
-    else
-      @first_name = (unsafe_params[:first_name] || @invitation.first_name).to_s.strip
-      @last_name = (unsafe_params[:last_name] || @invitation.last_name).to_s.strip
-      @email = (unsafe_params[:email] || @invitation.email).to_s.strip
-    end
-
-    @address1 = (unsafe_params[:address1] || @invitation.address1).to_s.strip
-    @address2 = (unsafe_params[:address2] || @invitation.address2).to_s.strip
-    @postal_code = (unsafe_params[:postal_code] || @invitation.postal_code).to_s.strip
-    @country = (unsafe_params[:country] || @invitation.country.name).to_s.strip
-    @city = (unsafe_params[:city] || @invitation.city).to_s.strip
-    @us_state = (unsafe_params[:us_state] || @invitation.us_state).to_s.strip
-    @full_phone = (unsafe_params[:full_phone] || @invitation.full_phone).to_s.strip
-    @duns = (unsafe_params[:duns] || @invitation.duns).to_s.strip
-
-    username = User.construct_username(@first_name, @last_name)
-    @suggested_username = find_unused_username(username)
-    org = "#{@first_name} #{@last_name} (#{@suggested_username})"
-    org_handle = @suggested_username
-    singular = true
-
-    case unsafe_params[:state]
-    when "step2"
-      @state = "step2"
-
-    when "step3"
-      errors_verifiable_attributes = {
-        first_name: @first_name,
-        last_name: @last_name,
-        email: @email,
-        org: org,
-        org_handle: org_handle,
-      }
-      @errors = add_errors(errors_verifiable_attributes)
-
-      if @errors.any?
-        @state = "step2"
-        return
-      end
-      add_warnings(@first_name, @last_name, @invitation, org, org_handle)
-      @state = "step3"
-
-    when "step4"
-      provision_params = {
-        org: org,
-        username: @suggested_username,
-        org_handle: org_handle,
-        email: @email,
-        first_name: @first_name,
-        last_name: @last_name,
-        address: @address1,
-        duns: @duns,
-        phone: @full_phone,
-        singular: singular,
-      }
-
-      service = DIContainer.resolve("orgs.provisioner")
-      service.call(@user, @invitation, provision_params)
-
-      @state = "step4"
-    end
-  end
-
   def provision_user
     @user = User.includes(:org).find(@context.user_id)
     raise unless @user.can_provision_accounts?
@@ -182,24 +104,32 @@ def provision_user
           papi = DNAnexusAPI.new(ADMIN_TOKEN)
           papi.call(ORG_EVERYONE, "invite", invitee: dxuserid, level: 'MEMBER', allowBillableActivities: false, appAccess: true, projectAccess: 'VIEW', suppressEmailNotification: true)
 
-          user = {}
-          user[:dxuser] = @suggested_username
-          user[:org_id] = @user.org.id
-          user[:schema_version] = User::CURRENT_SCHEMA
-          user[:first_name] = @first
-          user[:last_name] = @last
-          user[:email] = @email
-          user[:normalized_email] = @normalized_email
-          u = User.create!(user)
-
-          auditor_data = {
-            action: "create",
-            record_type: "Provision User",
-            record: {
-              message: "A new user has been created under the '#{@user.org.handle}' organization: user=#{u.as_json} by '#{@user.dxuser}'",
-            },
-          }
-          Auditor.perform_audit(auditor_data)
+          new_user = User.new do |u|
+            u.dxuser = @suggested_username
+            u.org_id = @user.org.id
+            u.schema_version = User::CURRENT_SCHEMA
+            u.first_name = @first
+            u.last_name = @last
+            u.email = @email
+            u.normalized_email = @normalized_email
+            u.pricing_map = CloudResourceDefaults::PRICING_MAP
+            u.job_limit = CloudResourceDefaults::JOB_LIMIT
+            u.total_limit = CloudResourceDefaults::TOTAL_LIMIT
+            u.resources = CloudResourceDefaults::RESOURCES
+            u.charges_baseline = @user.charges_baseline
+          end
+          ActiveRecord::Base.transaction do
+            new_user.save!
+            NotificationPreference.create_for_user!(new_user)
+            auditor_data = {
+              action: "create",
+              record_type: "Provision User",
+              record: {
+                message: "A new user has been created under the '#{@user.org.handle}' organization: user=#{new_user.as_json} by '#{@user.dxuser}'",
+              },
+            }
+            Auditor.perform_audit(auditor_data)
+          end
           @state = "step3"
         end
       end
@@ -246,7 +176,7 @@ def provision_org
 
     when "step3"
 
-      if unsafe_params[:organization_administration] != 'admin'
+      if unsafe_params[:organization_administration] != "admin"
         # clean out org vars.
         @org = nil
         @org_handle = nil
@@ -265,7 +195,8 @@ def provision_org
         @state = "step2"
         return
       end
-      add_warnings(@first_name, @last_name, @invitation, @org, @org_handle)
+
+      @warnings = add_warnings(@invitation, @org, @org_handle, @suggested_username)
       @state = "step3"
 
     when "step4"
@@ -289,6 +220,11 @@ def provision_org
     end
   end
 
+  def check_spaces_permissions
+    https_apps_client = DIContainer.resolve("https_apps_client")
+    https_apps_client.check_spaces_permissions
+  end
+
   def run_report
     @user = User.includes(:org).find(@context.user_id)
     raise unless @user.can_administer_site?
@@ -332,43 +268,6 @@ def find_admin
     raise unless @user.can_administer_site?
   end
 
-  def add_warnings(first_name, last_name, invitation, org, org_handle)
-    @warnings = []
-
-    username = User.construct_username(first_name, last_name)
-    if username != "#{first_name.downcase}.#{last_name.downcase}"
-      @warnings << "The entered name contains characters other than English letters (such as spaces, dashes, or accented characters). Those characters cannot be represented in the username. Therefore, please double-check the suggested username; if needed, go back to make changes to the name."
-    end
-    @suggested_username = find_unused_username(username)
-    if @suggested_username != username
-      if User.find_by(dxuser: username).present?
-        @warnings << "".html_safe + "There is already another user on precisionFDA with the username '#{username}'. " + view_context.link_to("Click here to visit their profile", user_path(username), target: "_blank") + " to make sure that the person you are trying to provision doesn't already exist on precisionFDA. The suggested username has been adjusted to avoid conflicts."
-      else
-        @warnings << "".html_safe + "There is already another DNAnexus user with the username '#{username}'. The suggested username has been adjusted to avoid conflicts."
-      end
-    end
-    if invitation.singular && invitation.org.present?
-      @warnings << "The original invitation included an organization but also ticked the 'self-represented' box. Make sure you are making the right choice between those two options."
-    end
-    if invitation.singular && invitation.organization_admin
-      @warnings << "The original invitation ticked both the organization admin and 'self-represented' boxes. Make sure you are making the right choice between those two options."
-    end
-    if invitation.singular && !invitation.org.present? && org.present?
-      @warnings << "The original invitation ticked the 'self-represented' box but you supplied an organization. Please double-check this is what you want."
-    end
-    if !invitation.singular && invitation.org.present? && !org.present? && !org_handle.present?
-      @warnings << "The original invitation supplied an organization but you are about to provision a self-represented user. Please double-check this is what you want."
-    end
-    if invitation.organization_admin && org.blank?
-      @warnings << "The original invitation ticked the organization admin box but you are about to provision a self-represented user. Please double-check this is what you want."
-    end
-  end
-
-  def find_unused_username(username)
-    api = DNAnexusAPI.new(@context.token)
-    UnusedUsernameGenerator.new(api).call(username)
-  end
-
   # Returns array of time zones ordered by UTC offset.
   # @return [Array[Array<String, String>]] Array of time zones info.
   #   Each element of returning array is array where:
diff --git a/app/controllers/spaces_controller.rb b/app/controllers/spaces_controller.rb
index 1424de027..22e1d8a30 100644
--- a/app/controllers/spaces_controller.rb
+++ b/app/controllers/spaces_controller.rb
@@ -1,257 +1,5 @@
 class SpacesController < ApplicationController
-  before_action :find_space_and_membership, only: %i(
-    discuss feed tasks invite notes assets comparisons reports
-  )
-
-  before_action :content_counters, only: %i(
-    feed tasks notes assets comparisons reports
-  )
-
-  layout "space_content", only: %i(
-    feed tasks notes assets comparisons reports
-  )
+  layout "react"
 
   def index; end
-
-  def discuss
-    @associate_with_options = ['Note', 'File', 'App', 'Job', 'Asset', 'Comparison', 'Workflow']
-    @items_from_params = [@space]
-    @item_path = pathify(@space)
-    @item_comments_path = pathify_comments(@space)
-    @comments = @space.root_comments.order(id: :desc).page unsafe_params[:comments_page]
-    user_ids = @space.space_memberships.active.map(&:user_id)
-    users = User.find(user_ids).map { |u| { name: u.dxuser } }
-    space_id = @space.to_param
-    js users: users, space_id: space_id, space_uid: @space.uid, scopes: @space.accessible_scopes_for_move
-  end
-
-  # Used in discuss only.
-  def search_content
-    space = Space.find(unsafe_params[:id])
-    results = space.search_content(unsafe_params[:content_type], unsafe_params[:query])
-    render json: results
-  end
-
-  # TODO: Move to API.
-  def invite
-    if @membership
-      space_invite_form = SpaceInviteForm.new(space_invite_params.merge(space: @space))
-
-      if space_invite_form.valid?
-        api = @membership.persisted? ? @context.api : DNAnexusAPI.for_admin
-
-        begin
-          invited_emails = space_invite_form.invite(@membership, api)
-        rescue StandardError
-          flash[:error] = "An error has occurred during inviting"
-        end
-
-        if invited_emails.present?
-          flash[:success] = "The invitations to the space have been sent to the following " \
-                            "emails: #{invited_emails.to_sentence}"
-        end
-      else
-        flash[:error] = space_invite_form.errors.full_messages.join(", ")
-      end
-    else
-      flash[:error] = "You don't have permission to invite members to this space"
-    end
-
-    redirect_back(fallback_location: _space_path(@space))
-  end
-
-  # Copies an item from a current confidential space to cooperative one.
-  # Used everywhere.
-  def copy_to_cooperative
-    space = Space.accessible_by(current_user).find(unsafe_params[:id])
-    object = item_from_uid(unsafe_params[:object_id])
-
-    if space.editable_by?(current_user) && space.member_in_cooperative?(@context.user_id)
-      if object && space.shared_space
-        ActiveRecord::Base.transaction do
-          copy_service.copy(object, space.shared_space.uid).each do |new_object|
-            SpaceEventService.call(
-              space.shared_space.id,
-              @context.user_id,
-              nil,
-              new_object,
-              "copy_to_cooperative",
-            )
-          end
-        end
-
-        flash[:success] = "#{object.class} successfully copied"
-      end
-    else
-      flash[:warning] = "You have no permission to copy object(s) to cooperative."
-    end
-
-    redirect_back(fallback_location: _space_path(space))
-  end
-
-  def tasks
-    if unsafe_params[:filter] == "all" && !@context.review_space_admin?
-      unsafe_params[:filter] = "my"
-    end
-
-    case unsafe_params[:filter]
-    when "created_by_me"
-      filter = { user_id: @context.user_id }
-    when "all"
-      filter = {}
-    else
-      unsafe_params[:filter] = "my"
-      filter = { assignee_id: @context.user_id }
-    end
-
-    case unsafe_params[:status]
-    when "completed"
-      @tasks = @space.tasks.where(filter).completed
-      @page_title = 'Completed Tasks'
-      @dates_titles = {
-        respond: 'RESPONDED ON',
-        complete: 'COMPLETED ON',
-      }
-    when "declined"
-      @tasks = @space.tasks.where(filter).declined
-      @page_title = 'Declined Tasks'
-      @dates_titles = {
-        respond: 'RESPOND BY',
-        complete: 'DECLINED ON',
-      }
-    when "accepted"
-      @tasks = @space.tasks.where(filter).accepted_and_failed_deadline
-      @page_title = 'Active Tasks'
-      @dates_titles = {
-        respond: 'RESPONDED BY',
-        complete: 'COMPLETE BY',
-      }
-    else
-      unsafe_params[:status] = "awaiting_response"
-      @tasks = @space.tasks.where(filter).awaiting_response
-      @page_title = 'Awaiting Response Tasks'
-      @dates_titles = {
-        respond: 'RESPOND BY',
-        complete: 'COMPLETE BY',
-      }
-    end
-
-    @tasks_grid = initialize_grid(@tasks, {
-      name: 'tasks',
-      order: 'tasks.created_at',
-      order_direction: 'desc',
-      per_page: 25,
-      include: [{user: :org}],
-    })
-
-    users = @space.users.map { |u| { label: u.dxuser, value: u.id } }
-
-    if @context.user.can_administer_site?
-      user_ids = @space.space_memberships.where(side: @membership.side).pluck(:user_id)
-      @group_tasks = @space.tasks.where(user_id: user_ids)
-    end
-
-    js(common_fields.merge(users: users))
-  end
-
-  def notes
-    @notes = Note.real_notes.accessible_by_space(@space)
-    @notes_list = @notes.order(title: :desc).page unsafe_params[:notes_page]
-    js({ space_uid: @space.uid, scopes: @space.accessible_scopes_for_move })
-  end
-
-  def assets
-    @assets = Asset.accessible_by_space(@space)
-    @assets_grid = initialize_grid(Asset.unscoped.accessible_by_space(@space).includes(:taggings), {
-      name: 'assets',
-      order: 'nodes.name',
-      order_direction: 'asc',
-      per_page: 25,
-      include: [:user, {user: :org}, { taggings: :tag }],
-    })
-    js(common_fields)
-  end
-
-  def comparisons
-    @comparisons = Comparison.accessible_by_space(@space)
-    @comparisons_grid = initialize_grid(@comparisons.includes(:taggings), {
-      name: 'comparisons',
-      order: 'comparisons.name',
-      order_direction: 'desc',
-      per_page: 25,
-      include: [:user, { user: :org }, { taggings: :tag }],
-    })
-    js(common_fields)
-  end
-
-  def feed
-    if (events = @space.space_events).any?
-      @start_date = events.order(created_at: :asc).first.created_at.strftime("%m/%d/%Y")
-      @end_date = events.order(created_at: :asc).last.created_at.strftime("%m/%d/%Y")
-      @users = User.find(events.pluck(:user_id).uniq).map { |u| { name: u.full_name, value: u.id } }
-    else
-      @start_date = ""
-      @end_date = ""
-      @users = []
-    end
-    @duration = ((Time.now - @space.created_at) / 1.days).ceil
-    @roles = SpaceEvent.roles.map { |k, v| { name: k, value: v } }
-    @sides = SpaceEvent.sides.map { |k, v| { name: k, value: v } }
-    @overall_users = @space.space_memberships.active.count
-    object_types = SpaceEvent.object_type_counters(Date.today.beginning_of_week.to_time, Time.now, { space_id: @space.id })
-    js(common_fields.merge(object_types: object_types, space_created_at: @space.created_at))
-  end
-
-  def reports
-    counters = {}
-    counters.merge!(@counts)
-    counters[:comments] = Comment.where(commentable: @space).count
-    counters[:tasks] = @space.tasks.count
-    counters.except!(:feed, :open_tasks, :accepted_tasks, :declined_tasks, :completed_tasks)
-    @users = @space.users.map { |user| { name: user.full_name, value: user.id } }
-    js(common_fields.merge(counts: counters, space_created_at: @space.created_at))
-  end
-
-  private
-
-  def copy_service
-    @copy_service ||= CopyService.new(api: @context.api, user: @context.user)
-  end
-
-  def space_invite_params
-    params.require(:space).permit(:invitees, :invitees_role)
-  end
-
-  def fetch_membership
-    membership = @space.space_memberships.active.find_by(user_id: @context.user_id)
-
-    if membership.nil? && @context.review_space_admin?
-      SpaceMembership.new_by_admin(@context.user)
-    else
-      membership
-    end
-  end
-
-  def find_space_and_membership
-    @space = Space.accessible_by(current_user).find_by(id: params[:id])
-
-    unless @space
-      redirect_back(fallback_location: root_path, alert: "Space doesn't exist") && return
-    end
-
-    @membership = fetch_membership
-  end
-
-  def content_counters
-    @counts ||= @space.content_counters(@context.user_id)
-  end
-
-  def common_fields
-    {
-      space_uid: @space.uid,
-      scopes: @space.accessible_scopes_for_move,
-      space_id: @space.id,
-      active: @space.active?,
-    }
-  end
 end
diff --git a/app/controllers/submissions_controller.rb b/app/controllers/submissions_controller.rb
index 9e9d39f73..9e07b6614 100644
--- a/app/controllers/submissions_controller.rb
+++ b/app/controllers/submissions_controller.rb
@@ -1,5 +1,7 @@
 # Submissions controller
 class SubmissionsController < ApplicationController
+  include CloudResourcesConcern
+
   skip_before_action :require_login, only: []
   before_action :require_login_or_guest, only: []
   before_action :check_challenge_access
@@ -27,6 +29,12 @@ def new
       return
     end
 
+    if user_has_no_compute_resources_allowed
+      flash[:error] = I18n.t("api.errors.no_allowed_instance_types")
+      redirect_to apps_path
+      return
+    end
+
     unless @app
       flash[:error] = "Sorry, this app does not exist or is not accessible by you"
       redirect_to apps_path
@@ -56,7 +64,8 @@ def new
        app: @app.slice(:dxid, :spec, :title),
        scopes_permitted: %w(public private),
        licenses_to_accept: licenses_to_accept.uniq(&:id),
-       licenses_accepted: licenses_accepted
+       licenses_accepted: licenses_accepted,
+       instance_types: user_compute_resource_labels
   end
 
   def edit
@@ -197,7 +206,7 @@ def log
       return
     end
     unless @submission.job.terminal?
-      User.sync_challenge_jobs!
+      Job.sync_challenge_jobs!
       @submission.job.reload
     end
 
@@ -297,10 +306,13 @@ def run_job_create_submission(opts, input_info = nil)
 
     @app = App.find(@challenge.app_id)
 
-    clone_inputs_to_space
+    cloned_inputs = clone_inputs_to_space
+    job_run_inputs = cloned_inputs.copies.to_h { |copy| [copy.source.uid, copy.object.uid] } unless cloned_inputs.nil?
 
     input_info ||= input_spec_preparer.run(@app, @inputs)
 
+    input_info.run_inputs.each { |k, v| input_info.run_inputs[k] = job_run_inputs[v] } unless cloned_inputs.nil?
+
     job = job_creator.create(
       app: @app,
       name: name,
@@ -315,6 +327,8 @@ def run_job_create_submission(opts, input_info = nil)
       _inputs: input_info.file_dxids,
     )
 
+    job.update!(project: @challenge.space.host_project, scope: @challenge.space.scope)
+
     Event::SubmissionCreated.create_for(submission, @context.user)
 
     flash[:success] = "Your entry was submitted successfully."
@@ -341,7 +355,7 @@ def clone_inputs_to_space
     )
 
     begin
-      challenge_bot_copy_service.copy(files, @challenge.space.scope)
+      copied_files = challenge_bot_copy_service.copy(files, @challenge.space.scope)
     ensure
       api.project_decrease_permissions(
         @context.user.private_files_project,
@@ -349,6 +363,7 @@ def clone_inputs_to_space
         "user-#{CHALLENGE_BOT_DX_USER}",
       )
     end
+    copied_files
   end
 
   def challenge_bot_copy_service
diff --git a/app/controllers/workflows_controller.rb b/app/controllers/workflows_controller.rb
index 260f10a9f..0a94e69d5 100644
--- a/app/controllers/workflows_controller.rb
+++ b/app/controllers/workflows_controller.rb
@@ -2,10 +2,17 @@ class WorkflowsController < ApplicationController
   include CommonConcern
   include WorkflowConcern
   include ErrorProcessable
+  include CloudResourcesConcern
 
   before_action :validate_workflow_before_export, only: %i(cwl_export wdl_export)
+  before_action :check_total_and_job_charges_limit, only: %i(batch_workflow run_batch)
 
   def new
+    if user_has_no_compute_resources_allowed
+      flash[:error] = I18n.t("api.errors.no_allowed_instance_types")
+      redirect_to workflows_path
+      return
+    end
     app_series = AppSeries.accessible_by(@context).joins(:apps).merge(App.accessible_by(@context)).distinct
     private_app_series = app_series.where(scope: "private")
     public_app_series = app_series.where(scope: "public")
@@ -13,13 +20,14 @@ def new
       apps: { private_apps: private_app_series.map { |a_s| a_s.slice(:id, :name) },
               public_apps: public_app_series.map { |a_s| a_s.slice(:id, :name) } },
       scope: %w(private),
+      instance_types: user_compute_resource_labels,
     )
   end
 
   def show
     @workflow = Workflow.accessible_by(@context).find_by(uid: unsafe_params[:id])
     if @workflow.nil?
-      flash[:error] = "Sorry, this workflow does not exist or is not accessible by you"
+      flash[:error] = I18n.t("workflow_not_accessible")
       redirect_to workflows_path
       return
     end
@@ -46,6 +54,11 @@ def show
   end
 
   def edit
+    if user_has_no_compute_resources_allowed
+      flash[:error] = I18n.t("api.errors.no_allowed_instance_types")
+      redirect_to workflows_path
+      return
+    end
     @workflow = Workflow.editable_by(@context).find_by(uid: unsafe_params[:id])
     if @workflow.nil?
       flash[:error] = "Sorry, you do not have permissions to edit this workflow"
@@ -59,6 +72,7 @@ def edit
       apps: { private_apps: private_app_series.map { |a_s| a_s.slice(:id, :name) },
               public_apps: public_app_series.map { |a_s| a_s.slice(:id, :name) } },
       scope: @workflow.accessible_scopes,
+      instance_types: user_compute_resource_labels,
       workflow: @workflow,
     )
   end
@@ -70,7 +84,7 @@ def index
     if unsafe_params[:id].present?
       @workflow = Workflow.accessible_by(@context).find_by(uid: unsafe_params[:id])
       if @workflow.nil?
-        flash[:error] = "Sorry, this workflow does not exist or is not accessible by you"
+        flash[:error] = I18n.t("workflow_not_accessible")
         redirect_to workflows_path
         return
       else
@@ -79,10 +93,10 @@ def index
       js_param[:workflow] = @workflow.slice(:id, :dxid, :uid, :readme, :spec)
     end
 
-    User.sync_jobs!(@context)
+    Job.sync_jobs!(@context)
 
     jobs = Job.includes(:analysis).where(user_id: @context.user_id).where.not(state: Job::TERMINAL_STATES).limit(SYNC_JOBS_LIMIT)
-    jobs.reload.each { |job| User.sync_job!(@context, job.id) }
+    jobs.reload.each { |job| Job.sync_job!(@context, job.id) }
 
     if @workflow.present?
       analysis_arel = Analysis.arel_table
@@ -131,6 +145,11 @@ def index
   end
 
   def fork
+    if user_has_no_compute_resources_allowed
+      flash[:error] = I18n.t("api.errors.no_allowed_instance_types")
+      redirect_to workflows_path
+      return
+    end
     @workflow = Workflow.accessible_by(@context).find_by(uid: unsafe_params[:id])
     if @workflow.nil?
       flash[:error] = "Sorry, you do not have permissions to fork this workflow"
@@ -146,6 +165,7 @@ def fork
         public_apps: public_app_series.map { |app_series| app_series.slice(:id, :name) },
       },
       scope: @workflow.accessible_scopes,
+      instance_types: user_compute_resource_labels,
       workflow: @workflow,
     )
   end
@@ -162,18 +182,14 @@ def batch_workflow
     @workflow = Workflow.accessible_by(@context).find_by(uid: unsafe_params[:id])
 
     if @workflow.nil?
-      flash[:error] = "Sorry, this workflow does not exist or is not accessible by you"
-      redirect_to workflows_path
-      return
-    elsif !@workflow.allow_batch_run?
-      flash[:error] = "Sorry, this workflow cannot be run in a batch"
+      flash[:error] = I18n.t("workflow_not_accessible")
       redirect_to workflows_path
       return
     else
       @revisions = @workflow.workflow_series.accessible_revisions(@context)
     end
 
-    inputs = @workflow.batch_input_spec.select { |input| input[:values][:id].nil? }
+    inputs = @workflow.all_input_spec.select { |input| input[:values][:id].nil? }
     outputs = @workflow.all_output_spec
 
     inputs.map { |v| v["uniq_input_name"] = v["parent_slot"] + "." + v["name"] }
@@ -346,7 +362,7 @@ def output_folder_create
         scope = "public"
       else
         flash[:error] = "You are not allowed to create public folders"
-        redirect_to explore_files_path
+        redirect_to "/home/files/everybody"
         return
       end
     elsif workflow.in_space?
@@ -358,7 +374,7 @@ def output_folder_create
     end
 
     service = FolderService.new(@context)
-    result = service.add_folder(unsafe_params[:name], parent_folder, scope)
+    result = service.add_folder(unsafe_params[:name], parent_folder, parent_folder&.scope || scope)
 
     if result.failure?
       full_messages =
diff --git a/app/decorators/graph_decorator.rb b/app/decorators/graph_decorator.rb
index 6fed72d7a..6be35bc2d 100644
--- a/app/decorators/graph_decorator.rb
+++ b/app/decorators/graph_decorator.rb
@@ -2,6 +2,7 @@ module GraphDecorator
   COMPARISON_NODES = %w(comparison).freeze
   NOTE_NODES = %w(note answer discussion).freeze
   FILE_NODES = %w(file asset).freeze
+  DB_CLUSTER_NODES = %w(db-cluster).freeze
   JOB_NODES = %w(job).freeze
   APP_NODE = %w(app).freeze
   WORKFLOW_NODE = %w(workflow).freeze
@@ -11,7 +12,7 @@ def for_publisher(context, roots, scope)
       Array.wrap(roots).map { |root| build(context, root, scope) }
     end
 
-    def build(context, record, scope = "public")
+    def build(context, record, scope = Scopes::SCOPE_PUBLIC)
       node_class(record).new(context, record, scope)
     end
 
@@ -20,6 +21,7 @@ def build(context, record, scope = "public")
     def node_class(record)
       case record.klass
       when *COMPARISON_NODES then GraphDecorator::ComparisonNode
+      when *DB_CLUSTER_NODES then GraphDecorator::DbClusterNode
       when *NOTE_NODES       then GraphDecorator::NoteNode
       when *FILE_NODES       then GraphDecorator::FileNode
       when *JOB_NODES        then GraphDecorator::JobNode
diff --git a/app/decorators/graph_decorator/base_node.rb b/app/decorators/graph_decorator/base_node.rb
index 4661661cc..9d0202053 100644
--- a/app/decorators/graph_decorator/base_node.rb
+++ b/app/decorators/graph_decorator/base_node.rb
@@ -23,6 +23,10 @@ def to_hash
       }
     end
 
+    def children
+      []
+    end
+
     private
 
     attr_reader :context, :scope
diff --git a/app/decorators/graph_decorator/db_cluster_node.rb b/app/decorators/graph_decorator/db_cluster_node.rb
new file mode 100644
index 000000000..e0533b1cb
--- /dev/null
+++ b/app/decorators/graph_decorator/db_cluster_node.rb
@@ -0,0 +1,4 @@
+module GraphDecorator
+  class DbClusterNode < BaseNode
+  end
+end
diff --git a/app/decorators/graph_decorator/file_node.rb b/app/decorators/graph_decorator/file_node.rb
index bbcb3529e..dce15c89b 100644
--- a/app/decorators/graph_decorator/file_node.rb
+++ b/app/decorators/graph_decorator/file_node.rb
@@ -1,10 +1,9 @@
 module GraphDecorator
   class FileNode < BaseNode
     def children
-      return [] unless record.accessible_by?(context)
-      return [build_child(record.parent)] if record.parent_type == "Node"
-      return [build_child(record.parent)] if record.parent_type == "Job"
-      return [build_child(record.parent)] if record.parent_type == "Comparison"
+      if %w(Node Job Comparison).include?(record.parent_type) && record.accessible_by?(context)
+        return [build_child(record.parent)]
+      end
 
       []
     end
diff --git a/app/errors/generic_error.rb b/app/errors/generic_error.rb
new file mode 100644
index 000000000..e334b1584
--- /dev/null
+++ b/app/errors/generic_error.rb
@@ -0,0 +1 @@
+class GenericError < RuntimeError; end
diff --git a/app/errors/job_in_terminal_state_error.rb b/app/errors/job_in_terminal_state_error.rb
new file mode 100644
index 000000000..89da8fd3b
--- /dev/null
+++ b/app/errors/job_in_terminal_state_error.rb
@@ -0,0 +1,7 @@
+# Job termimation error
+class JobInTerminalStateError < StandardError
+  def initialize(dxid)
+    msg = "Job #{dxid} is in terminal state and can not be terminated."
+    super(msg)
+  end
+end
diff --git a/app/extras/context.rb b/app/extras/context.rb
index 719bdf6d7..6f5830916 100644
--- a/app/extras/context.rb
+++ b/app/extras/context.rb
@@ -4,6 +4,11 @@
 #
 
 class Context
+  GRAVATAR_GUEST_AVATAR =
+    "https://secure.gravatar.com/avatar/00000000000000000000000000000000.png?d=mm&r=PG".freeze
+
+  INVALID_TOKEN = "INVALID".freeze
+
   attr_accessor :user_id, :username, :token, :expiration, :org_id
 
   class << self
@@ -23,13 +28,15 @@ def build(session)
     end
   end
 
-  def initialize(user_id, username, token, expiration, org_id)
+  def initialize(user_id, username, token, expiration, org_id, cli_client = false)
     @user_id = user_id
     @username = username
     @token = token
     @expiration = expiration
     @org_id = org_id
 
+    @cli_client = cli_client
+
     # Cache user, if logged in
     if logged_in?
       @user = User.find(@user_id)
@@ -40,51 +47,64 @@ def initialize(user_id, username, token, expiration, org_id)
   end
 
   def user
-    raise "context.user called for guest context" if guest?
-    @user
+    @user ||= begin
+      User.new(dxuser: @username, expiration: @expiration) if guest?
+    end
   end
 
-  def gravatar_url
-    guest? ? "https://secure.gravatar.com/avatar/00000000000000000000000000000000.png?d=mm&r=PG" : @user.gravatar_url
+  def cli_client?
+    @client_cli
   end
 
-  def logged_in?
-    return (@user_id.present? && @username.present? && @token.present? && @expiration.present? && ((@expiration - Time.now.to_i) > 5.minutes) && @org_id.present?) && (@user_id != -1 && @token != "INVALID" && @org_id != -1) && (@user.present? ? @user.user_state == 'enabled' : true)
-  end
+  def gravatar_url
+    return GRAVATAR_GUEST_AVATAR if guest?
 
-  def guest?
-    return (@user_id == -1 && @username.start_with?("Guest-") && @token == "INVALID" && @expiration.present? && ((@expiration - Time.now.to_i) > 5.minutes) && @org_id == -1)
+    @user.gravatar_url
   end
 
-  def can_create_challenges?
-    logged_in? && (user.can_administer_site? || user.is_challenge_admin?)
+  def logged_in?
+    @user_id.present? &&
+      @username.present? &&
+      @token.present? &&
+      @expiration.present? &&
+      (@expiration - Time.now.to_i) > 5.minutes &&
+      @org_id.present? &&
+      @user_id != -1 &&
+      @token != INVALID_TOKEN &&
+      @org_id != -1 &&
+      (@user ? @user.enabled? : true)
   end
 
-  def can_create_spaces?
-    logged_in? && user.can_create_spaces?
+  def guest?
+    @user_id == -1 &&
+      @username.start_with?("Guest-") &&
+      @token == INVALID_TOKEN &&
+      @expiration.present? &&
+      ((@expiration - Time.now.to_i) > 5.minutes) &&
+      @org_id == -1
   end
 
-  def can_administer_site?
-    logged_in? && user.can_administer_site?
+  def logged_in_or_guest?
+    logged_in? || guest?
   end
 
   def challenge_admin?
-    logged_in? && user.is_challenge_admin?
+    user&.site_or_challenge_admin?
   end
 
   def challenge_evaluator?
-    logged_in? && user.is_challenge_evaluator?
+    user&.is_challenge_evaluator?
   end
 
-  def logged_in_or_guest?
-    return logged_in? || guest?
+  def gov_user?
+    user&.government_user?
   end
 
   def api
     @api ||= DNAnexusAPI.new(token)
   end
 
-  def review_space_admin?
-    logged_in? && user.review_space_admin?
-  end
+  delegate :can_create_challenges?, :can_create_spaces?,
+           :can_administer_site?, :review_space_admin?,
+           to: :user, allow_nil: true
 end
diff --git a/app/extras/dn_anexus_api.rb b/app/extras/dn_anexus_api.rb
index 703b693f9..b4b1501e9 100644
--- a/app/extras/dn_anexus_api.rb
+++ b/app/extras/dn_anexus_api.rb
@@ -1,94 +1,36 @@
 # Platform API client.
 class DNAnexusAPI
+  extend DXClient::Constants
   include DXClient::Constants
   include DXClient::Endpoints::Apps
   include DXClient::Endpoints::Applets
   include DXClient::Endpoints::Files
+  include DXClient::Endpoints::DbClusters
   include DXClient::Endpoints::Organizations
   include DXClient::Endpoints::Projects
   include DXClient::Endpoints::System
   include DXClient::Endpoints::Users
+  include DXClient::Endpoints::Jobs
   include DXClient::Endpoints::Workflows
+  include DXClient::Common
 
-  def self.for_admin
-    new(ADMIN_TOKEN)
-  end
+  class << self
+    def for_admin
+      new(ADMIN_TOKEN)
+    end
 
-  def self.for_challenge_bot
-    new(CHALLENGE_BOT_TOKEN)
+    def for_challenge_bot
+      new(CHALLENGE_BOT_TOKEN)
+    end
   end
 
   def initialize(bearer_token, apiserver_url = DNANEXUS_APISERVER_URI)
-    raise "Bearer is nil" if bearer_token.nil?
+    raise "Bearer token is null" if bearer_token.nil?
 
     @transport = DXClient::Transport.new(bearer_token, apiserver_url)
   end
 
-  def generate_permanent_link(file)
-    opts = {
-      project: file.project,
-      preauthenticated: true,
-      filename: file.name,
-      duration: 9_999_999_999,
-    }
-    call(file.dxid, "download", opts)["url"]
-  end
-
   def call(subject, method, input = {})
     @transport.call(subject, method, input)
   end
-
-  def user_exists?(username)
-    begin
-      call("user-#{username}", "describe")
-    rescue Net::HTTPClientException => e
-      if e.message =~ /^404/
-        return false
-      end
-      raise e
-    end
-    true
-  end
-
-  def org_exists?(orgname)
-    begin
-      call("org-#{orgname}", "describe")
-    rescue Net::HTTPClientException => e
-      if e.message =~ /^404/
-        return false
-      end
-      raise e
-    end
-    true
-  end
-
-  def entity_exists?(entity)
-    begin
-      call(entity.to_s, "describe")
-    rescue Net::HTTPClientException => e
-      if e.message =~ /^404/
-        return false
-      end
-      raise e
-    end
-    true
-  end
-
-  def self.email_exists?(email)
-    api = new(ADMIN_TOKEN)
-    begin
-      api.call(ORG_DUMMY, "invite", invitee: email, suppressEmailNotification: true)
-    rescue Net::HTTPClientException => e
-      if e.message =~ /^404/
-        return false
-      end
-      raise e
-    end
-    api.call(ORG_DUMMY, "findMembers")["results"].each do |result|
-      if result["level"] == "MEMBER"
-        api.call(ORG_DUMMY, "removeMember", user: result["id"])
-      end
-    end
-    true
-  end
 end
diff --git a/app/extras/dn_anexus_auth.rb b/app/extras/dn_anexus_auth.rb
index 79af32c35..210c8ac58 100644
--- a/app/extras/dn_anexus_auth.rb
+++ b/app/extras/dn_anexus_auth.rb
@@ -15,13 +15,13 @@ def call(subject, method, input = {})
     end
   end
 
-  def fetch_token(code)
+  def fetch_token(code, redirect_url)
     uri = URI("#{@authserver_url}#{FETCH_TOKEN_PATH}")
 
     post_params = {
       grant_type: "authorization_code",
       code: code,
-      redirect_uri: OAUTH2_REDIRECT_URI,
+      redirect_uri: redirect_url,
       client_id: OAUTH2_CLIENT_ID,
     }
 
diff --git a/app/extras/dx_client/common.rb b/app/extras/dx_client/common.rb
new file mode 100644
index 000000000..4da6f71a0
--- /dev/null
+++ b/app/extras/dx_client/common.rb
@@ -0,0 +1,86 @@
+module DXClient
+  # Provides common actions
+  module Common
+    extend ActiveSupport::Concern
+    include Constants
+
+    # Class methods.
+    class_methods do
+      def email_exists?(email)
+        api = for_admin
+
+        begin
+          api.org_invite(ORG_DUMMY, email, suppressEmailNotification: true)
+        rescue DXClient::Errors::NotFoundError
+          return false
+        end
+
+        begin
+          members = api.org_find_members(ORG_DUMMY)["results"]
+          Utils.each_with_delay(members, 0.5) do |result|
+            user_dxid = result["id"]
+            next if result["level"] != ORG_MEMBERSHIP_MEMBER || user_dxid == ADMIN_USER
+
+            api.org_remove_member(ORG_DUMMY, user_dxid)
+          end
+        rescue DXClient::Errors::DXClientError => e
+          Rails.logger.error([e.message, e.backtrace.join("\n")].join("\n"))
+        end
+
+        true
+      end
+    end
+
+    def entity_exists?(entity)
+      call(entity.to_s, "describe")
+      true
+    rescue DXClient::Errors::NotFoundError
+      false
+    end
+
+    # Used with auth api endpoint only.
+    # Needs only for Staging and Production, works without a coed on Dev stack and Dev env
+    def get_https_job_auth_token(job)
+      params = {
+        grant_type: "authorization_code",
+        scope: { full: true },
+        label: "httpsapp",
+        client_id: "httpsapp",
+        redirect_uri: "#{job.https_job_external_url.downcase}/oauth2/access",
+      }
+
+      call("system", "newAuthToken", params)["authorization_code"]
+    end
+
+    def generate_permanent_link(file)
+      opts = {
+        project: file.project,
+        preauthenticated: true,
+        filename: file.name,
+        duration: 9_999_999_999,
+      }
+      call(file.dxid, "download", opts)["url"]
+    end
+
+    def org_exists?(orgname)
+      call("org-#{orgname}", "describe")
+      true
+    rescue DXClient::Errors::NotFoundError
+      false
+    end
+
+    def user_exists?(username)
+      call("user-#{username}", "describe")
+      true
+    rescue DXClient::Errors::NotFoundError
+      false
+    end
+
+    # Gets user's charges.
+    # @param user [User] User for whom we get charges.
+    # @return [ActiveSupport::HashWithIndifferentAccess] User's charges hash.
+    def user_charges(user)
+      org_describe(user.org.dxid).slice(:computeCharges, :storageCharges, :dataEgressCharges)
+    end
+  end
+end
diff --git a/app/extras/dx_client/endpoints/applets.rb b/app/extras/dx_client/endpoints/applets.rb
index b5e5161ea..bf8d0177b 100644
--- a/app/extras/dx_client/endpoints/applets.rb
+++ b/app/extras/dx_client/endpoints/applets.rb
@@ -10,6 +10,15 @@ module Applets
       def applet_new(project_dxid, opts)
         call("applet", "new", opts.merge(project: project_dxid))
       end
+
+      # Describes an applet object.
+      # @see https://documentation.dnanexus.com/developer/api/running-analyses/applets-and-entry-points#api-method-applet-xxxx-describe
+      # @param applet_dxid [String] Applet's dxid.
+      # @param opts [Hash] Additional options.
+      # @return [Hash]
+      def applet_describe(applet_dxid, opts = {})
+        call(applet_dxid, "describe", opts)
+      end
     end
   end
 end
diff --git a/app/extras/dx_client/endpoints/apps.rb b/app/extras/dx_client/endpoints/apps.rb
index cd0c649bb..6b0a59c04 100644
--- a/app/extras/dx_client/endpoints/apps.rb
+++ b/app/extras/dx_client/endpoints/apps.rb
@@ -61,6 +61,15 @@ def app_add_authorized_users(app_dxid, authorized_users)
       def app_add_developers(app_dxid, developers)
         call(app_dxid, "addDevelopers", developers: developers)
       end
+
+      # Describe the app.
+      # @see https://documentation.dnanexus.com/developer/api/running-analyses/apps#api-method-app-xxxx-yyyy-describe
+      # @param app_dxid [String] App's dxid.
+      # @param opts [Hash] Additional options.
+      # @return [Hash]
+      def app_describe(app_dxid, opts = {})
+        call(app_dxid, "describe", opts)
+      end
     end
   end
 end
diff --git a/app/extras/dx_client/endpoints/db_clusters.rb b/app/extras/dx_client/endpoints/db_clusters.rb
new file mode 100644
index 000000000..4ff5f8249
--- /dev/null
+++ b/app/extras/dx_client/endpoints/db_clusters.rb
@@ -0,0 +1,55 @@
+module DXClient
+  module Endpoints
+    # Provides DB clusters related methods.
+    module DbClusters
+      # Creates a new dbcluster in the specified project.
+      # @see https://documentation.dnanexus.com/developer/api/introduction-to-data-object-classes/dbclusters#api-method-dbcluster-new
+      # @param opts [Hash] Inputs. All of the following are required.
+      # @option opts [String] :name A user friendly name for the database cluster
+      # @option opts [String] :project The project ID that the database cluster will be created in
+      # @option opts [String] :engine The database engine to use (aurora-mysql, aurora-postgresql)
+      # @option opts [String] :engineVersion The version of the database engine to use.
+      # @option opts [String] :dxInstanceClass The DNAnexus instance class for the database
+      #   instances in this cluster.
+      # @option opts [String] :adminPassword The password associated with the admin user for this
+      #   cluster. Must be at least 8 characters in length.
+      # @return [Hash] The result contains only the id of the created dbcluster.
+      def dbcluster_new(opts)
+        call("dbcluster", "new", opts)
+      end
+
+      # Describes the specified dbcluster object.
+      # @see https://documentation.dnanexus.com/developer/api/introduction-to-data-object-classes/dbclusters#api-method-dbcluster-xxxx-describe
+      # @param dbcluster_dxid [String] The DB Cluster dxid.
+      # @param opts [Hash] Additinal inputs.
+      # @return [Hash] The result contains only the id of the created dbcluster.
+      def dbcluster_describe(dbcluster_dxid, opts = {})
+        call(dbcluster_dxid, "describe", opts)
+      end
+
+      # Stops the specified dbcluster. The cluster must be in the 'available' status in order for
+      #   this call to succeed.
+      # @param dbcluster_dxid [String] The DB Cluster dxid.
+      # @return [Hash] The result contains only the id of the created dbcluster.
+      def dbcluster_stop(dbcluster_dxid)
+        call(dbcluster_dxid, "stop")
+      end
+
+      # Restarts the specified dbcluster. Can only be called when the dbcluster is in
+      #   the 'stopped' status.
+      # @param dbcluster_dxid [String] The DB Cluster dxid.
+      # @return [Hash] The result contains only the id of the created dbcluster.
+      def dbcluster_start(dbcluster_dxid)
+        call(dbcluster_dxid, "start")
+      end
+
+      # Terminates the specified dbcluster. This can only be called when the dbcluster is in the
+      #   'available' status as AWS does not allow users to terminate stopped databases.
+      # @param dbcluster_dxid [String] The DB Cluster dxid.
+      # @return [Hash] The result contains only the id of the created dbcluster.
+      def dbcluster_terminate(dbcluster_dxid)
+        call(dbcluster_dxid, "terminate")
+      end
+    end
+  end
+end
diff --git a/app/extras/dx_client/endpoints/files.rb b/app/extras/dx_client/endpoints/files.rb
index acc9a0726..c48083388 100644
--- a/app/extras/dx_client/endpoints/files.rb
+++ b/app/extras/dx_client/endpoints/files.rb
@@ -34,6 +34,15 @@ def file_download(file_dxid, opts = {})
       def file_rename(file_dxid, project_dxid, name)
         call(file_dxid, "rename", { project: project_dxid, name: name })
       end
+
+      # Describes a file object.
+      # @see https://documentation.dnanexus.com/developer/api/introduction-to-data-object-classes/files#api-method-file-xxxx-describe
+      # @param file_dxid [String] ID of file object.
+      # @param opts [Hash] Additional options.
+      # @return [Hash]
+      def file_describe(file_dxid, opts = {})
+        call(file_dxid, "describe", opts)
+      end
     end
   end
 end
diff --git a/app/extras/dx_client/endpoints/jobs.rb b/app/extras/dx_client/endpoints/jobs.rb
new file mode 100644
index 000000000..9adf28383
--- /dev/null
+++ b/app/extras/dx_client/endpoints/jobs.rb
@@ -0,0 +1,14 @@
+module DXClient
+  module Endpoints
+    # Provides jobs-related methods.
+    module Jobs
+      # Terminates the job.
+      # @param user_dxid [String] Job dxid to terminate.
+      # @param opts [Hash] Additional options.
+      # @return [Hash]
+      def job_terminate(job_dxid, opts = {})
+        call(job_dxid, "terminate", opts)
+      end
+    end
+  end
+end
diff --git a/app/extras/dx_client/endpoints/organizations.rb b/app/extras/dx_client/endpoints/organizations.rb
index 81d22a1ea..2b69b4f91 100644
--- a/app/extras/dx_client/endpoints/organizations.rb
+++ b/app/extras/dx_client/endpoints/organizations.rb
@@ -5,7 +5,7 @@ module Organizations
       # Invites user to provided organization.
       # @see https://documentation.dnanexus.com/developer/api/organizations#api-method-org-xxxx-invite
       # @param org_dxid [String] Organization to invite user to.
-      # @param invitee_dxid [String] Invitee's dxid.
+      # @param invitee_dxid [String] Invitee's dxid or email.
       # @param opts [Hash] Additional options.
       # @return [Hash]
       def org_invite(org_dxid, invitee_dxid, opts = {})
diff --git a/app/extras/dx_client/endpoints/projects.rb b/app/extras/dx_client/endpoints/projects.rb
index e0359d349..976cfbb96 100644
--- a/app/extras/dx_client/endpoints/projects.rb
+++ b/app/extras/dx_client/endpoints/projects.rb
@@ -40,6 +40,13 @@ def project_invite(project_dxid, invitee, level, opts = {})
         call(project_dxid, "invite", opts.merge(invitee: invitee, level: level))
       end
 
+      # Remove user from project. Call using user_api as the user leaving is implied by the token
+      # @see https://documentation.dnanexus.com/developer/api/data-containers/project-permissions-and-sharing#api-method-project-xxxx-leave
+      # @return [Hash]
+      def project_leave(project_dxid, opts = {})
+        call(project_dxid, "leave", opts)
+      end
+
       # Decreases user permissions from provided project.
       # @see https://documentation.dnanexus.com/developer/api/data-containers/project-permissions-and-sharing#api-method-project-xxxx-decreasepermissions
       # @param project_dxid [String] Projects's dxid.
diff --git a/app/extras/dx_client/endpoints/system.rb b/app/extras/dx_client/endpoints/system.rb
index 882e79cd5..667b49915 100644
--- a/app/extras/dx_client/endpoints/system.rb
+++ b/app/extras/dx_client/endpoints/system.rb
@@ -19,6 +19,14 @@ def system_find_data_objects(opts = {})
         call("system", "findDataObjects", opts)
       end
 
+      # Finds orgs.
+      # @see https://documentation.dnanexus.com/developer/api/search#api-method-system-findorgs
+      # @param opts [Hash] Options used to find orgs.
+      # @return [Array]
+      def system_find_orgs(opts = {})
+        call("system", "findOrgs", opts)
+      end
+
       # Finds jobs.
       # @see https://documentation.dnanexus.com/developer/api/search#api-method-system-findjobs
       # @param opts [Hash] Options used to find jobs.
@@ -26,6 +34,22 @@ def system_find_data_objects(opts = {})
       def system_find_jobs(opts = {})
         call("system", "findJobs", opts)
       end
+
+      # Finds projects.
+      # @see https://documentation.dnanexus.com/developer/api/search#api-method-system-findprojects
+      # @param opts [Hash] Options used to find projects.
+      # @return [Array]
+      def system_find_projects(opts = {})
+        call("system", "findProjects", opts)
+      end
+
+      # Finds apps.
+      # @see https://documentation.dnanexus.com/developer/api/search#api-method-system-findapps
+      # @param opts [Hash] Options used to find apps.
+      # @return [Array]
+      def system_find_apps(opts = {})
+        call("system", "findApps", opts)
+      end
     end
   end
 end
diff --git a/app/extras/dx_client/endpoints/users.rb b/app/extras/dx_client/endpoints/users.rb
index 666396377..f6df055c4 100644
--- a/app/extras/dx_client/endpoints/users.rb
+++ b/app/extras/dx_client/endpoints/users.rb
@@ -2,6 +2,15 @@ module DXClient
   module Endpoints
     # Provides users-related methods.
     module Users
+      # Describes a user.
+      # @see https://documentation.dnanexus.com/developer/api/users#api-method-user-xxxx-describe
+      # @param user_dxid [String] ID of a user.
+      # @param opts [Hash] Additional options.
+      # @return [Hash]
+      def user_describe(user_dxid, opts = {})
+        call(user_dxid, "describe", opts)
+      end
+
       # Creates new user with provided params.
       # @param opts [Hash] Options for user creating.
       # @option opts [String] :username Username
diff --git a/app/extras/dx_client/errors/dx_client_error.rb b/app/extras/dx_client/errors/dx_client_error.rb
index 7d7d7152a..d1e14aa57 100644
--- a/app/extras/dx_client/errors/dx_client_error.rb
+++ b/app/extras/dx_client/errors/dx_client_error.rb
@@ -1,6 +1,11 @@
 module DXClient
   module Errors
+    E_DXCLIENT_CODE = "E_DXCLIENT".freeze
+
     class DXClientError < StandardError
+      def error_code
+        E_DXCLIENT_CODE
+      end
     end
   end
 end
diff --git a/app/extras/dx_client/errors/not_found_error.rb b/app/extras/dx_client/errors/not_found_error.rb
new file mode 100644
index 000000000..6c80c7ef4
--- /dev/null
+++ b/app/extras/dx_client/errors/not_found_error.rb
@@ -0,0 +1,6 @@
+module DXClient
+  module Errors
+    class NotFoundError < DXClientError
+    end
+  end
+end
diff --git a/app/extras/dx_client/errors/too_many_requests_error.rb b/app/extras/dx_client/errors/too_many_requests_error.rb
new file mode 100644
index 000000000..33ff462ae
--- /dev/null
+++ b/app/extras/dx_client/errors/too_many_requests_error.rb
@@ -0,0 +1,6 @@
+module DXClient
+  module Errors
+    class TooManyRequestsError < DXClientError
+    end
+  end
+end
diff --git a/app/extras/dx_client/transport.rb b/app/extras/dx_client/transport.rb
index bf493f88c..dcfc8c411 100644
--- a/app/extras/dx_client/transport.rb
+++ b/app/extras/dx_client/transport.rb
@@ -13,11 +13,12 @@ def initialize(token, api_server)
     # @param method [String] Method to invoke on subject.
     # @param body [Hash] HTTP POST body.
     # @return [Hash] The response from API server.
-    def call(subject, method, body = {})
+    def call(subject, method, body = {}, extra_headers = {})
       uri = URI("#{@api_server}#{subject}/#{method}")
+      conn_opts = connection_opts.merge(use_ssl: uri.scheme == "https")
 
-      Net::HTTP.start(uri.host, uri.port, connection_opts) do |http|
-        handle_response(http.post(uri.path, body.to_json, headers))
+      Net::HTTP.start(uri.host, uri.port, conn_opts) do |http|
+        handle_response(http.post(uri.path, body.to_json, headers.merge(extra_headers)))
       end
     end
 
@@ -26,7 +27,7 @@ def call(subject, method, body = {})
     # Returns connection options.
     # @return [Hash] Connection options.
     def connection_opts
-      @connection_opts ||= { read_timeout: 180, use_ssl: true }
+      @connection_opts ||= { read_timeout: 180 }
     end
 
     # Returns HTTP headers to be sent during every request.
@@ -43,9 +44,30 @@ def headers
     # @return [Hash] Response from server converted to hash.
     def handle_response(response)
       response.value
-      JSON.parse(response.body)
+      JSON.parse(response.body).with_indifferent_access
     rescue Net::HTTPClientException => e
-      raise e, "#{e.message}. #{response.body}", e.backtrace
+      raise_error(e)
+    end
+
+    # @param exception [Exception] Exception raised.
+    def raise_error(exception)
+      message =
+        begin
+          JSON.parse(exception.try(:response)&.body).dig("error", "message")
+        rescue JSON::ParserError
+          nil
+        end
+
+      message ||= exception.message
+
+      case exception.response
+      when Net::HTTPNotFound
+        raise DXClient::Errors::NotFoundError, message
+      when Net::HTTPTooManyRequests
+        raise DXClient::Errors::TooManyRequestsError, "Too many requests, please try later."
+      end
+
+      raise DXClient::Errors::DXClientError, message, exception.backtrace
     end
   end
 end
diff --git a/app/extras/https_apps_client.rb b/app/extras/https_apps_client.rb
new file mode 100644
index 000000000..5096ad571
--- /dev/null
+++ b/app/extras/https_apps_client.rb
@@ -0,0 +1,303 @@
+# The client for communicating with nodejs-api service.
+class HttpsAppsClient
+  # @param token [String] User access token.
+  # @param user [User] A user.
+  def initialize(token, user)
+    @token = token
+    @user = user
+  end
+
+  # User checkup
+  # To be run whenever user logs in to make sure sync tasks are
+  # healthy and to check the general health of the user account
+  def user_checkup
+    request(
+      "/account/checkup",
+      {},
+      Net::HTTP::Get::METHOD,
+    )
+  end
+
+  # Run an app.
+  # @param app_dxid [String] App dxid.
+  # @param opts [Hash] Request body options.
+  def app_run(app_dxid, opts)
+    request(
+      "/apps/#{app_dxid}/run",
+      opts,
+      Net::HTTP::Post::METHOD,
+    )
+  end
+
+  # Terminate a job.
+  # @param job_dxid [String] Job dxid to terminate.
+  # @param opts [Hash] Request body options.
+  def job_terminate(job_dxid)
+    request(
+      "/jobs/#{job_dxid}/terminate",
+      {},
+      Net::HTTP::Patch::METHOD,
+    )
+  end
+
+  # Sync files for a running HTTPS app job.
+  # @param job_dxid [String] Job dxid to terminate.
+  # @param opts [Hash] Request body options.
+  def job_sync_files(job_dxid)
+    request(
+      "/jobs/#{job_dxid}/syncFiles",
+      {},
+      Net::HTTP::Patch::METHOD,
+    )
+  end
+
+  # Checks all spaces where current user has ADMIN or LEAD access against platform.
+  # Only checks user's side of space (Host or Guest)
+  # and validates that all members saved in PFDA have their correct counterparts on Platform
+  # Result of this are just logs of permission issues (for now)
+  def check_spaces_permissions
+    request(
+      "/account/checkSpacesPermissions",
+      {},
+      Net::HTTP::Post::METHOD,
+    )
+  end
+
+  # Rename a folder.
+  # @param folder_id [Integer] Folder ID.
+  # @param new_name [String] New folder name.
+  def folder_rename(folder_id, new_name)
+    request(
+      "/folders/#{folder_id}/rename",
+      { newName: new_name },
+      Net::HTTP::Patch::METHOD,
+    )
+  end
+
+  # Delete a folder.
+  # @param folder_id [Integer] Folder ID.
+  def folder_remove(folder_id)
+    request(
+      "/folders/#{folder_id}",
+      {},
+      Net::HTTP::Delete::METHOD,
+    )
+  end
+
+  # Send notification email
+  def email_send(email_type_id, opts)
+    request(
+      "/emails/#{email_type_id}/send",
+      { input: opts },
+      Net::HTTP::Post::METHOD,
+    )
+  end
+
+  def dbcluster_action(dxids, action)
+    raise Error, "Wrong action #{action}" unless %w(start stop terminate).include?(action)
+
+    request(
+      "/dbclusters/#{action}",
+      { dxids: dxids },
+      Net::HTTP::Post::METHOD,
+    )
+  end
+
+  def dbcluster_create(opts)
+    request(
+      "/dbclusters/create",
+      opts,
+      Net::HTTP::Post::METHOD,
+    )
+  end
+
+  def experts_list(page, limit, year)
+    query_args = { page: page, limit: limit }
+    query_args[:year] = year if year
+    request(
+      "/experts",
+      {},
+      Net::HTTP::Get::METHOD,
+      query_args,
+    )
+  end
+
+  def experts_years
+    request(
+      "/experts/years",
+      {},
+      Net::HTTP::Get::METHOD,
+    )
+  end
+
+  def users_list(page, per_page, order_by, order_dir, filters)
+    pagination_args = {}
+    pagination_args[:page] = page if page
+    pagination_args[:per_page] = per_page if per_page
+    pagination_args[:order_by] = order_by if order_by
+    pagination_args[:order_dir] = order_dir if order_dir
+    pagination_args[:filters] = filters if filters
+    request(
+      "/admin/users",
+      {},
+      Net::HTTP::Get::METHOD,
+      pagination_args,
+    )
+  end
+
+  def users_set_total_limit(ids, total_limit)
+    request(
+      "/admin/users/setTotalLimit",
+      {
+        ids: ids,
+        totalLimit: total_limit,
+      },
+      Net::HTTP::Put::METHOD,
+    )
+  end
+
+  def users_set_job_limit(ids, job_limit)
+    request(
+      "/admin/users/setJobLimit",
+      {
+        ids: ids,
+        jobLimit: job_limit,
+      },
+      Net::HTTP::Put::METHOD,
+    )
+  end
+
+  def users_reset_2fa(ids)
+    request(
+      "/admin/users/reset2fa",
+      {
+        ids: ids,
+      },
+      Net::HTTP::Post::METHOD,
+    )
+  end
+
+  def users_unlock(ids)
+    request(
+      "/admin/users/unlock",
+      {
+        ids: ids,
+      },
+      Net::HTTP::Post::METHOD,
+    )
+  end
+
+  def users_activate(ids)
+    request(
+      "/admin/users/activate",
+      {
+        ids: ids,
+      },
+      Net::HTTP::Put::METHOD,
+    )
+  end
+
+  def users_deactivate(ids)
+    request(
+      "/admin/users/deactivate",
+      {
+        ids: ids,
+      },
+      Net::HTTP::Put::METHOD,
+    )
+  end
+
+  def users_enable_resource(ids, resource)
+    request(
+      "/admin/users/enableResourceType",
+      {
+        ids: ids,
+        resource: resource,
+      },
+      Net::HTTP::Put::METHOD,
+    )
+  end
+
+  def users_enable_all_resources(ids)
+    request(
+      "/admin/users/enableAllResourceTypes",
+      {
+        ids: ids,
+      },
+      Net::HTTP::Put::METHOD,
+    )
+  end
+
+  def users_disable_resource(ids, resource)
+    request(
+      "/admin/users/disableResourceType",
+      {
+        ids: ids,
+        resource: resource,
+      },
+      Net::HTTP::Put::METHOD,
+    )
+  end
+
+  def users_disable_all_resources(ids)
+    request(
+      "/admin/users/disableAllResourceTypes",
+      {
+        ids: ids,
+      },
+      Net::HTTP::Put::METHOD,
+    )
+  end
+
+  private
+
+  def request(path, body = {}, method_name = Net::HTTP::Post::METHOD, additional_query = {})
+    query = auth_query.merge(additional_query).to_query
+    uri = URI("#{ENV['HTTPS_APPS_API_URL']}#{path}?#{query}")
+    use_ssl = uri.scheme == "https"
+
+    conn_opts = connection_opts.merge(use_ssl: use_ssl)
+    conn_opts.merge!(verify_mode: OpenSSL::SSL::VERIFY_NONE) if use_ssl
+
+    Net::HTTP.start(uri.host, uri.port, conn_opts) do |http|
+      handle_response(http.send_request(method_name, uri.request_uri, body.to_json, headers))
+    end
+  rescue Errno::ECONNREFUSED
+    raise Error, "Can't connect to nodejs-api service"
+  end
+
+  # Returns connection options.
+  # @return [Hash] Connection options.
+  def connection_opts
+    @connection_opts ||= { read_timeout: 120 }
+  end
+
+  def auth_query
+    {
+      id: @user&.id,
+      dxuser: @user&.dxuser,
+      accessToken: @token,
+    }.compact_blank
+  end
+
+  # Returns HTTP headers to be sent during every request.
+  # @return [Hash] Headers to be sent.
+  def headers
+    @headers ||= { "Content-Type" => "application/json" }
+  end
+
+  # Builds hash from response.
+  # @param response [String] Response string.
+  # @return [Hash] Response from server converted to hash.
+  def handle_response(response)
+    response.value
+    parsed = JSON.parse(response.body || "")
+    parsed.is_a?(Hash) ? parsed.with_indifferent_access : parsed
+  rescue JSON::ParserError
+    response.body
+  rescue Net::HTTPClientException
+    raise Error, response
+  rescue StandardError
+    raise Error, "Something went wrong"
+  end
+end
diff --git a/app/extras/https_apps_client/error.rb b/app/extras/https_apps_client/error.rb
new file mode 100644
index 000000000..d63aff53f
--- /dev/null
+++ b/app/extras/https_apps_client/error.rb
@@ -0,0 +1,51 @@
+class HttpsAppsClient
+  # Client's specific error.
+  class Error < StandardError
+    DEFAULT_ERROR_MSG = "nodejs-api client error.".freeze
+    DEFAULT_ERROR_CODE = "E_UNKNOWN".freeze
+    SPACE_NOT_FOUND_ERROR_CODE = "E_SPACE_NOT_FOUND".freeze
+    VALIDATION_ERROR_CODE = "E_VALIDATION".freeze
+
+    def initialize(msg)
+      @msg = msg
+    end
+
+    def message
+      @message ||= begin
+        if @msg.is_a?(Net::HTTPResponse)
+          if code == VALIDATION_ERROR_CODE
+            error_body = parsed_body.dig(:error, :validationErrors, :body)[0]
+            "#{error_body[:instancePath][1..]} #{error_body[:message]}"
+          else
+            parsed_body.dig(:error, :clientResponse, :error, :message) ||
+              parsed_body.dig(:error, :message).presence ||
+              DEFAULT_ERROR_MSG
+          end
+        else
+          @msg
+        end
+      end
+    end
+
+    def code
+      @code ||= (
+        @msg.is_a?(Net::HTTPResponse) &&
+        parsed_body.dig(:error, :code).presence
+      ) || DEFAULT_ERROR_CODE
+    end
+
+    alias_method :error_code, :code
+
+    private
+
+    def parsed_body
+      @parsed_body ||= begin
+        begin
+          JSON.parse(@msg.try(:body) || "").with_indifferent_access
+        rescue JSON::ParserError
+          {}
+        end
+      end
+    end
+  end
+end
diff --git a/app/extras/ioc/container.rb b/app/extras/ioc/container.rb
index 0fffe1b12..fb42142ee 100644
--- a/app/extras/ioc/container.rb
+++ b/app/extras/ioc/container.rb
@@ -29,11 +29,16 @@ def configure # rubocop:todo Metrics/MethodLength
         )
       end
 
+      register("https_apps_client") { HttpsAppsClient.new(config[:token], config[:user]) }
+
       namespace "api" do
         register("user", memoize: true) { DNAnexusAPI.new(config[:token]) }
         register("admin", memoize: true) { DNAnexusAPI.new(ADMIN_TOKEN) }
         register("challenge_bot", memoize: true) { DNAnexusAPI.new(CHALLENGE_BOT_TOKEN) }
         register("auth", memoize: true) { DNAnexusAPI.new(ADMIN_TOKEN, DNANEXUS_AUTHSERVER_URI) }
+        register("auth_user", memoize: true) do
+          DNAnexusAPI.new(config[:token], DNANEXUS_AUTHSERVER_URI)
+        end
       end
 
       namespace "orgs" do # rubocop:todo Metrics/BlockLength
diff --git a/app/extras/login_tasks_processor.rb b/app/extras/login_tasks_processor.rb
index 1c1eda766..6d5614d83 100644
--- a/app/extras/login_tasks_processor.rb
+++ b/app/extras/login_tasks_processor.rb
@@ -2,6 +2,7 @@
 class LoginTasksProcessor
   include OrgService::Errors
   include OrgService::RequestFilter
+  include OrgService::BaselineCharges
 
   # Constructor.
   # @param leave_org_processor [OrgService::LeaveOrgProcess] Processor of leaving organization
@@ -11,8 +12,20 @@ def initialize(leave_org_processor)
   end
 
   # Invokes tasks for provided user.
-  # @param user User to process tasks for.
-  def call(user)
+  # @param user [User] User to process tasks for.
+  # @param api [DNAnexusAPI] User API object.
+  def call(user, api)
+    process_org_leave_and_dissolve!(user)
+    set_user_baseline_charges!(user, api)
+  end
+
+  private
+
+  attr_reader :request
+
+  # Process Org leaving and dissolving.
+  # @param user [User] User to process tasks for.
+  def process_org_leave_and_dissolve!(user)
     @user = user
     @request = find_request
 
@@ -23,10 +36,6 @@ def call(user)
     process_org_dissolving! if org.admin == @user
   end
 
-  private
-
-  attr_reader :request
-
   # Checks if admin tries to leave non-empty organization.
   # @return [true, false] Returns true if user is an admin and admin tries to leave an org
   #   where there are other users except this admin.
diff --git a/app/extras/unused_orgname_generator.rb b/app/extras/unused_orgname_generator.rb
index 801514cde..84d0181b3 100644
--- a/app/extras/unused_orgname_generator.rb
+++ b/app/extras/unused_orgname_generator.rb
@@ -1,23 +1,28 @@
-# Generates unused username by adding and increasing sequence number for provided username,
+# Generates unused orgname by adding and increasing sequence number for provided username,
 class UnusedOrgnameGenerator
+  RESERVED_SIZE = 4 # 3 digits plus 1 dot
+
   # Constructor.
   # @param api [DNAnexusAPI] API client to use for checks.
   def initialize(api)
     @api = api
   end
 
-  # Performs generation of unused username. Checks provided username first.
+  # Performs generation of unused orgname. Checks provided username first.
   # @param username [String] Initial username to check,
   # @param delay [Integer] delay between the requests to the platform
-  # @return [String] Unused username.
+  # @return [String] Unused org handle.
   def call(username, delay = 2)
-    candidate = username
-    i = 2
+    base_name = username.sub(".", "")
+    base_name = base_name[0...Org::HANDLE_MAX_LENGTH - Org::PFDA_PREFIX.size - RESERVED_SIZE]
+
+    idx = 2
+    candidate = base_name.dup
 
-    while @api.org_exists?("pfda.." + candidate)
-      candidate = "#{username}.#{i}"
+    while Org.where(handle: candidate).exists? || @api.org_exists?(Org::PFDA_PREFIX + candidate)
+      candidate = "#{base_name}.#{idx}"
       sleep delay
-      i += 1
+      idx += 1
     end
 
     candidate
diff --git a/app/form_objects/space_edit_form.rb b/app/form_objects/space_edit_form.rb
new file mode 100644
index 000000000..13247aeaf
--- /dev/null
+++ b/app/form_objects/space_edit_form.rb
@@ -0,0 +1,56 @@
+# Space Edit Form model, used for space editing.
+class SpaceEditForm < SpaceForm
+  include ActiveModel::Model
+
+  attr_accessor(
+    :space_host_lead,
+    :space_guest_lead,
+    :current_user,
+  )
+
+  validates :name, :description, :space_type, presence: true
+  validate :validate_host_lead_dxuser
+  validate :validate_sponsor_lead_dxuser, if: -> { space_type == TYPE_REVIEW }
+
+  alias_method :reviewer_lead_dxuser, :host_lead_dxuser
+
+  private
+
+  # A host lead user validation
+  # Prevents a reviewer lead to set the sponsor lead as the reviewer lead
+  def validate_host_lead_dxuser
+    errors.add(:reviewer_lead_dxuser, "'#{host_lead_dxuser}' not found") unless host_admin
+
+    check_dxuser_already_in_space(host_lead_dxuser) if host_lead_dxuser != space_host_lead
+
+    return unless host_lead_dxuser == space_guest_lead
+
+    errors.add(:sponsor_lead_dxuser, "can't be assigned as Reviewer lead")
+  end
+
+  # A sponsor lead user validation.
+  # Prevents a reviewer lead to set himself as the sponsor lead
+  def validate_sponsor_lead_dxuser
+    if sponsor_lead_dxuser == host_lead_dxuser
+      errors.add(:sponsor_lead_dxuser, "can't be the same as Reviewer lead")
+    end
+
+    if sponsor_lead_dxuser == space_host_lead
+      errors.add(:reviewer_lead_dxuser, "can't be assigned as Sponsor lead")
+    end
+    errors.add(:sponsor_lead_dxuser, "'#{sponsor_lead_dxuser}' not found") unless space_sponsor
+
+    check_dxuser_already_in_space(sponsor_lead_dxuser) if sponsor_lead_dxuser != space_guest_lead
+  end
+
+  def check_dxuser_already_in_space(dxuser)
+    space = Space.find(source_space_id)
+    return if space.user_member(dxuser).blank?
+
+    errors.add(
+      :base,
+      "The Space member #{dxuser} exists." \
+      " Use `Members` page to change the role",
+    )
+  end
+end
diff --git a/app/form_objects/space_form.rb b/app/form_objects/space_form.rb
index 1a935e625..a2ec01e12 100644
--- a/app/form_objects/space_form.rb
+++ b/app/form_objects/space_form.rb
@@ -17,12 +17,12 @@ class SpaceForm
 
   TYPE_GROUPS = "groups".freeze
   TYPE_REVIEW = "review".freeze
-  TYPE_VERIFICATION = "verification".freeze
+  TYPE_PRIVATE = "private_type".freeze
 
   validates :name, :description, :space_type, presence: true
   validate :validate_host_lead_dxuser
   validate :validate_leads_orgs, if: -> { space_type == TYPE_REVIEW }
-  validate :validate_guest_lead_dxuser, if: -> { space_type.in?([TYPE_GROUPS, TYPE_VERIFICATION]) }
+  validate :validate_guest_lead_dxuser, if: -> { space_type == TYPE_GROUPS }
   validate :validate_sponsor_lead_dxuser, if: -> { space_type == TYPE_REVIEW }
 
   class << self
@@ -35,8 +35,18 @@ def persist!(api, user)
     SpaceService::Create.call(self, api: api, user: user)
   end
 
+  def host_admin
+    @host_admin ||= User.find_by(dxuser: host_lead_dxuser)
+  end
+
+  def guest_admin
+    @guest_admin ||= User.find_by(dxuser: guest_lead_dxuser)
+  end
+
   def space_sponsor
-    User.find_by(dxuser: sponsor_lead_dxuser)
+    return unless space_type == TYPE_REVIEW
+
+    @space_sponsor ||= User.find_by(dxuser: sponsor_lead_dxuser)
   end
 
   private
@@ -52,19 +62,14 @@ def validate_guest_lead_dxuser
       errors.add(:guest_lead_dxuser, "can't be the same as Host lead")
     end
 
-    return unless guest_lead_in_groups || guest_lead_in_verification
+    return unless guest_lead_in_groups
 
     errors.add(:guest_lead_dxuser, "'#{guest_lead_dxuser}' not found")
   end
 
   # Check guest lead in space of "groups" type
   def guest_lead_in_groups
-    space_type == "groups" && !(guest_lead_dxuser.present? && guest_admin)
-  end
-
-  # Check guest lead in space of "verification" type
-  def guest_lead_in_verification
-    space_type == "verification" && guest_lead_dxuser.present? && guest_admin.nil?
+    space_type == TYPE_GROUPS && !(guest_lead_dxuser.present? && guest_admin)
   end
 
   # A sponsor lead user validation
@@ -85,12 +90,4 @@ def validate_leads_orgs
 
     errors.add(:sponsor_lead_dxuser, "can't belong to the same Org as Reviewer lead")
   end
-
-  def host_admin
-    User.find_by(dxuser: host_lead_dxuser)
-  end
-
-  def guest_admin
-    User.find_by(dxuser: guest_lead_dxuser)
-  end
 end
diff --git a/app/form_objects/space_invite_form.rb b/app/form_objects/space_invite_form.rb
index 2ae37e78c..7b6a0c13d 100644
--- a/app/form_objects/space_invite_form.rb
+++ b/app/form_objects/space_invite_form.rb
@@ -1,33 +1,43 @@
 class SpaceInviteForm
   include ActiveModel::Model
 
-  attr_accessor :invitees_role, :space, :space_id
+  attr_accessor :invitees_role, :space, :space_id, :side, :current_user
   attr_reader :invitees
 
   validates :invitees_role, presence: true, inclusion: { in: SpaceMembership.roles.keys }
   validate :validate_invitees,
            :validate_dxusers,
+           :validate_space_admin,
+           :validate_users_sides,
            :check_emails_already_in_space,
            :check_dxusers_already_in_space
 
-  # @param [SpaceMembership, #side, #user] membership
+  # @param membership [SpaceMembership] Inviter's membership object.
+  # @param api [DNAnexusAPI] Inviter's api object.
   def invite(membership, api)
-    # rubocop:disable Style/SymbolProc
+    # rubocop:todo Style/SymbolProc
     return if invalid?
 
+    # Do not allow external users for now. See PFDA-2594
+    unless non_existing_emails.empty?
+      raise "Cannot invite users #{non_existing_emails.join(', ')} to this space. " \
+        "Please ensure that they are registered with precisionFDA before inviting them."
+    end
+
     existing_users.find_each do |user|
       SpaceService::Invite.call(api, space, membership, user, invitees_role)
     end
 
     existing_emails = existing_users.map { |user| user.email }
 
-    # invite user from the outside of pFDA
-    non_existing_emails.each do |email|
-      SpaceService::InviteByEmail.call(space, email, membership, invitees_role)
-    end
+    # Disabling invitation of external user to a space until PFDA-2598 is fixed
+    # non_existing_emails.each do |email|
+    #   SpaceService::InviteByEmail.call(space, email, membership, invitees_role)
+    # end
     # rubocop:enable Style/SymbolProc
 
-    non_existing_emails + existing_emails
+    # non_existing_emails + existing_emails
+    existing_emails
   end
 
   # @param [String] value Comma-separated list of invitees (emails or dxusers)
@@ -52,8 +62,111 @@ def non_existing_emails
     invitees[:email] - existing_users.pluck(:email)
   end
 
+  # Validates if a current user is RSA. If yes, - then check, whether it is already a member.
+  # If yes, then validation passed.
+  # If no, the warning for RSA will display
+  def validate_space_admin
+    membership = space.space_memberships.active.find_by(user: current_user)
+
+    return unless current_user.review_space_admin? && membership.blank? &&
+                  !invitees[:dxuser].include?(current_user.dxuser)
+
+    errors.add(
+      :base,
+      "You must add your own account #{current_user.dxuser} as admin before " \
+        " you may add other members.",
+    )
+  end
+
   def validate_invitees
     errors.add(:invitees, "List of invitees is empty!") if invitees.values.flatten.blank?
+
+    return unless space.government?
+
+    # Check invitees for valid government emails
+    # N.B. the invite form allows both email and dxuser entries
+    invitees[:email].each do |email|
+      next if User.government_email?(email)
+
+      errors.add(
+        :base,
+        "Invitee #{email} is not a Government user",
+      )
+    end
+    invitees[:dxuser].each do |dxuser|
+      user = User.find_by(dxuser: dxuser)
+      next if User.government_email?(user.email)
+
+      errors.add(
+        :base,
+        "Invitee #{dxuser} is not a Government user",
+      )
+    end
+  end
+
+  # Validates a case to prevent a user from being added to both private and
+  #   shared areas of a review space
+  # @param side [String] a side selected by a client, provided from UI, when adding to shared area
+  # @param space [Space object] current space
+  # @return The validation result. Passed Ok or errors [Object] with a list of messages.
+  def validate_users_sides
+    members_ids_exist = []
+
+    if space.review?
+      if space.shared?
+        all_members = space.space_memberships.active
+
+        members = all_members.where(side: selected_side) if side
+        members_ids_exist = (all_members - members).pluck(:user_id) if members
+      else
+        shared_space = space.shared_space
+        space_members_ids = space.space_memberships.active.pluck(:user_id)
+        opposite_private_space = space.opposite_private_space(shared_space)
+        private_members_ids = opposite_private_space.space_memberships.active.pluck(:user_id)
+        members_ids_exist = space_members_ids + private_members_ids if private_members_ids
+      end
+    end
+
+    invalid_users = collect_invalid_users(members_ids_exist)
+
+    return if invalid_users.empty?
+
+    errors.add(
+      :base,
+      "The following users could not be added because they exist in other space side already: " \
+        "#{invalid_users.to_sentence}",
+    )
+  end
+
+  # Collects users ids, which are considered as invalid when a user is trying
+  #   to add them to space.
+  # @param members_ids_exist [Array of Integers] - array of users ids
+  # @param invitees [String] - string, contains added user's emails or dxusers,
+  #   separated by space or comma
+  # @return invalid_users [Array of Integers] - array of users ids
+  def collect_invalid_users(members_ids_exist)
+    invalid_users = []
+
+    invitees[:dxuser].each do |dxuser|
+      user = User.find_by(dxuser: dxuser)
+      invalid_users << user.dxuser if user && members_ids_exist.include?(user.id)
+    end
+    invitees[:email].each do |email|
+      user = User.find_by(email: email)
+      invalid_users << user.email if user && members_ids_exist.include?(user.id)
+    end
+
+    invalid_users
+  end
+
+  # Determines a proper Side in case of selected one by a user.
+  # @return selected_side [String] "host" or "guest"
+  def selected_side
+    if side == SpaceMembership::SIDE_HOST_ALIAS
+      SpaceMembership::SIDE_HOST
+    elsif side == SpaceMembership::SIDE_GUEST_ALIAS
+      SpaceMembership::SIDE_GUEST
+    end
   end
 
   def validate_dxusers
@@ -63,15 +176,17 @@ def validate_dxusers
 
     errors.add(
       :base,
-      "The following username's could not be added because they do not exist: " \
+      "The following usernames could not be added because they do not exist: " \
       "#{invalid_dxusers.to_sentence}",
     )
   end
 
   def check_emails_already_in_space
-    emails_in_space = (space.users & User.where(email: invitees[:email])).pluck(:email)
+    emails_in_space = space.
+      space_memberships.active.joins(:user).
+      where(users: { email: invitees[:email] }).pluck(:email)
 
-    return if emails_in_space.empty?
+    return if emails_in_space.blank?
 
     errors.add(
       :base,
@@ -81,9 +196,11 @@ def check_emails_already_in_space
   end
 
   def check_dxusers_already_in_space
-    dxusers_in_space = (space.users & User.where(dxuser: invitees[:dxuser])).pluck(:dxuser)
+    dxusers_in_space = space.
+      space_memberships.active.joins(:user).
+      where(users: { dxuser: invitees[:dxuser] }).pluck(:dxuser)
 
-    return if dxusers_in_space.empty?
+    return if dxusers_in_space.blank?
 
     errors.add(
       :base,
diff --git a/app/helpers/application_helper.rb b/app/helpers/application_helper.rb
index c01e39f50..4b2224dbd 100644
--- a/app/helpers/application_helper.rb
+++ b/app/helpers/application_helper.rb
@@ -1,8 +1,8 @@
 module ApplicationHelper
   include PathHelper
-  include VerifiedSpaceHelper
   include OrgService::RequestFilter
   include Rails.application.routes.url_helpers
+  # rubocop:disable Rails/HelperInstanceVariable
 
   def page_title(separator = " – ")
     [content_for(:title), 'precisionFDA'].compact.join(separator).html_safe
@@ -38,10 +38,10 @@ def humanize_seconds(secs)
   end
 
   def alert_help(text, path, prompt = "Need help?")
-    prompt = "<span class='pfda-help-prompt'>#{h(prompt)}</span>" if !prompt.blank?
+    prompt = "<span class='pfda-help-prompt alert-help-remediated'>#{h(prompt)}</span>" if !prompt.blank?
     raw """
     <div class='pfda-help-block'>
-      <span class='fa fa-question-circle' aria-hidden='true'></span>#{prompt}<a href='#{path}' target='_blank'>#{h(text)} <small class='external-link-indicator' aria-hidden='true'><span class='fa fa-external-link' ></span></small></a>
+      <span class='fa fa-question-circle' aria-hidden='true'></span>#{prompt}<a href='#{path}' class='review-doc-text' target='_blank'>#{h(text)} <small class='external-link-indicator' aria-hidden='true'><span class='fa fa-external-link' ></span></small></a>
     </div>
     """
   end
@@ -66,6 +66,8 @@ def fa_class(item)
     case item.klass
     when "file"
       "fa-file-o"
+    when "db-cluster"
+      "fa-database"
     when "note"
       "fa-sticky-note"
     when "answer"
@@ -95,41 +97,16 @@ def fa_class(item)
     end
   end
 
-  # Provide a node origin links to use on Home (Space) Files page
-  # @param node [Node] Node to get origin for.
-  # @return [String] - file link object node of type "UserFile"
-  def node_origin(node)
-    if node.klass == "folder"
-      nil
-    elsif node.parent_type == "Node" && node.parent.blank?
-      "Copied"
-    elsif node.parent_type != "User"
-      node_origin_link(unilinkfw(node.parent, { no_home: true }))
-    else
-      "Uploaded"
-    end
-  end
-
-  def node_origin_link(html_link)
-    parsed_html_link = Nokogiri::HTML(html_link)
-    parsed_a_element = parsed_html_link.at("a")
-    parsed_span_element = parsed_html_link.at("span")
-
-    origin_link = {}
-    origin_link[:href] = parsed_a_element["href"] if parsed_a_element
-    origin_link[:fa] = parsed_span_element.to_h["class"] if parsed_span_element
-    origin_link[:text] = parsed_html_link.text
-
-    origin_link
-  end
-
   # Valid options
   # icon_class: "fa-fw fa-2x"  # Appends to span class
   # scope_icon: true           # Displays scope icon instead of fa_class(item) as icon
   # title_class                # CSS class to apply to title
   # nolink: true               # Show a label, not a link
   # noicon: false              # Show/hide the icon
-  def unilink(item, opts = {})
+  # rubocop:disable Metrics/MethodLength
+  def unilink(item, opts = {}, context_user = nil)
+    current_user = opts[:current_user] || context_user
+
     return if item.nil?
 
     icon = fa_class(item)
@@ -149,25 +126,23 @@ def unilink(item, opts = {})
       icon_span = content_tag(:span, " ", class: "fa #{icon} #{opts[:icon_class]}") + " "
     end
 
-    # rubocop:disable Rails/HelperInstanceVariable
-    if item.check_accessibility(@context)
-      html_opts = { class: opts[:title_class] }
+    if item.check_accessibility(current_user)
+      html_opts = { class: opts[:title_class], target: opts[:target] }
       html_opts[:data] = opts[:data] if opts[:data]
       if opts[:nolink]
         icon_span + item.title.to_s
       else
-        link_to(icon_span + item.title.to_s, concat_path(item, opts[:no_home]), html_opts)
+        link_to(icon_span + item.title.to_s, home_path_to_item(item, opts[:no_home]), html_opts)
       end
     else
       icon_span + item.title.to_s # do not show item uid if unaccessible
     end
-    # rubocop:enable Rails/HelperInstanceVariable
   end
+  # rubocop:enable Metrics/MethodLength
 
   # Concat item path with '/home' to create a link to Home - for specific items
-  def concat_path(item, no_home = false)
-    if !no_home && (%w(file folder app app-series job
-                       asset workflow workflow-series).include? item.klass)
+  def home_path_to_item(item, no_home = false)
+    if !no_home && (%w(app app-series job workflow workflow-series).include? item.klass)
       "/home".concat(pathify(item))
     else
       pathify(item)
@@ -175,15 +150,20 @@ def concat_path(item, no_home = false)
   end
 
   # Shortcut for unilink(..., icon_class: fa-fw)
-  #
+
   def unilinkfw(item, opts = {})
+    current_user = opts[:current_user] || @context.user
+
     local_opts = opts.deep_dup
     if local_opts[:icon_class].present?
       local_opts[:icon_class] += " fa-fw"
     else
       local_opts[:icon_class] = "fa-fw"
     end
-    unilink(item, local_opts)
+    local_opts.merge!(data: { turbolinks: false })
+    local_opts.merge!(current_user: current_user)
+
+    unilink(item, local_opts, current_user)
   end
 
   def guest_hide
@@ -233,4 +213,5 @@ def inside_of_space_item?(space = nil)
       action_name == "show" &&
       space.present?
   end
+  # rubocop:enable Rails/HelperInstanceVariable
 end
diff --git a/app/helpers/files_helper.rb b/app/helpers/files_helper.rb
index 00eff5254..a5eec0021 100644
--- a/app/helpers/files_helper.rb
+++ b/app/helpers/files_helper.rb
@@ -3,8 +3,72 @@ module FilesHelper
   include ActionView::Helpers::UrlHelper
   include ApplicationHelper
 
+  # Get a node, mapped to attributes, used in /client on Space Files page,
+  # links crated for every node: UserFile or Folder.
+  # @param node [Node] Node to get origin for.
+  # @param space [Space] A space.
+  # @param current_user [User] A current_user.
+  # @return [Hash] An object of mapped node, to be used in /client
+  def client_file(node, space, current_user)
+    rename_path = if node.is_a?(UserFile)
+      api_file_path(node)
+    else
+      rename_folder_api_space_file_path(space, node)
+    end
+
+    {
+      id: node.id,
+      uid: node.uid,
+      name: ERB::Util.h(node.name),
+      type: node.is_a?(UserFile) ? "File" : node.sti_type,
+      org: node.user ? node.user.org.handle : "-",
+      added_by: node.user.dxuser,
+      file_size: node.is_a?(UserFile) ? number_to_human_size(node.file_size) : "",
+      created_at: node.created_at.strftime("%m/%d/%Y"),
+      created_at_date_time: node.created_at.strftime("%Y-%m-%d %H:%M:%S %Z"),
+      state: node.state,
+      tags: node.all_tags_list,
+      origin: node.is_a?(UserFile) ? node_origin(node, current_user) : "",
+      links: {}.tap do |links|
+        links[:filePath] = node.is_a?(UserFile) ? "/files/#{node.uid}" : ""
+        links[:user] = user_path(node.user.dxuser)
+        links[:renamePath] = rename_path if space.editable_by?(current_user)
+      end,
+    }
+  end
 
   def file_description(file)
     file.description.present? ? file.description : "This file has no description."
   end
+
+  # Provide a node origin links to use on Home (Space) Files page
+  # @param node [Node] Node to get origin for.
+  # @return [String] - file link object node of type "UserFile"
+  def node_origin(node, current_user)
+    if node.klass == "folder" && !node.https?
+      nil
+    elsif node.parent_type == "Node" && node.parent.blank?
+      "Copied"
+    elsif node.parent_type != "User"
+
+      node_origin_link(
+        unilinkfw(node.parent, { no_home: true, current_user: current_user }),
+      )
+    else
+      "Uploaded"
+    end
+  end
+
+  def node_origin_link(html_link)
+    parsed_html_link = Nokogiri::HTML(html_link)
+    parsed_a_element = parsed_html_link.at("a")
+    parsed_span_element = parsed_html_link.at("span")
+
+    origin_link = {}
+    origin_link[:href] = parsed_a_element["href"] if parsed_a_element
+    origin_link[:fa] = parsed_span_element.to_h["class"] if parsed_span_element
+    origin_link[:text] = parsed_html_link.text
+
+    origin_link
+  end
 end
diff --git a/app/helpers/main_helper.rb b/app/helpers/main_helper.rb
index 405570794..d474c9948 100644
--- a/app/helpers/main_helper.rb
+++ b/app/helpers/main_helper.rb
@@ -1,5 +1,6 @@
 module MainHelper
   include OrgAdmin
+  # rubocop:disable Rails/HelperInstanceVariable
 
   def graph_nodes(graph)
     s = ""
@@ -18,6 +19,7 @@ def graph_edges(graph)
     deps.each do |dep|
       s += graph_edges(dep)
       s += "g.setEdge(#{dep.uid.inspect}, #{item.uid.inspect}, {label: ''});\n"
+      # s += "g.setEdge(#{dep.uid.inspect}, #{item.dxid.inspect}, {label: ''});\n"
     end
     s
   end
@@ -37,6 +39,7 @@ def graph_nodes_recursive(nodes, graph)
     deps = graph.children
     # item is nil ...
     uid = item.uid
+    # uid = item.dxid
     unless nodes.has_key?(uid)
       if item.public?
         classname = 'public'
@@ -45,11 +48,19 @@ def graph_nodes_recursive(nodes, graph)
       else
         classname = item.user_id == @context.user_id ? 'own' : 'not_yours'
       end
-      nodes[uid] = {labelType: 'html', label: content_tag(:div, unilinkfw(item), class: 'track-box'), class: classname}
+      nodes[uid] = {
+        labelType: "html",
+        label: content_tag(
+          :div,
+          unilinkfw(item, { current_user: @context.user }),
+          class: "track-box",
+        ),
+        class: classname,
+      }
     end
     deps.each do |dep|
       graph_nodes_recursive(nodes, dep)
     end
   end
-
+  # rubocop:enable Rails/HelperInstanceVariable
 end
diff --git a/app/helpers/path_helper.rb b/app/helpers/path_helper.rb
index 630f6ff28..588e1a220 100644
--- a/app/helpers/path_helper.rb
+++ b/app/helpers/path_helper.rb
@@ -24,6 +24,8 @@ def pathify_comments(item)
       end
     when "app"
       app_comments_path(item)
+    when "db-cluster"
+      api_dbcluster_comments_path(item.dxid)
     when "job"
       job_comments_path(item)
     when "asset"
@@ -34,12 +36,8 @@ def pathify_comments(item)
       discussion_comments_path(item)
     when "answer"
       discussion_answer_comments_path(item.discussion, item.user.dxuser)
-    when "space"
-      space_comments_path(item)
     when "workflow"
       workflow_comments_path(item)
-    when "task"
-      space_task_comments_path(item.space_id, item)
     when "meta-appathon"
       meta_appathon_comments_path(item)
     when "appathon"
@@ -54,7 +52,7 @@ def pathify_comments(item)
   def pathify(item)
     case item.klass
     when "file"
-      file_path(item)
+      "/home/files/#{item.uid}"
     when "note"
       if item.note_type == "Answer"
         pathify(item.answer)
@@ -67,16 +65,14 @@ def pathify(item)
       app_path(item)
     when "app-series"
       pathify(item.latest_accessible(@context))
+    when "db-cluster"
+      "/home/databases/#{item.dxid}"
     when "job"
       job_path(item)
     when "asset"
-      asset_path(item)
+      "/home/assets/#{item.uid}"
     when "comment"
-      if item.commentable_type == 'Space'
-        discuss_space_path(item.commentable)
-      else
-        pathify_comments(item.commentable)
-      end
+      pathify_comments(item.commentable)
     when "comparison"
       comparison_path(item)
     when "discussion"
@@ -89,8 +85,6 @@ def pathify(item)
       license_path(item)
     when "space"
       _space_path(item)
-    when "task"
-      space_task_path(item.space_id, item)
     when "meta-appathon"
       meta_appathon_path(item)
     when "appathon"
@@ -115,12 +109,11 @@ def pathify(item)
   # @return [String] Folder's URL.
   def pathify_folder(folder)
     if folder.private?
-      files_path(folder_id: folder.id)
+      "/home/files?folderId=#{folder.id}"
     elsif folder.public?
-      explore_files_path(folder_id: folder.id)
+      "/home/files/everybody?folderId=#{folder.id}"
     elsif folder.in_space?
-      space = folder.space
-      api_files_path(space_id: space.id, folder_id: folder.id)
+      "/home/files/spaces?folderId=#{folder.id}"
     else
       raise "Unable to build folder's path"
     end
@@ -143,15 +136,11 @@ def pathify_comments_redirect(item)
       end
     when "workflow"
       return workflow_analyses_path(item) if request.referer =~ /analyses/
-
-      workflow_path(item)
-    when "space"
-      discuss_space_path(item)
-    when "task"
-      space_task_path(item.space_id, item)
-    when "expert", "expert-question", "meta-appathon", "appathon", "file", "app", "job", "asset",
-      "comparison", "answer", "folder"
+      concat_path(item)
+    when "expert", "expert-question", "meta-appathon", "appathon", "comparison", "answer"
       pathify(item)
+    when "file", "folder", "app", "job", "asset"
+      concat_path(item)
     else
       raise "Unknown class #{item.klass}"
     end
diff --git a/app/helpers/profile_helper.rb b/app/helpers/profile_helper.rb
index 39a01cbb8..3929b67d9 100644
--- a/app/helpers/profile_helper.rb
+++ b/app/helpers/profile_helper.rb
@@ -75,12 +75,4 @@ def remove_member_label(member)
       "Removing is approved"
     end
   end
-
-  def user_exists_attribute(invitation, attribute)
-    if invitation.user
-      User.user_helper_attribute(invitation.user_id, attribute)
-    else
-      invitation[attribute]
-    end
-  end
 end
diff --git a/app/helpers/recaptcha_helper.rb b/app/helpers/recaptcha_helper.rb
new file mode 100644
index 000000000..34ea860a9
--- /dev/null
+++ b/app/helpers/recaptcha_helper.rb
@@ -0,0 +1,32 @@
+# Helper function for validating ReCaptcha token in Enterprise Recaptcha verification flow
+module RecaptchaHelper
+  def verify_captcha_assessment(token, action, minimal_score = 0.7)
+    return true if Utils.development_or_test?
+
+    # rubocop:disable Layout/LineLength
+    uri = URI("https://recaptchaenterprise.googleapis.com/v1/projects/#{ENV['RECAPTCHA_PROJECT_ID']}/assessments?key=#{ENV['RECAPTCHA_API_KEY']}")
+    # rubocop:enable Layout/LineLength
+    site_key = ENV["RECAPTCHA_SITE_KEY"]
+
+    header = { "Content-Type": "application/json" }
+    body = {
+      event: {
+        token: token,
+        siteKey: site_key,
+        expectedAction: action,
+        },
+    }
+
+    http = Net::HTTP.new(uri.host, uri.port)
+    http.use_ssl = true
+    request = Net::HTTP::Post.new(uri.request_uri, header)
+    request.body = body.to_json
+
+    response = http.request(request)
+    result = JSON.parse(response.body)
+
+    result.dig("tokenProperties", "valid") &&
+      result.dig("tokenProperties", "action") == action &&
+      result.dig("riskAnalysis", "score") > minimal_score
+  end
+end
diff --git a/app/lib/cloud_resource_defaults.rb b/app/lib/cloud_resource_defaults.rb
new file mode 100644
index 000000000..548a09b54
--- /dev/null
+++ b/app/lib/cloud_resource_defaults.rb
@@ -0,0 +1,42 @@
+module CloudResourceDefaults
+  RESOURCES = %w(
+    baseline-2
+    baseline-4
+    hidisk-2
+    hidisk-4
+    himem-2
+    himem-4
+  ).freeze
+
+  PRICING_MAP = {
+    # Compute instances
+    "baseline-2" => 0.286,
+    "baseline-4" => 0.572,
+    "baseline-8" => 1.144,
+    "baseline-16" => 2.288,
+    "baseline-36" => 5.148,
+    "hidisk-2" => 0.372,
+    "hidisk-4" => 0.744,
+    "hidisk-8" => 1.488,
+    "hidisk-16" => 2.976,
+    "hidisk-36" => 6.696,
+    "himem-2" => 0.474,
+    "himem-4" => 0.948,
+    "himem-8" => 1.896,
+    "himem-16" => 3.792,
+    "himem-32" => 7.584,
+    "gpu-8" => 10.787,
+    # Db instances
+    "db_std1_x2" => 0.273,
+    "db_mem1_x2" => 0.967,
+    "db_mem1_x4" => 1.933,
+    "db_mem1_x8" => 3.867,
+    "db_mem1_x16" => 7.733,
+    "db_mem1_x32" => 15.467,
+    "db_mem1_x48" => 23.200,
+    "db_mem1_x64" => 30.933,
+  }.freeze
+
+  JOB_LIMIT = 100
+  TOTAL_LIMIT = 200
+end
diff --git a/app/lib/message.rb b/app/lib/message.rb
index 83686a5c9..222a75291 100644
--- a/app/lib/message.rb
+++ b/app/lib/message.rb
@@ -10,5 +10,9 @@ def not_found(content = "")
     def bad_request(error = "")
       ["Bad request", error].compact.join(" ")
     end
+
+    def can_not_serialize
+      "Record can not be serialized"
+    end
   end
 end
diff --git a/app/lib/salesforce_sender.rb b/app/lib/salesforce_sender.rb
index 45fffce03..45d17e6eb 100644
--- a/app/lib/salesforce_sender.rb
+++ b/app/lib/salesforce_sender.rb
@@ -20,7 +20,7 @@ def deliver!(mail)
           replyTo: mail_from,
           subject: mail.subject,
           htmlBody: mail.html_part.body,
-          orgWideEmailAddressId: org_wide_email_address_id(mail_from),
+          # orgWideEmailAddressId: org_wide_email_address_id(mail_from),
           fileAttachments: attachments(mail),
         },
       },
diff --git a/app/lib/uid_findable.rb b/app/lib/uid_findable.rb
index 92097cada..1942280e0 100644
--- a/app/lib/uid_findable.rb
+++ b/app/lib/uid_findable.rb
@@ -6,12 +6,13 @@ module UidFindable
   # @raise [ActiveRecord::RecordNotFound] If unable to find entity.
   # @return [Mixed] Found entity.
   def item_from_uid(uid, specified_klass = nil)
-    if uid =~ /^(job|app|file|workflow)-(.{24,})$/
+    if uid =~ /^(job|app|file|workflow|dbcluster)-(.{24,})$/
       klass = {
         "app" => App,
         "file" => UserFile,
         "job" => Job,
         "workflow" => Workflow,
+        "dbcluster" => DbCluster,
       }[$1]
 
       if specified_klass && klass != specified_klass
diff --git a/app/lib/utils.rb b/app/lib/utils.rb
new file mode 100644
index 000000000..4a96f1144
--- /dev/null
+++ b/app/lib/utils.rb
@@ -0,0 +1,25 @@
+# Collection of methods that can be used accross the whole project.
+module Utils
+  extend self
+
+  def aws_env?
+    Rails.env.production? || Rails.env.staging? || Rails.env.dev?
+  end
+
+  # rubocop:todo Rails/UnknownEnv
+  def development_or_test?
+    Rails.env.development? || Rails.env.test? || Rails.env.ui_test?
+  end
+  # rubocop:enable Rails/UnknownEnv
+
+  # Iterates an array with a delay between each iteration.
+  # @param collection [#each, #last] The collection to iterate on.
+  # @param delay [Integer|Float] The delay in seconds.
+  def each_with_delay(collection, delay = 1)
+    collection.each do |item|
+      yield item
+
+      sleep(delay) if item != collection.last
+    end
+  end
+end
diff --git a/app/mailers/notifications_mailer.rb b/app/mailers/notifications_mailer.rb
index 9a29c228a..74ba1f90d 100644
--- a/app/mailers/notifications_mailer.rb
+++ b/app/mailers/notifications_mailer.rb
@@ -1,8 +1,7 @@
 class NotificationsMailer < ApplicationMailer
-  add_template_helper(SpacesHelper)
   helper :application, :client_url
 
-  if ENV["DNANEXUS_BACKEND"] == "production"
+  if Rails.env.production?
     default  from: 'PrecisionFDA <PrecisionFDA@fda.hhs.gov>',
              reply_to: "PrecisionFDA@fda.hhs.gov"
   end
@@ -15,9 +14,7 @@ class NotificationsMailer < ApplicationMailer
   def invitation_email(invitation)
     @invitation = invitation
     recipients = ["precisionfda-support@dnanexus.com"]
-    if ENV["DNANEXUS_BACKEND"] == "production"
-      recipients << "precisionfda@fda.hhs.gov"
-    end
+    recipients << "precisionfda@fda.hhs.gov" if Rails.env.production?
 
     mail to: recipients,
          reply_to: "precisionfda-support@dnanexus.com",
@@ -58,7 +55,13 @@ def license_revoked_email(license, user)
 
   def space_activation_email(space, membership)
     @space = space
-    @membership = membership
+    @activation_request_lead =
+      if space.administrator?
+        membership.side_alias == "host" ? "creator" : "approver"
+      else
+        "#{membership.side_alias} #{membership.role}"
+      end
+    @leads_names = space.administrator? ? "creator and approver" : "host and guest"
     @user = membership.user
     mail to: @user.email,
          subject: "Action required to activate new space \"#{@space.title}\""
@@ -66,7 +69,6 @@ def space_activation_email(space, membership)
 
   def space_activated_email(space, membership)
     @space = space
-    @membership = membership
     @user = membership.user
     mail to: @user.email,
          subject: "Your space was activated: \"#{@space.title}\""
@@ -77,6 +79,7 @@ def space_invitation_email(space, membership, admin)
     @membership = membership
     @user = membership.user
     @admin = admin
+
     mail to: @user.email,
          reply_to: admin.user.email,
          subject: "#{admin.user.full_name} added you to the space \"#{space.title}\""
@@ -141,34 +144,6 @@ def new_expert_question_email(expert, question)
          subject: "A new question was submitted by \"#{name}\""
   end
 
-  def new_task_email(task)
-    @task = task
-    mail to: @task.assignee.email,
-         subject: "Task \"#{@task.name}\" was assigned to you"
-  end
-
-  def task_updated_email(task, receiver, action)
-    @task = task
-    @action = action
-    @receiver = receiver
-    @task_creator = @task.user.id == @receiver.id ? 'you' : @task.user.full_name
-    @task_assignee = @task.assignee.id == @receiver.id ? 'you' : @task.assignee.full_name
-    mail to: @receiver.email,
-         subject: "Task \"#{@task.name}\" was #{@action}"
-  end
-
-  def user_failed_to_acknowledge_task_email(task)
-    @task = task
-    mail to: @task.user.email,
-         subject: "User failed to ackowledge task \"#{@task.name}\""
-  end
-
-  def user_failed_to_complete_task_email(task)
-    @task = task
-    mail to: @task.user.email,
-         subject: "User failed to complete task \"#{@task.name}\" in time"
-  end
-
   def challenge_results(file, user_id, test_email=nil)
     @user = User.find(user_id)
 
@@ -177,9 +152,27 @@ def challenge_results(file, user_id, test_email=nil)
     }
 
     if test_email.present?
-      mail(to: test_email, from: 'notification@dnanexus.com', subject: "Results of NCI-CPTAC challenge")
+      mail(
+        to: test_email,
+        from: "notification@dnanexus.com",
+        subject: "Results of NCI-CPTAC challenge",
+      )
     else
       mail(to: @user.email, subject: "Results of NCI-CPTAC challenge")
     end
   end
+
+  def challenge_proposal_received(proposal)
+    recipients = CHALLENGE_PROPOSAL_RECIPIENTS.fetch(Rails.env.to_sym, [])
+
+    return if recipients.blank?
+
+    @subject = "[#{Rails.env.titleize}] New challenge proposal received from " \
+               "#{proposal[:name]} (#{proposal[:email]})"
+    @proposal = proposal
+
+    mail to: recipients,
+         reply_to: SUPPORT_EMAIL,
+         subject: @subject
+  end
 end
diff --git a/app/mailers/review_space_mailer.rb b/app/mailers/review_space_mailer.rb
index 8645fbf91..b39dd71d1 100644
--- a/app/mailers/review_space_mailer.rb
+++ b/app/mailers/review_space_mailer.rb
@@ -1,5 +1,5 @@
 class ReviewSpaceMailer < ApplicationMailer
-  helper :application, :spaces, :path, :client_url
+  helper :application, :path, :client_url
   default  from: 'PrecisionFDA <PrecisionFDA@fda.hhs.gov>',
            reply_to: "PrecisionFDA@fda.hhs.gov"
 
diff --git a/app/mailers/worker_mailer.rb b/app/mailers/worker_mailer.rb
index 6b79382e4..011304e27 100644
--- a/app/mailers/worker_mailer.rb
+++ b/app/mailers/worker_mailer.rb
@@ -1,6 +1,19 @@
 class WorkerMailer < ApplicationMailer
   helper :client_url
 
+  def node_copy_email(email, copies, scope)
+    not_copied_items = copies.reject(&:copied).map(&:object).group_by(&:class)
+    @not_copied_folders = not_copied_items[Folder]
+    @not_copied_files = Array(not_copied_items[UserFile]) + Array(not_copied_items[Asset])
+
+    space = Space.valid_scope?(scope) && Space.find(Space.scope_id(scope))
+    @destination = space.try(:title) || "#{scope} area"
+
+    @subject = "Some items haven't been copied to #{@destination}"
+
+    mail to: email, subject: @subject
+  end
+
   def remove_node_worker_email(email, space, error_message)
     @space = space
     @error_message = error_message
diff --git a/app/middleware/rack/permanent_redirect.rb b/app/middleware/rack/permanent_redirect.rb
index a42baec84..502d3844f 100644
--- a/app/middleware/rack/permanent_redirect.rb
+++ b/app/middleware/rack/permanent_redirect.rb
@@ -5,37 +5,25 @@ def initialize(app)
     end
 
     def call(env)
-      new_path = match_new_path(Rack::Request.new(env).path)
+      new_path = match_file_path(Rack::Request.new(env).path)
 
-      if new_path.present?
-        permanent_redirect(new_path)
-      else
-        @app.call(env)
-      end
+      return permanent_redirect(new_path) if new_path
+
+      @app.call(env)
     end
 
     private
 
-    def match_new_path(path)
-      match_file_path(path) || match_app_path(path)
-    end
-
+    # This redirect is only needed for truth challenge results page
     def match_file_path(path)
-      return unless path =~ /^\/files\/(file-.{24})$/
-
-      file = UserFile.find_by_dxid($1)
-      Rails.application.routes.url_helpers.file_path(file) if file.present?
-    end
-
-    def match_app_path(path)
-      return unless path =~ /^\/apps\/(app-.{24})$/
+      return unless path =~ %r{^/home/files/(file-.{24})$}
 
-      app = App.find_by_dxid($1)
-      Rails.application.routes.url_helpers.app_path(app) if app.present?
+      file = UserFile.find_by(dxid: Regexp.last_match(1))
+      "/home/files/#{file.uid}" if file
     end
 
     def permanent_redirect(location)
-      [301, { 'Location' => location, 'Content-Type' => 'text/html' }, ['Moved Permanently']]
+      [301, { "Location" => location, "Content-Type" => "text/html" }, ["Moved Permanently"]]
     end
   end
 end
diff --git a/app/models/accepted_license.rb b/app/models/accepted_license.rb
index 72ae17ca3..a61230a1b 100644
--- a/app/models/accepted_license.rb
+++ b/app/models/accepted_license.rb
@@ -13,23 +13,29 @@
 
 class AcceptedLicense < ApplicationRecord
   include Auditor
+
+  STATUS_ACTIVE = "active".freeze
+  STATUS_PENDING = "pending".freeze
+
   belongs_to :license
   belongs_to :user
   has_many :licensed_items, through: :license
 
   def pending?
-    state == 'pending'
+    state == STATUS_PENDING
   end
 
   def active?
-    state.nil? || state == 'active'
+    state.nil? || state == STATUS_ACTIVE
   end
 
-  def self.pending
-    where(state: 'pending')
-  end
+  class << self
+    def pending
+      where(state: STATUS_PENDING)
+    end
 
-  def self.active
-    where(state: [nil, 'active'])
+    def active
+      where(state: [nil, STATUS_ACTIVE])
+    end
   end
 end
diff --git a/app/models/analysis.rb b/app/models/analysis.rb
index 3f5dd88c7..e967b4184 100644
--- a/app/models/analysis.rb
+++ b/app/models/analysis.rb
@@ -24,10 +24,10 @@ class Analysis < ApplicationRecord
   belongs_to :user
   has_many :batch_items, class_name: "Analysis", foreign_key: :batch_id, primary_key: :batch_id
 
+  attr_accessor :current_user
+
   def batch_jobs
-    batch_items.map do |i|
-      i.jobs
-    end
+    batch_items.map(&:jobs)
   end
 
   def self.editable_by(context)
@@ -62,7 +62,7 @@ def self.batch_hash(analyses)
                  instance_type: job.resolved_instance_type,
                  energy_consumption: job.energy_string,
                  launched_by: job.user.full_name,
-                 location: ApplicationSerializer.new(job).location,
+                 location: job.location,
                  app_uid: job.app.uid,
                  app_title: job.app.title,
                  batch_id: batch_item.batch_id,
@@ -96,7 +96,7 @@ def self.job_hash(analyses, options={})
           instance_type: job.resolved_instance_type,
           energy_consumption: job.energy_string,
           launched_by: job.user.full_name,
-          location: ApplicationSerializer.new(job).location,
+          location: job.location,
           app_title: job.app.title,
           batch_id: analysis.batch_id,
           batch_children: options[:stop].nil? && analysis.batch_id.present? ? self.job_hash(analysis.batch_items, options.merge({stop: true})) : nil,
diff --git a/app/models/app.rb b/app/models/app.rb
index 0896de950..fa9104144 100644
--- a/app/models/app.rb
+++ b/app/models/app.rb
@@ -19,7 +19,9 @@
 #  uid           :string(255)
 #  dev_group     :string(255)
 #  release       :string(255)      not null
+#  entity_type   :integer          default("regular"), not null
 #  featured      :boolean          default(FALSE)
+#  deleted       :boolean          default(FALSE), not null
 #
 
 class App < ApplicationRecord
@@ -28,10 +30,14 @@ class App < ApplicationRecord
   include CommonPermissions
   include InternalUid
   include Featured
+  include ObjectLocation
   include Scopes
   include SoftRemovable
   include TagsContainer
 
+  TYPE_REGULAR = "regular".freeze
+  TYPE_HTTPS = "https".freeze
+
   belongs_to :user
   has_one :org, through: :user
 
@@ -56,6 +62,11 @@ class App < ApplicationRecord
 
   VALID_IO_CLASSES = %w(file string boolean int float).freeze
 
+  enum entity_type: {
+    TYPE_REGULAR => 0,
+    TYPE_HTTPS => 1,
+  }
+
   def to_param
     uid
   end
@@ -64,9 +75,9 @@ def to_param
   # Jobs are serialized.
   #  @param context [Context] The user context.
   #  @return jobs [Array of serialized Job objects.
-  def editable_jobs(context)
+  def accessible_jobs(context)
     app_series.jobs.
-      editable_by(context).
+      accessible_by(context).
       includes(:taggings).
       order(created_at: :desc).
       map { |job| JobSerializer.new(job) }
@@ -87,7 +98,7 @@ def space_scopes
   # Check whether app is not in space of any type
   # @return [true, false]
   def not_in_spaces
-    !in_space? || !space_object.review? && !space_object.verification? && !space_object.groups?
+    !in_space? || Space::TYPES.exclude?(space_object.space_type)
   end
 
   # Scopes that can be used to run an app.
diff --git a/app/models/app/cwl_parser/code_generator.rb b/app/models/app/cwl_parser/code_generator.rb
index b33ab77b1..7702d7c30 100644
--- a/app/models/app/cwl_parser/code_generator.rb
+++ b/app/models/app/cwl_parser/code_generator.rb
@@ -55,8 +55,10 @@ def setup_python3
             source venv/bin/activate
 
             # Upgrade Pip to the latest and install CWLtool
-            pip install -U pip
-            pip install cwltool
+            apt-get update
+            apt-get install python3-pip
+            python3 -m pip install pip==20.0.2
+            pip3 install cwltool
           CODE
         end
 
diff --git a/app/models/app_series.rb b/app/models/app_series.rb
index 2312bd49b..2a3cc16b6 100644
--- a/app/models/app_series.rb
+++ b/app/models/app_series.rb
@@ -12,6 +12,8 @@
 #  created_at             :datetime         not null
 #  updated_at             :datetime         not null
 #  verified               :boolean          default(FALSE), not null
+#  featured               :boolean          default(FALSE)
+#  deleted                :boolean          default(FALSE), not null
 #
 
 class AppSeries < ApplicationRecord
diff --git a/app/models/appathon.rb b/app/models/appathon.rb
index c5fad372f..3661789e3 100644
--- a/app/models/appathon.rb
+++ b/app/models/appathon.rb
@@ -83,6 +83,6 @@ def self.active
   end
 
   def rename(new_name, context)
-    update_attributes(name: new_name)
+    update(name: new_name)
   end
 end
diff --git a/app/models/asset.rb b/app/models/asset.rb
index 485c5dc2a..3f26b4c20 100644
--- a/app/models/asset.rb
+++ b/app/models/asset.rb
@@ -20,6 +20,7 @@
 #  scoped_parent_folder_id :integer
 #  uid                     :string(255)
 #  featured                :boolean          default(FALSE)
+#  entity_type             :integer          default("regular"), not null
 #
 
 #
diff --git a/app/models/challenge.rb b/app/models/challenge.rb
index 6bf4c47f2..2b246cdbb 100644
--- a/app/models/challenge.rb
+++ b/app/models/challenge.rb
@@ -2,29 +2,33 @@
 #
 # Table name: challenges
 #
-#  id              :integer          not null, primary key
-#  name            :string(255)
-#  admin_id        :integer
-#  app_owner_id    :integer
-#  app_id          :integer
-#  description     :text(65535)
-#  meta            :text(65535)
-#  start_at        :datetime
-#  end_at          :datetime
-#  created_at      :datetime         not null
-#  updated_at      :datetime         not null
-#  status          :string(255)
-#  automated       :boolean          default(TRUE)
-#  card_image_url  :string(255)
-#  card_image_id   :string(255)
-#  specified_order :integer
-#  space_id        :integer
+#  id                   :integer          not null, primary key
+#  name                 :string(255)
+#  admin_id             :integer
+#  app_owner_id         :integer
+#  app_id               :integer
+#  description          :text(65535)
+#  meta                 :text(16777215)
+#  start_at             :datetime
+#  end_at               :datetime
+#  created_at           :datetime         not null
+#  updated_at           :datetime         not null
+#  status               :string(255)
+#  automated            :boolean          default(TRUE)
+#  card_image_url       :string(255)
+#  card_image_id        :string(255)
+#  space_id             :integer
+#  specified_order      :integer
+#  scope                :string(255)      default("public"), not null
+#  pre_registration_url :string(255)
 #
 
 class Challenge < ApplicationRecord
+  paginates_per 5
   include Auditor
 
   STATUS_SETUP =    "setup".freeze
+  STATUS_PRE_REGISTRATION = "pre-registration".freeze
   STATUS_OPEN =     "open".freeze
   STATUS_PAUSED =   "paused".freeze
   STATUS_ARCHIVED = "archived".freeze
@@ -41,6 +45,17 @@ class Challenge < ApplicationRecord
   acts_as_followable
 
   after_create :initialize_order
+  after_save :send_email_on_open,
+             if: proc { |ch|
+                   [
+                     STATUS_SETUP,
+                     STATUS_PRE_REGISTRATION,
+                   ].include?(ch.status_previous_change&.first) &&
+                     ch.status_previous_change&.last == STATUS_OPEN
+                 }
+
+  after_save :send_email_on_prereg,
+             if: proc { |ch| ch.status_previous_change&.last == STATUS_PRE_REGISTRATION }
 
   attr_accessor :replacement_id
   store :meta, accessors: [:regions], coder: JSON
@@ -67,18 +82,28 @@ class Challenge < ApplicationRecord
   validates :status, inclusion: { in: ->(challenge) { challenge.available_statuses } }
   validates :meta, meta: true
   validates :app_id,
+            presence: { message: "The scoring app user must select an app for the challenge first" },
+            unless: :status_setup_or_pre_registration?
+  validates :pre_registration_url,
             presence: true,
-            unless: :status_setup?
+            if: :status_pre_registration?
   validate :validate_end_at
   validate :validate_start_at
-  validate :can_open?
+  validate :can_open?, if: :status_open?
   validate :scope_should_be_valid
 
   attr_accessor :host_lead_dxuser, :guest_lead_dxuser
 
   class << self
     def available_statuses
-      [STATUS_SETUP, STATUS_OPEN, STATUS_PAUSED, STATUS_ARCHIVED, STATUS_RESULT_ANNOUNCED]
+      [
+        STATUS_SETUP,
+        STATUS_PRE_REGISTRATION,
+        STATUS_OPEN,
+        STATUS_PAUSED,
+        STATUS_ARCHIVED,
+        STATUS_RESULT_ANNOUNCED,
+      ]
     end
 
     def add_app_dev(context, challenge_id, app_id)
@@ -97,10 +122,6 @@ def add_app_dev(context, challenge_id, app_id)
       result
     end
 
-    def featured(context)
-      accessible_by(context).order(specified_order: "desc")
-    end
-
     def app_owned_by(context)
       return none unless context.logged_in?
 
@@ -145,14 +166,28 @@ def accessible_by?(context)
     self.class.accessible_by(context).exists?(id)
   end
 
-  def editable_by?(context)
-    context.challenge_admin?
+  def editable_by?(context_or_user)
+    user = context_or_user.is_a?(User) ? context_or_user : context_or_user.user
+
+    user.site_or_challenge_admin?
+  end
+
+  def space_member?(user)
+    space&.space_memberships&.map(&:user_id)&.include?(user.id)
   end
 
   def status_setup?
     status == STATUS_SETUP
   end
 
+  def status_pre_registration?
+    status == STATUS_PRE_REGISTRATION
+  end
+
+  def status_setup_or_pre_registration?
+    status == STATUS_SETUP || status == STATUS_PRE_REGISTRATION
+  end
+
   def status_open?
     status == STATUS_OPEN
   end
@@ -178,11 +213,11 @@ def state
   end
 
   def available_statuses
-    return [STATUS_SETUP] if new_record?
+    return [STATUS_SETUP, STATUS_PRE_REGISTRATION] if new_record?
     return [STATUS_RESULT_ANNOUNCED, STATUS_ARCHIVED, status].uniq if over?
     return [STATUS_OPEN, STATUS_PAUSED, status].uniq if started?
 
-    [STATUS_OPEN, STATUS_PAUSED, status].uniq
+    [STATUS_SETUP, STATUS_PRE_REGISTRATION, STATUS_OPEN, STATUS_PAUSED, status].uniq
   end
 
   # not available statuses for select!
@@ -220,7 +255,7 @@ def can_announce_result?
   def can_assign_specific_app?(context, checked_app)
     if !context.logged_in? ||
        over? ||
-       ![STATUS_PAUSED, STATUS_SETUP].include?(status) ||
+       ![STATUS_PAUSED, STATUS_SETUP, STATUS_PRE_REGISTRATION].include?(status) ||
        app_owner != context.user ||
        app_id == checked_app.id
       false
@@ -290,18 +325,14 @@ def provision_space!(context, host_lead_dxuser, guest_lead_dxuser)
       description: description,
       host_lead_dxuser: host_lead_dxuser,
       guest_lead_dxuser: guest_lead_dxuser,
-      space_type: "groups",
+      space_type: SpaceForm::TYPE_GROUPS,
     )
 
-    space = SpaceService::Create.call(space_form, api: context.api, user: context.user)
-    membership = space.space_memberships.find_by(user_id: space.host_lead.id)
-
-    SpaceService::Invite.call(
-      context.api,
-      space,
-      membership,
-      User.find_by(dxuser: CHALLENGE_BOT_DX_USER),
-      SpaceMembership::ROLE_ADMIN,
+    space = SpaceService::Create.call(
+      space_form,
+      api: context.api,
+      user: context.user,
+      for_challenge: true,
     )
 
     update!(space: space)
@@ -315,6 +346,18 @@ def initialize_order
     self.specified_order = id
   end
 
+  def send_email_on_open
+    email_type_id = NotificationPreference.email_types[:notification_challenge_opened]
+    client = DIContainer.resolve("https_apps_client")
+    client.email_send(email_type_id, { challengeId: id })
+  end
+
+  def send_email_on_prereg
+    email_type_id = NotificationPreference.email_types[:notification_challenge_preregister]
+    client = DIContainer.resolve("https_apps_client")
+    client.email_send(email_type_id, { challengeId: id, scope: scope, name: name })
+  end
+
   def validate_end_at
     return unless end_at_changed?
     return if end_at.blank?
@@ -346,4 +389,4 @@ def scope_should_be_valid
 
     errors.add(:scope, "can be either 'public' or 'space-x")
   end
-end
\ No newline at end of file
+end
diff --git a/app/models/challenge_resource.rb b/app/models/challenge_resource.rb
index 45d55ac38..f049ce7d6 100644
--- a/app/models/challenge_resource.rb
+++ b/app/models/challenge_resource.rb
@@ -44,7 +44,7 @@ def editable_by?(context)
   def rename(new_name, context)
     if editable_by?(context)
       DNAnexusAPI.new(CHALLENGE_BOT_TOKEN).call(dxid, "rename", {project: CHALLENGE_BOT_PRIVATE_FILES_PROJECT, name: new_name})
-      user_file.update_attributes(name: new_name)
+      user_file.update(name: new_name)
     else
       false
     end
diff --git a/app/models/comment.rb b/app/models/comment.rb
index 62d1df8e4..1d26eeebd 100644
--- a/app/models/comment.rb
+++ b/app/models/comment.rb
@@ -44,6 +44,19 @@ class Comment < ApplicationRecord
 
   enum state: STATES
 
+  # Helper class method to lookup all comments assigned
+  # to all commentable types for a given user.
+  scope :find_comments_by_user, lambda { |user|
+    where(user_id: user.id).order("created_at DESC")
+  }
+
+  # Helper class method to look up all comments for
+  # commentable class name and commentable id.
+  scope :find_comments_for_commentable, lambda { |commentable_str, commentable_id|
+    where(commentable_type: commentable_str.to_s, commentable_id: commentable_id).
+      order("created_at DESC")
+  }
+
   # Helper class method that allows you to build a comment
   # by passing a commentable object, a user_id, and comment text
   # example in readme
@@ -54,31 +67,19 @@ def self.build_from(obj, user_id, comment)
       :user_id     => user_id
   end
 
+  # Helper class method to look up a commentable object
+  # given the commentable class name and id
+  def self.find_commentable(commentable_str, commentable_id)
+    commentable_str.constantize.find(commentable_id)
+  end
+
   def klass
-    'comment'
+    "comment"
   end
 
   #helper method to check if a comment has children
   def has_children?
-    self.children.any?
-  end
-
-  # Helper class method to lookup all comments assigned
-  # to all commentable types for a given user.
-  scope :find_comments_by_user, lambda { |user|
-    where(:user_id => user.id).order('created_at DESC')
-  }
-
-  # Helper class method to look up all comments for
-  # commentable class name and commentable id.
-  scope :find_comments_for_commentable, lambda { |commentable_str, commentable_id|
-    where(:commentable_type => commentable_str.to_s, :commentable_id => commentable_id).order('created_at DESC')
-  }
-
-  # Helper class method to look up a commentable object
-  # given the commentable class name and id
-  def self.find_commentable(commentable_str, commentable_id)
-    commentable_str.constantize.find(commentable_id)
+    children.any?
   end
 
   def content_object_name
@@ -91,9 +92,6 @@ def in_space?
   end
 
   def mentioned_users
-    User.where(
-      dxuser: body.scan(/\@([^[:space:]]*)/)
-    )
+    User.where(dxuser: body.scan(/@([^[:space:]]*)/))
   end
-
 end
diff --git a/app/models/comparison.rb b/app/models/comparison.rb
index fec2d858b..bbd07ce84 100644
--- a/app/models/comparison.rb
+++ b/app/models/comparison.rb
@@ -102,7 +102,7 @@ def publishable_by?(context, _scope_to_publish_to)
   end
 
   def rename(new_name, description, context)
-    update_attributes(name: new_name, description: description)
+    update(name: new_name, description: description)
   end
 
   def self.publication_project!(context, scope)
diff --git a/app/models/concerns/common_permissions.rb b/app/models/concerns/common_permissions.rb
index d02f461cb..c2e0433ea 100644
--- a/app/models/concerns/common_permissions.rb
+++ b/app/models/concerns/common_permissions.rb
@@ -7,10 +7,11 @@ module CommonPermissions
   # An object can be: app, workflow, job and space
   # analog of item.accessible_by?(@context) ||
   # @return [Boolean] Returns true if object is accessible by a user, false otherwise.
-  def check_accessibility(context)
-    accessible_by_user?(context) ||
+  def check_accessibility(current_user)
+    accessible_by_user?(current_user) ||
       (try(:user).try(:dxuser) == CHALLENGE_BOT_DX_USER &&
-        context.logged_in? &&
-        context.user.is_challenge_evaluator?)
+        current_user.logged_in? &&
+        current_user.is_challenge_evaluator?
+      )
   end
 end
diff --git a/app/models/concerns/enum_sortable.rb b/app/models/concerns/enum_sortable.rb
new file mode 100644
index 000000000..02af7b80e
--- /dev/null
+++ b/app/models/concerns/enum_sortable.rb
@@ -0,0 +1,23 @@
+# Contains the method for enum columns ordering.
+module EnumSortable
+  extend ActiveSupport::Concern
+
+  # Class methods
+  module ClassMethods
+    def order_by_enum_query(field, dir, enum_hash = nil)
+      query = "CASE "
+      query += (enum_hash || send(field.to_s.pluralize)).
+        sort_by { |name, _| name }.each_with_index.map do |(_, val), idx|
+          "WHEN #{field}='#{val}' THEN #{idx}"
+        end.join(" ")
+      query += " END #{dir}"
+      query
+    end
+  end
+
+  included do
+    scope :order_by_enum, lambda { |field, dir|
+      order(Arel.sql(order_by_enum_query(field, dir)))
+    }
+  end
+end
diff --git a/app/models/concerns/files_syncing.rb b/app/models/concerns/files_syncing.rb
new file mode 100644
index 000000000..e34be2b14
--- /dev/null
+++ b/app/models/concerns/files_syncing.rb
@@ -0,0 +1,155 @@
+# Contains files syncing methods.
+module FilesSyncing
+  extend ActiveSupport::Concern
+
+  # Class methods.
+  module ClassMethods
+    FILES_CHUNK_SIZE = 1000
+
+    SYNC_EXCLUDED_FILE_STATES = [
+      UserFile::STATE_CLOSED,
+      UserFile::STATE_COPYING,
+      UserFile::STATE_REMOVING,
+    ].freeze
+
+    def sync_files!(context)
+      return if context.guest?
+
+      user = context.user
+
+      Auditor.suppress do
+        files = user.uploaded_files.where.not(state: SYNC_EXCLUDED_FILE_STATES).all
+        sync_many_files(files, user, context.api)
+      end
+    end
+
+    def sync_challenge_bot_files!(context)
+      return if context.guest?
+
+      user = User.challenge_bot
+      files = user.uploaded_files.where.not(state: SYNC_EXCLUDED_FILE_STATES).all
+      sync_many_files(files, user, DNAnexusAPI.for_challenge_bot)
+    end
+
+    def sync_asset!(context, file_id)
+      return if context.guest?
+
+      user = context.user
+      file = user.assets.find(file_id) # Re-check file id
+
+      return if SYNC_EXCLUDED_FILE_STATES.include?(file.state)
+
+      result = find_files_on_platform([file.dxid], file.project, context.api).first
+
+      sync_file_state(result, file, user)
+    end
+
+    def sync_assets!(context)
+      return if context.guest?
+
+      user = context.user
+      assets = user.assets.where.not(state: SYNC_EXCLUDED_FILE_STATES).all
+
+      sync_many_files(assets, user, context.api)
+    end
+
+    def sync_challenge_file!(file_id)
+      user = User.challenge_bot
+      file = user.uploaded_files.find(file_id) # Re-check file id
+
+      return if SYNC_EXCLUDED_FILE_STATES.include?(file.state)
+
+      api = DNAnexusAPI.for_challenge_bot
+      result = find_files_on_platform([file.dxid], file.project, api).first
+      sync_file_state(result, file, user)
+    end
+
+    def sync_file!(context, file_id)
+      return if context.guest?
+
+      user = context.user
+      file = user.uploaded_files.find(file_id) # Re-check file id
+
+      return if SYNC_EXCLUDED_FILE_STATES.include?(file.state)
+
+      result = find_files_on_platform([file.dxid], file.project, context.api).first
+      sync_file_state(result, file, user)
+    end
+
+    def sync_file_state(result, file, user)
+      return remove_local_file(file, user) unless result
+
+      remote_state = result[:describe][:state]
+      return if remote_state == file.state
+
+      UserFile.transaction do
+        old_file_state = file.state
+        file.reload
+
+        return if remote_state == file.state
+
+        logger.debug("SyncFilesState: update file #{file.uid} by user #{user.dxuser} " \
+                     "from state #{file.state} to #{remote_state}")
+
+        if remote_state == UserFile::STATE_CLOSED
+          file.update!(state: remote_state, file_size: result[:describe][:size])
+          Event::FileCreated.create_for(file, user)
+          logger.debug("SyncFilesState: created new file #{file.uid}")
+        elsif (remote_state == UserFile::STATE_CLOSING && file.state == UserFile::STATE_OPEN) ||
+              remote_state == UserFile::STATE_ABANDONED
+          file.update!(state: remote_state)
+          logger.debug("SyncFilesState: updated file state to #{file.state} from #{remote_state}")
+        else
+          # NOTE we should never be here
+          raise "SyncFilesState: File #{file.uid} had local state #{file.state} " \
+                "(previously #{old_file_state}) and remote state #{remote_state}"
+        end
+      end
+    end
+
+    # Syncs multiple files or assets grouped by a project using findDataObjects platform call.
+    def sync_many_files(files, user, api)
+      files.group_by(&:project).each do |project, project_files|
+        project_files.each_slice(FILES_CHUNK_SIZE) do |files_chunk|
+          results = find_files_on_platform(files_chunk.map(&:dxid), project, api)
+
+          files_chunk.each do |file|
+            res = results.find { |r| r[:id] == file.dxid }
+            # means that file doesn't exist on the platform anymore
+            remove_local_file(file, user) unless res
+            sync_file_state(res, file, user)
+          end
+        end
+      end
+    end
+
+    # File was deleted by the DNAnexus stale file daemon; delete it on our end as well
+    def remove_local_file(file, user)
+      logger.debug("removing local file #{file.uid} by user #{user.dxuser}")
+      UserFile.transaction do
+        # Use find_by(file.id) since file.reload may raise ActiveRecord::RecordNotFound
+        file = UserFile.find_by(id: file.id)
+        return unless file
+
+        Event::FileDeleted.create_for(file, user)
+        file.destroy!
+      end
+    end
+
+    def find_files_on_platform(dxids, project, api)
+      api.system_find_data_objects(
+        id: dxids,
+        scope: { project: project },
+        class: "file",
+        describe: true,
+      )[:results]
+    end
+  end
+
+  included do
+    private_class_method :sync_many_files
+    private_class_method :sync_file_state
+    private_class_method :remove_local_file
+    private_class_method :find_files_on_platform
+  end
+end
diff --git a/app/models/concerns/jobs_syncing.rb b/app/models/concerns/jobs_syncing.rb
new file mode 100644
index 000000000..a355dc49c
--- /dev/null
+++ b/app/models/concerns/jobs_syncing.rb
@@ -0,0 +1,208 @@
+# Contains jobs syncing methods.
+# rubocop:todo Metrics/ModuleLength
+module JobsSyncing
+  extend ActiveSupport::Concern
+
+  # Class methods.
+  module ClassMethods
+    def sync_challenge_job!(job_id)
+      user = User.challenge_bot
+      job = user.jobs.find(job_id) # Re-check job id
+
+      return if job.terminal? || job.https?
+
+      api = DIContainer.resolve("api.challenge_bot")
+
+      result = api.system_find_jobs(
+        includeSubjobs: false,
+        id: [job.dxid],
+        project: user.private_files_project,
+        parentJob: nil,
+        parentAnalysis: nil,
+        describe: true,
+      )["results"].first
+
+      sync_job_state(result, job, user, api)
+    end
+
+    def sync_job!(context, job_id)
+      return if context.guest?
+
+      job = Job.accessible_by(context).find(job_id) # Re-check job id
+      return if job.terminal? || job.https?
+
+      user = context.user
+      api = DIContainer.resolve("api.user")
+
+      result = api.system_find_jobs(
+        includeSubjobs: false,
+        id: [job.dxid],
+        project:  job.project || user.private_files_project,
+        parentJob: nil,
+        parentAnalysis: job.analysis.try(:dxid),
+        describe: true,
+      )["results"].first
+
+      return if result.blank?
+
+      sync_job_state(result, job, user, api)
+    end
+
+    def sync_jobs!(context, jobs = Job.includes(:analysis), project = nil)
+      return if context.guest?
+
+      logger.debug("syncing jobs with context #{context.inspect}")
+      user = context.user
+      api = DIContainer.resolve("api.user")
+
+      # Prefer "all.each_slice" to "find_batches" as the latter might not be transaction-friendly
+      jobs.regular.where(user_id: user.id).
+        where.not(state: Job::TERMINAL_STATES).
+        limit(SYNC_JOBS_LIMIT).
+        each_slice(1000) do |jobs_batch|
+        jobs_hash = jobs_batch.map { |job| [job.dxid, job] }.to_h
+
+        jobs_hash.each_key do |job_dxid|
+          job_project = project || Job.find_by(dxid: job_dxid).project
+
+          response = api.system_find_jobs(
+            includeSubjobs: false,
+            id: [job_dxid],
+            project: job_project || user.private_files_project,
+            parentJob: nil,
+            describe: true,
+          )
+
+          response["results"].each do |result|
+            next if result.blank?
+
+            sync_job_state(result, jobs_hash[result["id"]], user, api)
+          end
+        end
+      end
+    end
+
+    def sync_challenge_jobs!
+      user = User.challenge_bot
+      api = DIContainer.resolve("api.challenge_bot")
+
+      # Prefer "all.each_slice" to "find_batches" as the latter might not be transaction-friendly
+      Job.regular.where(user_id: user.id).
+        where.not(state: Job::TERMINAL_STATES).all.each_slice(1000) do |jobs|
+        jobs_hash = jobs.map { |job| [job.dxid, job] }.to_h
+
+        api.system_find_jobs(
+          includeSubjobs: false,
+          id: jobs_hash.keys,
+          project: CHALLENGE_BOT_PRIVATE_FILES_PROJECT,
+          parentJob: nil,
+          parentAnalysis: nil,
+          describe: true,
+        )["results"].each do |result|
+          sync_job_state(result, jobs_hash[result["id"]], user, api)
+        end
+      end
+    end
+
+    # rubocop:todo Metrics/MethodLength
+    def sync_job_state(result, job, user, api)
+      logger.debug("syncing state #{result.inspect} for job id #{job.uid} by user #{user.dxuser}")
+      state = result["describe"]["state"]
+      # Only do anything if local job state is stale
+      return if state == job.state
+
+      if state == Job::STATE_DONE
+        # Use serialization to deep copy result since output will be modified
+        output = JSON.parse(result["describe"]["output"].to_json)
+        output_file_ids = []
+        output_file_cache = []
+        output.each_key do |key|
+          # TODO: handle arrays later
+          raise if output[key].is_a?(Array)
+          next unless output[key].is_a?(Hash)
+          raise unless output[key].key?("$dnanexus_link")
+
+          output_file_id = output[key]["$dnanexus_link"]
+          output_file_ids << output_file_id
+          output[key] = output_file_id
+        end
+        output_file_ids.uniq!
+        output_file_ids.each_slice(1000) do |slice_of_file_ids|
+          api.system_describe_data_objects(slice_of_file_ids)["results"].
+            each_with_index do |api_result, i|
+            # Push avoids creating a new array as opposed to +/+=
+            output_file_cache.push(
+              dxid: slice_of_file_ids[i],
+              project: job.project || user.private_files_project,
+              name: api_result["describe"]["name"],
+              state: "closed",
+              description: "",
+              user_id: user.id,
+              scope: job.scope || "private",
+              file_size: api_result["describe"]["size"],
+              parent: job,
+              parent_folder_id: job.local_folder_id,
+            )
+          end
+        end
+
+        # Job is done and outputs need to be created
+        Job.transaction do
+          job.reload
+          if state != job.state
+            output_file_cache.each do |output_file|
+              user_file = UserFile.create!(output_file)
+              if user_file.scope =~ /^space-(\d+)$/
+                user_file.update(scoped_parent_folder_id: user_file.parent_folder_id)
+              end
+              Event::FileCreated.create_for(user_file, user)
+            end
+            job.run_outputs = output
+            job.state = state
+            job.describe = result["describe"]
+            job.save!
+            Event::JobClosed.create_for(job, user)
+          end
+        end
+
+        if job.scope =~ /^space-(\d+)$/
+          SpaceEventService.call(Regexp.last_match(1).to_i, user.id, nil, job, :job_completed)
+        end
+
+        send_job_email(job.id, NotificationPreference.email_types[:notification_job_done])
+      else
+        if state == Job::STATE_FAILED
+          # Job failed, so we need to log this
+          logger.info "Job #{job.id} failed: " \
+                      "failureReason: #{result['describe']['failureReason']}, " \
+                      "failureMessage: #{result['describe']['failureMessage']}"
+
+          send_job_email(job.id, NotificationPreference.email_types[:notification_job_failed])
+        end
+
+        # Job state changed but not done (no outputs)
+        Job.transaction do
+          job.reload
+          if state != job.state
+            job.state = state
+            job.describe = result["describe"]
+            job.save!
+            Event::JobClosed.create_for(job, user)
+          end
+        end
+      end
+    end
+    # rubocop:enable Metrics/MethodLength
+
+    def send_job_email(job_id, email_type_id)
+      client = DIContainer.resolve("https_apps_client")
+      client.email_send(email_type_id, { jobId: job_id })
+    end
+  end
+
+  included do
+    private_class_method :sync_job_state
+    private_class_method :send_job_email
+  end
+end
+# rubocop:enable Metrics/ModuleLength
diff --git a/app/models/concerns/licenses.rb b/app/models/concerns/licenses.rb
index 09844d12d..9861a56d8 100644
--- a/app/models/concerns/licenses.rb
+++ b/app/models/concerns/licenses.rb
@@ -20,6 +20,14 @@ def licensed_by?(context)
     end
   end
 
+  # Check license status, whether it is 'active' or 'pending'
+  # @param user [User object]
+  # @param status [String]
+  # @return true or false - depends upon match status given
+  def license_status?(user, status)
+    accepted_licenses.exists?(user_id: user.id, state: [nil, status])
+  end
+
   def licensed_by_set?(context)
     if context.guest?
       false
diff --git a/app/models/concerns/object_location.rb b/app/models/concerns/object_location.rb
new file mode 100644
index 000000000..0a3d3daf1
--- /dev/null
+++ b/app/models/concerns/object_location.rb
@@ -0,0 +1,19 @@
+# Contains object location method.
+module ObjectLocation
+  extend ActiveSupport::Concern
+
+  # Returns object's location - its scope
+  # @return [String] Scope - a value on of: 'public', 'private' or 'space-xxx'.
+  #   Scope or Space name are titleized.
+  def location
+    return scope.titleize unless in_space?
+
+    space = space_object
+
+    if space.confidential?
+      "#{space.name} - Private"
+    else
+      "#{space.name} - Shared"
+    end
+  end
+end
diff --git a/app/models/db_cluster.rb b/app/models/db_cluster.rb
new file mode 100644
index 000000000..e8df4250b
--- /dev/null
+++ b/app/models/db_cluster.rb
@@ -0,0 +1,103 @@
+# == Schema Information
+#
+# Table name: dbclusters
+#
+#  id                :bigint           not null, primary key
+#  dxid              :string(255)      not null
+#  name              :string(255)      not null
+#  status            :integer          not null
+#  scope             :string(255)      not null
+#  user_id           :integer          not null
+#  project           :string(255)      not null
+#  dx_instance_class :string(255)      not null
+#  engine            :integer          not null
+#  engine_version    :string(255)      not null
+#  host              :string(255)
+#  port              :string(255)
+#  description       :string(255)
+#  status_as_of      :datetime
+#  uid               :string(255)      not null
+#  created_at        :datetime         not null
+#  updated_at        :datetime         not null
+#
+class DbCluster < ApplicationRecord
+  self.table_name = "dbclusters"
+
+  include Auditor
+  include Licenses
+  include Permissions
+  include TagsContainer
+  include ObjectLocation
+  include CommonPermissions
+  include InternalUid
+  include EnumSortable
+
+  paginates_per 10
+
+  belongs_to :user
+
+  has_one :licensed_item, as: :licenseable, dependent: :destroy
+  has_one :license, through: :licensed_item
+  has_many :accepted_licenses, through: :license
+
+  STATUS_CREATING = "creating".freeze
+  STATUS_AVAILABLE = "available".freeze
+  STATUS_STOPPING = "stopping".freeze
+  STATUS_STOPPED = "stopped".freeze
+  STATUS_STARTING = "starting".freeze
+  STATUS_TERMINATING = "terminating".freeze
+  STATUS_TERMINATED = "terminated".freeze
+
+  ALLOWED_ENGINE_VERSIONS = %w(
+    5.7.12
+    9.6.16
+    9.6.17
+    9.6.18
+    9.6.19
+    10.14
+  ).freeze
+
+  # TODO(samuel) validate that I'm not starting db_std1_x1, db_mem1_x96 instance
+  DX_INSTANCE_CLASSES = {
+    "db_std1_x2" => "DB Baseline 1 x 2",
+    "db_mem1_x2" => "DB Mem 1 x 2",
+    "db_mem1_x4" => "DB Mem 1 x 4",
+    "db_mem1_x8" => "DB Mem 1 x 8",
+    "db_mem1_x16" => "DB Mem 1 x 16",
+    "db_mem1_x32" => "DB Mem 1 x 32",
+    "db_mem1_x48" => "DB Mem 1 x 48",
+    "db_mem1_x64" => "DB Mem 1 x 64",
+  }.freeze
+
+  ENGINE_MYSQL = "aurora-mysql".freeze
+  ENGINE_POSTGRESQL = "aurora-postgresql".freeze
+
+  validates :name, :engine, :engine_version, :status, :scope,
+            :status_as_of, :project, :dx_instance_class, :user_id, presence: true
+
+  validates :dxid, :uid, uniqueness: { case_sensitive: true }
+  validates :dx_instance_class, inclusion: { in: DX_INSTANCE_CLASSES.keys }
+  validates :engine, inclusion: { in: [ENGINE_MYSQL, ENGINE_POSTGRESQL] }
+  validates :engine_version, inclusion: { in: ALLOWED_ENGINE_VERSIONS }
+
+  enum engine: {
+    ENGINE_MYSQL => 0,
+    ENGINE_POSTGRESQL => 1,
+  }
+
+  enum status: {
+    STATUS_AVAILABLE => 0,
+    STATUS_CREATING => 1,
+    STATUS_STOPPING => 2,
+    STATUS_STOPPED => 3,
+    STATUS_STARTING => 4,
+    STATUS_TERMINATING => 5,
+    STATUS_TERMINATED => 6,
+  }
+
+  alias_attribute :title, :name
+
+  def klass
+    "db-cluster"
+  end
+end
diff --git a/app/models/event.rb b/app/models/event.rb
index 051eef181..044f3940d 100644
--- a/app/models/event.rb
+++ b/app/models/event.rb
@@ -11,6 +11,7 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
 class Event < ApplicationRecord
@@ -18,31 +19,35 @@ class Event < ApplicationRecord
 
   scope :date_range, ->(begin_at, end_at) { where(created_at: begin_at..end_at) }
 
-  def self.select_sum(attribute)
-    original_name = attribute_alias(attribute)
-    query = sanitize_sql("CAST(SUM(#{original_name}) AS UNSIGNED) as #{original_name}")
-    select(query)
-  end
+  store :data, coder: JSON
 
-  def self.select_count
-    select("COUNT(id) as count")
-  end
+  class << self
+    def select_sum(attribute)
+      original_name = attribute_alias(attribute)
+      query = sanitize_sql("CAST(SUM(#{original_name}) AS UNSIGNED) as #{original_name}")
+      select(query)
+    end
 
-  def self.select_count_uniq_by(attribute)
-    original_name = attribute_alias(attribute) || attribute
-    query = sanitize_sql("COUNT(DISTINCT #{original_name}) as count")
-    select(query)
-  end
+    def select_count
+      select("COUNT(id) as count")
+    end
 
-  def self.group_by_hour
-    select("DATE_FORMAT(created_at, '%Y-%m-%d %H:00') AS date").group("date")
-  end
+    def select_count_uniq_by(attribute)
+      original_name = attribute_alias(attribute) || attribute
+      query = sanitize_sql("COUNT(DISTINCT #{original_name}) as count")
+      select(query)
+    end
 
-  def self.group_by_day
-    select("DATE(created_at) as date").group("date")
-  end
+    def group_by_hour
+      select("DATE_FORMAT(created_at, '%Y-%m-%d %H:00') AS date").group("date")
+    end
+
+    def group_by_day
+      select("DATE(created_at) as date").group("date")
+    end
 
-  def self.group_by_month
-    select("DATE(DATE_FORMAT(created_at, '%Y-%m-01')) AS date").group("date")
+    def group_by_month
+      select("DATE(DATE_FORMAT(created_at, '%Y-%m-01')) AS date").group("date")
+    end
   end
 end
diff --git a/app/models/event/app_created.rb b/app/models/event/app_created.rb
index 11c3affe2..19bc7d647 100644
--- a/app/models/event/app_created.rb
+++ b/app/models/event/app_created.rb
@@ -11,6 +11,7 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
 class Event::AppCreated < Event
diff --git a/app/models/event/app_published.rb b/app/models/event/app_published.rb
index af88a1f3e..8867e6349 100644
--- a/app/models/event/app_published.rb
+++ b/app/models/event/app_published.rb
@@ -11,6 +11,7 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
 class Event::AppPublished < Event
diff --git a/app/models/event/file_copied.rb b/app/models/event/file_copied.rb
new file mode 100644
index 000000000..f4d1b2c40
--- /dev/null
+++ b/app/models/event/file_copied.rb
@@ -0,0 +1,53 @@
+# == Schema Information
+#
+# Table name: events
+#
+#  id         :integer          not null, primary key
+#  type       :string(255)
+#  org_handle :string(255)
+#  dxuser     :string(255)
+#  param1     :string(255)
+#  param2     :string(255)
+#  param3     :string(255)
+#  created_at :datetime         not null
+#  param4     :string(255)
+#  data       :text(65535)
+#
+
+class Event
+  # Tracks file copy events.
+  class FileCopied < Event
+    store :data,
+          accessors: %i(
+            source_uid
+            source_name
+            source_path
+            source_folder_id
+            source_scope
+            target_uid
+            target_name
+            target_path
+            target_folder_id
+            target_scope
+          ), coder: JSON
+
+    class << self
+      def create_for(source, target, user)
+        create(
+          source_uid: source.uid,
+          source_name: source.name,
+          source_path: source.full_path,
+          source_folder_id: source.folder_id,
+          source_scope: source.scope,
+          target_uid: target.uid,
+          target_name: target.name,
+          target_path: target.full_path,
+          target_folder_id: target.folder_id,
+          target_scope: target.scope,
+          dxuser: user.dxuser,
+          org_handle: user.org.handle,
+        )
+      end
+    end
+  end
+end
diff --git a/app/models/event/file_created.rb b/app/models/event/file_created.rb
index f7d7cf335..41862e7ef 100644
--- a/app/models/event/file_created.rb
+++ b/app/models/event/file_created.rb
@@ -11,6 +11,7 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
 class Event::FileCreated < Event
diff --git a/app/models/event/file_deleted.rb b/app/models/event/file_deleted.rb
index d19558d37..d5df6e05c 100644
--- a/app/models/event/file_deleted.rb
+++ b/app/models/event/file_deleted.rb
@@ -11,20 +11,29 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
-class Event::FileDeleted < Event
-  alias_attribute :file_size, :param1
-  alias_attribute :dxid, :param2
-  alias_attribute :scope, :param3
+class Event
+  # Tracks file delete events.
+  class FileDeleted < Event
+    alias_attribute :file_size, :param1
 
-  def self.create_for(file, user)
-    create(
-      dxid: file.dxid,
-      file_size: file.file_size,
-      scope: file.scope,
-      dxuser: user.dxuser,
-      org_handle: user.org.handle
-    )
+    store :data, accessors: %i(uid name path folder_id scope), coder: JSON
+
+    class << self
+      def create_for(file, user)
+        create(
+          uid: file.uid,
+          name: file.name,
+          path: file.full_path,
+          folder_id: file.folder_id,
+          scope: file.scope,
+          file_size: file.file_size,
+          dxuser: user.dxuser,
+          org_handle: user.org.handle,
+        )
+      end
+    end
   end
 end
diff --git a/app/models/event/file_downloaded.rb b/app/models/event/file_downloaded.rb
index 5ef8da4dc..3d276c9ea 100644
--- a/app/models/event/file_downloaded.rb
+++ b/app/models/event/file_downloaded.rb
@@ -11,6 +11,7 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
 class Event::FileDownloaded < Event
diff --git a/app/models/event/folder_created.rb b/app/models/event/folder_created.rb
new file mode 100644
index 000000000..61ae6537b
--- /dev/null
+++ b/app/models/event/folder_created.rb
@@ -0,0 +1,37 @@
+# == Schema Information
+#
+# Table name: events
+#
+#  id         :integer          not null, primary key
+#  type       :string(255)
+#  org_handle :string(255)
+#  dxuser     :string(255)
+#  param1     :string(255)
+#  param2     :string(255)
+#  param3     :string(255)
+#  created_at :datetime         not null
+#  param4     :string(255)
+#  data       :text(65535)
+#
+
+class Event
+  # Tracks folder creation events.
+  class FolderCreated < Event
+    store :data, accessors: %i(id scope name path), coder: JSON
+
+    class << self
+      def create_for(folder, user)
+        path_with_folder = folder.full_path == "/" ? "/#{folder.name}" : folder.full_path + folder.name
+        create(
+          id: folder.id,
+          scope: folder.scope,
+          name: folder.name,
+          path: path_with_folder,
+          param1: path_with_folder,
+          dxuser: user.dxuser,
+          org_handle: user.org.handle,
+        )
+      end
+    end
+  end
+end
diff --git a/app/models/event/folder_deleted.rb b/app/models/event/folder_deleted.rb
new file mode 100644
index 000000000..5ac280694
--- /dev/null
+++ b/app/models/event/folder_deleted.rb
@@ -0,0 +1,37 @@
+# == Schema Information
+#
+# Table name: events
+#
+#  id         :integer          not null, primary key
+#  type       :string(255)
+#  org_handle :string(255)
+#  dxuser     :string(255)
+#  param1     :string(255)
+#  param2     :string(255)
+#  param3     :string(255)
+#  created_at :datetime         not null
+#  param4     :string(255)
+#  data       :text(65535)
+#
+
+class Event
+  # Tracks folder deletion events.
+  class FolderDeleted < Event
+    store :data, accessors: %i(id scope name path), coder: JSON
+
+    class << self
+      def create_for(folder, user)
+        path_with_folder = folder.full_path == "/" ? "/#{folder.name}" : folder.full_path + folder.name
+        create(
+          id: folder.id,
+          scope: folder.scope,
+          name: folder.name,
+          path: path_with_folder,
+          param1: path_with_folder,
+          dxuser: user.dxuser,
+          org_handle: user.org.handle,
+        )
+      end
+    end
+  end
+end
diff --git a/app/models/event/job_closed.rb b/app/models/event/job_closed.rb
index 24c7d0e04..d2a7413f1 100644
--- a/app/models/event/job_closed.rb
+++ b/app/models/event/job_closed.rb
@@ -11,6 +11,7 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
 class Event::JobClosed < Event
diff --git a/app/models/event/job_run.rb b/app/models/event/job_run.rb
index f307a4ed4..d59f368fa 100644
--- a/app/models/event/job_run.rb
+++ b/app/models/event/job_run.rb
@@ -11,6 +11,7 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
 class Event::JobRun < Event
diff --git a/app/models/event/signed_up_for_challenge.rb b/app/models/event/signed_up_for_challenge.rb
index 3e004db22..8ccb3ef40 100644
--- a/app/models/event/signed_up_for_challenge.rb
+++ b/app/models/event/signed_up_for_challenge.rb
@@ -11,6 +11,7 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
 class Event::SignedUpForChallenge < Event
diff --git a/app/models/event/submission_created.rb b/app/models/event/submission_created.rb
index 47ca0676e..96c3cc23a 100644
--- a/app/models/event/submission_created.rb
+++ b/app/models/event/submission_created.rb
@@ -11,6 +11,7 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
 class Event::SubmissionCreated < Event
diff --git a/app/models/event/user_access_requested.rb b/app/models/event/user_access_requested.rb
index d5f2d4dcb..a7558c695 100644
--- a/app/models/event/user_access_requested.rb
+++ b/app/models/event/user_access_requested.rb
@@ -11,6 +11,7 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
 class Event::UserAccessRequested < Event
diff --git a/app/models/event/user_logged_in.rb b/app/models/event/user_logged_in.rb
index d9a4c9838..7ec82e992 100644
--- a/app/models/event/user_logged_in.rb
+++ b/app/models/event/user_logged_in.rb
@@ -11,6 +11,7 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
 class Event::UserLoggedIn < Event
diff --git a/app/models/event/user_viewed.rb b/app/models/event/user_viewed.rb
index b4c8ff293..cc46275cb 100644
--- a/app/models/event/user_viewed.rb
+++ b/app/models/event/user_viewed.rb
@@ -11,6 +11,7 @@
 #  param3     :string(255)
 #  created_at :datetime         not null
 #  param4     :string(255)
+#  data       :text(65535)
 #
 
 class Event::UserViewed < Event
diff --git a/app/models/expert.rb b/app/models/expert.rb
index 69b87b22b..d5a484444 100644
--- a/app/models/expert.rb
+++ b/app/models/expert.rb
@@ -14,6 +14,7 @@
 
 class Expert < ApplicationRecord
   include Auditor
+  paginates_per 10
 
   has_many :expert_questions, dependent: :destroy
   has_many :expert_answers, through: :expert_questions, dependent: :destroy
diff --git a/app/models/folder.rb b/app/models/folder.rb
index e5e1f0706..03d119f0e 100644
--- a/app/models/folder.rb
+++ b/app/models/folder.rb
@@ -19,6 +19,7 @@
 #  sti_type                :string(255)
 #  scoped_parent_folder_id :integer
 #  uid                     :string(255)
+#  entity_type             :integer          default("regular"), not null
 #  featured                :boolean          default(FALSE)
 #
 
@@ -103,8 +104,7 @@ def has_in_children?(node)
   end
 
   def children
-    column = self.class.connection.quote_column_name(Node.scope_column_name(scope))
-    Node.where("#{column} = ?", id)
+    Node.where(scope_column_name => id, scope: scope)
   end
 
   def sub_folders
diff --git a/app/models/invitation.rb b/app/models/invitation.rb
index def543f8f..e3faac293 100644
--- a/app/models/invitation.rb
+++ b/app/models/invitation.rb
@@ -41,12 +41,6 @@ class Invitation < ApplicationRecord
   validates :first_name,
             :last_name,
             :email,
-            :address1,
-            :country,
-            :city,
-            :postal_code,
-            :phone_country,
-            :phone,
             :req_reason,
             presence: true
 
@@ -57,9 +51,6 @@ class Invitation < ApplicationRecord
             inclusion: [true, false]
 
   validate :validate_email,
-           :validate_phone,
-           # :validate_state,
-           :validate_phone_country_code,
            on: :create
 
   store :extras,
@@ -105,18 +96,6 @@ def phone_country_code
     phone_country.try(:dial_code)
   end
 
-  def validate_phone_country_code
-    if usa? && !usa_phone_code?
-      errors.add(:phone_country_id, "doesn't match USA phone code")
-    end
-  end
-
-  def validate_phone
-    if full_phone.gsub(/[^0-9]/, '').length < 9
-      errors.add(:phone, "wrong format")
-    end
-  end
-
   def usa_phone_code?
     phone_country_code == Country::UNITED_STATES_AREA_CODE
   end
@@ -135,11 +114,6 @@ def validate_email
     errors.add(:email, I18n.t(:email_taken, side: "DNAnexus")) if DNAnexusAPI.email_exists?(email)
   end
 
-  def validate_state
-    if usa? && !User.validate_state(us_state, postal_code)
-      errors.add(:state, "doesn't match postal code")
-    end
-  end
 
   delegate :usa?, to: :country, allow_nil: true
 end
diff --git a/app/models/job.rb b/app/models/job.rb
index d85cbb46c..30f0cd963 100644
--- a/app/models/job.rb
+++ b/app/models/job.rb
@@ -20,14 +20,17 @@
 #  uid             :string(255)
 #  local_folder_id :integer
 #  featured        :boolean          default(FALSE)
+#  entity_type     :integer          default("regular"), not null
 #
 
 class Job < ApplicationRecord
   include Auditor
   include Permissions
   include CommonPermissions
-  include InternalUid
   include Featured
+  include InternalUid
+  include JobsSyncing
+  include ObjectLocation
   include Scopes
   include TagsContainer
 
@@ -47,16 +50,23 @@ class Job < ApplicationRecord
     "hidisk-8" => "mem1_ssd2_x8_fedramp",
     "hidisk-16" => "mem1_ssd2_x16_fedramp",
     "hidisk-36" => "mem1_ssd2_x36_fedramp",
+    "gpu-8" => "mem3_ssd1_gpu_x8_fedramp",
   }.freeze
 
   STATE_DONE = "done".freeze
   STATE_FAILED = "failed".freeze
   STATE_IDLE = "idle".freeze
+  STATE_RUNNING = "running".freeze
   STATE_TERMINATED = "terminated".freeze
   STATE_TERMINATING = "terminating".freeze
 
   TERMINAL_STATES = [STATE_TERMINATED, STATE_DONE, STATE_FAILED].freeze
 
+  TYPE_REGULAR = "regular".freeze
+  TYPE_HTTPS = "https".freeze
+
+  DEFAULT_HTTPS_PORT = 443
+
   belongs_to :app
   belongs_to :user
   belongs_to :app_series
@@ -78,9 +88,14 @@ class Job < ApplicationRecord
   acts_as_votable
 
   scope :done, -> { where(state: STATE_DONE) }
-  scope :terminal, -> { where(state: [TERMINAL_STATES]) }
+  scope :terminal, -> { where(state: TERMINAL_STATES) }
 
-  delegate :input_spec, :output_spec, to: :app
+  enum entity_type: {
+    TYPE_REGULAR => 0,
+    TYPE_HTTPS => 1,
+  }
+
+  delegate :input_spec, :output_spec, to: :app, allow_nil: true
 
   attr_accessor :current_user
 
@@ -112,10 +127,20 @@ def done?
     state == STATE_DONE
   end
 
+  def running?
+    state == STATE_RUNNING
+  end
+
   def failed?
     state == STATE_FAILED
   end
 
+  def failure_reason
+    return "" if !failed? || !describe.key?("failureReason")
+
+    describe["failureReason"]
+  end
+
   def failure_message
     return "" if !failed? || !describe.key?("failureMessage")
 
@@ -131,11 +156,18 @@ def runtime
   def energy
     return nil unless describe.key?("totalPrice")
 
-    ((describe["totalPrice"] * 400 + 5).to_i / 5.0).to_i * 5
+    (describe["totalPrice"] * 100).to_i / 100.0
   end
 
   def energy_string
-    (energy || "TBD").to_s
+    ("$#{energy}" || "TBD").to_s
+  end
+
+  def https_job_external_url
+    return unless https?
+
+    https_port = describe.dig(:runInput, :port) || DEFAULT_HTTPS_PORT
+    describe.dig(:httpsApp, :dns, :url).chomp("/") + ":#{https_port}"
   end
 
   def update_provenance!
diff --git a/app/models/job/io_collection.rb b/app/models/job/io_collection.rb
index b5d7aeb46..6667d607d 100644
--- a/app/models/job/io_collection.rb
+++ b/app/models/job/io_collection.rb
@@ -3,11 +3,11 @@ class Job::IOCollection
   delegate :each, to: :records
 
   def self.build_outputs(job)
-    build(Output, job.output_spec, job.run_outputs, project: job.project)
+    build(::Job::IOCollection::Output, job.output_spec, job.run_outputs, project: job.project)
   end
 
   def self.build_inputs(job)
-    build(Input, job.input_spec, job.run_inputs)
+    build(::Job::IOCollection::Input, job.input_spec, job.run_inputs)
   end
 
   def self.build(record_class, spec, data, options = {})
diff --git a/app/models/job/io_collection/input.rb b/app/models/job/io_collection/input.rb
index 25fe80272..1edf148f5 100644
--- a/app/models/job/io_collection/input.rb
+++ b/app/models/job/io_collection/input.rb
@@ -31,7 +31,7 @@ def file?
   def file
     return nil unless file?
 
-    UserFile.find_by_uid(value)
+    UserFile.find_by(uid: value)
   end
 
   private
diff --git a/app/models/license.rb b/app/models/license.rb
index 4a46df0ed..1dd74573f 100644
--- a/app/models/license.rb
+++ b/app/models/license.rb
@@ -1,4 +1,3 @@
-
 # == Schema Information
 #
 # Table name: licenses
@@ -18,6 +17,7 @@ class License < ApplicationRecord
   include Permissions
   include CommonPermissions
   include Licenses
+  include ObjectLocation
 
   belongs_to :user
   has_many :licensed_items, dependent: :destroy
@@ -26,6 +26,7 @@ class License < ApplicationRecord
   has_many :files, through: :licensed_items, source: :licenseable, source_type: "UserFile"
   has_many :assets, through: :licensed_items, source: :licenseable, source_type: "Asset"
   has_many :licensed_users, through: :accepted_licenses, source: :user
+  has_many :dbclusters, through: :licensed_items, source: :licenseable, source_type: "DbCluster"
 
   acts_as_taggable
 
@@ -45,19 +46,19 @@ def to_param
     end
   end
 
-  def publishable_by?(context, scope_to_publish_to = "public")
+  def publishable_by?(*)
     false
   end
 
   def rename(new_name, context)
-    update_attributes(title: new_name)
+    update(title: new_name)
   end
 
   def describe_fields
-    ["title", "content", "approval_required"]
+    %w(title content approval_required)
   end
 
   def accepted_licenses_pending
-    accepted_licenses.where(state: 'pending')
+    accepted_licenses.where(state: "pending")
   end
 end
diff --git a/app/models/news_item.rb b/app/models/news_item.rb
index 3172d5d61..4c5da05cf 100644
--- a/app/models/news_item.rb
+++ b/app/models/news_item.rb
@@ -16,6 +16,8 @@
 #
 
 class NewsItem < ApplicationRecord
+  paginates_per 10
+
   belongs_to :user
   validates :link, :video, url: true
   validates :title, presence: true
diff --git a/app/models/node.rb b/app/models/node.rb
index 6ee09d530..d31d0e0bc 100644
--- a/app/models/node.rb
+++ b/app/models/node.rb
@@ -19,6 +19,7 @@
 #  sti_type                :string(255)
 #  scoped_parent_folder_id :integer
 #  uid                     :string(255)
+#  entity_type             :integer          default("regular"), not null
 #  featured                :boolean          default(FALSE)
 #
 
@@ -27,6 +28,7 @@ class Node < ApplicationRecord
   extend Scopes
   include Scopes
   include Featured
+  include ObjectLocation
   include TagsContainer
 
   self.inheritance_column = :sti_type
@@ -37,14 +39,82 @@ class Node < ApplicationRecord
   # pFDA internal state, used for files that are being removing by a worker.
   STATE_REMOVING = "removing".freeze
 
+  TYPE_REGULAR = "regular".freeze
+  TYPE_HTTPS = "https".freeze
+
   belongs_to :user, required: true
   belongs_to :parent, polymorphic: true
   belongs_to :scoped_parent_folder, class_name: "Folder"
 
+  attr_accessor :current_user
+
   scope :files_and_folders, -> { where(sti_type: %w(Folder UserFile)) }
   scope :files, -> { where(sti_type: %w(UserFile)) }
   scope :folders, -> { where(sti_type: %w(Folder)) }
 
+  enum entity_type: {
+    TYPE_REGULAR => 0,
+    TYPE_HTTPS => 1,
+  }
+
+  acts_as_taggable
+
+  class << self
+    def scope_column_name(scope)
+      if [SCOPE_PRIVATE, SCOPE_PUBLIC, nil].include?(scope)
+        :parent_folder_id
+      else
+        :scoped_parent_folder_id
+      end
+    end
+
+    def opposite_scope_column_name(scope)
+      (%i(parent_folder_id scoped_parent_folder_id) - [scope_column_name(scope)]).first
+    end
+
+    def folder_content(files, folders)
+      Node.where(id: (files + folders).map(&:id))
+    end
+  end
+
+  # Collects a string of item's path.
+  # @param dir_set [Array<String>] ordered array of folder names
+  # @return [String] file path or "/" for root. Ex. "/second_level_folder/third_level_folder/"
+  def collect_path_string(dir_set)
+    path = "/"
+    dir_set.each { |dir| path += "#{dir}/" }
+    path
+  end
+
+  # Returns a full path to the current file or folder
+  # @param [item_scope] the scope
+  # @return [String] the path or "/" for root
+  def full_path(item_scope = scope)
+    parent_folder = parent_folder(item_scope)
+    folders = []
+    if parent_folder.blank?
+      "/"
+    else
+      folders << parent_folder_name(item_scope)
+      folders << parent_folder.ancestors(item_scope).pluck(:name)
+    end
+
+    collect_path_string(folders.flatten.reverse)
+  end
+
+  def parent_folder(file_scope = scope)
+    column_name = Node.scope_column_name(file_scope)
+    Folder.find_by(id: self[column_name])
+  end
+
+  # Returns a parent folder name of an item
+  # @param [item_scope] the scope
+  # @return [String] the name or "/" for root
+  def parent_folder_name(item_scope = scope)
+    folder = parent_folder(item_scope)
+    folder.blank? ? "/" : folder.name
+  end
+
   def title
     parent_type == "Asset" ? self.becomes(Asset).prefix : name
   end
@@ -57,8 +127,16 @@ def ancestors(scope)
     build_ancestors_tree(self, scope)
   end
 
-  def parent_folder
-    Folder.find_by(id: self[self.class.scope_column_name(scope)])
+  def scope_column_name
+    self.class.scope_column_name(scope)
+  end
+
+  def opposite_scope_column_name
+    self.class.opposite_scope_column_name(scope)
+  end
+
+  def folder_id
+    self[scope_column_name]
   end
 
   # Check, whether node is publishable. A node should be 'private' or in space.
@@ -68,16 +146,6 @@ def publishable?(user)
     user.present? && !public?
   end
 
-  class << self
-    def scope_column_name(scope)
-      [SCOPE_PRIVATE, SCOPE_PUBLIC].include?(scope) ? :parent_folder_id : :scoped_parent_folder_id
-    end
-
-    def folder_content(files, folders)
-      Node.where(id: (files + folders).map(&:id))
-    end
-  end
-
   private
 
   def build_ancestors_tree(start_from, scope)
diff --git a/app/models/note.rb b/app/models/note.rb
index f48b26c05..c789832a2 100644
--- a/app/models/note.rb
+++ b/app/models/note.rb
@@ -16,6 +16,7 @@ class Note < ApplicationRecord
   include Auditor
   include Permissions
   include CommonPermissions
+  include ObjectLocation
   include TagsContainer
 
   belongs_to :user, required: true
@@ -107,7 +108,7 @@ def real_files
   end
 
   def rename(new_name, context)
-    update_attributes(title: new_name)
+    update(title: new_name)
   end
 
   def self.publish(notes, context, scope)
diff --git a/app/models/notification_preference.rb b/app/models/notification_preference.rb
index 3c9af9cdd..eb49ad8bc 100644
--- a/app/models/notification_preference.rb
+++ b/app/models/notification_preference.rb
@@ -10,64 +10,135 @@
 # The current class is responsible only for storing user's preferences
 #   (not the rights to receive a notification).
 class NotificationPreference < ApplicationRecord
+  REVIEWER_KEYS = %i(
+    reviewer_membership_changed
+    reviewer_comment_activity
+    reviewer_content_added_or_deleted
+  ).freeze
 
-  COMMON_KEYS = [
-    :all_membership_changed,
-    :all_new_task_assigned,
-    :all_task_status_changed,
-    :all_comment_activity, #mentioned in a comment, someone replies to their comment
-    :all_content_added_or_deleted,
-    # :all_app_or_workflow_status_changed, #job started, job completed, job failed, job terminated
-  ]
-  LEAD_KEYS = [
-    :lead_membership_changed,
-    :lead_new_task_assigned,
-    :lead_task_status_changed,
-    :lead_comment_activity, #mentioned in a comment, someone replies to their comment
-    :lead_content_added_or_deleted,
-    # :lead_app_or_workflow_status_changed, #job started, job completed, job failed, job terminated
-    :lead_member_added_or_removed_from_space,
-    :lead_space_locked_unlocked_deleted,
-  ]
-  ADMIN_KEYS = [
-    :admin_membership_changed,
-    :admin_new_task_assigned,
-    :admin_task_status_changed,
-    :admin_comment_activity, #mentioned in a comment, someone replies to their comment
-    :admin_content_added_or_deleted,
-    # :admin_app_or_workflow_status_changed, #job started, job completed, job failed, job terminated
-    :admin_member_added_or_removed_from_space,
-    :admin_space_locked_unlocked_deleted,
-    :admin_space_lock_unlock_delete_requests,
-  ]
-
-  ALL_KEYS = COMMON_KEYS + LEAD_KEYS + ADMIN_KEYS
+  SPONSOR_KEYS = %i(
+    sponsor_membership_changed
+    sponsor_comment_activity
+    sponsor_content_added_or_deleted
+  ).freeze
+
+  REVIEWER_LEAD_KEYS = %i(
+    reviewer_lead_membership_changed
+    reviewer_lead_comment_activity
+    reviewer_lead_content_added_or_deleted
+    reviewer_lead_member_added_to_space
+    reviewer_lead_space_locked_unlocked_deleted
+  ).freeze
+
+  SPONSOR_LEAD_KEYS = %i(
+    sponsor_lead_membership_changed
+    sponsor_lead_comment_activity
+    sponsor_lead_content_added_or_deleted
+    sponsor_lead_member_added_to_space
+    sponsor_lead_space_locked_unlocked_deleted
+  ).freeze
+
+  ADMIN_KEYS = %i(
+    admin_membership_changed
+    admin_comment_activity
+    admin_content_added_or_deleted
+    admin_member_added_to_space
+    admin_space_locked_unlocked_deleted
+  ).freeze
+
+  PRIVATE_SCOPE_KEYS = %i(
+    private_job_finished
+    private_challenge_opened
+    private_challenge_preregister
+  ).freeze
+
+  # email types currently handled by nodejs app
+  # File - /https-apps-api/packages/shared/src/domain/email/email.config.ts
+  EMAIL_TYPES = {
+    notification_job_done: 1,
+    notification_content: 2,
+    notification_space_membership: 3,
+    notification_space_action: 4,
+    notification_comment: 5,
+    notification_challenge_opened: 6,
+    notification_challenge_preregister: 7,
+    # nodejs app only types
+    # jobTerminationWarning = 8,
+    # staleJobsReport = 9,
+    notification_job_failed: 11,
+  }.freeze
+
+  ALL_KEYS = REVIEWER_KEYS + SPONSOR_KEYS + REVIEWER_LEAD_KEYS + SPONSOR_LEAD_KEYS +
+             ADMIN_KEYS + PRIVATE_SCOPE_KEYS
 
   ALL_KEYS.each do |key|
     define_method("#{key}=") do |value|
-      super value.to_s == '1'
+      super value.to_s == "1"
     end
 
     define_method("#{key}") do
       return true if super().nil?
+
       super()
     end
   end
 
   belongs_to :user
 
-  validates *ALL_KEYS, inclusion: { in: [ true, false ] }
+  validates(*ALL_KEYS, inclusion: { in: [true, false] })
   store :data, accessors: ALL_KEYS, coder: JSON
 
+  class << self
+    def default_preferences
+      {
+        # flags - enabled only for comment_activity
+        # https://jira.internal.dnanexus.com/browse/PFDA-3094
+        reviewer_membership_changed: 0,
+        reviewer_comment_activity: 1,
+        reviewer_content_added_or_deleted: 0,
+        sponsor_membership_changed: 0,
+        sponsor_comment_activity: 1,
+        sponsor_content_added_or_deleted: 0,
+        reviewer_lead_membership_changed: 1,
+        reviewer_lead_comment_activity: 1,
+        reviewer_lead_content_added_or_deleted: 1,
+        reviewer_lead_member_added_to_space: 1,
+        reviewer_lead_space_locked_unlocked_deleted: 1,
+        sponsor_lead_membership_changed: 1,
+        sponsor_lead_comment_activity: 1,
+        sponsor_lead_content_added_or_deleted: 1,
+        sponsor_lead_member_added_to_space: 1,
+        sponsor_lead_space_locked_unlocked_deleted: 1,
+        admin_membership_changed: 1,
+        admin_comment_activity: 1,
+        admin_content_added_or_deleted: 1,
+        admin_member_added_to_space: 1,
+        admin_space_locked_unlocked_deleted: 1,
+        private_job_finished: 0,
+        private_challenge_opened: 1,
+        private_challenge_preregister: 1,
+      }
+    end
+
+    def create_for_user!(user)
+      np = default_preferences
+      np[:user_id] = user.id
+      create!(np)
+    end
+  end
+
   def self.find_by_user(user)
     find_or_initialize_by(user_id: user.id)
   end
 
   def all_attributes
     {
-      review_space_admin: keys_list(ADMIN_KEYS),
-      lead_reviewer: keys_list(LEAD_KEYS),
-      reviewer: keys_list(COMMON_KEYS)
+      reviewer: keys_list(REVIEWER_KEYS),
+      sponsor: keys_list(SPONSOR_KEYS),
+      reviewer_lead: keys_list(REVIEWER_LEAD_KEYS),
+      sponsor_lead: keys_list(SPONSOR_LEAD_KEYS),
+      admin: keys_list(ADMIN_KEYS),
+      private: keys_list(PRIVATE_SCOPE_KEYS),
     }
   end
 
@@ -80,4 +151,8 @@ def keys_list(keys)
   def available_keys
     ALL_KEYS
   end
+
+  def self.email_types
+    EMAIL_TYPES
+  end
 end
diff --git a/app/models/org.rb b/app/models/org.rb
index e80e6eb91..cb5160d9e 100644
--- a/app/models/org.rb
+++ b/app/models/org.rb
@@ -18,7 +18,9 @@
 class Org < ApplicationRecord
   default_scope { where.not(state: "deleted") }
 
-  PFDA_PREFIX = "org-pfda..".freeze
+  ORG_PREFIX = "org-".freeze
+  PFDA_PREFIX = "pfda..".freeze
+  HANDLE_MAX_LENGTH = 33
 
   include Auditor
 
@@ -33,33 +35,33 @@ class Org < ApplicationRecord
           -> { where(action_type: OrgActionRequest::Type::DISSOLVE) },
           class_name: "OrgActionRequest"
 
-  def self.construct_dxorg(handle)
-    raise unless handle.present? && handle =~ /^[0-9a-z][0-9a-z_.]*$/
+  scope :real_orgs, -> { where(singular: false) }
 
-    PFDA_PREFIX + handle
-  end
+  class << self
+    def construct_dxorg(handle)
+      raise unless handle.present? && handle =~ /^[0-9a-z][0-9a-z_.]*$/
 
-  def self.handle_by_id(id)
-    id.sub(/^org-/, '')
-  end
+      ORG_PREFIX + PFDA_PREFIX + handle
+    end
 
-  def self.featured
-    Org.find_by(handle: ORG_EVERYONE_HANDLE)
-  end
+    def handle_by_id(id)
+      id.sub(/^org-/, "")
+    end
 
-  def self.real_orgs
-    where(singular: false)
-  end
+    def featured
+      Org.find_by(handle: ORG_EVERYONE_HANDLE)
+    end
 
-  def self.reports(sheet)
-    order(:name).find_each do |org|
-      %w(name handle address phone).each do |label|
-        sheet.add_row ["Organization #{label}:", org.send(label)]
+    def reports(sheet)
+      order(:name).find_each do |org|
+        %w(name handle address phone).each do |label|
+          sheet.add_row ["Organization #{label}:", org.send(label)]
+        end
+        org.admin_in_report(sheet)
+        org.users_in_report(sheet)
       end
-      org.admin_in_report(sheet)
-      org.users_in_report(sheet)
+      sheet
     end
-    sheet
   end
 
   def admin_in_report(sheet)
@@ -102,10 +104,10 @@ def real_org?
   end
 
   def dxid
-    PFDA_PREFIX + handle
+    ORG_PREFIX + PFDA_PREFIX + handle
   end
 
   def dxorg
-    Org.construct_dxorg(handle)
+    self.class.construct_dxorg(handle)
   end
 end
diff --git a/app/models/space.rb b/app/models/space.rb
index af53982a2..70f0e97f4 100644
--- a/app/models/space.rb
+++ b/app/models/space.rb
@@ -20,6 +20,11 @@
 #  restrict_to_template :boolean          default(FALSE)
 #  inactivity_notified  :boolean          default(FALSE)
 #
+#
+#  Notes:
+#  space_id is used primarily for Review Spaces where private areas of the Sponsor and
+#           Reviewer sides refer to the host space
+#           It is also used for Private Spaces which points back to itself
 
 class Space < ActiveRecord::Base
   paginates_per 25
@@ -34,9 +39,11 @@ class Space < ActiveRecord::Base
   STATE_LOCKED = "locked".freeze
   STATE_DELETED = "deleted".freeze
 
-  TYPES = %i(groups review verification).freeze
   STATES = [STATE_UNACTIVATED, STATE_ACTIVE, STATE_LOCKED, STATE_DELETED].freeze
 
+  TYPES = %w(groups review verification private_type government administrator).freeze
+  EXCLUSIVE_TYPES = %w(private_type government administrator).freeze
+
   SCOPE_PATTERN = /^space-(\d+)$/.freeze
 
   belongs_to :space
@@ -47,7 +54,6 @@ class Space < ActiveRecord::Base
 
   has_many :users, through: :space_memberships
   has_many :confidential_spaces, class_name: "Space"
-  has_many :tasks, dependent: :destroy
   has_many :space_events
   has_many :space_invitations
 
@@ -71,7 +77,8 @@ class Space < ActiveRecord::Base
   attr_accessor :invitees,
                 :invitees_role,
                 :host_lead_dxuser,
-                :guest_lead_dxuser
+                :guest_lead_dxuser,
+                :sponsor_lead_dxuser
 
   scope :top_level, -> { where(space_id: nil) }
   scope :shared, -> { review.top_level }
@@ -79,6 +86,7 @@ class Space < ActiveRecord::Base
   scope :reviewer, -> { review.where.not(host_dxorg: nil) }
   scope :sponsor, -> { review.where.not(guest_dxorg: nil) }
   scope :non_groups, -> { where.not(space_type: :groups) }
+  scope :admin_spaces, -> { where(space_type: :administrator) }
   scope :undeleted, -> { where.not(state: :deleted) }
   scope :restricted, -> { confidential.where(restrict_to_template: true) }
   scope :editable_by, lambda { |context|
@@ -190,6 +198,14 @@ def comparisons
     Comparison.accessible_by_space(self)
   end
 
+  def workflow_series
+    WorkflowSeries.accessible_by_space(self)
+  end
+
+  def latest_revision_workflows
+    Workflow.where(id: workflow_series.pluck(:latest_revision_workflow_id))
+  end
+
   def workflows
     Workflow.accessible_by_space(self)
   end
@@ -206,6 +222,10 @@ def confidential_reviewer_space
     confidential_spaces.reviewer.first
   end
 
+  def confidential_sponsor_space
+    confidential_spaces.sponsor.first
+  end
+
   def reviewer?
     review? && host_dxorg.present?
   end
@@ -218,47 +238,147 @@ def shared?
     review? && !confidential?
   end
 
+  # To distinct all Private spaces of private_type
+  def exclusive?
+    (space_id.present? && space_id == id) || EXCLUSIVE_TYPES.include?(space_type)
+  end
+
+  # Find a space, oposite to a given area of a current review space:
+  #   if a current space is confidential and reviewer,
+  #   then opposite space will be a sponsor one. And vice versa.
+  # @param shared_space [Space object] shared space for self space
+  # @return space [Space object] the opposite space
+  def opposite_private_space(shared_space)
+    if reviewer? && confidential?
+      shared_space.confidential_spaces.sponsor.first
+    else
+      shared_space.confidential_spaces.reviewer.first
+    end
+  end
+
   def verified?
     return false if space_type != "verification"
     verified ? true : false
   end
 
+  # this is always false for confidential review spaces
+  # this is always true for exclusive private spaces
   def accepted?
-    accepted_by_host = accepted_by?(host_lead_member)
-    condition = verification?
-    condition &&= (guest_lead_member.blank? || host_lead_member.user == guest_lead_member.user)
-    return accepted_by_host if condition
-    accepted_by_host && accepted_by?(guest_lead_member)
+    return true if exclusive?
+
+    accepted_by?(host_lead_member) && accepted_by?(guest_lead_member)
   end
 
+  # @param member [SpaceMembership object] - space member, host- or guest- lead.
+  # @return [true, false] depends upon member acceptance of a space
   def accepted_by?(member)
-    return false if member.blank?
-    if member.host?
-      return false if host_project.blank?
-      return true unless review?
-      return true if confidential?
-      confidential_reviewer_space.host_lead_member.present?
-    else
-      return false if guest_project.blank?
-      return true unless review?
-      confidential_spaces.sponsor.first.guest_lead_member.present? unless confidential?
-      guest_lead_member.present?
+    return false unless member
+    return true if review? && confidential?
+
+    if groups? || government? || administrator?
+      return member.host? && host_project.present? ||
+             member.guest? && guest_project.present?
     end
+
+    # below are the checks for a shared review space
+    member.host? && confidential_reviewer_space&.host_lead_member.present? ||
+      member.guest? && confidential_sponsor_space&.guest_lead_member.present?
   end
 
   def uid
     "space-#{id}"
   end
 
+  # @param update_space_params [Object] - consists of SpaceEditForm attributes
+  # @param api [DNAnexusAPI]
+  def leads_updates(update_space_params, api)
+    return unless review?
+
+    lead_invite_and_update(
+      host_lead_dxuser,
+      update_space_params.host_lead_dxuser,
+      update_space_params.current_user,
+      SpaceMembership::SIDE_HOST,
+      api,
+    )
+
+    lead_invite_and_update(
+      guest_lead_dxuser,
+      update_space_params.sponsor_lead_dxuser,
+      update_space_params.current_user,
+      SpaceMembership::SIDE_GUEST,
+      api,
+    )
+  end
+
+  # @param space_lead_dxuser [String] dxuser of a current space lead - to be changed to Admin.
+  # @param updated_lead_dxuser [String] dxuser of a new space lead - to be changed to Lead.
+  # @param side [String] dxuser of a current space lead - to be changed to Admin.
+  # @param api [DNAnexusAPI]
+  def lead_invite_and_update(space_lead_dxuser, updated_lead_dxuser, current_user, side, api)
+    return if space_lead_dxuser == updated_lead_dxuser
+
+    membership = leads.find_by(side: side)
+
+    return if user_member(updated_lead_dxuser).present?
+
+    invite(membership, updated_lead_dxuser, current_user, api)
+    update_role(updated_lead_dxuser, side, api)
+  end
+
+  def user_member(dxuser)
+    # An active user's space memberships
+    space_memberships.active.joins(:user).find_by(users: { dxuser: dxuser })
+  end
+
+  # @param space_lead_dxuser [String] dxuser of a current space lead - to be changed to Admin.
+  # @param new_lead_dxuser [String] dxuser of a new space lead - to be changed to Lead.
+  # @param api [DNAnexusAPI]
+  def update_role(new_lead_dxuser, side, api)
+    admin_member = leads.find_by(side: side)
+    # An active user member changing to be Lead
+    member = space_memberships.active.joins(:user).find_by(users: { dxuser: new_lead_dxuser })
+    SpaceMembershipService::ToLead.call(api, self, member, admin_member)
+  end
+
+  def space_sponsor
+    User.find_by(dxuser: sponsor_lead_dxuser)
+  end
+
+  def invite(membership, dxuser, current_user, api)
+    space_invite_form = SpaceInviteForm.new(
+      space: self,
+      invitees_role: SpaceMembership::ROLE_ADMIN,
+      space_id: id,
+      invitees: dxuser,
+      current_user: current_user,
+    )
+
+    return unless space_invite_form.valid?
+
+    begin
+      space_invite_form.invite(membership, api)
+    rescue StandardError
+      "An error has occurred during inviting"
+    end
+  end
+
   alias_method :scope, :uid
 
+  # Space title for spaces list in actions modals
   def title
     if review?
-      confidential? ? "#{name}(Private)" : "#{name}(Shared)"
+      confidential? ? "#{name} (Private Review)" : "#{name} (Shared Review)"
     elsif verification?
-      "#{name}(Verification)"
+      "#{name} (Verification)"
+    elsif groups?
+      "#{name} (Group)"
+    elsif private_type?
+      "#{name} (Private)"
+    elsif government?
+      "#{name} (Government)"
     else
-      "#{name}(Group)"
+      "#{name} (Administrator)"
     end
   end
 
@@ -290,7 +410,6 @@ def opposite_org_dxid(member)
 
   def project_for_user(user)
     member = space_memberships.find_by(user_id: user.id)
-
     member ||= SpaceMembership.new_by_admin(user) if user.review_space_admin? || user.challenge_bot?
 
     project_dxid(member)
@@ -380,11 +499,26 @@ def editable_by?(user)
       !(restrict_to_template? && confidential?)
   end
 
+  # def updatable_by?(user)
+  #   active? && (user.review_space_admin? && reviewer? ||
+  #     space_memberships.active.lead_or_admin.exists?(user: user))
+  # end
+
   # Checks if user is able to update a space via Edit page.
   # @return [Boolean] Returns true if user is able to update a space, false otherwise.
   def updatable_by?(user)
-    active? && (user.review_space_admin? && reviewer? ||
-      space_memberships.active.lead_or_admin.exists?(user: user))
+    active? &&
+      updatable_by_rsa?(user) || space_memberships.active.lead_or_admin.exists?(user: user)
+  end
+
+  # Checks if user is RSA and able to update a space via Edit page.
+  # @return [Boolean] Returns true if user is RSA in review space and:
+  #   does not member of a space (to be able to add himself) or
+  #   is member of a space already, with 'lead' or 'admin' role.
+  def updatable_by_rsa?(user)
+    user.review_space_admin? && reviewer? &&
+      (!space_memberships.active.exists?(user: user) ||
+        space_memberships.active.lead_or_admin.exists?(user: user))
   end
 
   # Scopes of files that can be used to run an app.
@@ -392,11 +526,6 @@ def accessible_scopes
     [uid, shared_space.try(:uid)].compact
   end
 
-  # Scopes of content that can be moved to an space.
-  def accessible_scopes_for_move
-    [SCOPE_PRIVATE].freeze
-  end
-
   # Determine, whether a space is accessible by a user.
   # @param context [Context] A user context.
   # @return [Boolean] Returns true if user has access to a space, false otherwise.
@@ -418,64 +547,4 @@ def accessible_by_user?(user)
 
     user_membership.present? && (unactivated? || active? || locked? && user_membership.host?)
   end
-
-  # Used in discuss only
-  def search_content(content_type, query)
-    case content_type
-    when "Note"
-      notes.where("LOWER(title) LIKE LOWER(?)", "%#{query}%")
-        .map { |note| [note.id, note.title] }
-    when "File"
-      files.where("LOWER(name) LIKE LOWER(?)", "%#{query}%").where(parent_type: "User")
-        .map { |file| [file.id, file.name] }
-    when "Asset"
-      assets.where("LOWER(name) LIKE LOWER(?)", "%#{query}%")
-        .map { |asset| [asset.id, asset.name] }
-    when "Comparison"
-      comparisons.where("LOWER(name) LIKE LOWER(?)", "%#{query}%")
-        .map { |comparison| [comparison.id, comparison.name] }
-    when "App"
-      apps.where("LOWER(title) LIKE LOWER(?)", "%#{query}%")
-        .map { |app| [app.id, app.title] }
-    when "Workflow"
-      workflows.where("LOWER(title) LIKE LOWER(?)", "%#{query}%")
-        .map { |workflow| [workflow.id, workflow.title] }
-    when "Job"
-      jobs.where("LOWER(name) LIKE LOWER(?)", "%#{query}%")
-        .map { |job| [job.id, job.name] }
-    else
-      []
-    end.map { |i, j| { id: i, name: j } }
-  end
-
-  def can_verify_space(context)
-    (space_memberships.host.lead[0].user.dxuser == context.user.dxuser) && active?
-  end
-
-  def content_counters(user_id)
-    tasks = self.tasks.where("user_id = :user_id or assignee_id = :user_id", user_id: user_id)
-    open_tasks = tasks.open.count
-    accepted_tasks = tasks.accepted_and_failed_deadline.count
-    declined_tasks = tasks.declined.count
-    completed_tasks = tasks.completed.count
-    tasks = open_tasks + accepted_tasks + declined_tasks + completed_tasks
-
-    feed = space_events.count
-
-    {
-      feed: feed,
-      tasks: tasks,
-      notes: notes.count,
-      files: files.count,
-      apps: apps.count,
-      jobs: jobs.count,
-      comparisons: comparisons.count,
-      assets: assets.count,
-      workflows: workflows.count,
-      open_tasks: open_tasks,
-      accepted_tasks: accepted_tasks,
-      declined_tasks: declined_tasks,
-      completed_tasks: completed_tasks,
-    }
-  end
 end
diff --git a/app/models/space_event.rb b/app/models/space_event.rb
index afee3117a..b68a0c57a 100644
--- a/app/models/space_event.rb
+++ b/app/models/space_event.rb
@@ -16,49 +16,44 @@
 #
 
 class SpaceEvent < ApplicationRecord
-  OBJECT_TYPES = %i(
-    space
-    membership
-    task
-    comment
-    app
-    job
-    file
-    asset
-    comparison
-    workflow
-    note
-  ).freeze
+  OBJECT_TYPES = {
+    space: 0,
+    membership: 1,
+    comment: 3,
+    app: 4,
+    job: 5,
+    file: 6,
+    asset: 7,
+    comparison: 8,
+    workflow: 9,
+    note: 10,
+  }.freeze
 
-  ACTIVITY_TYPES = %i(
-    membership_added
-    membership_disabled
-    membership_changed
-    task_created
-    task_reassigned
-    task_completed
-    task_declined
-    task_deleted
-    job_added
-    job_completed
-    file_added
-    file_deleted
-    note_added
-    app_added
-    asset_added
-    asset_deleted
-    comparison_added
-    workflow_added
-    comment_added
-    comment_edited
-    comment_deleted
-    space_locked
-    space_unlocked
-    space_deleted
-    task_accepted
-    task_reopened
-    membership_enabled
-  ).freeze
+  ACTIVITY_TYPES = {
+    membership_added: 0,
+    membership_disabled: 1,
+    membership_changed: 2,
+    job_added: 8,
+    job_completed: 9,
+    file_added: 10,
+    file_deleted: 11,
+    note_added: 12,
+    app_added: 13,
+    asset_added: 14,
+    asset_deleted: 15,
+    comparison_added: 16,
+    workflow_added: 17,
+    comment_added: 18,
+    comment_edited: 19,
+    comment_deleted: 20,
+    space_locked: 21,
+    space_unlocked: 22,
+    space_deleted: 23,
+    task_accepted: 24,
+    task_reopened: 25,
+    membership_enabled: 26,
+    membership_deleted: 27,
+  }.freeze
 
   ROLES = %i(
     admin
@@ -68,16 +63,15 @@ class SpaceEvent < ApplicationRecord
   ).freeze
 
   DATA_ATTRIBUTES = {
-    :comment    => %i(body),
-    :app        => %i(title),
-    :note       => %i(title),
-    :space      => %i(name),
-    :task       => %i(name),
-    :job        => %i(name),
-    :file       => %i(name uid),
-    :asset      => %i(name uid),
-    :comparison => %i(name),
-    :workflow   => %i(name),
+    comment: %i(body),
+    app: %i(title),
+    note: %i(title),
+    space: %i(name),
+    job: %i(name),
+    file: %i(name uid),
+    asset: %i(name uid),
+    comparison: %i(name),
+    workflow: %i(name),
   }.freeze
 
   belongs_to :user
@@ -91,117 +85,12 @@ class SpaceEvent < ApplicationRecord
 
   store :data, coder: JSON
 
-  scope :date_range, ->(start_date=nil, end_date=nil) {
-    if start_date && end_date
-      where("created_at BETWEEN :start AND :end", start: start_date.beginning_of_day, end: end_date.end_of_day)
-    elsif start_date
-      where("created_at >= ?", start_date.beginning_of_day)
-    elsif end_date
-      where("created_at <= ?", end_date.end_of_day)
-    else
-      all
-    end
-  }
   before_create :sort_object_type, :generate_data
 
-  def activity
-    activity_type.split("_").join(" ").capitalize
-  end
-
-  def entity_name
-    case object_type
-    when "file", "asset"
-      data["uid"]
-    when "space", "task", "job", "comparison", "workflow"
-      data["name"]
-    when "comment"
-      data["body"]
-    when "app"
-      entity.title
-    when "note"
-      data['title']
-    when "membership"
-      "#{data['full_name']}(#{data['role']})"
-    else
-      ""
-    end
-  end
-
-  def additional_info
-    return if self.entity.nil?
-    if self.comment? && (obj = self.entity.content_object)
-      name =
-        if obj.klass == "file"
-          obj.dxid
-        else
-          obj.try(:name) || obj.try(:title)
-        end
-      {
-        comment_object_name: name,
-        comment_object_type: obj.klass,
-      }
-    end
-  end
-
   def data
     super || {}
   end
 
-  def self.describe_events(collection, page = 1)
-    events = collection.includes(:user, :entity)
-    events.page(page).per(10)
-      .map do |event|
-        {
-          id: event.id,
-          activity_type: event.activity,
-          object_type: event.object_type,
-          created_at: event.created_at.strftime("%m/%d/%Y"),
-          username: event.user.username,
-          user_fullname: event.user.full_name,
-          entity_name: event.entity_name,
-          entity: event.entity,
-          additional_info: event.additional_info,
-        }
-      end
-  end
-
-  def self.collection(start_date, end_date, filters = {})
-    sort = filters[:sort] ? filters[:sort] : "asc"
-    filters.delete(:sort)
-    filters.reject! { |_, v| v.blank? || v == "null" }
-    if filters[:object_type] == "[]"
-      filters[:object_type] = []
-    end
-
-    filters[:user_id] = filters.delete(:users) if filters[:users]
-    filters[:role] = filters.delete(:roles) if filters[:roles]
-    SpaceEvent.date_range(start_date, end_date).where(filters).order(created_at: sort)
-  end
-
-  def self.object_type_counters(start_date = nil, end_date = nil, filters = {})
-    events = collection(start_date, end_date, filters).group(:object_type).count
-
-    object_types.map do |type, type_idx|
-      { name: type.to_sym, value: events[type.to_s].to_i, type_id: type_idx }
-    end
-  end
-
-  def self.group_by_hour
-    select("DATE_FORMAT(created_at, '%Y-%m-%d %H:00') AS date").group("date")
-  end
-
-  def self.group_by_day
-    select("DATE(created_at) as date").group("date")
-  end
-
-  def self.group_by_month
-    select("DATE(DATE_FORMAT(created_at, '%Y-%m-01')) AS date").group("date")
-  end
-
-  def self.select_count
-    select("COUNT(id) as count")
-  end
-
   private
 
   def sort_object_type
@@ -210,15 +99,14 @@ def sort_object_type
 
   def generate_data
     new_data = SpaceEvent::DATA_ATTRIBUTES.find(-> {{}}) do |type, attributes|
-      break entity.slice(*attributes) if type.to_s == self.object_type
+      break entity.slice(*attributes) if type.to_s == object_type
     end
 
-    if self.membership?
-      new_data['role'] = entity.role
-      new_data['full_name'] = entity.user.full_name
+    if membership?
+      new_data["role"] = entity.role
+      new_data["full_name"] = entity.user.full_name
     end
 
     self.data = new_data
   end
-
 end
diff --git a/app/models/space_membership.rb b/app/models/space_membership.rb
index 1e737f864..1463108ca 100644
--- a/app/models/space_membership.rb
+++ b/app/models/space_membership.rb
@@ -83,4 +83,12 @@ def lead_or_admin_or_contributor?
   def custom_role
     { role => self[:role] }
   end
+
+  def side_alias
+    if spaces.first&.review?
+      host? ? SIDE_HOST_ALIAS : SIDE_GUEST_ALIAS
+    else
+      host? ? SIDE_HOST : SIDE_GUEST
+    end
+  end
 end
diff --git a/app/models/user.rb b/app/models/user.rb
index 01ceb6710..966941005 100644
--- a/app/models/user.rb
+++ b/app/models/user.rb
@@ -27,10 +27,11 @@
 
 class User < ApplicationRecord
   include Auditor
+  include FilesSyncing
 
   EMAIL_FORMAT = %r{
-    ^(([^<>()\[\]\\.,;:\s@\"]+(\.[^<>()\[\]\\.,;:\s@\"]+)*)|(\".+\"))@((\[[0-9]{1,3}\.
-    [0-9]{1,3}\.[0-9]{1,3}\.[0-9]{1,3}\])|(([a-zA-Z\-0-9]+\.)+[a-zA-Z]{2,}))$
+    \A(([^<>()\[\]\\.,;:\s@\"]+(\.[^<>()\[\]\\.,;:\s@\"]+)*)|(\".+\"))@((\[[0-9]{1,3}\.
+    [0-9]{1,3}\.[0-9]{1,3}\.[0-9]{1,3}\])|(([a-zA-Z\-0-9]+\.)+[a-zA-Z]{2,}))\z
   }x.freeze
 
   # The "schema_version" field is used to denote the schema
@@ -43,12 +44,6 @@ class User < ApplicationRecord
 
   enum user_state: { enabled: 0, locked: 1, deactivated: 2 }
 
-  SYNC_EXCLUDED_FILE_STATES = [
-    UserFile::STATE_CLOSED,
-    UserFile::STATE_COPYING,
-    UserFile::STATE_REMOVING,
-  ].freeze
-
   has_many :uploaded_files, class_name: "UserFile", dependent: :restrict_with_exception, as: "parent"
   has_many :user_files
   has_many :nodes
@@ -75,7 +70,6 @@ class User < ApplicationRecord
   has_many :challenge_resources
   has_many :analyses
   has_one :usage_metric
-  has_many :tasks
   has_many :workflows
   has_one :notification_preference
   has_one :profile, dependent: :destroy
@@ -86,6 +80,9 @@ class User < ApplicationRecord
            dependent: :destroy
 
   store :extras, accessors: [:has_seen_guidelines], coder: JSON
+  store :cloud_resource_settings,
+        accessors: %i(charges_baseline pricing_map job_limit total_limit resources),
+        coder: JSON
 
   include Gravtastic
   gravtastic secure: true, default: "retro"
@@ -117,13 +114,66 @@ class User < ApplicationRecord
     joins(:admin_groups).where(admin_groups: { role: AdminGroup::ROLE_CHALLENGE_EVALUATOR })
   }
 
-  validates :first_name, length: { minimum: 2, message: "The first name must be at least two letters long." }, presence: true
-  validates :last_name, length: { minimum: 2, message: "The last name must be at least two letters long." }, presence: true
-  validates :email, presence: true, uniqueness: { case_sensitive: false }
-  validates :disable_message, length: { maximum: 250, message: "Deactivation reason is too long (over 250 characters)" }
+  validates :first_name,
+            length: { minimum: 2, message: "The first name must be at least two letters long." },
+            presence: true
+  validates :last_name,
+            length: { minimum: 2, message: "The last name must be at least two letters long." },
+            presence: true
+  validates :email, presence: true, uniqueness: { case_sensitive: false }, format: EMAIL_FORMAT
+  validates :disable_message,
+            length: {
+              maximum: 250, message: "Deactivation reason is too long (over 250 characters)"
+            }
+
+  class << self
+    def challenge_bot
+      find_by!(dxuser: CHALLENGE_BOT_DX_USER)
+    end
+
+    # Selects users, according search string.
+    # Users selected are the given org members and are not in 'pending' state.
+    # @param search [String] - search string
+    # @param org [String] - org handle string
+    # @return [ActiveRecord::Relation<User>] - an array of users, searched by search string match.
+    def org_members(search, org)
+      org = Org.find_by(handle: org)
+      org_id = org&.id
+
+      query = "%" + sanitize_sql_like(search) + "%"
+      users = User.arel_table
+
+      where(users[:dxuser].matches(query).
+        or(users[:first_name].matches(query)).
+        or(users[:last_name].matches(query))).
+        belongs_to_org(org_id).
+        pending.
+        limit(ORG_MEMBERS_SEARCH_LIMIT)
+    end
+
+    def set_legacy_org_baseline_charges!(org_id, charges)
+      belongs_to_org(org_id).
+        # Note(samuel) this part is potentially slow
+        # Tried .update_all(charges_baseline: charges)
+        # Didn't work, most likely ActiveRecord bulk updating doesn't work that well with JSON types
+        each { |u| u.update(charges_baseline: charges) }
+    end
+
+    def validate_email(email)
+      EMAIL_FORMAT =~ email
+    end
+
+    def validate_state(state, zip_code)
+      Country.state_matches_zip_code?(state, zip_code)
+    end
 
-  def self.challenge_bot
-    find_by!(dxuser: CHALLENGE_BOT_DX_USER)
+    def construct_username(first, last)
+      "#{first.downcase.gsub(/[^a-z]/, '')}.#{last.downcase.gsub(/[^a-z]/, '')}"
+    end
+
+    def authserver_acceptable?(username)
+      username.size >= 3 && username.size <= 255 && username =~ /^[a-z][0-9a-z_\.]{2,}$/
+    end
   end
 
   def active_leave_org_request
@@ -167,6 +217,10 @@ def org
 
   delegate :real_files, to: :user_files
 
+  def guest?
+    dxuser.start_with?("Guest-")
+  end
+
   def singular?
     org_id.blank? || org.singular
   end
@@ -205,10 +259,6 @@ def select_text
     "#{username} (#{full_name.titleize}, #{org.name})"
   end
 
-  def is_self(context)
-    id == context.user_id
-  end
-
   def logged_in?
     !Session.find_by(user_id: id).expired?
   rescue StandardError
@@ -225,390 +275,62 @@ def can_administer_site?
     admin_groups.any?(&:site?)
   end
 
-  # Checks if a user can create spaces.
-  # @return [Boolean] Returns true if a user can create spaces, false otherwise.
-  def can_create_spaces?
-    can_administer_site? || review_space_admin?
-  end
-
-  def is_challenge_evaluator?
-    challenge_eval? || can_administer_site?
-  end
-
-  def challenge_eval?
-    admin_groups.any?(&:challenge_eval?)
-  end
-
-  def review_space_admin?
-    admin_groups.any?(&:space?)
-  end
-
-  # @param time_zone [String] new time zone
-  def update_time_zone(time_zone)
-    update(time_zone: time_zone) if Time.find_zone(time_zone)
-  end
-
-  def is_challenge_admin?
-    can_administer_site? || admin_groups.any?(&:challenge_admin?)
-  end
-
   def challenge_admin?
     admin_groups.any?(&:challenge_admin?)
   end
 
-  # Selects users, according search string.
-  # Users selected are the given org members and are not in 'pending' state.
-  # @param search [String] - search string
-  # @param org [String] - org handle string
-  # @return [ActiveRecord::Relation<User>] - an array of users, searched by search string match.
-  def self.org_members(search, org)
-    org = Org.find_by(handle: org)
-    org_id = org&.id
-
-    query = "%" + sanitize_sql_like(search) + "%"
-    users = User.arel_table
-
-    where(users[:dxuser].matches(query).
-      or(users[:first_name].matches(query)).
-      or(users[:last_name].matches(query))).
-      belongs_to_org(org_id).
-      pending.
-      limit(ORG_MEMBERS_SEARCH_LIMIT)
-  end
-
-  def self.validate_email(email)
-    EMAIL_FORMAT =~ email
-  end
-
-  def self.validate_state(state, zip_code)
-    Country.state_matches_zip_code?(state, zip_code)
-  end
-
-  def self.construct_username(first, last)
-    "#{first.downcase.gsub(/[^a-z]/, '')}.#{last.downcase.gsub(/[^a-z]/, '')}"
-  end
-
-  def self.authserver_acceptable?(username)
-    username.size >= 3 && username.size <= 255 && username =~ /^[a-z][0-9a-z_\.]{2,}$/
-  end
-
-  def self.sync_challenge_file!(file_id)
-    user = User.challenge_bot
-    token = CHALLENGE_BOT_TOKEN
-    file = user.uploaded_files.find(file_id) # Re-check file id
-
-    return if SYNC_EXCLUDED_FILE_STATES.include?(file.state)
-
-    result = DNAnexusAPI.new(token).call(
-      "system",
-      "describeDataObjects",
-      objects: [file.dxid],
-    )["results"][0]
-
-    sync_file_state(result, file, user)
+  def is_challenge_evaluator?
+    challenge_eval? || can_administer_site?
   end
 
-  def self.sync_file!(context, file_id)
-    return if context.guest?
-
-    user = context.user
-    file = user.uploaded_files.find(file_id) # Re-check file id
-    token = context.token
-
-    return if SYNC_EXCLUDED_FILE_STATES.include?(file.state)
-
-    result = DNAnexusAPI.new(token).call(
-      "system",
-      "describeDataObjects",
-      objects: [file.dxid],
-    )["results"][0]
-
-    sync_file_state(result, file, user)
+  # Government user: check if user have fda.hhs.gov email
+  def self.government_email?(email)
+    email =~ URI::MailTo::EMAIL_REGEXP && email.split("@").last == "fda.hhs.gov"
   end
 
-  def self.sync_files!(context)
-    Auditor.suppress do
-      return if context.guest?
-
-      user = context.user
-      token = context.token
-
-      # Prefer "all.each_slice" to "find_batches" as the latter might not be transaction-friendly
-      user.uploaded_files.
-        where.not(state: SYNC_EXCLUDED_FILE_STATES).
-        all.each_slice(1000) do |files|
-        DNAnexusAPI.new(token).call(
-          "system",
-          "describeDataObjects",
-          objects: files.map(&:dxid),
-        )["results"].each_with_index do |result, i|
-          sync_file_state(result, files[i], user)
-        end
-      end
-    end
+  def government_user?
+    User.government_email?(email)
   end
 
-  def self.sync_challenge_bot_files!(context)
-    return if context.guest?
-
-    user = User.challenge_bot
-    token = CHALLENGE_BOT_TOKEN
-
-    # Prefer "all.each_slice" to "find_batches" as the latter might not be transaction-friendly
-    user.uploaded_files.where.not(state: SYNC_EXCLUDED_FILE_STATES).all.each_slice(1000) do |files|
-      DNAnexusAPI.new(token).call(
-        "system",
-        "describeDataObjects",
-        objects: files.map(&:dxid),
-      )["results"].each_with_index do |result, i|
-        sync_file_state(result, files[i], user)
-      end
-    end
+  def challenge_eval?
+    admin_groups.any?(&:challenge_eval?)
   end
 
-  def self.sync_asset!(context, file_id)
-    return if context.guest?
-
-    user = context.user
-    token = context.token
-    file = user.assets.find(file_id) # Re-check file id
-
-    return if SYNC_EXCLUDED_FILE_STATES.include?(file.state)
-
-    result = DNAnexusAPI.new(token).call(
-      "system",
-      "describeDataObjects",
-      objects: [file.dxid],
-    )["results"][0]
-
-    sync_file_state(result, file, user)
+  def review_space_admin?
+    admin_groups.any?(&:space?)
   end
 
-  def self.sync_assets!(context)
-    return if context.guest?
-
-    user = context.user
-    token = context.token
-
-    # Prefer "all.each_slice" to "find_batches" as the latter might not be transaction-friendly
-    user.assets.where.not(state: SYNC_EXCLUDED_FILE_STATES).all.each_slice(1000) do |files|
-      DNAnexusAPI.new(token).call("system", "describeDataObjects", objects: files.map(&:dxid))["results"].each_with_index do |result, i|
-        sync_file_state(result, files[i], user)
-      end
-    end
+  def site_or_challenge_admin?
+    can_administer_site? || challenge_admin?
   end
 
-  def self.sync_challenge_job!(job_id)
-    user = User.challenge_bot
-    token = CHALLENGE_BOT_TOKEN
-    job = user.jobs.find(job_id) # Re-check job id
-    unless job.terminal?
-      result = DNAnexusAPI.new(token).call("system", "findJobs",
-                                           includeSubjobs: false,
-                                           id: [job.dxid],
-                                           project: user.private_files_project,
-                                           parentJob: nil,
-                                           parentAnalysis: nil,
-                                           describe: true)["results"][0]
-      sync_job_state(result, job, user, token)
-    end
+  # Checks if a user can create spaces.
+  # @return [Boolean] Returns true if a user can create spaces, false otherwise.
+  def can_create_spaces?
+    can_administer_site? || review_space_admin?
   end
 
-  def self.sync_job!(context, job_id)
-    return if context.guest?
-
-    user = context.user
-    token = context.token
-    job = Job.accessible_by(context).find(job_id) # Re-check job id
-    return if job.terminal?
-
-    result = DNAnexusAPI.new(token).call("system", "findJobs",
-                                         includeSubjobs: false,
-                                         id: [job.dxid],
-                                         project:  job.project || user.private_files_project,
-                                         parentJob: nil,
-                                         parentAnalysis: job.analysis.try(:dxid),
-                                         describe: true)["results"][0]
-    return if result.blank?
-
-    sync_job_state(result, job, user, token)
-  end
-
-  def self.sync_jobs!(context, jobs = Job.includes(:analysis), project = nil)
-    return if context.guest?
-
-    user_id = context.user_id
-    token = context.token
-    user = User.find(user_id)
-    # Prefer "all.each_slice" to "find_batches" as the latter might not be transaction-friendly
-    jobs.where(user_id: user_id).where.not(state: Job::TERMINAL_STATES).limit(SYNC_JOBS_LIMIT).each_slice(1000) do |jobs_batch|
-      jobs_hash = jobs_batch.map { |j| [j.dxid, j] }.to_h
-      jobs_hash.keys.each do |job_dxid|
-        job_project = project || Job.find_by(dxid: job_dxid).project
-
-        response = DNAnexusAPI.new(token).call(
-          "system",
-          "findJobs",
-          includeSubjobs: false,
-          id: [job_dxid],
-          project: job_project || user.private_files_project,
-          parentJob: nil,
-          describe: true,
-        )
-        response["results"].each do |result|
-          next if result.blank?
-
-          sync_job_state(result, jobs_hash[result["id"]], user, token)
-        end
-      end
-    end
-  end
+  def can_see_spaces?
+    return true if can_create_spaces?
 
-  def self.sync_challenge_jobs!
-    user = User.challenge_bot
-    # Prefer "all.each_slice" to "find_batches" as the latter might not be transaction-friendly
-    Job.where(user_id: user.id).where.not(state: Job::TERMINAL_STATES).all.each_slice(1000) do |jobs|
-      jobs_hash = jobs.map { |j| [j.dxid, j] }.to_h
-      DNAnexusAPI.new(CHALLENGE_BOT_TOKEN).call("system", "findJobs",
-                                                includeSubjobs: false,
-                                                id: jobs_hash.keys,
-                                                project: CHALLENGE_BOT_PRIVATE_FILES_PROJECT,
-                                                parentJob: nil,
-                                                parentAnalysis: nil,
-                                                describe: true)["results"].each do |result|
-        sync_job_state(result, jobs_hash[result["id"]], user, CHALLENGE_BOT_TOKEN)
-      end
-    end
+    space_memberships.active.count.positive?
   end
 
-  def self.provision_params(id)
-    user = find(id)
-    {
-      first_name: user.first_name,
-      last_name: user.last_name,
-      email: user.email,
-    }
+  def can_create_challenges?
+    site_or_challenge_admin?
   end
 
-  def self.user_helper_attribute(id, attribute)
-    find(id)[attribute]
+  def can_access_notification_preference?
+    spaces.review.any?
   end
 
-  private
-
-  def self.sync_file_state(result, file, user)
-    if result["statusCode"] == 404
-      # File was deleted by the DNAnexus stale file daemon; delete it on our end as well
-      UserFile.transaction do
-        # Use find_by(file.id) since file.reload may raise ActiveRecord::RecordNotFound
-        file = UserFile.find_by(id: file.id)
-        if file.present?
-          Event::FileDeleted.create_for(file, user)
-          file.destroy!
-        end
-      end
-    elsif result["describe"].present?
-      remote_state = result["describe"]["state"]
-
-      # Only begin transaction if stale file detected
-      if remote_state != file.state
-        UserFile.transaction do
-          old_file_state = file.state
-          file.reload
-          # confirm local file state is stale
-          if remote_state != file.state
-            if remote_state == UserFile::STATE_CLOSED
-              file.update!(state: remote_state, file_size: result["describe"]["size"])
-              Event::FileCreated.create_for(file, user)
-            elsif remote_state == UserFile::STATE_CLOSING && file.state == UserFile::STATE_OPEN ||
-                  remote_state == UserFile::STATE_ABANDONED
-              file.update!(state: remote_state)
-            else
-              # NOTE we should never be here
-              raise "File #{file.uid} had local state #{file.state} " \
-                    "(previously #{old_file_state}) and remote state #{remote_state}"
-            end
-          end
-        end
-      end
-    else
-      # NOTE we should never be here
-      raise "Unsupported response for file #{file.uid}: #{result}"
-    end
+  # @param time_zone [String] new time zone
+  def update_time_zone(time_zone)
+    update(time_zone: time_zone) if Time.find_zone(time_zone)
   end
 
-  def self.sync_job_state(result, job, user, token)
-    state = result["describe"]["state"]
-    # Only do anything if local job state is stale
-    return if state == job.state
-
-    if state == "done"
-      # Use serialization to deep copy result since output will be modified
-      output = JSON.parse(result["describe"]["output"].to_json)
-      output_file_ids = []
-      output_file_cache = []
-      output.each_key do |key|
-        # TODO: handle arrays later
-        raise if output[key].is_a?(Array)
-        next unless output[key].is_a?(Hash)
-        raise unless output[key].key?("$dnanexus_link")
-
-        output_file_id = output[key]["$dnanexus_link"]
-        output_file_ids << output_file_id
-        output[key] = output_file_id
-      end
-      output_file_ids.uniq!
-      output_file_ids.each_slice(1000) do |slice_of_file_ids|
-        DNAnexusAPI.new(token).call("system", "describeDataObjects", objects: slice_of_file_ids)["results"].each_with_index do |api_result, i|
-          # Push avoids creating a new array as opposed to +/+=
-          output_file_cache.push(
-            dxid: slice_of_file_ids[i],
-            project: job.project || user.private_files_project,
-            name: api_result["describe"]["name"],
-            state: "closed",
-            description: "",
-            user_id: user.id,
-            scope: job.scope || "private",
-            file_size: api_result["describe"]["size"],
-            parent: job,
-            parent_folder_id: job.local_folder_id,
-          )
-        end
-      end
-
-      # Job is done and outputs need to be created
-      Job.transaction do
-        job.reload
-        if state != job.state
-          output_file_cache.each do |output_file|
-            user_file = UserFile.create!(output_file)
-            if user_file.scope =~ /^space-(\d+)$/
-              user_file.update(scoped_parent_folder_id: user_file.parent_folder_id)
-            end
-            Event::FileCreated.create_for(user_file, user)
-          end
-          job.run_outputs = output
-          job.state = state
-          job.describe = result["describe"]
-          job.save!
-          Event::JobClosed.create_for(job, user)
-        end
-      end
-      if job.scope =~ /^space-(\d+)$/
-        SpaceEventService.call(Regexp.last_match(1).to_i, user.id, nil, job, :job_completed)
-      end
-    else
-      # Job state changed but not done (no outputs)
-      Job.transaction do
-        job.reload
-        if state != job.state
-          job.state = state
-          job.describe = result["describe"]
-          job.save!
-          Event::JobClosed.create_for(job, user)
-        end
-      end
-    end
+  def can_run_jobs?
+    job_limit.positive?
   end
 
   alias_method :site_admin?, :can_administer_site?
diff --git a/app/models/user_file.rb b/app/models/user_file.rb
index 781c39a37..d40cbd215 100644
--- a/app/models/user_file.rb
+++ b/app/models/user_file.rb
@@ -20,6 +20,7 @@
 #  scoped_parent_folder_id :integer
 #  uid                     :string(255)
 #  featured                :boolean          default(FALSE)
+#  entity_type             :integer          default("regular"), not null
 #
 
 # Parent types:
@@ -84,8 +85,6 @@ class UserFile < Node
   acts_as_commentable
   acts_as_votable
 
-  attr_accessor :current_user
-
   validates :name, presence: { message: "Name could not be blank" }
   validates :description,
             allow_blank: true,
@@ -98,8 +97,6 @@ class << self; undef_method :open; end
 
   scope :open, -> { where(state: STATE_OPEN) }
   scope :not_removing, -> { where.not(state: STATE_REMOVING) }
-  scope :not_copying, -> { where.not(state: STATE_COPYING) }
-  scope :not_blocked, -> { not_removing.not_copying }
 
   scope :files_conditions, -> {
     where(state: "closed").where.not(parent_type: ["Comparison", nil]).includes(:taggings)
@@ -127,10 +124,6 @@ def real_files
       where(parent_type: ["User", "Job", "Node", "Comparison"])
     end
 
-    def not_assets
-      where.not(parent_type: "Asset")
-    end
-
     def independent
       where.not(parent_type: PARENT_TYPE_COMPARISON)
     end
@@ -142,9 +135,10 @@ def closed
     # This is a class method for independent files.
     # For comparison files, use Comparison.publication_project!
     def publication_project!(user, scope)
-      if scope == SCOPE_PUBLIC
+      case scope
+      when SCOPE_PUBLIC
         user.public_files_project
-      elsif scope == SCOPE_PRIVATE
+      when SCOPE_PRIVATE
         user.private_files_project
       else
         Space.from_scope(scope).project_for_user(user)
@@ -264,15 +258,27 @@ def refresh_state(context)
   # @param generate_event [true, false] Either to generate Event::FileDownloaded or not.
   # @return [url] a file url.
   def file_url(context, inline, generate_event = true)
+    if challenge_file?
+      token = CHALLENGE_BOT_TOKEN
+      result = DNAnexusAPI.new(CHALLENGE_BOT_TOKEN).call(
+        "system",
+        "describeDataObjects",
+        objects: [dxid],
+      )["results"][0]
+      project = result["describe"]["project"]
+    else
+      token = context.token
+      project = self.project
+    end
+
     opts = {
       project: project,
       preauthenticated: true,
       filename: name,
       duration: 86_400,
     }
-    inline_attribute = inline == "true" ? "?inline" : ""
+    inline_attribute = inline.present? ? "?inline" : ""
 
-    token = challenge_file? ? CHALLENGE_BOT_TOKEN : context.token
     api = DNAnexusAPI.new(token)
     url = api.file_download(dxid, opts)["url"] + inline_attribute
     Event::FileDownloaded.create_for(self, context.user) if generate_event
@@ -302,44 +308,6 @@ def to_param
     uid
   end
 
-  # Returns a parent folder name of UserFile
-  # @param [scope] a file scope
-  # @return [String] folder name or "/" for root
-  def parent_folder_name(scope = SCOPE_PRIVATE)
-    folder = parent_folder(scope)
-    folder.blank? ? "/" : folder.name
-  end
-
-  def parent_folder(scope = SCOPE_PRIVATE)
-    column_name = Node.scope_column_name(scope)
-    Folder.find_by(id: self[column_name])
-  end
-
-  # Returns a full path to current file
-  # @param [scope] a file scope]
-  # @return [String] file path or "/" for root
-  def file_full_path(scope = SCOPE_PRIVATE)
-    parent_folder = parent_folder(scope)
-    folders = []
-    if parent_folder.blank?
-      "/"
-    else
-      folders << parent_folder_name(scope)
-      folders << parent_folder.ancestors(scope).pluck(:name)
-    end
-
-    collect_path_string(folders.flatten.reverse)
-  end
-
-  # Collects a string of file's path.
-  # @param [dir_set] Array of strings: ["second_level_folder", "third_level_folder"]
-  # @return [String] file path or "/" for root. Ex. "/second_level_folder/third_level_folder/"
-  def collect_path_string(dir_set)
-    path = "/"
-    dir_set.each { |dir| path = path + dir + "/" }
-    path
-  end
-
   def not_asset?
     parent_type != "Asset"
   end
diff --git a/app/models/wdl_object/parseable.rb b/app/models/wdl_object/parseable.rb
index 533cbe8e2..c91c7eeca 100644
--- a/app/models/wdl_object/parseable.rb
+++ b/app/models/wdl_object/parseable.rb
@@ -66,7 +66,7 @@ def parse_inputs(raw)
       # parse top level inputs definition
       raw.each_line.each_with_index do |line, index|
         # break if line's matched any top level section definition
-        break if line =~ /^.+?\s*\{\s*$/ && index != 0
+        break if line =~ /^.+?\s*\{\s*$/ && index != 0 && line.exclude?("input")
 
         input = line[/^\s*([A-Z][\w_\?]+\s+[a-zA-Z][a-zA-Z0-9_]+)\s*$/, 1]
 
diff --git a/app/models/workflow.rb b/app/models/workflow.rb
index 862b3e50a..a056d2f4b 100644
--- a/app/models/workflow.rb
+++ b/app/models/workflow.rb
@@ -19,7 +19,7 @@
 #  uid                :string(255)
 #  project            :string(255)
 #  featured           :boolean          default(FALSE)
-#  deleted            :boolean          default(FALSE)
+#  deleted            :boolean          default(FALSE), not null
 #
 
 class Workflow < ApplicationRecord
@@ -28,6 +28,7 @@ class Workflow < ApplicationRecord
   include CommonPermissions
   include InternalUid
   include Featured
+  include ObjectLocation
   include SoftRemovable
   include TagsContainer
 
@@ -63,22 +64,6 @@ def stage(slot_id)
     stages.find { |stage| stage[:slotId] == slot_id }
   end
 
-  def allow_batch_run?
-    return unless stages.any?
-
-    batch_input_spec.select { |s| s["allow_batch"] }.any?
-  end
-
-  def batch_input_spec
-    all_input_spec.map do |input|
-      input["allow_batch"] = allow_batch?(input)
-      input
-    end
-  end
-
-  def allow_batch?(input)
-    input["requiredRunInput"] && %w(file string).include?(input["class"])
-  end
 
   def all_input_spec
     stages.reduce([]) { |inputs, stage| inputs + stage["inputs"] }
diff --git a/app/models/workflow/stages/slot_presenter.rb b/app/models/workflow/stages/slot_presenter.rb
index de60698ff..044caa399 100644
--- a/app/models/workflow/stages/slot_presenter.rb
+++ b/app/models/workflow/stages/slot_presenter.rb
@@ -14,6 +14,7 @@ class SlotPresenter
       validates :prev_slot, 'workflow/non_empty_string': true, if: :prev_slot_condition
       validates :next_slot, 'workflow/non_empty_string': true, if: :next_slot_condition
       validate :input_objects_valid?
+      validate :instance_type_accessible?
 
       delegate :context, :slot_objects, :max_stage_index, to: :base_presenter
 
@@ -81,6 +82,14 @@ def next_slot_condition
         stage_index && stage_index != max_stage_index
       end
 
+      def instance_type_accessible?
+        return if context.user.resources.include?(instance_type)
+
+        errors.add \
+          :instance_type,
+          "\"#{name}\" app instance type \"#{instance_type}\" is not accessbile by you"
+      end
+
       def input_objects_valid?
         input_objects.each do |input_object|
           next if input_object.valid?
diff --git a/app/models/workflow/wdl_presenter.rb b/app/models/workflow/wdl_presenter.rb
index bc23f5159..5dda7a55c 100644
--- a/app/models/workflow/wdl_presenter.rb
+++ b/app/models/workflow/wdl_presenter.rb
@@ -56,7 +56,7 @@ def create_app(task)
       opts = app_presenter.build
 
       AppService.create_app(context.user, context.api, opts)
-    rescue => e
+    rescue StandardError
       errors.add(:base, "Can't create App for the task '#{task.name}'")
       nil
     end
diff --git a/app/models/workflow_series.rb b/app/models/workflow_series.rb
index cc60f135e..36db787a0 100644
--- a/app/models/workflow_series.rb
+++ b/app/models/workflow_series.rb
@@ -10,7 +10,8 @@
 #  scope                       :string(255)
 #  created_at                  :datetime         not null
 #  updated_at                  :datetime         not null
-#  deleted                     :boolean          default(FALSE)
+#  featured                    :boolean          default(FALSE)
+#  deleted                     :boolean          default(FALSE), not null
 #
 
 class WorkflowSeries < ApplicationRecord
diff --git a/app/policies/space_membership_policy.rb b/app/policies/space_membership_policy.rb
index 9e772baa1..ef849ccda 100644
--- a/app/policies/space_membership_policy.rb
+++ b/app/policies/space_membership_policy.rb
@@ -10,28 +10,6 @@ def can_run_apps?(space, membership)
         membership.lead_or_admin_or_contributor?
     end
 
-    def can_move_content_by_user?(space, user)
-      can_move_content?(
-        space,
-        space.space_memberships.find_by(user: user),
-      )
-    end
-
-    # Check, whether space member can make actions with a space content, for ex. with a file.
-    #   Actions could be one of: 'publish', 'delete' or 'copy_to_cooperative'.
-    # @param space [Space] - space.
-    # @param member [SpaceMembership] - an Object with a user data, who is space member.
-    # @return [true or false] - depends upon: space, member and member's role.
-    def can_move_content?(space, member)
-      return false if space.restrict_to_template? && !space.shared?
-      return false if member.blank?
-      return false unless space.active?
-      return false if member.new_record?
-      return false if member.inactive?
-
-      member.lead_or_admin_or_contributor?
-    end
-
     def can_disable?(space, admin, member)
       suitable_admin_and_member?(space, admin, member)
     end
@@ -117,6 +95,15 @@ def suitable_admin_and_member?(_space, admin, member, for_enable = false)
       return false unless admin.lead_or_admin?
 
       if for_enable
+        space_invite_params = {
+          invitees: member.user.dxuser,
+          invitees_role: member.role,
+          space_id: _space.id,
+          side: member.side,
+          current_user: admin.user,
+        }
+        return false unless check_valid_invite_form?(space_invite_params, _space)
+
         return false if member.active?
       elsif member.inactive?
         return false
@@ -126,5 +113,10 @@ def suitable_admin_and_member?(_space, admin, member, for_enable = false)
 
       admin.side == member.side
     end
+
+    def check_valid_invite_form?(space_invite_params, space)
+      space_invite_form = SpaceInviteForm.new(space_invite_params.merge(space: space))
+      space_invite_form.valid?
+    end
   end
 end
diff --git a/app/policies/space_request_policy.rb b/app/policies/space_request_policy.rb
index c93d53ebb..523363b24 100644
--- a/app/policies/space_request_policy.rb
+++ b/app/policies/space_request_policy.rb
@@ -18,5 +18,13 @@ def can_unlock?(user, space)
     user.review_space_admin? && space.shared? && space.locked?
   end
 
-  alias_method :can_delete?, :can_unlock?
+  # Determines if space can be deleted by user.
+  # @param user [User] User that tries to delete space.
+  # @param space [Space] Space that is to be deleted.
+  # @return [true, false] Returns true if space can be unlocked by user, false otherwise.
+  def can_delete?(user, space)
+    return true if user.site_admin?
+
+    user.review_space_admin? && space.shared?
+  end
 end
diff --git a/app/policies/user_policy.rb b/app/policies/user_policy.rb
index 15f319292..814110979 100644
--- a/app/policies/user_policy.rb
+++ b/app/policies/user_policy.rb
@@ -5,14 +5,17 @@ class << self
     # Visibility of the spaces' button
     def can_see_spaces?(context)
       return false unless context.logged_in?
-      return true if context.user.review_space_admin?
-      return true if context.user.can_administer_site?
+      context.user.can_see_spaces?
+    end
+
+    def can_see_gsrs?(context)
+      return false unless context.logged_in?
 
-      context.user.space_memberships.active.count > 0
+      !context.user.guest?
     end
 
     def access_notification_preference?(user)
-      user.spaces.review.any?
+      user.spaces.any?
     end
 
   end
diff --git a/app/presenters/workflow_diagram_presenter.rb b/app/presenters/workflow_diagram_presenter.rb
new file mode 100644
index 000000000..181a201e0
--- /dev/null
+++ b/app/presenters/workflow_diagram_presenter.rb
@@ -0,0 +1,36 @@
+# Workflow diagram presenter to present data
+# Used in HomeWorkflowsDiagram component
+# It receives an instance of a Workflow
+class WorkflowDiagramPresenter
+  class << self
+    def call(*args)
+      new(*args).call
+    end
+  end
+
+  def initialize(workflow)
+    @workflow = workflow
+  end
+
+  def call
+    {
+      data: { stages: schema },
+    }
+  end
+
+  private
+
+  attr_accessor :workflow
+
+  # Stage 1: [,...]
+  # 0: {name: "app_1", prev_slot: null, next_slot: "stage-17097", slotId: "stage-4",}
+  # 1: {name: "app_1", prev_slot: null, next_slot: "stage-17097", slotId: "stage-jiz",}
+  # Stage 2: [,...]
+  # 0: {name: "app_1", prev_slot: "stage-4", next_slot: null, slotId: "stage-17",}
+  # 1: {name: "copier", prev_slot: "stage-4", next_slot: null, slotId: "stage-aj",}
+  def schema
+    workflow.spec.dig(:input_spec, :stages).group_by { |h| h[:stageIndex] }
+  rescue StandardError => _e
+    []
+  end
+end
diff --git a/app/serializers/accepted_license_serializer.rb b/app/serializers/accepted_license_serializer.rb
new file mode 100644
index 000000000..4f780e70e
--- /dev/null
+++ b/app/serializers/accepted_license_serializer.rb
@@ -0,0 +1,15 @@
+# AcceptedLicense serializer.
+class AcceptedLicenseSerializer < ApplicationSerializer
+  attributes(
+    :id,
+    :license_id,
+    :state,
+    :added_by,
+    :added_by_fullname,
+    :created_at_date_time,
+    :message,
+  )
+  attribute :all_tags_list, key: :tags
+
+  delegate :all_tags_list, to: :object
+end
diff --git a/app/serializers/analysis_serializer.rb b/app/serializers/analysis_serializer.rb
new file mode 100644
index 000000000..137530d65
--- /dev/null
+++ b/app/serializers/analysis_serializer.rb
@@ -0,0 +1,111 @@
+# Analysis serializer
+class AnalysisSerializer < ApplicationSerializer
+  include Permissions
+  include ApplicationHelper
+
+  attributes(
+    :active, :app_title, :added_by, :added_by_fullname,
+    :created_at, :dxid, :featured, :id, :in_space,
+    :jobs, :launched_by, :launched_on, :location, :links,
+    :name, :object_type, :revision, :user, :uid, :version,
+    :workflow_series_id, :workflow, :workflow_title
+  )
+
+  def uid
+    object.workflow.uid
+  end
+
+  def in_space
+    object.workflow.in_space?
+  end
+
+  def added_by
+    added_by_fullname
+  end
+
+  def revision
+    object.workflow.revision
+  end
+
+  def featured
+    object.workflow.featured
+  end
+
+  def active
+    object.workflow.not_deleted?
+  end
+
+  def workflow_series_id
+    object.workflow.workflow_series_id
+  end
+
+  def version
+    object.workflow.edit_version
+  end
+
+  def location
+    ""
+  end
+
+  def app_title
+    ""
+  end
+
+  def workflow_title
+    (object.workflow.title.presence + batch_meta) || "N/A"
+  end
+
+  def launched_by
+    added_by_fullname
+  end
+
+  def launched_on
+    formatted_date_time object.created_at
+  end
+
+  def links
+    return {} unless logged_user
+
+    {}.tap do |links|
+      links[:show] = workflow_path(object.workflow) if accessible_by_user?(logged_user)
+      links[:user] = user_path(object.workflow.user.dxuser)
+      links[:space] = "/spaces/#{object.workflow.space_object.id}" if object.workflow.in_space?
+      links[:attach_to] = api_attach_to_notes_path
+      links[:copy] = copy_api_workflows_path
+      links[:run_workflow] = api_run_workflow_path
+      links[:batch_run_workflow] = batch_workflow_workflow_path(object.workflow)
+      links[:edit] = edit_workflow_path(object.workflow)
+      links[:fork] = fork_workflow_path(object.workflow)
+      links[:cwl_export] = cwl_export_workflow_path(object.workflow)
+      links[:wdl_export] = wdl_export_workflow_path(object.workflow)
+      if object.workflow.owned_by_user?(object.workflow.user)
+        links[:delete] = delete_api_workflows_path
+      end
+      object.workflow.user.can_administer_site? &&
+        links[:feature] = feature_api_workflows_path
+    end
+  end
+
+  def jobs
+    object.jobs.map do |job|
+      job.current_user = logged_user
+      JobSerializer.new(job).serializable_hash
+    end
+  end
+
+  def object_type
+    instance_options[:type]
+  end
+
+  def meta
+    instance_options[:meta]
+  end
+
+  def batch_meta
+    meta.empty? ? "" : " (#{meta.join(' of ')})"
+  end
+
+  def user_id
+    logged_user.id
+  end
+end
diff --git a/app/serializers/app_serializer.rb b/app/serializers/app_serializer.rb
index cb515c6b4..ba98bbecc 100644
--- a/app/serializers/app_serializer.rb
+++ b/app/serializers/app_serializer.rb
@@ -4,14 +4,17 @@ class AppSerializer < ApplicationSerializer
     :id,
     :uid,
     :dxid,
+    :entity_type,
     :name,
     :title,
     :added_by,
     :added_by_fullname,
     :created_at,
     :created_at_date_time,
+    :updated_at,
     :location,
     :readme,
+    :scope,
     :revision,
     :app_series_id,
     :run_by_you,
@@ -23,6 +26,17 @@ class AppSerializer < ApplicationSerializer
   )
 
   attribute :all_tags_list, key: :tags
+  attribute :job_count, key: :job_count
+  attribute :scope_id, key: :scope
+  delegate :updated_at, to: :object
+
+  def scope_id
+    object.scope
+  end
+
+  def job_count
+    object.app_series.jobs.distinct.count
+  end
 
   # Returns a tags list for an App
   def all_tags_list
@@ -79,7 +93,7 @@ def links
       links[:space] = space_path if object.in_space?
       links[:jobs] = jobs_api_app_path(object)
       # GET track single app
-      links[:track] = track_object
+      links[:track] = track_path(id: object.uid)
       # GET /apps/:id/fork - fork a single app
       links[:fork] = fork_app_path(object)
       # POST export a single app to a docker container
@@ -112,18 +126,14 @@ def links
       if can_run? && !object.in_locked_space?
         unless member_viewer?
           # app single run
-          links[:run_job] = new_app_job_path(
-            object.app_series.latest_version_app || object.app_series.latest_revision_app,
-          )
+          links[:run_job] = new_app_job_path(object.uid)
           # GET app batch run
           links[:batch_run] = batch_app_app_path(object.uid)
         end
       end
       unless object.in_space?
         # app single run
-        links[:run_job] = new_app_job_path(
-          object.app_series.latest_version_app || object.app_series.latest_revision_app,
-        )
+        links[:run_job] = new_app_job_path(object.uid)
         # GET app batch run
         links[:batch_run] = batch_app_app_path(object.uid)
       end
diff --git a/app/serializers/application_serializer.rb b/app/serializers/application_serializer.rb
index fcc9f515b..2b1ad449c 100644
--- a/app/serializers/application_serializer.rb
+++ b/app/serializers/application_serializer.rb
@@ -13,11 +13,21 @@ def logged_user
   end
 
   # license of the file with selected attributes
-  # when file doe not have license - return {}
+  # when file does not have license - return {}
   def file_license
     object.license&.slice(:id, :uid, :title) || {}
   end
 
+  # Returns license pending status for the object
+  # @return [show_license_pending] true or false
+  def show_license_pending
+    if object.license&.approval_required
+      object.license_status?(current_user, "pending")
+    else
+      false
+    end
+  end
+
   # Check whether object could be licensed - means,
   # current_user is the owner of the object, independently of object scope
   def licenseable
@@ -54,14 +64,6 @@ def member_lead?
     current_membership&.role == "lead"
   end
 
-  # GET
-  # Returns url for object tracking.
-  # @param object.uid [String]
-  # @return [String] url.
-  def track_object
-    "/track?id=#{object.uid}"
-  end
-
   # POST
   # Returns url for object tracking.
   # @param object.uid [String]
@@ -70,31 +72,6 @@ def publish_object
     "/publish?id=#{object.uid}"
   end
 
-  # POST
-  # Returns url for object associating to the license.
-  # @param license_id [Integer]
-  # @param [object.uid] [Array of object uids]
-  # @return [String] url.
-  def licensed_object
-    "/licenses/:id/license_item?items_to_license=#{[object.uid]}"
-  end
-
-  # Returns object's location - its scope
-  # @return [String] Scope - a value on of: 'public', 'private' or 'space-xxx'.
-  #   Scope or Space name are titleized.
-  def location
-    if object.in_space?
-      space_name = object.space_object.name
-      if object.space_object.confidential?
-        space_name + " - Private"
-      else
-        space_name + " - Shared"
-      end
-    else
-      object.scope.titleize
-    end
-  end
-
   # Returns a user who has created this app.
   # @return [String] User full_name.
   def added_by_fullname
diff --git a/app/serializers/asset_serializer.rb b/app/serializers/asset_serializer.rb
index cc2a32460..0217f9636 100644
--- a/app/serializers/asset_serializer.rb
+++ b/app/serializers/asset_serializer.rb
@@ -1,8 +1,5 @@
 # Asset serializer.
 class AssetSerializer < UserFileSerializer
-  include ActionView::Helpers::NumberHelper
-  include FilesHelper
-
   attributes(
     :uid,
     :created_at_date_time,
@@ -12,8 +9,6 @@ class AssetSerializer < UserFileSerializer
     :file_license,
   )
 
-  attribute :all_tags_list, key: :tags
-
   # get array of asset archive_entries
   def archive_content
     object.file_paths
@@ -21,53 +16,80 @@ def archive_content
 
   # Builds links to files.
   # @return [Hash] Links.
+  # rubocop:disable Metrics/MethodLength
   def links
     return {} unless current_user
 
-    {}.tap do |links|
+    # rubocop:disable Metrics/BlockLength
+    super.tap do |links|
       links[:show] = api_asset_path(object)
       links[:user] = user_path(object.user.dxuser)
       links[:space] = space_path if object.in_space?
 
-      # GET download single file #
-      links[:download] = download_api_file_path(object)
-      # POST download_list files #
+      # POST download_list asset
       links[:download_list] = download_list_api_files_path
-      # POST Authorize URL - to move to api #
-      links[:link] = link_file_path(object)
+      # POST /api/files/copy  copy_api_files
+      links[:copy] = copy_api_files_path
+
+      if object.license.present? && object.license_status?(current_user, "active")
+        unless object.license.owned_by_user?(current_user)
+          # GET download single asset
+          links[:download] = download_api_file_path(object)
+        end
+      end
+
+      if object.license.blank? && object.owned_by_user?(current_user)
+        # GET download single asset
+        links[:download] = download_api_file_path(object)
+      end
+
+      if object.license.present? && !object.license_status?(current_user, "active")
+        if object.license.approval_required
+          unless object.license_status?(current_user, "pending")
+            # GET|POST /licenses/:id/request_approval
+            links[:request_approval_license] =
+              request_approval_license_path(object.license.id)
+            links[:request_approval_action] = "api/licenses/:id/request_approval"
+          end
+        else
+          # POST /api/licenses/:id/accept
+          links[:accept_license_action] =
+            object.license && accept_api_license_path(object.license.id)
+        end
+      end
 
       # GET asset license page if exists
       links[:show_license] = license_path(object.license.id) if object.license
 
       if object.owned_by_user?(current_user)
-        # POST: /api/assets/rename
-        links[:rename] = rename_api_assets_path(object)
-        # publish single asset if it is not public already
-        links[:publish] = publish_object unless object.public?
-        # PUT /api/assets/:id update single asset: title and description permitted
-        links[:update] = api_asset_path(object)
-        # DELETE: /api/assets/:id - Delete single asset
-        links[:remove] = api_asset_path(object)
-        if object.license
-          # GET asset license object if exists
-          links[:object_license] = api_license_path(object.license&.id)
-          # POST detach license from item
-          links[:detach_license] = "/api/licenses/:id/remove_item/:item_uid"
+        unless object.in_space? && member_viewer?
+          # publish single asset if it is not public already
+          links[:publish] = publish_object unless object.public?
+          # POST: /api/assets/rename
+          links[:rename] = rename_api_assets_path(object)
+          # DELETE: /api/assets/:id - Delete single asset
+          links[:remove] = api_asset_path(object)
+          # POST associate item to a license
+          links[:license] = "/api/licenses/:id/license_item/:item_uid" if licenseable
+          if object.license&.owned_by_user?(current_user)
+            # GET asset license object if exists
+            links[:object_license] = api_license_path(object.license&.id)
+            # POST detach license from item
+            links[:detach_license] = "/api/licenses/:id/remove_item/:item_uid"
+          end
+          # PUT /api/assets/:id update single asset: title and description permitted
+          links[:update] = api_asset_path(object)
         end
-        # POST associate item to a license
-        links[:license] = "/api/licenses/:id/license_item/:item_uid" if licenseable
-        # POST /api/attach_to: api_attach_to_notes, discussions, answers
-        links[:attach_to] = api_attach_to_notes_path
-        # POST /api/files/copy copy_api_files
-        links[:copy] = copy_api_files_path
       end
+      # POST /api/attach_to: api_attach_to_notes, discussions, answers
+      links[:attach_to] = api_attach_to_notes_path
 
       if current_user.can_administer_site?
         # PUT /api/assets/feature #
         links[:feature] = feature_api_assets_path
       end
+      # rubocop:enable Metrics/BlockLength
     end
   end
-
-  delegate :all_tags_list, to: :object
+  # rubocop:enable Metrics/MethodLength
 end
diff --git a/app/serializers/challenge_serializer.rb b/app/serializers/challenge_serializer.rb
new file mode 100644
index 000000000..16677bb08
--- /dev/null
+++ b/app/serializers/challenge_serializer.rb
@@ -0,0 +1,47 @@
+# Challenge serializer.
+class ChallengeSerializer < ApplicationSerializer
+  attributes(
+    :id,
+    :name,
+    :description,
+    :meta,
+    :start_at,
+    :end_at,
+    :created_at,
+    :updated_at,
+    :status,
+    :card_image_url,
+    :card_image_id,
+    :pre_registration_url,
+    :links,
+  )
+
+  attribute :followed?, key: :is_followed
+  attribute :can_edit?, key: :can_edit
+  attribute :space_member?, key: :is_space_member
+
+  def can_edit?
+    current_user && object.editable_by?(current_user)
+  end
+
+  def followed?
+    current_user && object.followed_by?(current_user)
+  end
+
+  def space_member?
+    current_user && object.space_member?(current_user)
+  end
+
+  def links
+    return unless current_user
+
+    {}.tap do |links|
+      links[:edit] = edit_challenge_path(object) if object.editable_by?(current_user)
+      links[:editor] = edit_page_challenge_path(object) if object.editable_by?(current_user)
+      if object.accepting_submissions?
+        links[:new_submission] = new_challenge_submission_path(challenge_id: object.id,
+                                                                   app_dxid: object.app)
+      end
+    end
+  end
+end
diff --git a/app/serializers/custom_challenge_serializer.rb b/app/serializers/custom_challenge_serializer.rb
new file mode 100644
index 000000000..89554fe6f
--- /dev/null
+++ b/app/serializers/custom_challenge_serializer.rb
@@ -0,0 +1,37 @@
+# Custom Challenge serializer used in edit challenge form.
+class CustomChallengeSerializer < ApplicationSerializer
+  attributes(
+    :id,
+    :name,
+    :description,
+    :meta,
+    :start_at,
+    :end_at,
+    :created_at,
+    :updated_at,
+    :status,
+    :card_image_url,
+    :card_image_id,
+    :pre_registration_url,
+    :host_lead_dxuser,
+    :guest_lead_dxuser,
+    :scope,
+    :app_owner_id,
+  )
+
+  def host_lead_dxuser
+    object.space.host_lead_dxuser
+  end
+
+  def guest_lead_dxuser
+    object.space.guest_lead_dxuser
+  end
+
+  def app_owner_id
+    [object.app_owner.select_text, object.app_owner.id]
+  end
+
+  def scope
+    object.scope
+  end
+end
diff --git a/app/serializers/db_cluster_serializer.rb b/app/serializers/db_cluster_serializer.rb
new file mode 100644
index 000000000..13b43e4fe
--- /dev/null
+++ b/app/serializers/db_cluster_serializer.rb
@@ -0,0 +1,104 @@
+# DB Cluster serializer.
+class DbClusterSerializer < ApplicationSerializer
+  attributes(
+    :id,
+    :dxid,
+    :uid,
+    :name,
+    :title,
+    :status,
+    :location,
+    :scope_name,
+    :description,
+    :added_by,
+    :added_by_fullname,
+    :created_at,
+    :created_at_date_time,
+    :engine, # aurora-mysql, aurora-postgresql
+    :engine_version, # see possible values in the documentation
+    :dx_instance_class,
+    :status_as_of,
+    :status_updated_date_time,
+    :host,
+    :port,
+    :show_license_pending,
+    :tags,
+    :links,
+  )
+  delegate :scope, to: :object
+  delegate :license, to: :object, allow_nil: true
+
+  attribute :scope_name, key: :scope
+  attribute :all_tags_list, key: :tags
+
+  # Returns formatted status_as_of time.
+  # @return [String] Formatted time.
+  def status_updated_date_time
+    formatted_date_time(object.status_as_of)
+  end
+
+  def title
+    object.name
+  end
+
+  def scope_name
+    object.scope
+  end
+
+  def added_by
+    object.user.full_name
+  end
+
+  def added_by_dxuser
+    object.user.dxuser
+  end
+
+  # Builds links.
+  # @return [Hash] Links.
+  def links
+    {}.tap do |links|
+      links[:show] = api_dbcluster_path(dxid: object.dxid)
+      links[:user] = user_path(added_by_dxuser)
+      links[:space] = space_path if object.in_space?
+      links[:create] = api_dbcluster_path(dxid: object.dxid)
+      links[:update] = api_dbcluster_path(dxid: object.dxid)
+      links[:attach_to] = api_attach_to_notes_path
+      links[:track] = track_path(id: object.uid)
+
+      licenses_links!(links)
+    end
+  end
+
+  def licenses_links!(links)
+    unless license
+      links_for_run_actions!(links)
+      return
+    end
+
+    links[:show_license] = license_path(license)
+
+    if object.license_status?(current_user, AcceptedLicense::STATUS_ACTIVE)
+      links_for_run_actions!(links) unless license.owned_by_user?(current_user)
+    elsif license.approval_required &&
+          !object.license_status?(current_user, AcceptedLicense::STATUS_PENDING)
+      links[:request_approval_license] = request_approval_license_path(license)
+    else
+      links[:accept_license] = accept_api_license_path(license)
+    end
+
+    return unless object.owned_by_user?(current_user) && !member_viewer?
+
+    links[:license] = "/api/licenses/:id/license_item/:item_uid" if object.user == current_user
+
+    return unless license.owned_by_user?(current_user)
+
+    links[:object_license] = api_license_path(license)
+    links[:detach_license] = "/api/licenses/:id/remove_item/:item_uid"
+  end
+
+  def links_for_run_actions!(links)
+    links[:start] = run_api_dbclusters_path(api_method: :start)
+    links[:stop] = run_api_dbclusters_path(api_method: :stop)
+    links[:terminate] = run_api_dbclusters_path(api_method: :terminate)
+  end
+end
diff --git a/app/serializers/expert_serializer.rb b/app/serializers/expert_serializer.rb
new file mode 100644
index 000000000..1df221315
--- /dev/null
+++ b/app/serializers/expert_serializer.rb
@@ -0,0 +1,50 @@
+# Expert serializer.
+class ExpertSerializer < ApplicationSerializer
+  attributes(
+    :id,
+    :user_id,
+    :image,
+    :state,
+    :scope,
+    :created_at,
+    :updated_at,
+    :title,
+    :about,
+    :blog_title,
+    :blog_preview,
+    :blog,
+    :total_question_count,
+    :total_answer_count,
+    :total_comment_count,
+  )
+
+  delegate :scope, :title, :total_comment_count, to: :object
+  def about
+    object._about
+  end
+
+  def blog_title
+    object._blog_title
+  end
+
+  # blog_preview - A short preview text of the blog to be displayed in a list as a preview.
+  #                Changing the attribute name from _challenge (which is how it is stored
+  #                in the 'meta' column) to avoid confusion to the consumers of the API
+  #
+  def blog_preview
+    object._challenge
+  end
+
+  # blog - the main body of the blog
+  def blog
+    object._blog
+  end
+
+  def total_question_count
+    object.answered_questions.count + object.ignored_questions.count + object.open_questions.count
+  end
+
+  def total_answer_count
+    object.answered_questions.count
+  end
+end
diff --git a/app/serializers/file_actions_serializer.rb b/app/serializers/file_actions_serializer.rb
index 3fd794033..0aedab707 100644
--- a/app/serializers/file_actions_serializer.rb
+++ b/app/serializers/file_actions_serializer.rb
@@ -11,7 +11,8 @@ class FileActionsSerializer < ApplicationSerializer
   attribute :klass, key: :type
   attribute :fs_path, key: :fsPath
   attribute :view_url, key: :viewURL
-  attribute :download_url, key: :downloadURL, if: -> { object.is_a?(UserFile) && download_action? }
+  attribute :download_url, key: :downloadURL,
+                           if: -> { object.is_a?(UserFile) && download_or_open_action? }
 
   # Returns a path to a file starting from root folder.
   # @return [String] A path to a file.
@@ -24,7 +25,7 @@ def fs_path
   # Returns a view url to file or folder.
   # @return [String] A view URL.
   def view_url
-    object.is_a?(Folder) ? pathify_folder(object) : file_path(object)
+    pathify(object)
   end
 
   # Returns a download url to a file.
@@ -35,10 +36,13 @@ def download_url
 
   private
 
-  # Checks if action is download.
+  # Checks if action is download or open.
   # @return [Boolean] Returns true if action is download, false otherwise.
-  def download_action?
-    @instance_options[:action_name] == Api::FilesController::DOWNLOAD_ACTION
+  def download_or_open_action?
+    [
+      Api::FilesController::DOWNLOAD_ACTION,
+      Api::FilesController::OPEN_ACTION,
+    ].include?(@instance_options[:action_name])
   end
 
   # Returns files scope label.
diff --git a/app/serializers/folder_serializer.rb b/app/serializers/folder_serializer.rb
index 1146a3b9d..791ab95e1 100644
--- a/app/serializers/folder_serializer.rb
+++ b/app/serializers/folder_serializer.rb
@@ -15,20 +15,30 @@ def path
   def links
     return {} unless current_user
 
-    {}.tap do |links|
+    super.tap do |links|
       unless object.in_space? && member_viewer?
         # POST /api/folders/rename_folder
-        links[:rename_folder] = rename_folder_api_folders_path(object)
-        # POST: Move file(s) and folder()s) to other folder
-        links[:organize] = move_api_files_path
-        # POST: /api/files/remove - Delete file(s) & folder(s), being selected
-        links[:remove] = remove_api_files_path
+        if object.owned_by_user?(current_user)
+          links[:rename_folder] = rename_folder_api_folders_path(object)
+          # POST: Move file(s) and folder()s) to other folder
+          links[:organize] = move_api_files_path
+          # POST: /api/files/remove - Delete file(s) & folder(s), being selected
+          links[:remove] = remove_api_files_path
+        end
       end
-      links[:publish] = publish_folders_api_folders_path if current_user.can_administer_site?
+
       links[:user] = user_path(object.user.dxuser)
       links[:space] = space_path if object.in_space?
       links[:copy] = copy_api_files_path
       links[:children] = children_api_folders_path
+
+      if current_user.can_administer_site?
+        links[:publish] = publish_folders_api_folders_path unless object.parent_folder_id
+        # PUT /api/files/feature
+        links[:feature] = feature_api_files_path
+        # POST: Move file(s) and folder()s) to other folder
+        links[:organize] = move_api_files_path
+      end
     end
   end
 
diff --git a/app/serializers/invitation_serializer.rb b/app/serializers/invitation_serializer.rb
new file mode 100644
index 000000000..fadec21df
--- /dev/null
+++ b/app/serializers/invitation_serializer.rb
@@ -0,0 +1,18 @@
+# Serializes invitation
+class InvitationSerializer
+  # Serializes invitation.
+  # @param invitation [Invitation] Invitation to serialize.
+  # @return [Hash] Serialized invitation.
+  def self.call(invitation)
+    {
+      id: invitation.id,
+      first_name: invitation.first_name,
+      last_name: invitation.last_name,
+      email: invitation.email,
+      duns: invitation.duns,
+      created_at: invitation.created_at.strftime("%Y-%m-%d %H:%M"),
+      organize_intent: invitation.organize_intent,
+      participate_intent: invitation.participate_intent,
+    }
+  end
+end
diff --git a/app/serializers/job_serializer.rb b/app/serializers/job_serializer.rb
index 20ddaab68..6bd786b31 100644
--- a/app/serializers/job_serializer.rb
+++ b/app/serializers/job_serializer.rb
@@ -9,6 +9,7 @@ class JobSerializer < ApplicationSerializer
     :state,
     :name,
     :app_title,
+    :app_uid,
     :app_revision,
     :app_active,
     :workflow_title,
@@ -20,6 +21,8 @@ class JobSerializer < ApplicationSerializer
     :duration,
     :duration_in_seconds,
     :energy_consumption,
+    :failure_reason,
+    :failure_message,
     :created_at,
     :created_at_date_time,
     :scope,
@@ -28,13 +31,15 @@ class JobSerializer < ApplicationSerializer
     :launched_on,
     :featured,
     :links,
+    :entity_type,
     :logged_dxuser,
   )
 
   attribute :all_tags_list, key: :tags
   attr_reader :launched_on
 
-  delegate :name, to: :object
+  delegate :name, :location, to: :object
+  delegate :failure_reason, :failure_message, to: :object
 
   # Returns a run input_data for each input.
   # @return [Array] of objects [
@@ -67,27 +72,36 @@ def run_output_data
   # Returns a run_data output file uid, updated if output is of type 'file'
   # @return run_data [Hash] Contains:
   #   { ... "run_outputs" => { "qf1 " => "file-Fz1qBXQ06fZ9PGyy3yKxqb0j-1" } }
+  # Be careful that not all run_outputs values are strings, e.g.
+  #   { ... "run_outputs" => { "float_output" => 0.997611725020877 } }
   def run_data_updates
-    object.run_data["run_outputs"]&.each { |_k, v| v&.concat("-1") if v[0..3] == "file" }
+    object.run_data["run_outputs"]&.each { |_k, v| v&.concat("-1") if v.is_a?(String) && v[0..3] == "file" }
     object.run_data
   end
 
+  # TODO: (samuel) - fix properly by adding NOT NULL constraint on db column
   # Returns a title of an app.
   # @return [String] app title.
   def app_title
-    object.app.title
+    object.app&.title
   end
 
+  def app_uid
+    object.app&.uid
+  end
+
+  # TODO: (samuel) - fix properly by adding NOT NULL constraint on db column
   # Returns a revision of an app.
   # @return [Numeric] app revision.
   def app_revision
-    object.app.revision
+    object.app&.revision
   end
 
+  # TODO: (samuel) - fix properly by adding NOT NULL constraint on db column
   # Returns if app is active (not-deleted).
   # @return [Boolean] app active flag.
   def app_active
-    object.app.not_deleted?
+    object.app&.not_deleted?
   end
 
   # Returns a user who has created this Job.
@@ -168,8 +182,9 @@ def links
       links[:show] = job_path(object)
       # link to user who run a job - api_job_path
       links[:user] = user_path(object.user.dxuser)
+      # TODO: (samuel) - fix properly by adding NOT NULL constraint on db column
       # show job's app details page - api_app_path
-      links[:app] = app_path(object.app)
+      links[:app] = app_path(object.app) if object.app
       # show job's workflow details page
       links[:workflow] =
         object.try(:analysis).try(:workflow) ? workflow_path(object.analysis.workflow) : "N/A"
@@ -180,26 +195,35 @@ def links
       # GET show job's logs page: TODO: move to api/jobs
       links[:log] = log_job_path(object)
       # GET track single object
-      links[:track] = track_object
+      links[:track] = track_path(id: object.uid)
       # POST /api/attach_to: api_attach_to_notes, discussions, answers
       links[:attach_to] = api_attach_to_notes_path
       # POST /api/jobs/copy  copy_api_jobs
       links[:copy] = copy_api_jobs_path
       # POST /api/jobs/terminate
       links[:terminate] = terminate_api_jobs_path unless object.terminal?
+
+      # GET /api/jobs/:id/open_external
+      links[:open_external] = open_external_api_job_path(object) if object.https? && object.running?
+      # GET /api/jobs/:id/sync_files
+      links[:sync_files] = sync_files_api_job_path(object.dxid) if object.https? && object.running?
+
       # this job's app single run
       if object.in_space?
         unless member_viewer?
           links[:run_job] = new_app_job_path(
-            object.app.app_series.latest_version_app || object.app.app_series.latest_revision_app,
+            # TODO: (samuel) - fix properly by adding NOT NULL constraint on db column
+            object.app&.app_series&.latest_version_app || object.app&.app_series&.latest_revision_app,
           )
           links[:space] = space_path
         end
       else
         links[:run_job] = new_app_job_path(
-          object.app.app_series.latest_version_app || object.app.app_series.latest_revision_app,
+          # TODO: (samuel) - fix properly by adding NOT NULL constraint on db column
+          object.app&.app_series&.latest_version_app || object.app&.app_series&.latest_revision_app,
         )
       end
+
       if logged_user.can_administer_site?
         # PUT /api/jobs/feature
         links[:feature] = feature_api_jobs_path
diff --git a/app/serializers/news_item_serializer.rb b/app/serializers/news_item_serializer.rb
new file mode 100644
index 000000000..21be31b15
--- /dev/null
+++ b/app/serializers/news_item_serializer.rb
@@ -0,0 +1,16 @@
+# NewsItem serializer.
+class NewsItemSerializer < ApplicationSerializer
+  attributes(
+    :id,
+    :title,
+    :link,
+    :when,
+    :content,
+    :user_id,
+    :video,
+    :position,
+    :published,
+    :created_at,
+    :updated_at,
+  )
+end
diff --git a/app/serializers/node_serializer.rb b/app/serializers/node_serializer.rb
index f48293814..41ee18f1b 100644
--- a/app/serializers/node_serializer.rb
+++ b/app/serializers/node_serializer.rb
@@ -1,5 +1,10 @@
 # Node serializer.
 class NodeSerializer < ApplicationSerializer
+  include ActionView::Helpers::NumberHelper
+  include FilesHelper
+
+  delegate :all_tags_list, to: :object
+
   attributes(
     :id,
     :name,
@@ -8,11 +13,34 @@ class NodeSerializer < ApplicationSerializer
     :location,
     :added_by,
     :created_at,
-    :all_tags_list,
     :featured,
+    :scope,
+    :space_id,
   )
 
   attribute :sti_type, key: :type
+  attribute :origin, if: -> { object.is_a?(UserFile) || object.is_a?(Folder) && object.https? }
+  attribute :all_tags_list, key: :tags
+  attribute :scope_id, key: :scope
+
+  def scope_id
+    object.scope
+  end
+
+  # Builds links to files.
+  # @return [Hash] Links.
+  def links
+    return {} unless current_user
+
+    {}.tap do |links|
+      links[:origin_object] = origin_object
+    end
+  end
+
+  # Returns object's space id - when object is in space
+  def space_id
+    object.space_object&.scope if object.in_space?
+  end
 
   # Returns a user who has created this node.
   # @return [String] User full name.
@@ -25,4 +53,19 @@ def added_by
   def created_at
     formatted_time(object.created_at)
   end
+
+  # Returns a node's origin: one of Executable, Uploaded or Job origin data.
+  # @return [String] origin name.
+  def origin
+    return unless current_user
+
+    node_origin(object, current_user)
+  end
+
+  def origin_object
+    {
+      origin_type: object.parent&.class&.name,
+      origin_uid: object.parent&.uid,
+    }
+  end
 end
diff --git a/app/serializers/participant_serializer.rb b/app/serializers/participant_serializer.rb
new file mode 100644
index 000000000..431e186af
--- /dev/null
+++ b/app/serializers/participant_serializer.rb
@@ -0,0 +1,13 @@
+# Participant serializer
+class ParticipantSerializer < ApplicationSerializer
+  attributes(
+    :id,
+    :title,
+    :image_url,
+    :public,
+    :kind,
+    :position,
+    :created_at,
+    :updated_at,
+  )
+end
diff --git a/app/serializers/space_serializer.rb b/app/serializers/space_serializer.rb
index 58e47eb3c..d89fff9f5 100644
--- a/app/serializers/space_serializer.rb
+++ b/app/serializers/space_serializer.rb
@@ -1,6 +1,8 @@
 # Space serializer.
 # rubocop:disable Metrics/ClassLength
 class SpaceSerializer < ApplicationSerializer
+  delegate :all_tags_list, to: :object
+
   attributes(
     :id,
     :description,
@@ -17,12 +19,15 @@ class SpaceSerializer < ApplicationSerializer
 
   attribute :space_type, key: :type
 
-  attribute :space_id, key: :shared_space_id, if: -> { object.confidential? }
+  attribute :space_id, key: :shared_space_id, if: lambda {
+    object.confidential? && !object.private_type?
+  }
   attribute :private_space_id, if: -> { object.shared? && confidential_space }
-
-  attribute :tag_list, key: :tags
+  attribute :all_tags_list, key: :tags
 
   attribute :can_duplicate, if: -> { object.review? }
+  attribute :current_user_membership, key: :current_user_membership
+  attribute :exclusive?, key: :private_exclusive, if: -> { object.private_type? }
 
   has_one :host_lead_member,
           key: :host_lead,
@@ -35,7 +40,7 @@ class SpaceSerializer < ApplicationSerializer
           if: -> { object.guest_lead_member }
 
   has_one :confidential_space, serializer: self,
-                               if: -> { current_user && space_membership && object.shared? }
+          if: -> { current_user && space_membership && (object.shared? || object.exclusive?) }
 
   # Builds links according to user permissions.
   # @return [Hash] Links.
@@ -45,7 +50,7 @@ def links
     {}.tap do |links|
       links[:accept] = accept_api_space_path(object) if can_accept?
       links[:add_data] = add_data_api_space_path(object) if can_edit?
-      links[:show] = api_space_path(object) if can_access?
+      links[:show] = api_space_path(object) if can_access? || current_user.review_space_admin?
       links[:delete] = delete_api_space_path(object) if can_delete?
       links[:lock] = lock_api_space_path(object) if can_lock?
       links[:unlock] = unlock_api_space_path(object) if can_unlock?
@@ -81,7 +86,7 @@ def updated_at
   end
 
   # Returns space counters for related objects.
-  # @return [Hash] Space counters for members, tasks, files and notes, apps, comments.
+  # @return [Hash] Space counters for members, files and notes, apps, comments.
   def counters
     {
       files: files_count,
@@ -98,6 +103,12 @@ def confidential_space
     space_membership && object.confidential_space(space_membership)
   end
 
+  # Checks if user is a space member, and returns that member
+  # @return [SpaceMembership]
+  def current_user_membership
+    space_membership
+  end
+
   def can_duplicate
     SpaceMembershipPolicy.can_duplicate?(object, space_membership)
   end
diff --git a/app/serializers/submission_serializer.rb b/app/serializers/submission_serializer.rb
new file mode 100644
index 000000000..93008380e
--- /dev/null
+++ b/app/serializers/submission_serializer.rb
@@ -0,0 +1,76 @@
+# Submission serializer.
+class SubmissionSerializer < ApplicationSerializer
+  attributes(
+    :id,
+    :name,
+    :challenge_id,
+    :desc,
+    :created_at,
+    :updated_at,
+    :user,
+    :inputs,
+    :job_state,
+    :job_name,
+    :job_input_files,
+    :run_input_data,
+    :user_can_access_space,
+  )
+
+  delegate :user, to: :object
+
+  def inputs
+    object._inputs
+  end
+
+  def created_at
+    object.created_at.to_s(:human)
+  end
+
+  def updated_at
+    object.updated_at.to_s(:human)
+  end
+
+  def job_state
+    object.job.state
+  end
+
+  def job_name
+    object.job.name
+  end
+
+  def job_input_files
+    object.job.input_files
+  end
+
+  def run_input_data
+    input_data = []
+    object.job.input_data.each do |item|
+      input_data << form_item_run_data(item)
+    end
+    input_data
+  end
+
+  def form_item_run_data(item)
+    item_run_data = {}
+    item_run_data.merge!(name: item.name)
+
+    if item.file?
+      if item.file.present?
+        item_run_data.merge!(file_name: item.file.name)
+        item_run_data.merge!(file_uid: item.file.uid)
+      else
+        item_run_data.merge!(value: item.value)
+      end
+    else
+      item_run_data.merge!(value: item.value)
+    end
+
+    item_run_data
+  end
+
+  def user_can_access_space
+    return false unless object.challenge.space
+
+    object.challenge.space.accessible_by_user?(current_user)
+  end
+end
diff --git a/app/serializers/user_file_serializer.rb b/app/serializers/user_file_serializer.rb
index 790ce9d95..a9d769a95 100644
--- a/app/serializers/user_file_serializer.rb
+++ b/app/serializers/user_file_serializer.rb
@@ -1,40 +1,47 @@
 # UserFile serializer.
 class UserFileSerializer < NodeSerializer
-  include ActionView::Helpers::NumberHelper
-  include FilesHelper
-
   attributes(
     :uid,
     :file_size,
     :created_at,
     :created_at_date_time,
     :description,
-    :origin,
     :location,
     :links,
     :file_license,
+    :show_license_pending,
   )
 
-  attribute :all_tags_list, key: :tags
-
   def file_size
     number_to_human_size(object.file_size)
   end
 
-  # Returns a file's origin: one of Executable, Uploaded or Job origin data.
-  # @return [String] origin name.
-  def origin
-    return unless current_user
-
-    node_origin(object)
-  end
-
   # Returns formatted created_at time.
   # @return [String] Formatted time.
   def created_at
     formatted_time(object.created_at)
   end
 
+  def show_license_pending
+    if object.license&.approval_required
+      object.license_status?(current_user, "pending")
+    else
+      false
+    end
+  end
+
+  # license of the file with selected attributes
+  # when file does not have license - return {}
+  def file_license
+    object.license&.slice(:id, :uid, :title) || {}
+  end
+
+  # Check whether object could be licensed - means,
+  # current_user is the owner of the object, independently of object scope
+  def licenseable
+    object.user.id == current_user.id
+  end
+
   # Builds links to files.
   # @return [Hash] Links.
   # rubocop:disable Metrics/MethodLength
@@ -42,44 +49,71 @@ def links
     return {} unless current_user
 
     # rubocop:disable Metrics/BlockLength
-    {}.tap do |links|
-      links[:show] = file_path(object)
+    super.tap do |links|
+      links[:show] = "/files/#{object.uid}"
       links[:user] = user_path(object.user.dxuser)
+      links[:track] = track_path(id: object.uid)
       links[:space] = space_path if object.in_space?
-      # track single object
-      links[:track] = track_object
 
-      # GET download single file
-      links[:download] = download_api_file_path(object)
       # POST download_list files
       links[:download_list] = download_list_api_files_path
-      # POST Authorize URL - to move to api
-      links[:link] = link_file_path(object)
-
-      # publish single file if it is not public already
-      links[:publish] = publish_object unless object.public?
-      # POST /api/files/copy  copy_api_files
-      links[:copy] = copy_api_files_path
-
+      # POST /api/attach_to: api_attach_to_notes, discussions, answers
+      links[:attach_to] = api_attach_to_notes_path
       # POST: Add file
       links[:add_file] = api_create_file_path
       # POST: Add folder
       links[:add_folder] = create_folder_api_files_path
-
-      # GET: File origin object data { type, uid }
-      links[:origin_object] = origin_object
-
+      # PUT edit a single file
+      links[:update] = api_files_path(object)
       # link to license page if exists
       links[:show_license] = license_path(object.license.id) if object.license
 
+      if object.license.present? && object.license_status?(current_user, "active")
+        unless object.license.owned_by_user?(current_user)
+          links[:download] = download_api_file_path(object)
+          # POST /api/files/copy  copy_api_files
+          links[:copy] = copy_api_files_path
+        end
+      end
+
+      if object.license.present? && !object.license_status?(current_user, "active")
+        if object.license&.approval_required
+          unless object.license_status?(current_user, "pending")
+            # GET|POST /licenses/:id/request_approval
+            links[:request_approval_license] =
+              request_approval_license_path(object.license.id)
+            links[:request_approval_action] = "api/licenses/:id/request_approval"
+          end
+        else
+          # POST /api/licenses/:id/accept
+          links[:accept_license_action] =
+            object.license && accept_api_license_path(object.license.id)
+        end
+      end
+
+      # license exists and accepted
+      if object.license.present? &&
+         object.license.accepted_licenses.exists?(user_id: current_user.id)
+        links[:download] = download_api_file_path(object)
+      end
+
+      # any file without license
+      if object.license.blank?
+        # GET download single file
+        links[:download] = download_api_file_path(object)
+        # POST /api/files/copy  copy_api_files
+        links[:copy] = copy_api_files_path
+      end
+
       if object.owned_by_user?(current_user)
         unless object.in_space? && member_viewer?
-          links[:rename] = rename_file_path(object)
+          # publish single file if it is not public already and in a root folder
+          links[:publish] = publish_object unless object.public? || object.parent_folder_id
           # POST: /api/files/remove - Delete file(s) & folder(s), being selected
           links[:remove] = remove_api_files_path
           # POST associate item to a license
           links[:license] = "/api/licenses/:id/license_item/:item_uid" if licenseable
-          if object.license
+          if object.license&.owned_by_user?(current_user)
             # GET UserFile license object if exists
             links[:object_license] = api_license_path(object.license&.id)
             # POST detach license from item
@@ -88,28 +122,16 @@ def links
           # POST: Move file(s) and folder()s) to other folder
           links[:organize] = move_api_files_path
         end
-        # PUT edit a single file
-        links[:update] = api_files_path(object)
-
-        # POST /api/attach_to: api_attach_to_notes, discussions, answers
-        links[:attach_to] = api_attach_to_notes_path
       end
 
       if current_user.can_administer_site?
         # PUT /api/files/feature
         links[:feature] = feature_api_files_path
+        # POST: Move file(s) and folder()s) to other folder
+        links[:organize] = move_api_files_path
       end
     end
     # rubocop:enable Metrics/BlockLength
   end
   # rubocop:enable Metrics/MethodLength
-
-  def origin_object
-    {
-      origin_type: object.parent&.class&.name,
-      origin_uid: object.parent&.uid,
-    }
-  end
-
-  delegate :all_tags_list, to: :object
 end
diff --git a/app/serializers/user_serializer.rb b/app/serializers/user_serializer.rb
index 019c61d47..8ed12d8f7 100644
--- a/app/serializers/user_serializer.rb
+++ b/app/serializers/user_serializer.rb
@@ -5,12 +5,26 @@ class UserSerializer < ApplicationSerializer
     :dxuser,
     :first_name,
     :last_name,
+    :full_name,
     :email,
-    :counters,
     :admin,
+    :counters,
     :links,
+    :is_guest,
+    :gravatar_url,
+    :job_limit,
+    :pricing_map,
+    :resources,
+    :total_limit,
   )
 
+  attribute :guest?, key: :is_guest
+  attribute :can_administer_site?, key: :can_administer_site
+  attribute :can_create_challenges?, key: :can_create_challenges
+  attribute :can_see_spaces?, key: :can_see_spaces
+  attribute :review_space_admin?, key: :review_space_admin
+  attribute :can_access_notification_preference?, key: :can_access_notification_preference
+
   has_one :org
 
   # Checks if a user has site admin role.
@@ -22,6 +36,8 @@ def admin
   # Returns user counters for related objects.
   # @return [Hash] User counters for files, apps, workflows, etc.
   def counters
+    return {} if object.guest?
+
     {
       files: files_private_count,
       folders: folders_private_count,
@@ -36,11 +52,20 @@ def counters
   # Builds links to user.
   # @return [Hash] Links.
   def links
-    return unless current_user
+    return unless current_user && !current_user.guest?
 
     {}.tap do |links|
       # GET user accessible licenses list - show this link when current user has licenses
       links[:licenses] = api_list_licenses_path(object) unless current_user.licenses.empty?
     end
   end
+
+  delegate :can_administer_site?, to: :object
+  delegate :can_create_challenges?, to: :object
+  delegate :can_see_spaces?, to: :object
+  delegate :can_access_notification_preference?, to: :object
+  delegate :review_space_admin?, to: :object
+
+  delegate :full_name, to: :object
+  delegate :gravatar_url, to: :object
 end
diff --git a/app/serializers/workflow_serializer.rb b/app/serializers/workflow_serializer.rb
index 1a334d316..a585f62d5 100644
--- a/app/serializers/workflow_serializer.rb
+++ b/app/serializers/workflow_serializer.rb
@@ -13,6 +13,7 @@ class WorkflowSerializer < ApplicationSerializer
     :app_title,
     :location,
     :revision,
+    :readme,
     :workflow_series_id,
     :version,
     :scope,
@@ -24,18 +25,23 @@ class WorkflowSerializer < ApplicationSerializer
   )
 
   attribute :all_tags_list, key: :tags
+  attribute :job_count, key: :job_count
 
   # Returns manually assigned jobs - do not confuse with object.jobs.
   attr_accessor :jobs
   attr_reader :launched_on
   attr_writer :title
 
-  delegate :uid, to: :object
+  delegate :uid, :location, :name, to: :object
 
   def title
     @title || object.title
   end
 
+  def job_count
+    object.analyses.distinct.count
+  end
+
   # Returns a tags list for a Workflow
   def all_tags_list
     object.workflow_series.all_tags_list
diff --git a/app/services/app_series_service/app_series_filter.rb b/app/services/app_series_service/app_series_filter.rb
index b391f5046..a65884478 100644
--- a/app/services/app_series_service/app_series_filter.rb
+++ b/app/services/app_series_service/app_series_filter.rb
@@ -11,6 +11,7 @@ class AppSeriesFilter
       "name" => ->(value) { condition(APP_SERIES_TABLE[:name], value) },
       "title" => ->(value) { condition(APP_TABLE[:name], value) },
       "revision" => ->(value) { condition(APP_TABLE[:revision], value.to_i) },
+      "featured" => ->(value) { APP_TABLE[:featured].eq(to_bool(value)) },
       "username" => lambda do |value|
         condition(USER_TABLE[:first_name], value).or(condition(USER_TABLE[:last_name], value))
       end,
@@ -21,6 +22,10 @@ class AppSeriesFilter
       "title" => ->(app, value) { app.title.downcase.include? value },
       "revision" => ->(app, value) { app.revision == value.to_i },
       "username" => ->(app, value) { app.user.full_name.downcase.include? value },
+      "featured" => ->(app, value) { app.featured.to_s == value },
+      "location" => lambda do |app, value|
+        app.in_space? && app.space_object.name.downcase.include?(value)
+      end,
       "tags" => ->(app, value) { app.app_series.all_tags_list.to_s.downcase.include? value },
     }.freeze
   end
diff --git a/app/services/app_service.rb b/app/services/app_service.rb
index ab4c31c81..920675980 100644
--- a/app/services/app_service.rb
+++ b/app/services/app_service.rb
@@ -22,7 +22,7 @@ def initialize(user, api)
   # @return [App] Created app.
   def create_app(opts)
     app = nil
-    scope = opts[:scope] || Scopes::SCOPE_PRIVATE
+    scope = select_scope(opts[:scope])
 
     assets = Asset.accessible_by_user(user).
       where(
@@ -69,6 +69,7 @@ def create_app(opts)
         revision: revision,
         title: opts[:title],
         readme: opts[:readme],
+        entity_type: opts[:entity_type] || App::TYPE_REGULAR,
         user: user,
         scope: scope,
         app_series: app_series,
@@ -85,6 +86,7 @@ def create_app(opts)
 
       app_series.update!(latest_revision_app: app)
       app_series.update!(latest_version_app: app) if Space.valid_scope?(scope)
+      app_series.update!(deleted: false) if app_series.deleted?
 
       Event::AppCreated.create_for(app, user)
     end
@@ -92,6 +94,18 @@ def create_app(opts)
     app
   end
 
+  # Determine a proper scope for new app copy, depends upon current scope.
+  # Every new revision is private or of current space scope.
+  # @param scope [String] 'private', 'public', nil or 'space-xxx'
+  # @return scope [String] 'private' or 'space-xxx'
+  def select_scope(scope)
+    if [Scopes::SCOPE_PRIVATE, Scopes::SCOPE_PUBLIC, nil].include?(scope)
+      Scopes::SCOPE_PRIVATE
+    else
+      scope
+    end
+  end
+
   # Creates new applet on the platform.
   # @param opts [Hash] Opts to create hash with.
   # @return [String] Created applet id.
diff --git a/app/services/application_service.rb b/app/services/application_service.rb
new file mode 100644
index 000000000..3b425f622
--- /dev/null
+++ b/app/services/application_service.rb
@@ -0,0 +1,6 @@
+# The base service for all the services
+class ApplicationService
+  def self.call(*args, &block)
+    new(*args, &block).call
+  end
+end
diff --git a/app/services/asset_service.rb b/app/services/asset_service.rb
index 515f05af0..fcf81e36f 100644
--- a/app/services/asset_service.rb
+++ b/app/services/asset_service.rb
@@ -92,7 +92,6 @@ def upload(uid, asset_io, chunk_size = CHUNK_SIZE)
     end
 
     url_service = UploadUrlFetcher.new(context, uid)
-    url_service.instance_eval { file }
 
     Parallel.each_with_index(
       chunks, in_threads: THREADS_COUNT
diff --git a/app/services/base_filter.rb b/app/services/base_filter.rb
index 19b33b975..2a889c8cd 100644
--- a/app/services/base_filter.rb
+++ b/app/services/base_filter.rb
@@ -22,8 +22,13 @@ def match(record, filters)
   # @param filters [Hash] Filter object.
   # @return [ActiveRecord::Relation<AppSeries>] or [ActiveRecord::Relation<App>] Filtered nodes.
   def call(records, filters)
+    return records if filters.nil?
+
     records = records.where(build_where(filters.except(:tags))) if filters.present?
+
     records
+  rescue StandardError
+    []
   end
 
   # Builds AREL where clause.
@@ -59,4 +64,8 @@ def condition(field, value)
   def sanitize(query)
     "%" + ActiveRecord::Base.sanitize_sql_like(query) + "%"
   end
+
+  def to_bool(value)
+    ActiveModel::Type::Boolean.new.cast(value)
+  end
 end
diff --git a/app/services/base_transport_service.rb b/app/services/base_transport_service.rb
new file mode 100644
index 000000000..6336d971c
--- /dev/null
+++ b/app/services/base_transport_service.rb
@@ -0,0 +1,45 @@
+# Base service class to bind domain with transport layer
+class BaseTransportService
+  STATUS = {
+    success: :success,
+    error: :error,
+    warning: :warning,
+  }.freeze
+
+  attr_reader :response
+  attr_accessor :status
+
+  class << self
+    def call(*attrs)
+      new(*attrs).call
+    end
+  end
+
+  def initialize(params, context, scope = "")
+    @params = params
+    @context = context
+    @scope = scope
+    @response = { data: [], errors: [] }
+    @status = STATUS[:error]
+  end
+
+  def call
+    raise NotImplementedError, "#call is not implemented for #{self.class}"
+  end
+
+  def success?
+    status == STATUS[:success]
+  end
+
+  def message
+    "You are using #{self.class}##{__method__} method"
+  end
+
+  protected
+
+  attr_reader :context, :params
+
+  def api
+    @api ||= DNAnexusAPI.new(context.token)
+  end
+end
diff --git a/app/services/copy_service/app_copier.rb b/app/services/copy_service/app_copier.rb
index c70691564..fed7dc774 100644
--- a/app/services/copy_service/app_copier.rb
+++ b/app/services/copy_service/app_copier.rb
@@ -60,6 +60,7 @@ def build_opts(app, scope)
         opts[:scope] = scope
         opts[:name] = app.name
         opts[:title] = app.title
+        opts[:entity_type] = app.entity_type
         opts[:release] = app.release
         opts[:output_spec] = app.output_spec
         opts[:code] = app.code
@@ -108,7 +109,7 @@ def build_input_spec(app, scope)
     def copy_assets(app, scope)
       return [] unless app.assets.exists?
 
-      file_copier.copy(app.assets, scope).all
+      file_copier.copy(app.assets, scope, nil, true).all
     end
 
     # Copies default input files from a source app.
diff --git a/app/services/copy_service/copies.rb b/app/services/copy_service/copies.rb
index 2216b254a..00b5788af 100644
--- a/app/services/copy_service/copies.rb
+++ b/app/services/copy_service/copies.rb
@@ -44,7 +44,7 @@ def first
       copies.first.object
     end
 
-    delegate :size, :select, :reject, :[], :empty?, :present?, to: :copies
+    delegate :size, :select, :reject, :[], :empty?, :present?, :all?, to: :copies
 
     attr_reader :copies
   end
diff --git a/app/services/copy_service/file_copier.rb b/app/services/copy_service/file_copier.rb
index d9aefb19b..920ca4b0c 100644
--- a/app/services/copy_service/file_copier.rb
+++ b/app/services/copy_service/file_copier.rb
@@ -9,20 +9,24 @@ class << self
       # @param scope [String] A destination scope.
       # @param destination_project [String] A destination project.
       # @param attrs [Hash] Extra attributes for a new file.
+      # @param skip_parent Attribute introduced because of PFDA-3325.
+      #  Set to true if you want to skip setting file as a parent of the new record.
       # @return [UserFile] A new file record.
-      def copy_record(file, scope, destination_project, attrs = {})
+      # rubocop:disable Style/OptionalBooleanParameter
+      def copy_record(file, scope, destination_project, attrs = {}, skip_parent = false)
         existed_file = UserFile.find_by(dxid: file.dxid, project: destination_project)
 
         return existed_file if existed_file
 
-        new_file = file.dup
-        new_file.assign_attributes(attrs)
-        new_file.scope = scope
-        new_file.project = destination_project
-        new_file.parent = file.asset? ? new_file : file
-        new_file.parent_type = "Asset" if file.asset?
-        new_file.save!
-        new_file
+        file.dup.tap do |new_file|
+          new_file.assign_attributes(attrs)
+          new_file.scope = scope
+          new_file.project = destination_project
+          new_file.parent = file unless skip_parent
+          new_file.entity_type = UserFile::TYPE_REGULAR
+          new_file.archive_entries = file.archive_entries.map(&:dup) if defined? file.archive_entries
+          new_file.save!
+        end
       end
     end
 
@@ -31,28 +35,28 @@ def initialize(api:, user:)
       @user = user
     end
 
-    def copy(files, scope, folder_id = nil)
-      attrs = check_and_assign_folder!(scope, folder_id)
+    def copy(files, scope, folder_id = nil, skip_parent = false)
+      attrs = check_and_assign_folder(scope, folder_id)
       attrs[:user] = user
 
-      files = Array.wrap(files)
-      copies = Copies.new
+      @copies = Copies.new
 
       destination_project = UserFile.publication_project!(user, scope)
+      grouped_files = files_grouped_by_project(Array(files).uniq, destination_project)
 
-      files_grouped_by_project(copies, files, destination_project).each do |project, project_files|
+      grouped_files.each do |project, project_files|
         api.project_clone(project, destination_project, objects: project_files.map(&:dxid))
 
         project_files.each do |file|
-          copies.push(
-            object: self.class.copy_record(file, scope, destination_project, attrs),
-            source: file,
-          )
+          copied_file = self.class.copy_record(file, scope, destination_project, attrs, skip_parent)
+          @copies.push(object: copied_file, source: file)
+          Event::FileCopied.create_for(file, copied_file, user)
         end
       end
 
-      copies
+      @copies
     end
+    # rubocop:enable Style/OptionalBooleanParameter
 
     private
 
@@ -62,27 +66,26 @@ def copy(files, scope, folder_id = nil)
     # @param scope [String] A destination scope.
     # @param folder_id [Integer] A folder ID.
     # @return [Hash] Folder attributes.
-    def check_and_assign_folder!(scope, folder_id)
+    def check_and_assign_folder(scope, folder_id)
       return {} unless folder_id
 
       folder = Folder.find(folder_id)
 
-      if folder.scope != scope
-        raise FileCopyError, "Folder '#{folder.name}' doesn't belong to a scope '#{scope}'"
-      end
+      raise FileCopyError, "Folder '#{folder.name}' doesn't belong to a scope '#{scope}'" if folder.scope != scope
 
       folder_column = Folder.scope_column_name(scope)
+      opposite_folder_column = Folder.opposite_scope_column_name(scope)
 
-      { folder_column => folder_id }
+      { folder_column => folder_id, opposite_folder_column => nil }
     end
 
-    def files_grouped_by_project(copies, files, destination_project)
-      files.uniq.each_with_object({}) do |file, projects|
+    def files_grouped_by_project(files, destination_project)
+      files.each_with_object({}) do |file, projects|
         existed_file = UserFile.where.not(state: UserFile::STATE_COPYING).
           find_by(dxid: file.dxid, project: destination_project)
 
-        if existed_file.present?
-          copies.push(
+        if existed_file
+          @copies.push(
             object: existed_file,
             source: file,
             copied: false,
@@ -90,7 +93,7 @@ def files_grouped_by_project(copies, files, destination_project)
           next
         end
 
-        next if file.state != UserFile::STATE_CLOSED || destination_project == file.project
+        next if !file.closed? || destination_project == file.project
 
         projects[file.project] ||= []
         projects[file.project].push(file)
diff --git a/app/services/copy_service/node_copier.rb b/app/services/copy_service/node_copier.rb
index 8c6cb4c46..8114e9b83 100644
--- a/app/services/copy_service/node_copier.rb
+++ b/app/services/copy_service/node_copier.rb
@@ -17,10 +17,16 @@ def copy(nodes, scope)
       return copies if nodes.empty?
 
       @parent_folder_col = Node.scope_column_name(scope)
+      @opposite_parent_folder_col = Node.opposite_scope_column_name(scope)
 
       parent_folder = nil
 
-      nodes.each { |node| copies.concat(copy_node(node, scope, parent_folder)) }
+      Node.transaction do
+        nodes.each do |node|
+          copied_node = copy_node(node, scope, parent_folder)
+          copies.concat(copied_node)
+        end
+      end
 
       copies
     end
@@ -34,6 +40,7 @@ def copy(nodes, scope)
     # @param scope [String] A destination scope.
     # @return [CopyService::Copies] An object that contains copied files and/or folders.
     def copy_node(node, scope, parent_folder = nil)
+      Rails.logger.info("NodeCopier::copy_node #{node.id}, scope #{scope}")
       if node.is_a?(Folder)
         copy_folder(node, scope, parent_folder)
       else
@@ -46,19 +53,32 @@ def copy_node(node, scope, parent_folder = nil)
     # @param scope [String] A destination scope.
     # @param parent_folder [Folder, nil] A parent folder of a folder.
     # @return [CopyService::Copies] An object that contains copied files and folders.
-    # rubocop:disable Metrics/MethodLength
+    # rubocop:todo Metrics/MethodLength
     def copy_folder(folder, scope, parent_folder = nil)
+      Rails.logger.info("NodeCopier::copy_folder id {folder.id} name #{folder.name} to scope #{scope}")
       copies = Copies.new
 
-      existed_folder = Folder.find_by(
-        scope: scope,
-        name: folder.name,
-        @parent_folder_col => parent_folder&.id,
-      )
+      existing_folder = if scope == Scopes::SCOPE_PRIVATE
+        Folder.find_by(
+          scope: scope,
+          name: folder.name,
+          user: @user,
+          @parent_folder_col => parent_folder&.id,
+        )
+      else
+        Folder.find_by(
+          scope: scope,
+          name: folder.name,
+          @parent_folder_col => parent_folder&.id,
+        )
+      end
+
+      if existing_folder
+        Rails.logger.info("NodeCopier::copy_folder found existing folder id #{existing_folder.id} " \
+                          "name #{existing_folder.name}")
 
-      if existed_folder
         copies.push(
-          object: existed_folder,
+          object: existing_folder,
           source: folder,
           copied: false,
         )
@@ -68,11 +88,15 @@ def copy_folder(folder, scope, parent_folder = nil)
 
       copied_folder = folder.dup.tap do |new_folder|
         new_folder.scope = scope
+        new_folder.entity_type = Folder::TYPE_REGULAR
         new_folder.user = user
         new_folder[@parent_folder_col] = parent_folder&.id
+        new_folder[@opposite_parent_folder_col] = nil
         new_folder.save!
       end
 
+      Rails.logger.info("NodeCopier::copy_folder copied folder id #{copied_folder.id} name #{copied_folder.name}")
+
       copies.push(
         object: copied_folder,
         source: folder,
@@ -97,10 +121,9 @@ def copy_folder(folder, scope, parent_folder = nil)
     # @param parent_folder [Folder, nil] A parent folder of a file.
     # @return [CopyService::Copies] An object that contains copied and source files.
     def copy_file(file, scope, parent_folder = nil)
-      copies = file_copier.copy(file, scope)
-      file_copy = copies[0]
-      file_copy.object.update!(@parent_folder_col => parent_folder&.id) if file_copy&.copied
-      copies
+      Rails.logger.info("NodeCopier::copy_file id #{file.id} name #{file.name} to scope #{scope}")
+
+      file_copier.copy(file, scope, parent_folder&.id)
     end
   end
 end
diff --git a/app/services/copy_service/workflow_copier.rb b/app/services/copy_service/workflow_copier.rb
index 4601f7124..1537dc0a9 100644
--- a/app/services/copy_service/workflow_copier.rb
+++ b/app/services/copy_service/workflow_copier.rb
@@ -74,8 +74,11 @@ def copy_dependencies(new_workflow, workflow, scope)
 
             raise WorkflowCopyError, "Can't remap workflow stage inputs" unless app_input
 
-            input["default_workflow_value"] = app_input["default"]
-            input["defaultValues"] = app_input["default"]
+            file_to_copy = UserFile.find_by!(uid: input["default_workflow_value"])
+            copied_file = copy_service.copy(file_to_copy, scope).first
+
+            input["default_workflow_value"] = copied_file.uid
+            input["defaultValues"] = app_input["defaultValues"]
           end
 
           input
diff --git a/app/services/db_clusters/filter.rb b/app/services/db_clusters/filter.rb
new file mode 100644
index 000000000..0bd992633
--- /dev/null
+++ b/app/services/db_clusters/filter.rb
@@ -0,0 +1,27 @@
+module DbClusters
+  # Responsible for filtering db clusters.
+  class Filter
+    extend ::BaseFilter
+
+    DB_CLUSTER_TABLE = DbCluster.arel_table
+
+    FILTER_FIELDS = {
+      "name" => ->(value) { condition(DB_CLUSTER_TABLE[:name], value) },
+      "status" => lambda do |value|
+        condition(DB_CLUSTER_TABLE[:status], enum_values(DbCluster.statuses, value))
+      end,
+      "type" => lambda do |value|
+        condition(DB_CLUSTER_TABLE[:engine], enum_values(DbCluster.engines, value))
+      end,
+      "instance" => ->(value) { condition(DB_CLUSTER_TABLE[:dx_instance_class], value) },
+    }.freeze
+
+    class << self
+      private
+
+      def enum_values(values, match)
+        values.select { |value| value =~ Regexp.new(match) }.values
+      end
+    end
+  end
+end
diff --git a/app/services/file_publisher.rb b/app/services/file_publisher.rb
index 0c2e7f552..a18a583d5 100644
--- a/app/services/file_publisher.rb
+++ b/app/services/file_publisher.rb
@@ -1,9 +1,12 @@
 class FilePublisher
+  include FilesSyncing
+  include Scopes
+
   def self.by_context(context)
     new(
-        api: DNAnexusAPI.new(context.token),
-        user: context.user,
-        )
+      api: DNAnexusAPI.new(context.token),
+      user: context.user,
+    )
   end
 
   def self.by_challenge_bot
@@ -19,11 +22,16 @@ def initialize(api:, user:)
   end
 
   # Publish a file - to make its scope 'public'
+  #   When file is from challenge, its project is taken from describe call, since
+  #   Challenge Submission Job is being transferred to space 'scope' and output file has
+  #   Challenge Bot privte files project.
+  #   Other files, which are non challenge - published in a usual way.
   # @param files [Array] - array of UserFile objects to be published.
   # @param scope [String] - a new scope of a file.
   # @param user [User] - a current user, who is going to publish. A current class attribute.
   # @return count [Integer] - files quantity, being published successfully.
   #   returns 0 when no files were published.
+  # rubocop:disable Metrics/MethodLength
   def publish(files, scope = "public")
     count = 0
     destination_project = UserFile.publication_project!(user, scope)
@@ -40,13 +48,19 @@ def publish(files, scope = "public")
         raise "Source and destination collision for file #{file.id} (#{file.dxid})"
       end
 
-      projects[file.project] = [] unless projects.has_key?(file.project)
+      projects[file.project] = [] unless projects.key?(file.project)
       projects[file.project].push(file)
     end
 
+    # rubocop:disable Metrics/BlockLength
     projects.each do |project, project_files|
-      if project.present? # clone only files, not folders
-        api.project_clone(project, destination_project, { objects: project_files.map(&:dxid) })
+      # clone only files, not folders
+      clone_challenge_objects(project_files, destination_project)
+
+      non_challehge_files_dxids =
+        project_files.map { |file| file.dxid unless file.challenge_file? }.compact
+      if project.present? && !non_challehge_files_dxids.empty?
+        api.project_clone(project, destination_project, { objects: non_challehge_files_dxids })
       end
 
       UserFile.transaction do
@@ -58,10 +72,10 @@ def publish(files, scope = "public")
           end
 
           file.update!(
-              state: UserFile::STATE_CLOSED,
-              scope: scope,
-              project: destination_project,
-              scoped_parent_folder_id: nil
+            state: UserFile::STATE_CLOSED,
+            scope: scope,
+            project: destination_project,
+            scoped_parent_folder_id: nil,
           )
           count += 1
 
@@ -76,16 +90,54 @@ def publish(files, scope = "public")
               SpaceEventService.call(Regexp.last_match(1).to_i, user.id, nil, file, event_type)
             end
           end
+
+          remove_challenge_object(file) if file.challenge_file?
         end
       end
 
-      api.call(project, "removeObjects", objects: project_files.map(&:dxid)) if project.present?
+      if project.present? && !non_challehge_files_dxids.empty?
+        api.call(project, "removeObjects", objects: non_challehge_files_dxids)
+      end
     end
+    # rubocop:enable Metrics/BlockLength
 
     count
   end
+  # rubocop:enable Metrics/MethodLength
 
   private
 
+  def clone_challenge_objects(project_files, destination_project)
+    project_files.each do |file|
+      next unless file.challenge_file?
+
+      result = DNAnexusAPI.new(CHALLENGE_BOT_TOKEN).call(
+        "system",
+        "describeDataObjects",
+        objects: [file.dxid],
+      )["results"][0]
+
+      next if result["describe"].blank?
+
+      api.project_clone(
+        result["describe"]["project"],
+        destination_project,
+        { objects: [file.dxid] },
+      )
+    end
+  end
+
+  def remove_challenge_object(file)
+    result = DNAnexusAPI.new(CHALLENGE_BOT_TOKEN).call(
+      "system",
+      "describeDataObjects",
+      objects: [file.dxid],
+    )["results"][0]
+
+    return if result["describe"].blank?
+
+    api.call(result["describe"]["project"], "removeObjects", objects: [file.dxid])
+  end
+
   attr_reader :api, :user
 end
diff --git a/app/services/file_service/files_filter.rb b/app/services/file_service/files_filter.rb
index 1d80be3d2..c11670c32 100644
--- a/app/services/file_service/files_filter.rb
+++ b/app/services/file_service/files_filter.rb
@@ -9,8 +9,13 @@ class FilesFilter
     FILTER_FIELDS = {
       "name" => ->(value) { condition(NODE_TABLE[:name], value) },
       "state" => ->(value) { condition(NODE_TABLE[:state], value) },
-      "size" => ->(value) { NODE_TABLE[:file_size].gteq(value) },
-      "size2" => ->(value) { NODE_TABLE[:file_size].lteq(value) },
+      "size" => ->(value) { NODE_TABLE[:file_size].gteq(value.to_i * 1024) }, # in Kb
+      "size2" => ->(value) { NODE_TABLE[:file_size].lteq(value.to_i * 1024) }, # in Kb
+      "featured" => ->(value) { NODE_TABLE[:featured].eq(to_bool(value)) },
+      "location" => lambda do |value|
+        scopes = Space.where(condition(Space.arel_table[:name], value)).map(&:uid)
+        condition(NODE_TABLE[:scope], scopes)
+      end,
       "username" => lambda do |value|
         condition(USER_TABLE[:first_name], value).or(condition(USER_TABLE[:last_name], value))
       end,
diff --git a/app/services/file_service/toggle_feature_public_folder_service.rb b/app/services/file_service/toggle_feature_public_folder_service.rb
new file mode 100644
index 000000000..037da34a9
--- /dev/null
+++ b/app/services/file_service/toggle_feature_public_folder_service.rb
@@ -0,0 +1,56 @@
+module FileService
+  # The ToggleFeaturePublicFolderService used for toggling files and folders
+  # it toggles all available records Nodes#featured
+  #
+  class ToggleFeaturePublicFolderService
+    def initialize(params, context)
+      @featured = params[:featured]
+      @ids = params[:item_ids].presence || []
+      @context = context
+      @node = Node.arel_table
+    end
+
+    def call
+      return [] unless context.user.site_admin?
+
+      featured? ? update_records : toggle_records
+
+      records
+    end
+
+    private
+
+    attr_reader :featured, :node, :context, :ids
+
+    def featured?
+      featured.present?
+    end
+
+    def records
+      nodes = Node.where(
+        (node[:id].in ids).
+          or((node[:uid].in ids)).
+          or((node[:parent_folder_id].in ids)).
+          and((node[:scope].in ::Scopes::SCOPE_PUBLIC)),
+      )
+      children = nodes.folders.flat_map(&:children)
+      nodes.to_a.concat(children).uniq
+    end
+
+    def toggle_records
+      Node.transaction do
+        records.map do |record|
+          raise ActiveRecord::Rollback unless record.toggle(:featured).save
+        end
+      end
+    end
+
+    def update_records
+      Node.transaction do
+        records.map do |record|
+          raise ActiveRecord::Rollback unless record.update(featured: featured)
+        end
+      end
+    end
+  end
+end
diff --git a/app/services/files/file_uploader.rb b/app/services/files/file_uploader.rb
new file mode 100644
index 000000000..d8fffbc22
--- /dev/null
+++ b/app/services/files/file_uploader.rb
@@ -0,0 +1,126 @@
+module Files
+  # File uploader service
+  class FileUploader
+    MAX_FILE_SIZE = 5.terabytes
+    CHUNK_SIZE = 50.megabytes
+    MAX_CHUNK_SIZE = 2.gigabytes
+    MIN_CHUNK_SIZE = 5.megabytes
+    THREADS_COUNT = 5
+
+    class FileUploaderError < StandardError; end
+
+    class << self
+      # Used to create any small text file.
+      def upload_from_string(context, options)
+        file_content = options.delete(:content)
+        raise FileUploaderError, "The file content is missed" if file_content.blank?
+
+        new(context).create_and_upload(options.merge(file_io: StringIO.new(file_content)))
+      end
+    end
+
+    def initialize(context)
+      @context = context
+    end
+
+    def create_and_upload(options)
+      file_io = options[:file_io]
+      file_size = file_io.length
+
+      if file_size > MAX_FILE_SIZE
+        raise FileUploaderError, "Size of file exceeds maximum allowed file size"
+      end
+
+      Node.transaction do
+        file = create(options)
+        upload(file.uid, file_io)
+        close(file.uid)
+      end
+    end
+
+    private
+
+    def upload(uid, file_io, chunk_size = CHUNK_SIZE)
+      chunks = lambda do
+        if !file_io.eof?
+          chunk = file_io.read(chunk_size)
+          [chunk, md5sum(chunk), chunk.length]
+        else
+          Parallel::Stop
+        end
+      end
+
+      url_service = UploadUrlFetcher.new(context, uid)
+
+      Parallel.each_with_index(chunks, in_threads: THREADS_COUNT) do |(chunk, md5, size), index|
+        idx = index + 1
+        result = url_service.fetch_url(md5: md5, size: size, index: idx)
+        send_to_store(result["url"], result["headers"], chunk, idx)
+      end
+    ensure
+      file_io.close
+    end
+
+    def create(options)
+      project = context.user.private_files_project
+      dxid = context.api.file_new(options[:name], project)["id"]
+
+      UserFile.create!(
+        dxid: dxid,
+        project: project,
+        name: options[:name],
+        state: "open",
+        description: options[:description],
+        user_id: context.user_id,
+        scope: Scopes::SCOPE_PRIVATE,
+        parent: context.user,
+        parent_type: "User",
+      )
+    end
+
+    def close(uid)
+      file = UserFile.open.find_by!(user_id: context.user_id, uid: uid)
+      context.api.call(file.dxid, "close")
+
+      file.reload
+      file.update!(state: "closing") if file.open?
+      file
+    end
+
+    def send_to_store(url, headers, chunk, index)
+      uri = URI(url)
+      req = Net::HTTP::Put.new(uri)
+      req.body = chunk
+      headers.each { |name, value| req[name] = value }
+
+      res = Net::HTTP.start(
+        uri.hostname,
+        uri.port,
+        read_timeout: 180,
+        use_ssl: uri.scheme == "https",
+      ) do |http|
+        http.request(req)
+      end
+
+      return if res.is_a?(Net::HTTPSuccess)
+
+      raise FileUploaderError,
+            "Failed to upload chunk ##{index}. Please try again later. " \
+            "If the problem persists, contact precisionFDA support."
+    end
+
+    def md5sum(chunk)
+      file = Tempfile.new("")
+      file.binmode
+      file.write(chunk)
+      file.rewind
+
+      `md5sum #{file.path} | cut -d ' ' -f 1`.strip
+    ensure
+      file.close
+      file.unlink
+    end
+
+    attr_reader :context
+  end
+end
diff --git a/app/services/folder_service.rb b/app/services/folder_service.rb
index 3636284c1..481eb906e 100644
--- a/app/services/folder_service.rb
+++ b/app/services/folder_service.rb
@@ -1,34 +1,46 @@
 class FolderService
+  class Error < StandardError; end
+
+  ROOT_DIR = "root".freeze
+
   def initialize(context)
     @context = context
   end
 
-  def add_folder(name, parent_folder = nil, scope = "private")
-    if parent_folder
-      unless parent_folder.editable_by?(context)
-        return Rats.failure(
-          message: "You have no permissions to add objects to #{parent_folder.name}."
-        )
-      end
+  # Find a set of matched names between folders to be published and
+  #   all public folders exist.
+  # @param folders_names [Array] - a collection of Folder objects.
+  # @return [Array] - a set of matched names
+  def find_match_names(folders)
+    folders_names = folders_names(folders)
+    public_folders_names = Folder.accessible_by_public.pluck(:name).uniq
+    folders_names & public_folders_names
+  end
 
-      computed_scope = parent_folder.scope
-      parent_folder_id = parent_folder.id
-    else
-      computed_scope = scope
-      parent_folder_id = nil
+  def add_folder(name, parent_folder = nil, scope = Scopes::SCOPE_PRIVATE)
+    if parent_folder && !parent_folder.editable_by?(context)
+      return Rats.failure(
+        message: "You have no permissions to add objects to #{parent_folder.name}.",
+      )
+    elsif parent_folder&.https?
+      return Rats.failure(message: "You're not allowed to add objects to an HTTPS folder.")
     end
 
+    computed_scope = parent_folder&.scope || scope
     scope_column_name = Node.scope_column_name(computed_scope)
 
     folder = Folder.new(
       name: name,
       parent: context.user,
       scope: computed_scope,
-      user: context.user
+      user: context.user,
+      scope_column_name => parent_folder&.id,
     )
-    folder[scope_column_name] = parent_folder_id
 
-    folder.save ? Rats.success(folder) : Rats.failure(folder.errors.messages)
+    return Rats.failure(folder.errors.messages) unless folder.save
+
+    Event::FolderCreated.create_for(folder, context.user)
+    Rats.success(folder)
   end
 
   def rename(folder, new_name)
@@ -43,61 +55,30 @@ def rename(folder, new_name)
       )
     end
 
+    return rename_https_folder(folder, new_name) if folder.https?
+
     folder.name = new_name
-    folder.save ? Rats.success(folder) : Rats.failure(folder.errors.messages)
+    folder.save ? Rats.success(folder) : Rats.failure(message: folder.errors.messages.first)
   end
 
-  # rubocop:disable Metrics/MethodLength
-  def move(nodes, target_folder = nil, scope = nil)
-    scope ||= "private"
-    return Rats.failure(message: "No files selected.") unless nodes.present?
-
-    if target_folder
-      unless target_folder.editable_by?(context)
-        return Rats.failure(
-          message: "You have no permissions to add objects to '#{target_folder.name}'."
-        )
-      end
-      computed_scope = target_folder.scope
-      target_folder_id = target_folder.id
-    else
-      computed_scope = scope
-      target_folder_id = nil
-    end
-    scope_column_name = Node.scope_column_name(computed_scope)
-    errors = []
-
-    nodes.each do |node|
-      unless (node.public? && context.user.can_administer_site?) || node.editable_by?(context)
-        errors << "You have no permissions to move '#{node.name}'."
-        break
-      end
-
-      if node.in_locked_verification_space?
-        errors << "You have no permissions to move '#{node.name}', " \
-                  "as it is part of Locked Verification space."
-      end
+  def move(nodes, target_folder = nil, scope = Scopes::SCOPE_PRIVATE)
+    return Rats.failure(message: "No files/folders selected.") if nodes.empty?
 
-      if node.is_a?(Folder)
-        if node.scope != computed_scope && !node.private?
-          return Rats.failure(message: "Unexpected scope.")
-        end
-        if target_folder.present? && (node == target_folder || node.has_in_children?(target_folder))
-          return Rats.failure(message: "Unable to move folder into itself or its child folder.")
-        end
-      end
+    validate_target_folder!(target_folder)
+    validate_nodes_to_move!(nodes, target_folder, scope)
 
-      node[scope_column_name] = target_folder_id
-      errors << node.errors.messages.values unless node.save
-    end
+    nodes.each { |node| node.update(Node.scope_column_name(scope) => target_folder&.id) }
 
-    if errors.empty?
+    if nodes.all?(&:valid?)
       Rats.success(count: nodes.size, scope: scope)
     else
-      Rats.failure(messages: errors.uniq)
+      Rats.failure(messages: "An error occurred during the saving to the database.")
     end
+  rescue Error => e
+    Rats.failure(message: e.message)
+  rescue StandardError
+    Rats.failure(message: "Something went wrong.")
   end
-  # rubocop:enable Metrics/MethodLength
 
   def remove(nodes)
     return Rats.failure(message: "No objects selected.") if nodes.blank?
@@ -128,30 +109,109 @@ def remove(nodes)
 
   attr_reader :context
 
+  # Collect names of folders and folder's children - use for names check when publishing.
+  # @param folders [A collection of Folder objects]
+  # @return folders_children_names [Array] - names of folder's children folders
+  def folders_names(folders)
+    folders_names = folders.pluck(:name)
+
+    folders_children_names = []
+    folders.each do |folder|
+      sub_folders = folder.sub_folders.pluck(:name)
+      folders_children_names += sub_folders unless sub_folders.empty?
+    end
+
+    folders_names += folders_children_names unless folders_children_names.empty?
+    folders_names
+  end
+
+  # Validates nodes.
+  # @param nodes [ActiveRecord::Relation<Node>] Nodes to move.
+  def validate_nodes_to_move!(nodes, target_folder, target_scope)
+    nodes.each do |node|
+      raise Error, "You're not allowed to move an HTTPS #{node.klass}." if node.https?
+
+      if node.public? && !context.can_administer_site? || !node.accessible_by?(context)
+        raise Error, "You have no permissions to move '#{node.name}'."
+      end
+
+      # Verification spaces are deprecated.
+      if node.in_locked_verification_space?
+        raise Error, "You have no permissions to move '#{node.name}', " \
+                     "as it is part of Locked Verification space."
+      end
+
+      next unless node.is_a?(Folder)
+
+      raise Error, "Unexpected scope." if node.scope != target_scope && !node.private?
+
+      if target_folder && (node == target_folder || node.has_in_children?(target_folder))
+        raise Error, "Unable to move folder into itself or its child folder."
+      end
+    end
+  end
+
+  # Validates target folder for moving nodes.
+  # @param target_folder [Folder] The target folder.
+  def validate_target_folder!(target_folder)
+    return unless target_folder
+
+    raise Error, "You're not allowed to move to an HTTPS folder." if target_folder.https?
+
+    return if target_folder.editable_by?(context)
+
+    raise Error, "You have no permissions to add objects to '#{target_folder.name}'."
+  end
+
   def remove_folder(folder)
     if folder.public? && folder.all_files.present?
       return Rats.failure(message: "#{folder.name}: folder or any of its subfolders contain files.")
     end
 
+    folder.https? ? remove_https_folder(folder) : remove_regular_folder(folder)
+  end
+
+  def remove_regular_folder(folder)
     folder.sub_folders.each do |sub_folder|
       res = remove_folder(sub_folder)
       return res if res.failure?
     end
 
-    folder.files.each do |file|
+    folder_files = folder.files.where(scope: folder.scope)
+    folder_files.each do |file|
       res = remove_file(file)
+
       return res if res.failure?
     end
 
     folder.destroy
 
     if folder.destroyed?
+      Event::FolderDeleted.create_for(folder, context.user)
       Rats.success(folder)
     else
       Rats.failure(message: "#{folder.name}: folder removal error.")
     end
   end
 
+  # Removes https folder and all its childs via Https Apps service.
+  # @param folder [Folder] A folder.
+  def remove_https_folder(folder)
+    nodejs_api_client.folder_remove(folder.id)
+
+    Rats.success(folder)
+  rescue HttpsAppsClient::Error => e
+    Rats.failure(message: e.message)
+  end
+
+  def rename_https_folder(folder, new_name)
+    nodejs_api_client.folder_rename(folder.id, new_name)
+
+    Rats.success(folder)
+  rescue HttpsAppsClient::Error => e
+    Rats.failure(message: e.message)
+  end
+
   def remove_file(file)
     if file.comparisons.count > 0
       return Rats.failure(
@@ -167,10 +227,14 @@ def remove_file(file)
       )
     end
 
-    begin
-      DNAnexusAPI.new(context.token).call(file.project, "removeObjects", objects: [file.dxid])
-    rescue Net::HTTPClientException => e
-      raise e unless e.message =~ /^404/
+    # remove the file from the platform only when it's the last with given dxid
+    if UserFile.where(dxid: file.dxid).count == 1
+      Rails.logger.info "FolderService::remove_file removing file #{file.dxid} from platform"
+      begin
+        DNAnexusAPI.new(context.token).call(file.project, "removeObjects", objects: [file.dxid])
+      rescue DXClient::Errors::NotFoundError
+        # do nothing
+      end
     end
 
     UserFile.transaction { file.destroy }
@@ -181,9 +245,21 @@ def remove_file(file)
 
     if file.scope =~ /^space-(\d+)$/
       event_type = file.klass == "asset" ? :asset_deleted : :file_deleted
-      SpaceEventService.call($1.to_i, context.user_id, nil, file, event_type)
+
+      SpaceEventService.call(
+        Regexp.last_match(1).to_i,
+        context.user_id,
+        nil,
+        file,
+        event_type,
+        nodejs_api_client,
+      )
     end
 
     Rats.success(file)
   end
+
+  def nodejs_api_client
+    @nodejs_api_client ||= HttpsAppsClient.new(context.token, context.user)
+  end
 end
diff --git a/app/services/ginas/substance_file_creator.rb b/app/services/ginas/substance_file_creator.rb
new file mode 100644
index 000000000..0ee7ff8aa
--- /dev/null
+++ b/app/services/ginas/substance_file_creator.rb
@@ -0,0 +1,80 @@
+module Ginas
+  # Substance file creator
+  class SubstanceFileCreator
+    class SubstanceFileCreatorError < StandardError; end
+
+    GSRS_TAG = "GSRS".freeze
+
+    def initialize(context)
+      @context = context
+    end
+
+    def create_and_upload_file(request)
+      data = JSON.parse(CGI.unescape(request.raw_post))
+
+      substance_type = data["substanceClass"]&.titleize
+      substance_data = data["names"].first
+      substance_uuid = substance_data&.fetch("uuid", nil)
+      substance_name = substance_data&.fetch("name", nil)
+
+      unless substance_uuid || substance_type || substance_name
+        raise SubstanceFileCreatorError, "Can't find the required fields in the substance body"
+      end
+
+      file = Files::FileUploader.upload_from_string(
+        @context,
+        name: substance_file_name(request, substance_name, substance_uuid),
+        content: data.to_json,
+      )
+      file.tag_list.add(GSRS_TAG, substance_type)
+      file.save
+
+      move_file_to_folder(file, "#{substance_name}_#{substance_uuid}")
+
+      file
+    end
+
+    def move_file_to_folder(file, folder_name)
+      folder_service = FolderService.new(@context)
+
+      target_folder = Folder.find_by(
+        name: folder_name,
+        user: @context.user,
+        scope: Scopes::SCOPE_PRIVATE,
+      )
+
+      Node.transaction do
+        unless target_folder
+          result = folder_service.add_folder(folder_name)
+          target_folder = result.value if result.success?
+        end
+
+        unless target_folder
+          logger.error "Can't create a folder for the substance file"
+          return
+        end
+
+        target_folder.tag_list.add(GSRS_TAG)
+        target_folder.save
+
+        result = folder_service.move([file], target_folder)
+
+        if result.failure?
+          logger.error "Can't move the substance file to the folder due to: " +
+                       result.value[:message]
+          raise ActiveRecord::Rollback
+        end
+      end
+    end
+
+    def substance_file_name(request, substance_name, substance_uuid)
+      base_name = "#{substance_name}_#{substance_uuid}"
+
+      if request.method == Net::HTTP::Post::METHOD
+        "#{base_name}.json"
+      else # PUT
+        "#{base_name}_edited.json"
+      end
+    end
+  end
+end
diff --git a/app/services/invitation_searcher.rb b/app/services/invitation_searcher.rb
new file mode 100644
index 000000000..52b7d2415
--- /dev/null
+++ b/app/services/invitation_searcher.rb
@@ -0,0 +1,51 @@
+# Responsible for users invitation searching.
+class InvitationSearcher
+  class << self
+    # Performs user searching by invitation's email, first name or last name.
+    # @param query [String] Query to search users.
+    # @return [ActiveRecord::Relation<Invitation>] Found invitations.
+    def call(query = nil, exclude = [])
+      Invitation.where(conditions(query, exclude))
+    end
+
+    private
+
+    # Sanitizes query and adds wildcards for use in SQL LIKE.
+    # @param query [String] Query to sanitize.
+    # @return [String] Sanitized query.
+    def sanitized_like_query(query)
+      "%#{ActiveRecord::Base.sanitize_sql_like(query)}%"
+    end
+
+    # Returns search conditions.
+    # @param query [String] Search query.
+    # @return [Arel::Nodes::Node] Arel node containing search conditions.
+    def conditions(query, exclude)
+      full_conditions = invitations[:user_id].eq(nil)
+      full_conditions = full_conditions.and(invitations[:id].not_in(exclude)) if exclude.present?
+
+      if query.present?
+        or_conditions = fields.inject(nil) do |relation, field|
+          condition = invitations[field].matches(sanitized_like_query(query))
+          relation ? relation.or(condition) : condition
+        end
+
+        full_conditions = full_conditions.and(or_conditions)
+      end
+
+      full_conditions
+    end
+
+    # Returns Arel table for Invitation model.
+    # @return [Arel::Table] Arel table.
+    def invitations
+      Invitation.arel_table
+    end
+
+    # Returns set of fields to search invitation by.
+    # @return [Array<String>] Search fields.
+    def fields
+      %w(email first_name last_name).freeze
+    end
+  end
+end
diff --git a/app/services/job_creator.rb b/app/services/job_creator.rb
index c1d903c9e..2a0079f6a 100644
--- a/app/services/job_creator.rb
+++ b/app/services/job_creator.rb
@@ -7,8 +7,9 @@ def initialize(api:, context:, user:, project:)
     @project = project
   end
 
-  def create(app:, name:, input_info:, run_instance_type: nil, scope: nil)
-    dxjob_id = create_dx_job(app, input_info, name, run_instance_type)
+  def create(app:, name:, input_info:, job_limit: CloudResourceDefaults::JOB_LIMIT,
+    run_instance_type: nil, scope: nil)
+    dxjob_id = create_dx_job(app, input_info, name, run_instance_type, job_limit)
 
     Job.transaction do
       job = Job.create!(
@@ -32,8 +33,8 @@ def create(app:, name:, input_info:, run_instance_type: nil, scope: nil)
     end
   end
 
-  def create_dx_job(app, input_info, name, run_instance_type)
-    input = api_input(app, name, input_info, run_instance_type)
+  def create_dx_job(app, input_info, name, run_instance_type, job_limit)
+    input = api_input(app, name, input_info, run_instance_type, job_limit)
 
     api.app_run(app.dxid, nil, input)["id"]
   end
@@ -42,14 +43,15 @@ def create_dx_job(app, input_info, name, run_instance_type)
 
   attr_reader :api, :user, :context, :project
 
-  def api_input(app, name, input_info, run_instance_type)
+  def api_input(app, name, input_info, run_instance_type, job_limit)
     {
       name: name,
       input: input_info.dx_run_input,
       project: project,
-      timeoutPolicyByExecutable: { app.dxid => { "*" => { "days" => 2 } } },
+      timeoutPolicyByExecutable: { app.dxid => { "*" => { "days" => 10 } } },
       singleContext: true,
       systemRequirements: system_requirements(run_instance_type),
+      costLimit: job_limit,
     }.delete_if { |_, value| value.nil? }
   end
 
diff --git a/app/services/job_service/jobs_filter.rb b/app/services/job_service/jobs_filter.rb
index 7fecd027c..7f8735439 100644
--- a/app/services/job_service/jobs_filter.rb
+++ b/app/services/job_service/jobs_filter.rb
@@ -13,7 +13,12 @@ class JobsFilter
         condition(WORKFLOW_TABLE[:title], value).or(condition(JOB_TABLE[:name], value))
       end,
       "state" => ->(value) { condition(JOB_TABLE[:state], value) },
-      "apptitle" => ->(value) { condition(APP_TABLE[:title], value) },
+      "app_title" => ->(value) { condition(APP_TABLE[:title], value) },
+      "featured" => ->(value) { JOB_TABLE[:featured].eq(to_bool(value)) },
+      "location" => lambda do |value|
+        scopes = Space.where(condition(Space.arel_table[:name], value)).map(&:uid)
+        condition(JOB_TABLE[:scope], scopes)
+      end,
       "username" => lambda do |value|
         condition(USER_TABLE[:first_name], value).or(condition(USER_TABLE[:last_name], value))
       end,
diff --git a/app/services/jobs/sync_files_service.rb b/app/services/jobs/sync_files_service.rb
new file mode 100644
index 000000000..147175af4
--- /dev/null
+++ b/app/services/jobs/sync_files_service.rb
@@ -0,0 +1,38 @@
+module Jobs
+  # Jobs sync files service to trigger syncing of files in an https job's dx project to pFDA
+  class SyncFilesService < ::BaseTransportService
+    SUCCESS_MESSAGE = "Workstation files will begin syncing momentarily. Depending on "\
+                      "the number of folders and files this may take 10-20 minutes.".freeze
+
+    def call
+      sync_files
+
+      self
+    end
+
+    def message
+      service_message = SUCCESS_MESSAGE
+      service_message = response[:errors].inspect.delete('[""]') if response[:errors].present?
+
+      service_message
+    end
+
+    private
+
+    def sync_files
+      process params
+      set_status
+    end
+
+    def process(job_dxid)
+      api = DIContainer.resolve("https_apps_client")
+      response[:data] << api.job_sync_files(job_dxid)
+    rescue HttpsAppsClient::Error => e
+      response[:errors] << e.message
+    end
+
+    def set_status
+      @status = STATUS[:success] if response[:errors].empty?
+    end
+  end
+end
diff --git a/app/services/jobs/terminate_service.rb b/app/services/jobs/terminate_service.rb
new file mode 100644
index 000000000..4f75df955
--- /dev/null
+++ b/app/services/jobs/terminate_service.rb
@@ -0,0 +1,43 @@
+module Jobs
+  # Jobs terminate service
+  # https://documentation.dnanexus.com/developer/api/running-analyses
+  # /applets-and-entry-points#api-method-job-xxxx-terminate
+  class TerminateService < ::BaseTransportService
+    SUCCESS_MESSAGE = "Request(s) to terminate executions has been successfully sent. ".freeze
+
+    def call
+      terminate
+
+      self
+    end
+
+    def message
+      service_message = SUCCESS_MESSAGE
+      service_message = response[:errors].inspect if response[:errors].present?
+
+      service_message
+    end
+
+    private
+
+    def terminate
+      Array.wrap(params).map { |uid| process uid }
+      set_status
+    end
+
+    def process(uid)
+      job = Job.where(user_id: context.user_id).find_by!(uid: uid)
+      raise JobInTerminalStateError, job.dxid if job.terminal?
+
+      api = job.https? ? DIContainer.resolve("https_apps_client") : DIContainer.resolve("api.user")
+
+      response[:data] << api.job_terminate(job.dxid)
+    rescue ActiveRecord::RecordNotFound, JobInTerminalStateError, HttpsAppsClient::Error => e
+      response[:errors] << e.message
+    end
+
+    def set_status
+      @status = STATUS[:success] if response[:errors].empty?
+    end
+  end
+end
diff --git a/app/services/org_service/baseline_charges.rb b/app/services/org_service/baseline_charges.rb
new file mode 100644
index 000000000..b46ac0605
--- /dev/null
+++ b/app/services/org_service/baseline_charges.rb
@@ -0,0 +1,27 @@
+module OrgService
+  # Shared module for setting baseline charges
+  module BaselineCharges
+    # Sets user's baseline charges for compute, storage, and data egress
+    # @param user [User] User to process tasks for.
+    # @param api [DNAnexusAPI] User API object.
+    def set_user_baseline_charges!(user, api)
+      raw_update_user_baseline_charges!(user, api) if user.charges_baseline.blank?
+    end
+
+    def raw_update_user_baseline_charges!(user, api)
+      charges = api.user_charges(user)
+      if user.singular?
+        user.update(charges_baseline: charges)
+        return
+      end
+      # Note(samuel) This is workaround for legacy orgs
+      # If every org has baseline charges initialized at different time
+      # There will be difficulty upgrading user charges, if all users share billing accounts
+      # but use different baselines
+      User.set_legacy_org_baseline_charges!(user.org_id, charges)
+    rescue StandardError => e
+      Rails.logger.error "There was an error during setting the baseline charges for " \
+                         "user #{user.dxid}, org handle #{user.org.handle}: #{e.message}"
+    end
+  end
+end
diff --git a/app/services/org_service/create.rb b/app/services/org_service/create.rb
index 739a43635..6356ffc0b 100644
--- a/app/services/org_service/create.rb
+++ b/app/services/org_service/create.rb
@@ -1,13 +1,13 @@
 module OrgService
   module Create
-    # @param id [String] ID of the organization ("org-" + handle)
-    def self.call(api, id, billable = false)
-      papi = DNAnexusAPI.new(ADMIN_TOKEN)
+    # @param dxid [String] ID of the organization ("org-" + handle)
+    def self.call(dxid, billable = false)
+      papi = DIContainer.resolve("api.admin")
 
-      raise "We did not expect #{id} to exist on DNAnexus" if api.entity_exists?(id)
+      raise "The org #{dxid} already exists!" if papi.entity_exists?(dxid)
 
-      handle = Org.handle_by_id(id)
-      org = papi.call("org", "new", handle: handle, name: handle)
+      handle = Org.handle_by_id(dxid)
+      org = papi.org_new(handle, handle)
 
       auditor_data = {
         action: "create",
@@ -16,14 +16,16 @@ def self.call(api, id, billable = false)
           message: "The system is about to start provisioning a new dxorg '#{org[:id]}'",
         },
       }
+
       Auditor.perform_audit(auditor_data)
 
       if billable
-        auth = DNAnexusAPI.new(ADMIN_TOKEN, DNANEXUS_AUTHSERVER_URI)
-        auth.call(
-          org[:dxorg], "updateBillingInformation",
-          billingInformation: BILLING_INFO,
-          autoConfirm: BILLING_CONFIRMATION
+        auth = DIContainer.resolve("api.auth")
+
+        auth.org_update_billing_info(
+          org[:dxorg],
+          BILLING_INFO,
+          autoConfirm: BILLING_CONFIRMATION,
         )
       end
 
diff --git a/app/services/org_service/developers_org.rb b/app/services/org_service/developers_org.rb
index 8708ea94d..654442d96 100644
--- a/app/services/org_service/developers_org.rb
+++ b/app/services/org_service/developers_org.rb
@@ -12,15 +12,16 @@ def self.create
     def self.update_members(dxorg)
       papi = DNAnexusAPI.for_admin
       users = User.review_space_admins.where.not(review_app_developers_org: dxorg)
-      users.pluck(:dxuser).each do |dxuser|
-        papi.call(
-          dxorg, "invite",
-          invitee: "user-#{dxuser}",
+      users.find_each do |user|
+        next if user.dxid == ADMIN_USER
+
+        papi.org_invite(
+          dxorg,
+          user.dxid,
           level: "ADMIN",
-          suppressEmailNotification: true
+          suppressEmailNotification: true,
         )
       end
-
       users.update_all(review_app_developers_org: dxorg)
     end
 
diff --git a/app/services/org_service/leave_org_process.rb b/app/services/org_service/leave_org_process.rb
index 1e4e2903b..8c6b2864b 100644
--- a/app/services/org_service/leave_org_process.rb
+++ b/app/services/org_service/leave_org_process.rb
@@ -2,6 +2,7 @@ module OrgService
   # Responsible user leaving organization process.
   class LeaveOrgProcess
     include OrgService::Errors
+    include OrgService::BaselineCharges
 
     # Constructor.
     # @param user_api [DNAnexusAPI] User API instance.
@@ -182,8 +183,7 @@ def invite_user_to_new_org!
         level: DNAnexusAPI::ORG_MEMBERSHIP_ADMIN,
         suppressEmailNotification: true,
       )
-    # TODO: Temporary fix, DXClient exceptions should be raised via reflection mechanism.
-    rescue Net::HTTPClientException => e
+    rescue DXClient::Errors::DXClientError => e
       # Allow to proceed for case when SITE ADMIN leaves organization.
       raise e unless e.message =~ /Cannot invite yourself to an organization/
     end
@@ -207,6 +207,7 @@ def update_database!
         )
 
         @user.update!(org: org)
+        raw_update_user_baseline_charges!(@user, @user_api)
       end
     end
   end
diff --git a/app/services/org_service/provision.rb b/app/services/org_service/provision.rb
index 42d79aa6b..f05c1ab3a 100644
--- a/app/services/org_service/provision.rb
+++ b/app/services/org_service/provision.rb
@@ -62,6 +62,7 @@ def store_data
         org = create_org
         user = create_user(org)
         create_profile(user)
+        create_notification_preferences(user)
         @invitation.update!(user_id: user.id)
         add_user_to_spaces(user)
       end
@@ -94,11 +95,19 @@ def create_user(org)
         first_name: @params[:first_name],
         last_name: @params[:last_name],
         normalized_email: @params[:email].downcase,
+        pricing_map: CloudResourceDefaults::PRICING_MAP,
+        job_limit: CloudResourceDefaults::JOB_LIMIT,
+        total_limit: CloudResourceDefaults::TOTAL_LIMIT,
+        resources: CloudResourceDefaults::RESOURCES,
       )
       org.update!(admin_id: user.id)
       user
     end
 
+    def create_notification_preferences(user)
+      NotificationPreference.create_for_user!(user)
+    end
+
     # add user to spaces if there is any invitation
     def add_user_to_spaces(user)
       space_invitations = @invitation.space_invitations
diff --git a/app/services/org_service/provision_admin_org_member.rb b/app/services/org_service/provision_admin_org_member.rb
index b6228f0cd..099a08a16 100644
--- a/app/services/org_service/provision_admin_org_member.rb
+++ b/app/services/org_service/provision_admin_org_member.rb
@@ -12,6 +12,7 @@ def initialize(admin_api)
     # Adds user to admin_org on the platform.
     # @param dxid [String] User's dxid (ex: user-xxxx).
     def call(dxid)
+      Rails.logger.info("ProvisionAdminOrgMember class: Org invite API call, using api.admin, org: #{PFDA_ADMIN_ORG}, user: #{dxid}")
       @admin_api.org_invite(PFDA_ADMIN_ORG, dxid,
                             level: DNAnexusAPI::ORG_MEMBERSHIP_MEMBER,
                             allowBillableActivities: false,
diff --git a/app/services/org_service/provision_on_platform.rb b/app/services/org_service/provision_on_platform.rb
index 340fff830..e859d7dee 100644
--- a/app/services/org_service/provision_on_platform.rb
+++ b/app/services/org_service/provision_on_platform.rb
@@ -28,11 +28,7 @@ def call(org:, username:, org_handle:, email:, first_name:, last_name:)
         raise "We did not expect #{dxuserid} to exist on DNAnexus"
       end
 
-      if Org.find_by(name: org).present?
-        raise "We did not expect org name '#{org}' to exist in the database"
-      end
-
-      if Org.find_by(handle: org_handle).present?
+      if Org.where(handle: org_handle).exists?
         raise "We did not expect org handle '#{org_handle}' to exist in the database"
       end
 
diff --git a/app/services/presenters/workflow_executions_presenter.rb b/app/services/presenters/workflow_executions_presenter.rb
new file mode 100644
index 000000000..f14fa4a03
--- /dev/null
+++ b/app/services/presenters/workflow_executions_presenter.rb
@@ -0,0 +1,158 @@
+module Presenters
+  ##
+  # *WorkflowExecutionPresenter* displays workflow executions (Analyses) with their workflow jobs
+  # and handles filtering and pagination. It supposed to have one workflow and different types of
+  # its analyses: batch and single.
+  #
+  #   presenter = WorkflowExecutionsPresenter.new(page, context, params).call
+  #
+  #   payload = { jobs: presenter.response, meta: pagination_meta(presenter.size) }
+  #
+  class WorkflowExecutionsPresenter
+    include Sortable
+    include Paginationable
+    include Sortable
+
+    # Collection of serialized records.
+    # @return [Array] Array of serialized job hashes
+    attr_accessor :response
+    # Used in pagination meta.
+    # @return [integer]
+    attr_reader :size
+
+    ORDER_PARAMS_MAP = {
+      name: :name,
+      username: :launched_by,
+      app_title: :app_title,
+      created_at: :created_at_date_time,
+      launched_on: :created_at_date_time,
+    }.freeze
+
+    # Instance of WorkflowExecutionsPresenter initializes with filter params from controller
+    # context and ActiveRecord association of Analyses.
+    # @param analyses [Analysis]
+    # @param contest [Context]
+    # @param params permitted params
+    def initialize(analyses, context, params = {})
+      @context = context
+      @analyses = Array.wrap analyses
+      @params = params.symbolize_keys
+      @filters = params[:filters]
+      @matcher = lambda do |hash|
+        (hash.keys & filters.symbolize_keys.keys).present? &&
+          filters.all? do |k, v|
+            v.to_s.downcase.in? hash.fetch(k.to_sym, "").downcase
+          end
+      end
+      @response = []
+      @size = 0
+      @ids = []
+    end
+
+    # Process serialization of analyses. It can be a single analysis or a batch. In this case we
+    # use @ids to remember serialized analysis. If analysis have batch_items we have to serialize
+    # all batch analysis and collect serialized +ids+ to check if analysis was processed, if it
+    # was - serialize it and collect its id, if was not - skip serialization step and return an
+    # empty array.
+    #
+    # Returns serialized Analyses filtered and splitted by params and returns itself to use
+    #   #response
+    # and
+    #   #size
+    # methods to build controller response.
+    def call
+      serialize_records
+      filter_records if filters.present?
+      sort_records if params[:order_by].present?
+      select_pages
+
+      self
+    end
+
+    private
+
+    attr_accessor :ids
+    attr_reader :analyses, :context, :params, :filters, :matcher, :sorter
+
+    # To collect serialized records in @response
+    def serialize_records #:nodoc:
+      @response = analyses.map { |record| serialized_analysis(record) }.flatten
+      @size = @response.size
+    rescue NoMethodError
+      @response << Message.can_not_serialize
+    end
+
+    # @param analyses [Analysis]
+    def serialized_analysis(analysis)
+      if analysis.batch_items.present? && (analysis.batch_items.map(&:id) & ids).empty?
+        analysis.batch_items.map { |a| ids << a.id }
+        serialized_batch_analysis(analysis.batch_items)
+      elsif !analysis.id.in? ids
+        ids << analysis.id
+        serialized_workflow(analysis)
+      else
+        ids << analysis.id
+        []
+      end
+    end
+
+    # Serialize batch analysis.
+    # Adds for example _(1 of 3)_ label to Analysis title.
+    # @param analyses [Analysis]
+    def serialized_batch_analysis(analyses)
+      analyses.map.with_index(1) do |analysis, idx|
+        serialized_workflow(analysis, [idx, analyses.size], :batch)
+      end
+    end
+
+    # Call AnalysisSerializer through a Rails Cache with ttl 1 minute to reduce DB load while
+    # doing filter subsequent requests.
+    # @param [Analysis]
+    def serialized_workflow(analysis, idx = [], type = :workflow)
+      analysis_cache_key = [analysis.dxid, idx, analysis.updated_at, context.user_id].join(":")
+      Rails.cache.fetch(analysis_cache_key, expires_in: 1.minute) do
+        analysis.current_user = @context.user
+        AnalysisSerializer.new(
+          analysis,
+          type: type,
+          meta: idx,
+        ).serializable_hash
+      end
+    end
+
+    # filter all response records with +#matcher+ lambda selection within +@params+
+    def filter_records
+      # For filtering by workflow_title
+      filters[:name] = filters.delete :workflow_title if filters.key?(:workflow_title)
+      # For filtering launched_by via 'username' to normalize execution filter keys with JobsFilter
+      filters[:launched_by] = filters.delete :username if filters.key?(:username)
+      @response = response.each do |record|
+        record[:jobs] = record.fetch(:jobs, []).select(&matcher)
+      end
+      @response = response.filter { |f| f[:jobs].present? }
+      @size = @response.size
+    end
+
+    # sort records if params[:ornder_by] present
+    def sort_records
+      @response = response.each do |record|
+        order_field = ORDER_PARAMS_MAP.fetch(params[:order_by].to_sym)
+        sorted_records = record.fetch(:jobs, []).sort do |a, b|
+          a[order_field].downcase <=> b[order_field].downcase
+        end
+        record[:jobs] = params[:order_dir] == "DESC" ? sorted_records.reverse : sorted_records
+      end
+    end
+
+    # Select records if page params is present
+    def select_pages
+      page_size = params[:per_page] ? params[:per_page].to_i : Paginationable::PAGE_SIZE
+      to = params[:page].to_i * page_size - 1
+      from = to - page_size + 1
+      from = 0 if from.negative?
+      to = from + (response.size % page_size) if to > response.size
+
+      @response = @response[from..to]
+    end
+  end
+end
diff --git a/app/services/space_event_service.rb b/app/services/space_event_service.rb
index da00aef8d..005bef2d6 100644
--- a/app/services/space_event_service.rb
+++ b/app/services/space_event_service.rb
@@ -1,32 +1,35 @@
 module SpaceEventService
-  def self.call(space_id, user_id, membership, entity, activity_type)
-    if membership.nil?
-      membership = Space.find(space_id).space_memberships.find_by(user_id: user_id)
-      membership = SpaceMembership.new_by_admin(User.find(user_id)) unless membership
-    end
+  EVENTS_MAPPING = {
+    "app" => :app_added,
+    "comparison" => :comparison_added,
+    "file" => :file_added,
+    "asset" => :asset_added,
+    "job" => :job_added,
+    "note" => :note_added,
+    "workflow" => :workflow_added,
+  }.freeze
 
-    if activity_type == "copy_to_cooperative"
-      activity_type =
-        case entity.klass
-        when "app" then :app_added
-        when "comparison" then :comparison_added
-        when "file" then :file_added
-        when "asset" then :asset_added
-        when "job" then :job_added
-        when "note" then :note_added
-        when "workflow" then :workflow_added
-        end
-    end
+  class << self
+    # rubocop:todo Metrics/ParameterLists
+    def call(space_id, user_id, membership, entity, activity_type, nodejs_api_client = nil)
+      membership ||= Space.find(space_id).space_memberships.find_by(user_id: user_id) ||
+                     SpaceMembership.new_by_admin(User.find(user_id))
 
-    space_event = SpaceEvent.create(
-      space_id: space_id,
-      user_id: user_id,
-      side: membership[:side],
-      role: membership[:role],
-      entity: entity,
-      activity_type: activity_type,
-    )
+      activity_type = EVENTS_MAPPING[entity.klass] if activity_type == "copy_to_cooperative"
 
-    NotificationSender.call(space_event)
+      space_event = SpaceEvent.create(
+        space_id: space_id,
+        user_id: user_id,
+        side: membership[:side],
+        role: membership[:role],
+        entity: entity,
+        activity_type: activity_type,
+      )
+
+      # DIContainer is not configured inside of Sidekiq's workers.
+      api = nodejs_api_client || DIContainer.resolve("https_apps_client")
+      NotificationSender.call(space_event, api)
+    end
+    # rubocop:enable Metrics/ParameterLists
   end
 end
diff --git a/app/services/space_event_service/comment_notifications.rb b/app/services/space_event_service/comment_notifications.rb
index 1da37c362..f00997ddd 100644
--- a/app/services/space_event_service/comment_notifications.rb
+++ b/app/services/space_event_service/comment_notifications.rb
@@ -1,46 +1,10 @@
 module SpaceEventService
   class CommentNotifications
-
     class << self
-
-      def send(event)
-        receivers(event).each do |receiver|
-          ReviewSpaceMailer.new_comment_email(event.entity, receiver).deliver_now!
-        end
+      def send(event, nodejs_api_client)
+        email_type_id = NotificationPreference.email_types[:notification_comment]
+        nodejs_api_client.email_send(email_type_id, { spaceEventId: event.id })
       end
-
-      private
-
-      def receivers(event)
-        candidates = []
-        mentioned = event.entity.mentioned_users
-        mentioned.map { |u| candidates << u }
-        candidates << event.entity.parent.user if event.entity.parent.present?
-
-        candidates.uniq.select do |user|
-          next if user.id == event.user_id
-          notification_preference_by_role(event, user)
-        end
-      end
-
-      def notification_preference_by_role(event, user)
-        notification_preference = NotificationPreference.find_by_user(user)
-        role = event.space.space_memberships.find_by_user_id(user.id).role
-        role = "all" unless ["admin", "lead"].include?(role)
-        preference = "#{role}_comment_activity"
-        admin_preference = rsa?(role, user) ? "admin_comment_activity" : nil
-        if admin_preference
-          notification_preference.send(preference) || notification_preference.send(admin_preference)
-        else
-          notification_preference.send(preference)
-        end
-      end
-
-      def rsa?(role, user)
-        role != "admin" && user.review_space_admin?
-      end
-
     end
-
   end
 end
diff --git a/app/services/space_event_service/content_notifications.rb b/app/services/space_event_service/content_notifications.rb
index 1d135235f..5a7cc4fc6 100644
--- a/app/services/space_event_service/content_notifications.rb
+++ b/app/services/space_event_service/content_notifications.rb
@@ -1,49 +1,10 @@
 module SpaceEventService
   class ContentNotifications
-
     class << self
-
-      def send(event)
-        receivers(event).each do |receiver|
-          if action(event) == "added"
-            ReviewSpaceMailer.new_content_email(event.entity, receiver).deliver_now!
-          else
-            ReviewSpaceMailer.content_deleted_email(event.entity, receiver).deliver_now!
-          end
-        end
+      def send(event, nodejs_api_client)
+        email_type_id = NotificationPreference.email_types[:notification_content]
+        nodejs_api_client.email_send(email_type_id, { spaceEventId: event.id })
       end
-
-      private
-
-      def action(event)
-        event.activity_type.to_s.split("_").last
-      end
-
-      def receivers(event)
-        User.joins(:space_memberships).merge(event.entity.space_object.space_memberships.active).select do |user|
-          next if user.id == event.user_id
-          notification_preference_by_role(event, user)
-        end
-      end
-
-      def notification_preference_by_role(event, user)
-        notification_preference = NotificationPreference.find_by_user(user)
-        role = event.space.space_memberships.find_by_user_id(user.id).role
-        role = "all" unless ["admin", "lead"].include?(role)
-        admin_preference = rsa?(role, user) ? "admin_content_added_or_deleted" : nil
-        preference = "#{role}_content_added_or_deleted"
-        if admin_preference
-          notification_preference.send(preference) || notification_preference.send(admin_preference)
-        else
-          notification_preference.send(preference)
-        end
-      end
-
-      def rsa?(role, user)
-        role != "admin" && user.review_space_admin?
-      end
-
     end
-
   end
 end
diff --git a/app/services/space_event_service/membership_notifications.rb b/app/services/space_event_service/membership_notifications.rb
index 3ee74c870..56d50872b 100644
--- a/app/services/space_event_service/membership_notifications.rb
+++ b/app/services/space_event_service/membership_notifications.rb
@@ -1,81 +1,21 @@
 module SpaceEventService
   class MembershipNotifications
-
     class << self
-
-      def send(event)
-        receivers(event).each do |receiver|
-          ReviewSpaceMailer.member_email(event, receiver, action(event)).deliver_now!
-        end
-      end
-
-      private
-
-      def action(event)
-        {
-          "membership_added" => "added a new member",
-          "membership_disabled" => "disabled a member",
-          "membership_changed" => "changed role of member",
-          "membership_enabled" => "enabled member",
-        }[event.activity_type]
+      def send(event, nodejs_api_client)
+        email_type_id = NotificationPreference.email_types[:notification_space_membership]
+
+        nodejs_api_client.email_send(email_type_id, {
+          initUserId: event.user_id,
+          spaceId: event.space_id,
+          updatedMembershipId: event.entity_id,
+          activityType: event.activity_type,
+          newMembershipRole: event.entity.role,
+        })
+      rescue HttpsAppsClient::Error => e
+        raise e unless e.code == HttpsAppsClient::Error::SPACE_NOT_FOUND_ERROR_CODE
+
+        {}
       end
-
-      def receivers(event)
-        User.joins(:space_memberships).merge(event.space.space_memberships.active).to_a.push(event.entity.user).uniq.select do |user|
-          next if user.id == event.user_id || user.challenge_bot?
-
-          notification_preference_by_role(event, user)
-        end
-      end
-
-      def notification_preference_by_role(event, user)
-        notification_preference = NotificationPreference.find_by_user(user)
-        role = event.space.space_memberships.find_by_user_id(user.id).role
-        role = "all" unless lead_or_admin?(role)
-
-        admin_preference =
-          if rsa?(role, user)
-            if membership_changed?(event)
-              "admin_membership_changed"
-            else
-              "admin_member_added_or_removed_from_space"
-            end
-          else
-            nil
-          end
-
-        preference =
-          if membership_changed?(event)
-            "#{role}_membership_changed"
-          elsif lead_or_admin?(role)
-            "#{role}_member_added_or_removed_from_space"
-          else
-            nil
-          end
-
-        admin_preference = rsa?(role, user) ? "admin_membership_changed" : nil
-        if admin_preference && preference
-          notification_preference.send(preference) || notification_preference.send(admin_preference)
-        elsif preference
-          notification_preference.send(preference)
-        else
-          false
-        end
-      end
-
-      def rsa?(role, user)
-        role != "admin" && user.review_space_admin?
-      end
-
-      def membership_changed?(event)
-        event.activity_type == "membership_changed"
-      end
-
-      def lead_or_admin?(role)
-        ["admin", "lead"].include?(role)
-      end
-
     end
-
   end
 end
diff --git a/app/services/space_event_service/notification_sender.rb b/app/services/space_event_service/notification_sender.rb
index e57595932..d61c17655 100644
--- a/app/services/space_event_service/notification_sender.rb
+++ b/app/services/space_event_service/notification_sender.rb
@@ -1,16 +1,6 @@
 module SpaceEventService
   # Responsible for sending notifications.
   class NotificationSender
-    TASK_TYPES = %w(
-      task_created
-      task_reassigned
-      task_accepted
-      task_completed
-      task_declined
-      task_deleted
-      task_reopened
-    ).freeze
-
     CONTENT_TYPES = %w(
       file_added
       note_added
@@ -39,15 +29,14 @@ class NotificationSender
     ).freeze
 
     class << self
-      def call(event)
-        notification_class(event).try(:send, event)
+      def call(event, nodejs_api_client)
+        notification_class(event).try(:send, event, nodejs_api_client)
       end
 
       private
 
       def notification_class(event)
         case event.activity_type
-        when *TASK_TYPES       then SpaceEventService::TaskNotifications
         when *CONTENT_TYPES    then SpaceEventService::ContentNotifications
         when *COMMENT_TYPES    then SpaceEventService::CommentNotifications
         when *SPACE_TYPES      then SpaceEventService::SpaceNotifications
diff --git a/app/services/space_event_service/space_notifications.rb b/app/services/space_event_service/space_notifications.rb
index a0c7ab83e..295080428 100644
--- a/app/services/space_event_service/space_notifications.rb
+++ b/app/services/space_event_service/space_notifications.rb
@@ -1,53 +1,14 @@
 module SpaceEventService
   class SpaceNotifications
-
     class << self
-
-      def send(event)
-        receivers(event).each do |receiver|
-          ReviewSpaceMailer.space_transition_email(event.entity, event.user, receiver, action(event)).deliver_now!
-        end
+      def send(event, nodejs_api_client)
+        email_type_id = NotificationPreference.email_types[:notification_space_action]
+        nodejs_api_client.email_send(email_type_id, {
+          initUserId: event.user_id,
+          spaceId: event.space_id,
+          activityType: event.activity_type,
+        })
       end
-
-      private
-
-      def action(event)
-        event.activity_type.to_s.gsub('space_', '')
-      end
-
-      def receivers(event)
-        User.joins(:space_memberships).merge(event.space.space_memberships.active.lead).select do |user|
-          next if user.id == event.user_id
-          notification_preference_by_role(event, user)
-        end
-      end
-
-      def notification_preference_by_role(event, user)
-        notification_preference = NotificationPreference.find_by_user(user)
-        role = event.space.space_memberships.find_by_user_id(user.id).role
-        if lead_or_admin?(role)
-          admin_preference = rsa?(role, user) ? "admin_space_locked_unlocked_deleted" : nil
-          preference = "#{role}_space_locked_unlocked_deleted"
-
-          if admin_preference
-            notification_preference.send(preference) || notification_preference.send(admin_preference)
-          else
-            notification_preference.send(preference)
-          end
-        else
-          false
-        end
-      end
-
-      def lead_or_admin?(role)
-        ["admin", "lead"].include?(role)
-      end
-
-      def rsa?(role, user)
-        role != "admin" && user.review_space_admin?
-      end
-
     end
-
   end
 end
diff --git a/app/services/space_membership_service/create.rb b/app/services/space_membership_service/create.rb
index 2f3051a39..537d09df1 100644
--- a/app/services/space_membership_service/create.rb
+++ b/app/services/space_membership_service/create.rb
@@ -1,49 +1,64 @@
 module SpaceMembershipService
   module Create
-    # @param [DNAnexusAPI] api
-    # @param [Space] space
-    # @param [SpaceMembership] membership
-    def self.call(api, space, membership)
-      invitee = membership.user.dxid
-      org_dxid = space.org_dxid(membership)
-
-      if ADMIN_USER != invitee || !admin_user_member?(api, org_dxid)
-        attrs = {
-          invitee: invitee,
-          level: "ADMIN",
-          suppressEmailNotification: true,
-        }
-
-        unless membership.lead_or_admin?
-          attrs.merge!(
-            level: "MEMBER",
-            projectAccess: membership.contributor? ? "CONTRIBUTE" : "VIEW",
-            allowBillableActivities: false,
-            appAccess: membership.contributor?,
-          )
+    class << self
+      # @param api [DNAnexusAPI]
+      # @param space [Space]
+      # @param membership [SpaceMembership]
+      # @param admin_member [User] - current user
+      def call(api, space, membership, admin_member)
+        new_user = membership.user
+        invitee = new_user.dxid
+        org_dxid = space.org_dxid(membership)
+
+        if ADMIN_USER != invitee || !admin_user_member?(api, org_dxid)
+          attrs = {
+            level: "ADMIN",
+            suppressEmailNotification: true,
+          }
+
+          unless membership.lead_or_admin?
+            attrs.merge!(
+              level: "MEMBER",
+              projectAccess: membership.contributor? ? "CONTRIBUTE" : "VIEW",
+              allowBillableActivities: false,
+              appAccess: membership.contributor?,
+            )
+          end
+
+          # To avoid invite yourself to an organization when user is RSA and
+          # space is created and active already
+          unless new_user.review_space_admin? && new_user.id == admin_member.id && space.state == Space::STATE_ACTIVE
+            api.org_invite(org_dxid, invitee, attrs)
+          end
         end
 
-        api.call(org_dxid, "invite", attrs)
-      end
+        # add a new member to the space given
+        space.space_memberships << membership
 
-      space.space_memberships << membership
+        # Skip adding to second space area when:
+        #   space is of `groups` type or
+        #   space is accepted (check in the Shared area only)
+        return membership if !space.review? || space.shared? && !space.accepted?
 
-      return membership if !space.review? || !space.accepted?
+        if space.confidential?
+          # add a new member to the Shared space
+          space.space.space_memberships << membership
+        else
+          # add a new member to a Private area of member side
+          private_space = space.confidential_space(membership)
+          private_space.space_memberships << membership if private_space
+        end
 
-      if space.confidential?
-        space.space.space_memberships << membership
-      else
-        private_space = space.confidential_space(membership)
-        private_space.space_memberships << membership if private_space # initial leads
+        membership
       end
 
-      membership
+      def admin_user_member?(api, org_dxid)
+        api.org_find_members(org_dxid, id: [ADMIN_USER])["results"].present?
+      rescue StandardError
+        false
+      end
     end
 
-    def self.admin_user_member?(api, org_dxid)
-      api.call(org_dxid, "findMembers", id: [ADMIN_USER])["results"].present?
-    rescue
-      false
-    end
+    private_class_method :admin_user_member?
   end
 end
diff --git a/app/services/space_membership_service/create_lead.rb b/app/services/space_membership_service/create_lead.rb
index 7c3d035af..36f8c9a6a 100644
--- a/app/services/space_membership_service/create_lead.rb
+++ b/app/services/space_membership_service/create_lead.rb
@@ -1,13 +1,13 @@
 module SpaceMembershipService
   module CreateLead
     # @param [String] target_side
-    def self.call(api, space, user, target_side)
+    def self.call(api, space, user, target_side, admin_member)
       membership = space.space_memberships.lead.new(
         user_id: user.id,
         side: target_side
       )
 
-      SpaceMembershipService::Create.call(api, space, membership)
+      SpaceMembershipService::Create.call(api, space, membership, admin_member)
     end
   end
 end
diff --git a/app/services/space_membership_service/create_or_update.rb b/app/services/space_membership_service/create_or_update.rb
index b8e0849cb..0228c5fba 100644
--- a/app/services/space_membership_service/create_or_update.rb
+++ b/app/services/space_membership_service/create_or_update.rb
@@ -3,15 +3,17 @@ module CreateOrUpdate
     # @param [String] target_role
     # @param [String] target_side
     # @param [SpaceMembership] admin_member
-    def self.call(api, space, user, target_role, admin_member)
-      membership = space.space_memberships.where(user_id: user.id).first_or_initialize
+    # @param [Boolean] should_emit_event
+    def self.call(api, space, user, target_role, admin_member, should_emit_event)
+      # Note: should_emit_event is a workaround, implemented as part of bugfix, to prevent breaking changes
+      membership = space.space_memberships.active.where(user_id: user.id).first_or_initialize
       membership.attributes = { role: target_role, side: admin_member.side }
 
       return if membership.lead?
 
       if membership.new_record?
-        membership = SpaceMembershipService::Create.call(api, space, membership)
-        create_event(space, membership, admin_member)
+        membership = SpaceMembershipService::Create.call(api, space, membership, admin_member.user)
+        create_event(space, membership, admin_member) if should_emit_event
         membership
       else
         SpaceMembershipService::Update.call(api, space, membership) unless membership.lead?
@@ -22,6 +24,5 @@ def self.call(api, space, user, target_role, admin_member)
     def self.create_event(space, member, admin_member)
       SpaceEventService.call(space.id, admin_member.user_id, admin_member, member, :membership_added)
     end
-
   end
 end
diff --git a/app/services/space_membership_service/delete.rb b/app/services/space_membership_service/delete.rb
new file mode 100644
index 000000000..9704e9021
--- /dev/null
+++ b/app/services/space_membership_service/delete.rb
@@ -0,0 +1,34 @@
+module SpaceMembershipService
+  # Operation to remove a member from a space, and the associated permissions on the platform
+  # THIS IS ONLY INTENTED FOR ADMIN SPACES currently. Other space types does not remove their members via memberships, only lowers permissions to DISABLED.
+  module Delete
+    # @param [DNAnexusAPI] admin_api - currently not used
+    # @param [DNAnexusAPI] user_api
+    # @param [Space] space
+    # @param [SpaceMembership] membership
+    # @param [SpaceMembership] admin_membership
+    def self.call(admin_api, user_api, space, membership, admin_membership)
+      return false unless space
+      return false unless membership
+      raise "This method is only intented for Admin Spaces at this moment!" unless space.administrator?
+
+      # Should not delete last member of a Space
+      raise "Cannot delete last member of space #{space.id}." if space.space_memberships.count == 1
+
+      # Remove user's org and project membership from dx platform
+      project_dxid = space.host_project
+      user_api.org_remove_member(space.host_dxorg, membership.user.dxid)
+
+      space.space_memberships.delete(membership)
+      membership.destroy!
+
+      create_event(space, membership, admin_membership)
+      space.save!
+      space
+    end
+
+    def self.create_event(space, membership, admin_membership)
+      SpaceEventService.call(space.id, admin_membership.user_id, admin_membership, membership, :membership_deleted)
+    end
+  end
+end
diff --git a/app/services/space_membership_service/to_lead.rb b/app/services/space_membership_service/to_lead.rb
index 0d663d563..091094409 100644
--- a/app/services/space_membership_service/to_lead.rb
+++ b/app/services/space_membership_service/to_lead.rb
@@ -23,6 +23,8 @@ def self.create_event(space, member, admin_member)
     end
 
     def self.update_current_lead(space, admin_member)
+      return false unless admin_member
+
       lead = space.leads.where(side: admin_member[:side]).first
       lead.role = SpaceMembership::ROLE_ADMIN
       lead.save!
diff --git a/app/services/space_service/accept.rb b/app/services/space_service/accept.rb
index 49f2dd606..9b3d284b9 100644
--- a/app/services/space_service/accept.rb
+++ b/app/services/space_service/accept.rb
@@ -7,6 +7,7 @@ def self.project_creator_class(space)
       elsif space.verification?
         ProjectBuilders::VerificationSpace
       else
+        # for Group, Gov and Admin types of spaces
         ProjectBuilders::GroupSpace
       end
     end
diff --git a/app/services/space_service/create.rb b/app/services/space_service/create.rb
index c3d152d2a..1d30f28e8 100644
--- a/app/services/space_service/create.rb
+++ b/app/services/space_service/create.rb
@@ -1,104 +1,193 @@
 module SpaceService
   class Create
-    # @param [SpaceForm] space_form
+    # @param space_form [SpaceForm] Space form.
+    # @param options [Hash] Options.
     def self.call(space_form, options = {})
       new(**options).call(space_form)
     end
 
-    def initialize(user:, api:, notification_mailer: NotificationsMailer)
+    def initialize(user:, api:, for_challenge: false, notification_mailer: NotificationsMailer)
       @api = api
+      @admin_api = DIContainer.resolve("api.admin")
       @notification_mailer = notification_mailer
       @user = user
+      @for_challenge = for_challenge
     end
 
     # Creates a space based on space_form data and returns new space
-    # @param [
-    #   SpaceForm, #name, #description, #space_type, #cts, #host_lead_dxuser,
-    #   #guest_lead_dxuser, #sponsor_org
-    # ] space_form
-    # @return [Space]
+    # @param space_form [SpaceForm] Space form object.
+    # @return [Space] Created space.
     def call(space_form)
+      space = nil
+      site_admins = nil
+
       Space.transaction do
         space = build_space(space_form)
-        org_dxs = [space.host_dxorg, space.guest_dxorg].uniq.compact
-        create_orgs(org_dxs)
+        dxorgs = [space.host_dxorg, space.guest_dxorg].uniq.compact
+
+        create_orgs(dxorgs)
         space.save!
         add_leads(space, space_form)
+        invite_challenge_bot(space) if @for_challenge
+
+        create_shared_or_private_project(space)
 
         if space.review?
-          create_reviewer_cooperative_project(space)
           create_reviewer_confidential_space(space, space_form)
-        else
-          remove_pfda_admin_user(org_dxs)
+        elsif space.groups? || space.government? || space.administrator?
+          remove_pfda_admin_user(space, space_form)
+        elsif space.private_type?
+          # Private Spaces have space_id set to it's own id
+          space.update(space_id: space.id)
         end
 
-        send_emails(space)
-        space
+        # For private, government and administrator spaces we accept the space automatically
+        accept_space(space) if space.private_type? || space.government? || space.administrator?
+
+        site_admins = User.site_admins - [space.host_lead]
+        create_site_admin_invitations_to_space(space, site_admins) if space.administrator?
       end
+
+      send_invitation_emails_to_site_admins(space, site_admins) if space.administrator?
+      send_emails(space) unless space.private_type?
+
+      space
     end
 
     private
 
-    attr_reader :user, :api, :notification_mailer
+    attr_reader :user, :api, :notification_mailer, :admin_api
+
+    # Invites all site administrators to the space
+    def create_site_admin_invitations_to_space(space, site_admins)
+      host_lead = space.host_lead # the admin who's created the current administrator space
+
+      return if site_admins.empty?
+
+      admin_membership = space.space_memberships.find_by(user: host_lead)
+
+      site_admins.each do |site_admin|
+        # rubocop:disable Layout/LineLength
+        Rails.logger.info("Adding site admin #{user.dxuser} to space #{space.id}" \
+                          " with admin membership #{admin_membership.id}")
+        SpaceMembershipService::CreateOrUpdate.call(api, space, site_admin, SpaceMembership::ROLE_ADMIN, admin_membership, false)
+        NotificationsMailer.space_activated_email(space, admin_membership).deliver_now!
+        # rubocop:enable Layout/LineLength
+      end
+    end
+
+    # Sends invitation emails to administrator space
+    # Logic inspired from SpaceMembershipService::CreateOrUpdate
+    # Known Bug: could probably send an email if space_membership record was already existing
+    # However this should be unexpected edge case AFAIK (samuel)
+    def send_invitation_emails_to_site_admins(space, site_admins)
+      host_lead = space.host_lead # the admin who's created the current administrator space
+
+      return if site_admins.empty?
+
+      admin_membership = space.space_memberships.find_by(user: host_lead)
+
+      site_admins.each do |site_admin|
+        membership = space.space_memberships.active.where(user_id: site_admin.id).first
+        SpaceEventService.call(space.id, admin_membership.user_id, admin_membership, membership, :membership_added)
+      end
+    end
+
+    # Accept space without user action
+    def accept_space(space)
+      space.active! if space.accepted? # always true for private_type spaces
+      space.save!
+    end
+
+    def invite_challenge_bot(space)
+      membership = space.space_memberships.find_by(user_id: space.host_lead.id)
+
+      SpaceService::Invite.call(
+        admin_api,
+        space,
+        membership,
+        User.challenge_bot,
+        SpaceMembership::ROLE_ADMIN,
+      )
+    end
+
+    # Construct guest dxorg upon its existance - used for Non review and Non groups
+    #   and Non gov., admin groups types,
+    #   which have space_form.guest_lead_dxuser == '' and space_form.sponsor_lead_dxuser == ''
+    #   - for Private type spaces we do not create dxorg here
+    def construct_guest_dxorg(guest_lead_dxuser, sponsor_lead_dxuser, uuid)
+      return if guest_lead_dxuser && guest_lead_dxuser.empty? && sponsor_lead_dxuser && sponsor_lead_dxuser.empty?
+
+      Org.construct_dxorg("space_guest_#{uuid}")
+    end
 
     def build_space(space_form)
       uuid = SecureRandom.hex[0..9]
 
-      space = Space.new(
+      Space.new(
         name: space_form.name,
         description: space_form.description,
         host_dxorg: Org.construct_dxorg("space_host_#{uuid}"),
+        guest_dxorg: construct_guest_dxorg(
+          space_form.guest_lead_dxuser, space_form.sponsor_lead_dxuser, uuid
+        ),
+        sponsor_org_id: space_form.space_sponsor&.org_id,
         space_type: space_form.space_type,
         cts: space_form.cts,
         restrict_to_template: space_form.restrict_to_template,
       )
-      space.guest_dxorg = guest_dx_org(uuid, space, space_form)
-      space.sponsor_org_id = space_form.space_sponsor.org_id if space.review?
-      # TODO: set up a migration to add sponsor_lead_dxuser?
-      # space.sponsor_lead_dxuser = space_form.sponsor.id if space.review?
-      space
     end
 
     # Provision Host and Guest orgs
     def create_orgs(orgs_dxs)
-      orgs_dxs.each { |dxorg| OrgService::Create.call(api, dxorg) }
+      orgs_dxs.each { |dxorg| OrgService::Create.call(dxorg) }
     end
 
     # Add host and guest leads as ADMINs
     # @param [Space]
     # @param [SpaceForm]
     def add_leads(space, space_form)
-      form_host_lead_dxuser = space_form.host_lead_dxuser
       add_lead(
         space,
-        User.find_by!(dxuser: form_host_lead_dxuser),
+        space_form.host_admin,
         SpaceMembership::SIDE_HOST,
       )
-      return if guest_blank?(space, space_form)
 
-      form_guest_lead_dxuser = space_form.guest_lead_dxuser
+      # do not add guest/sponsor side admin for private_type, gov and admin spaces
+      return if space.private_type? || space.government? || space.administrator?
+
       add_lead(
         space,
-        space.review? ? space_form.space_sponsor : User.find_by!(dxuser: form_guest_lead_dxuser),
+        space.review? ? space_form.space_sponsor : space_form.guest_admin,
         SpaceMembership::SIDE_GUEST,
       )
     end
 
-    def add_lead(space, user, side)
+    def add_lead(space, lead, side)
       SpaceMembershipService::CreateLead.call(
-        papi,
+        admin_api,
         space,
-        user,
+        lead,
         side,
+        user,
       )
     end
 
-    # Remove pfda admin from orgs
-    # Skip if the host user is actual ADMIN_USER
-    def remove_pfda_admin_user(orgs_dxs)
+    # Remove pfda admin from orgs (only for group spaces).
+    # Skip removing if:
+    #   - admin is a current user
+    #   - admin is a host lead - skip removing from a host org
+    #   - admin is a guest lead - skip removing from a guest org
+    def remove_pfda_admin_user(space, space_form)
       return if user.dxid == ADMIN_USER
 
-      orgs_dxs.each { |dxorg| papi.org_remove_member(dxorg, ADMIN_USER) }
+      unless space_form.host_admin.dxid == ADMIN_USER
+        admin_api.org_remove_member(space.host_dxorg, ADMIN_USER)
+      end
+
+      return if space_form.guest_admin.nil? || space_form.guest_admin&.dxid == ADMIN_USER
+
+      admin_api.org_remove_member(space.guest_dxorg, ADMIN_USER)
     end
 
     # Send an activation email to all space leads
@@ -109,11 +198,12 @@ def send_emails(space)
       end
     end
 
-    # Create a project of a cooperative review space.
+    # Create a project of a cooperative (shared) review or private_type space.
     # @param [Space]
-    def create_reviewer_cooperative_project(space)
+    #  rubocop:disable Metrics/MethodLength
+    def create_shared_or_private_project(space)
       if ADMIN_USER != user.dxid
-        papi.org_invite(
+        admin_api.org_invite(
           space.host_dxorg,
           user.dxid,
           level: DNAnexusAPI::ORG_MEMBERSHIP_ADMIN,
@@ -129,18 +219,20 @@ def create_reviewer_cooperative_project(space)
       api.project_invite(
         project_dxid,
         space.host_dxorg,
-        DNAnexusAPI::PROJECT_ACCESS_CONTRIBUTE,
+        DNAnexusAPI::PROJECT_ACCESS_ADMINISTER,
         suppressEmailNotification: true,
         suppressAllNotifications: true,
       )
 
-      api.project_invite(
-        project_dxid,
-        space.guest_dxorg,
-        DNAnexusAPI::PROJECT_ACCESS_CONTRIBUTE,
-        suppressEmailNotification: true,
-        suppressAllNotifications: true,
-      )
+      if space.shared?
+        api.project_invite(
+          project_dxid,
+          space.guest_dxorg,
+          DNAnexusAPI::PROJECT_ACCESS_CONTRIBUTE,
+          suppressEmailNotification: true,
+          suppressAllNotifications: true,
+        )
+      end
 
       api.project_invite(
         project_dxid,
@@ -153,6 +245,7 @@ def create_reviewer_cooperative_project(space)
       space.host_project = project_dxid
       space.save!
     end
+    #  rubocop:enable Metrics/MethodLength
 
     # Create a project of a confidential review space.
     # @param [Space]
@@ -207,25 +300,8 @@ def duplicate_space(space, source_space_id)
       space_copier.copy(space, source_space)
     end
 
-    def papi
-      @papi ||= DIContainer.resolve("api.admin")
-    end
-
     def guest_dx_org(uuid, space, space_form)
-      return if guest_blank?(space, space_form)
-      return Org.construct_dxorg("space_host_#{uuid}") if guest_and_host_equal?(space, space_form)
-
       Org.construct_dxorg("space_guest_#{uuid}")
     end
-
-    def guest_and_host_equal?(space, space_form)
-      return false unless space.verification?
-
-      space_form.guest_lead_dxuser == space_form.host_lead_dxuser
-    end
-
-    def guest_blank?(space, space_form)
-      space.verification? && space_form.guest_lead_dxuser.blank?
-    end
   end
 end
diff --git a/app/services/space_service/delete.rb b/app/services/space_service/delete.rb
index e90b042c6..b986b6e75 100644
--- a/app/services/space_service/delete.rb
+++ b/app/services/space_service/delete.rb
@@ -6,6 +6,7 @@ def self.call(space, admin_member)
       space.confidential_spaces.each(&:deleted!)
 
       delete_files(space)
+      # delete_memberships(space)
 
       SpaceEventService.call(space.id, admin_member.user_id, admin_member, space, :space_deleted)
     end
@@ -19,6 +20,10 @@ def self.delete_files(space)
       files.destroy_all
     end
 
+    def self.delete_memberships(space)
+      # TODO: fill in stub
+    end
+
     def self.remove_objects_from_platform(files)
       api = DNAnexusAPI.for_admin
       projects = {}
@@ -30,8 +35,8 @@ def self.remove_objects_from_platform(files)
       projects.each do |project, project_files|
         begin
           api.call(project, "removeObjects", objects: project_files.map(&:dxid))
-        rescue Net::HTTPClientException => e
-          raise e unless e.message =~ /^404/
+        rescue DXClient::Errors::NotFoundError
+          # do nothing
         end
       end
     end
diff --git a/app/services/space_service/invite.rb b/app/services/space_service/invite.rb
index 2096e87d8..6343c33bc 100644
--- a/app/services/space_service/invite.rb
+++ b/app/services/space_service/invite.rb
@@ -2,7 +2,7 @@ module SpaceService
   class Invite
     # @param [SpaceMembership] admin
     def self.call(api, space, admin, user, role)
-      member = SpaceMembershipService::CreateOrUpdate.call(api, space, user, role, admin)
+      member = SpaceMembershipService::CreateOrUpdate.call(api, space, user, role, admin, true)
       NotificationsMailer.space_invitation_email(space, member, admin).deliver_now! if member
     end
   end
diff --git a/app/services/space_service/project_builders/group_space.rb b/app/services/space_service/project_builders/group_space.rb
index b74155fbb..71d061091 100644
--- a/app/services/space_service/project_builders/group_space.rb
+++ b/app/services/space_service/project_builders/group_space.rb
@@ -7,6 +7,7 @@ def initialize(api)
 
       def create(space, admin)
         return if space.project_dxid(admin).present?
+
         contribute_org = space.org_dxid(admin)
         opposite_org = space.opposite_org_dxid(admin)
         project_dxid = create_project(admin, space)
diff --git a/app/services/space_service/publishing.rb b/app/services/space_service/publishing.rb
index 05a970c8d..71345039f 100644
--- a/app/services/space_service/publishing.rb
+++ b/app/services/space_service/publishing.rb
@@ -21,8 +21,7 @@ def scope_check(scope_to_check)
       elsif scope.is_a?(String)
         if scope != "public"
           raise "Publish route called with invalid scope #{scope}" unless Space.valid_scope?(scope)
-
-          space = Space.find_by(id: Regexp.last_match(1))
+          space = Space.find_by(id: Space.scope_id(scope))
           useful_space = space.present? && space.active? && space.accessible_by?(context)
           raise "Publish route called with invalid space #{scope}" unless useful_space
 
diff --git a/app/services/space_service/spaces_filter.rb b/app/services/space_service/spaces_filter.rb
index 2ccfd29a5..334d849dd 100644
--- a/app/services/space_service/spaces_filter.rb
+++ b/app/services/space_service/spaces_filter.rb
@@ -5,9 +5,9 @@ module SpacesFilter
 
     # Filters spaces.
     # @param user [User] User.
-    # @param query [String] Search query.
+    # @param filters [hash] filter params
     # @return [ActiveRecord::Relation<Space>] Filtered spaces.
-    def call(user, query = nil)
+    def call(user, filters = nil)
       spaces_site_admin = user.site_admin? ? Space.groups : Space.none
 
       spaces_rsa = user.review_space_admin? ? Space.shared : Space.none
@@ -21,36 +21,33 @@ def call(user, query = nil)
             Space.shared.or(Space.where.not(space_type: "review")).visible_by(user),
           )
 
-      spaces = spaces.where(build_where(query)).joins(:users) if query.present?
+      spaces = spaces.where(build_where(filters)).joins(:users) if filters.present?
 
       spaces
     end
 
     # Builds AREL where clause.
-    # @param query [String] Search query.
+    # @param filters [hash] filter params.
     # @return [Arel::Node] Built where AREL node.
-    def build_where(query)
+    def build_where(filters)
       conditions = []
       space_arel = Space.arel_table
-      users_arel = User.arel_table
-      sanitized_query = "%" + ActiveRecord::Base.sanitize_sql_like(query) + "%"
+      space_type = Space.space_types[filters[:type]]
 
-      state = Space.states[query]
-      space_type = Space.space_types[query]
-
-      conditions << space_arel[:state].eq(state) if state
       conditions << space_arel[:space_type].eq(space_type) if space_type
-
-      conditions << space_arel[:name].matches(sanitized_query)
-      conditions << users_arel[:dxuser].matches(sanitized_query)
-      conditions << users_arel[:first_name].matches(sanitized_query)
-      conditions << users_arel[:last_name].matches(sanitized_query)
-
+      conditions << space_arel[:name].matches(wildcard(filters[:name])) if filters[:name]
+      conditions << space_arel[:created_at].matches(wildcard(filters[:created_at])) if filters[:created_at]
+      conditions << space_arel[:updated_at].matches(wildcard(filters[:updated_at])) if filters[:updated_at]
+      conditions << space_arel[:description].matches(wildcard(filters[:description])) if filters[:description]
       conditions.reduce(nil) do |where, condition|
-        where ? where.or(condition) : condition
+        where ? where.and(condition) : condition
       end
     end
 
+    def wildcard(value)
+      "%#{value}%"
+    end
+
     private_class_method :build_where
   end
 end
diff --git a/app/services/upload_url_fetcher.rb b/app/services/upload_url_fetcher.rb
index 22f0caca5..defa4ac0c 100644
--- a/app/services/upload_url_fetcher.rb
+++ b/app/services/upload_url_fetcher.rb
@@ -3,7 +3,7 @@ class UploadUrlFetcher
 
   def initialize(context, uid)
     @context = context
-    @uid = uid
+    @file = UserFile.open.find_by!(uid: uid)
   end
 
   # Returns:
@@ -33,20 +33,13 @@ def fetch_url(options)
 
   private
 
-  def file
-    # Check that the file exists, is accessible by the user
-    #   and is in the open state. Throw 404 if otherwise.
-    @file ||= UserFile.open.find_by_uid!(uid)
-  end
-
   def token
     @token ||= begin
       if file.user_id != context.user_id
-        if file.created_by_challenge_bot? && context.user.is_challenge_admin?
-          CHALLENGE_BOT_TOKEN
-        else
-          raise "The current user does not have access to the file."
-        end
+        have_access = file.created_by_challenge_bot? && context.user.site_or_challenge_admin?
+        raise "The current user does not have access to the file." unless have_access
+
+        CHALLENGE_BOT_TOKEN
       else
         context.token
       end
@@ -57,5 +50,5 @@ def api
     api ||= DNAnexusAPI.new(token)
   end
 
-  attr_reader :context, :uid
+  attr_reader :context, :file
 end
diff --git a/app/services/users/charges_fetcher.rb b/app/services/users/charges_fetcher.rb
new file mode 100644
index 000000000..577dc0803
--- /dev/null
+++ b/app/services/users/charges_fetcher.rb
@@ -0,0 +1,23 @@
+module Users
+  # Fetches and calculates user charges from API.
+  class ChargesFetcher
+    class << self
+      def exceeded_charges_limit?(api, user)
+        charges = fetch(api, user)
+
+        charges[:totalCharges] >= user.total_limit
+      end
+
+      def fetch(api, user)
+        current_charges = api.user_charges(user)
+        charges_baseline = user.charges_baseline || {}
+
+        current_charges.each_with_object({}) do |(name, amount), memo|
+          value = [amount.to_f - charges_baseline[name].to_f, 0].max
+          memo[name] = value
+          memo[:totalCharges] = memo[:totalCharges].to_f + value
+        end
+      end
+    end
+  end
+end
diff --git a/app/services/workflows/workflow_filter.rb b/app/services/workflows/workflow_filter.rb
index fa9bb06f2..4c1d87492 100644
--- a/app/services/workflows/workflow_filter.rb
+++ b/app/services/workflows/workflow_filter.rb
@@ -11,6 +11,7 @@ class WorkflowFilter
       "name" => ->(value) { condition(WORKFLOW_SERIES_TABLE[:name], value) },
       "title" => ->(value) { condition(WORKFLOW_TABLE[:title], value) },
       "revision" => ->(value) { condition(WORKFLOW_TABLE[:revision], value.to_i) },
+      "featured" => ->(value) { WORKFLOW_TABLE[:featured].eq(to_bool(value)) },
       "username" => lambda do |value|
         condition(USER_TABLE[:first_name], value).or(condition(USER_TABLE[:last_name], value))
       end,
@@ -22,6 +23,10 @@ class WorkflowFilter
       "revision" => ->(work, value) { work.revision == value.to_i },
       "username" => ->(work, value) { work.user.full_name.downcase.include? value },
       "addedBy" => ->(work, value) { work.user.full_name.downcase.include? value },
+      "featured" => ->(app, value) { app.featured.to_s == value },
+      "location" => lambda do |workflow, value|
+        workflow.in_space? && workflow.space_object.name.downcase.include?(value)
+      end,
       "tags" => ->(work, value) { work.workflow_series.all_tags_list.to_s.downcase.include? value },
     }.freeze
   end
diff --git a/app/views/_partials/_btn_publish.html.erb b/app/views/_partials/_btn_publish.html.erb
index 06eec65fb..125ce73d1 100644
--- a/app/views/_partials/_btn_publish.html.erb
+++ b/app/views/_partials/_btn_publish.html.erb
@@ -1,35 +1,9 @@
 <%
   can_be_public = item.publishable_by?(@context, Scopes::SCOPE_PUBLIC)
-  spaces = Space.editable_by(@context).select { |space| item.publishable_by?(@context, space.uid) }
 %>
 
-<% if can_be_public && spaces.empty? %>
+<% if can_be_public %>
   <%= link_to publish_path + "?" + { id: item.uid, scope: Scopes::SCOPE_PUBLIC }.to_param, method: :post, class: "btn btn-success #{defined?(classes) ? classes : ''}" do %>
-    <span class="fa fa-bullhorn"></span> Publish
+    <span class="fa fa-bullhorn"></span> Publish publicly
   <% end %>
-<% elsif spaces.present? %>
-  <div class="btn-group">
-    <button id="dLabel" type="button" data-toggle="dropdown" aria-haspopup="true" aria-expanded="false" class="btn btn-success dropdown-toggle <%= defined?(classes) ? classes : '' %>">
-      Publish
-      <span class="caret"></span>
-    </button>
-
-    <ul class="dropdown-menu dropdown-menu-right" aria-labelledby="dLabel">
-      <% if can_be_public %>
-        <li>
-          <%= link_to publish_path + "?" + { id: item.uid, scope: Scopes::SCOPE_PUBLIC }.to_param, method: :post do %>
-            <span class="fa fa-globe"></span> Public
-          <% end %>
-        </li>
-      <% end %>
-
-      <% spaces.each do |space| %>
-        <li>
-          <%= link_to publish_path + "?" + { id: item.uid, scope: space.uid }.to_param, method: :post do %>
-            <span class="fa fa-object-group"></span> <%= space.title %>
-          <% end %>
-        </li>
-      <% end %>
-    </ul>
-  </div>
 <% end %>
diff --git a/app/views/_partials/_cloud_resources_modal.html.erb b/app/views/_partials/_cloud_resources_modal.html.erb
new file mode 100644
index 000000000..0096bd5a2
--- /dev/null
+++ b/app/views/_partials/_cloud_resources_modal.html.erb
@@ -0,0 +1,41 @@
+<%# Modal is accessible from every route, because absence of Paloma controller in coffee-script files
+rendering of modal is restricted in erb template %>
+<% if @context.logged_in?%>
+  <script type="text/html" id="cloud-resources-modal-template">
+    <div id="cloud_resources_modal" class="modal fade tasks-actions-modal modal-with-loader" data-bind="css: {loading: isLoading}">
+      <div class="modal-dialog">
+        <div class="modal-content">
+          <div class="modal-header">
+            <button type="button" class="close" data-dismiss="modal" aria-label="Close">
+              <span aria-hidden="true">&times;</span>
+            </button>
+            <h4 class="modal-title">Cloud usage report</h4>
+          </div>
+          <div class="loader-container">
+            <div class="loader">
+              <i class="fa fa-spinner fa-spin"></i>
+            </div>
+          </div>
+          <div class="modal-body">
+            <table class="table table-striped table-spec">
+              <thead>
+                <tr><th>Resource</th><th>Usage</th></tr>
+              </thead>
+                <tbody data-bind="foreach: resourceTable">
+                  <tr>
+                    <td data-bind="text: resource, style: { fontWeight: bold ? 'bold' : 'normal' }"></td>
+                    <td data-bind="text: usage, style: { fontWeight: bold ? 'bold' : 'normal' }"></td>
+                  </tr>
+                </tbody>
+            </table>
+          </div>
+        </div>
+      </div>
+    </div>
+  </script>
+  <div data-bind="template: {
+    name: 'cloud-resources-modal-template',
+    data: $root,
+    afterRender: function() { loadStats(isLoading, resourceTable) }
+  }">
+<% end %>
diff --git a/app/views/_partials/_feed.html.erb b/app/views/_partials/_feed.html.erb
index fac805795..2ae4c1be8 100644
--- a/app/views/_partials/_feed.html.erb
+++ b/app/views/_partials/_feed.html.erb
@@ -15,7 +15,7 @@
               from <span class="pfda-post-org"><%= post.user.org.name %></span> shared <span class="pfda-post-timestamp"><%= time_ago_in_words(post.created_at) %> ago</span>
             </li>
           </ul>
-          <%= unilinkfw(post, {title_class: 'pfda-post-title', noicon: true}) %>
+          <%= unilinkfw(post, {title_class: 'pfda-post-title', noicon: true, target: "_blank"}) %>
           <ul class="pfda-post-actions list-inline list-inline-bullets">
             <li class="pfda-post-comments">
               <%= link_to pathify_comments(post), class: 'link-muted' do %>
diff --git a/app/views/_partials/_head.html.erb b/app/views/_partials/_head.html.erb
index f1336e581..d9224b853 100644
--- a/app/views/_partials/_head.html.erb
+++ b/app/views/_partials/_head.html.erb
@@ -15,19 +15,6 @@
 
 <%= favicon_link_tag 'favicon.png', type: 'image/png' %>
 
-<% if ENV["DNANEXUS_BACKEND"] == "production" %>
-<script>
-  (function(i,s,o,g,r,a,m){i['GoogleAnalyticsObject']=r;i[r]=i[r]||function(){
-  (i[r].q=i[r].q||[]).push(arguments)},i[r].l=1*new Date();a=s.createElement(o),
-  m=s.getElementsByTagName(o)[0];a.async=1;a.src=g;m.parentNode.insertBefore(a,m)
-  })(window,document,'script','//www.google-analytics.com/analytics.js','ga');
-
-  ga('create', 'UA-70060830-1', 'auto');
-  ga('require', 'linkid');
-  ga('send', 'pageview');
-</script>
-<% end %>
-
 <% if @context.logged_in? %>
   <script>
     Precision.session_checker.run();
diff --git a/app/views/_partials/_head_react.html.erb b/app/views/_partials/_head_react.html.erb
new file mode 100644
index 000000000..1b86aed40
--- /dev/null
+++ b/app/views/_partials/_head_react.html.erb
@@ -0,0 +1,19 @@
+<meta charset="utf-8">
+<meta http-equiv="X-UA-Compatible" content="IE=edge">
+<meta name="viewport" content="width=device-width, initial-scale=1">
+<!-- The above 3 meta tags *must* come first in the head; any other head content must come *after* these tags -->
+
+<title><%= page_title %></title>
+<meta name="description" content="<%= content_for?(:description) ? yield(:description) : "A community for NGS assay evaluation" %>">
+
+<%= stylesheet_link_tag    "vendor",      media: "all", debug: false, 'data-turbolinks-track' => true  %>
+<%= stylesheet_link_tag    'application', media: 'all', 'data-turbolinks-track' => true %>
+<%= javascript_include_tag 'application', 'data-turbolinks-track' => true, 'integrity' => true %>
+<%= csrf_meta_tags %>
+
+<link rel="stylesheet" href="/assets/bundle.css">
+<script type="text/javascript" src="/assets/bundle.js"></script>
+
+<link href='https://fonts.googleapis.com/css?family=Lato:400,300,100,700,900,400italic|PT+Mono' rel='stylesheet' type='text/css'>
+
+<%= favicon_link_tag 'favicon.png', type: 'image/png' %>
diff --git a/app/views/_partials/_nav_links.html.erb b/app/views/_partials/_nav_links.html.erb
index bb43574f6..9b0e5629d 100644
--- a/app/views/_partials/_nav_links.html.erb
+++ b/app/views/_partials/_nav_links.html.erb
@@ -1,6 +1,6 @@
 <ul class="nav-links nav navbar-nav">
   <li class="<%= 'active' if controller_name == 'main' && action_name == 'index' %>" role="presentation">
-    <%= link_to root_path do %>
+    <%= link_to root_path, data: { turbolinks: false } do %>
       <div class="nav-icon fa fa-2x fa-home"></div>
       <div class="nav-pill-title">Overview</div>
     <% end %>
@@ -12,18 +12,25 @@
     <% end %>
   </li>
   <li class="<%= 'active' if %w(challenges meta_appathons appathons).include?(controller_name) %>" role="presentation">
-    <%= link_to challenges_path do %>
+    <%= link_to challenges_path, data: { turbolinks: false } do %>
       <div class="nav-icon fa fa-2x fa-trophy"></div>
       <div class="nav-pill-title">Challenges</div>
     <% end %>
   </li>
   <li class="<%= 'active' if %w(experts expert_questions).include?(controller_name) %>" role="presentation">
-    <%= link_to experts_path do %>
+    <%= link_to experts_path, data: { turbolinks: false } do %>
       <div class="nav-icon fa fa-2x fa-star-o"></div>
       <div class="nav-pill-title">Experts</div>
     <% end %>
   </li>
   <li class="nav-spacer"></li>
+  <li class="<%= 'active' if (controller_name == 'home' || controller_name == 'main') %>" role="presentation">
+    <%= link_to home_path, data: { turbolinks: false }, notice: "Book not found" do %>
+      <div class="nav-icon fa fa-2x fa-fort-awesome"></div>
+      <div class="nav-pill-title">My Home</div>
+    <% end %>
+  </li>
+  <li class="nav-spacer"></li>
   <li class="<%= 'active' if controller_name == 'notes' %>" role="presentation">
     <%= link_to notes_path do %>
       <div class="nav-icon fa fa-2x fa-sticky-note"></div>
@@ -37,14 +44,7 @@
     <% end %>
   </li>
   <li class="nav-spacer"></li>
-  <li class="<%= 'active' if (controller_name == 'home' || controller_name == 'main') %>" role="presentation">
-    <%= link_to home_path, data: { turbolinks: false }, notice: "Book not found" do %>
-      <div class="nav-icon fa fa-2x fa-fort-awesome"></div>
-      <div class="nav-pill-title">My Home</div>
-    <% end %>
-  </li>
   <% if UserPolicy.can_see_spaces?(@context) %>
-    <li class="nav-spacer"></li>
     <li class="<%= 'active' if controller_name == 'spaces' %>" role="presentation">
       <%= link_to spaces_path, data: { turbolinks: false }, "aria-label": 'Application spaces link' do %>
         <div class="nav-icon fa fa-2x fa-object-group"></div>
@@ -52,4 +52,14 @@
       <% end %>
     </li>
   <% end %>
+  <% if UserPolicy.can_see_gsrs?(@context) %>
+    <li role="presentation">
+      <%= link_to "/ginas/app/beta", data: { turbolinks: false }, "target": '_blank', "aria-label": 'GSRS link' do %>
+        <div class="nav-icon" style="margin-top: -4px; margin-bottom: 4px;">
+          <%= image_tag("navbar/gsrs-logo-round-bw.svg", style:'width: 16px; height: 16px', alt:"GSRS Logo") %>
+        </div>
+        <div class="nav-pill-title">GSRS</div>
+      <% end %>
+    </li>
+  <% end %>
 </ul>
diff --git a/app/views/_partials/_nav_links_spaces.html.erb b/app/views/_partials/_nav_links_spaces.html.erb
index 54812b5d7..3d7edc998 100644
--- a/app/views/_partials/_nav_links_spaces.html.erb
+++ b/app/views/_partials/_nav_links_spaces.html.erb
@@ -1,6 +1,6 @@
 <ul class="nav-links nav navbar-nav">
   <li class="<%= 'active' if controller_name == 'main' && action_name == 'index' %>" role="presentation">
-    <%= link_to root_path do %>
+    <%= link_to root_path, data: { turbolinks: false } do %>
       <div class="nav-icon fa fa-2x fa-home"></div>
       <div class="nav-pill-title">Back Home</div>
     <% end %>
diff --git a/app/views/_partials/_nav_user.html.erb b/app/views/_partials/_nav_user.html.erb
index bc05f0287..29efaaa18 100644
--- a/app/views/_partials/_nav_user.html.erb
+++ b/app/views/_partials/_nav_user.html.erb
@@ -1,32 +1,50 @@
-<ul class="nav navbar-nav navbar-right">
-  <li>
-    <a href="mailto:<%= SUPPORT_EMAIL %>"><span class="fa fa-fw fa-commenting-o"></span> Support</a>
+<ul class="nav-links nav navbar-nav navbar-right">
+  <li role="presentation">
+    <a href="mailto:<%= SUPPORT_EMAIL %>">
+      <div class="nav-icon fa fa-fw fa-commenting-o"></div>
+      <div class="nav-pill-title">Support</div>
+    </a>
+  </li>
+  <li role="presentation">
+    <a href="/docs">
+      <div class="nav-icon fa fa-question"></div>
+      <div class="nav-pill-title">Get Started</div>
+    </a>
   </li>
   <li class="dropdown">
-    <a href="#" class="dropdown-toggle" data-toggle="dropdown" role="button" aria-haspopup="true" aria-expanded="false">
-      <%= @context.logged_in? ? @context.user.full_name : @context.username %>
-      <span class="caret"></span>
+    <a href="#" class="dropdown-toggle" data-toggle="dropdown" role="button" aria-haspopup="true" aria-expanded="false" style="background: none;">
+      <svg height="16" data-prefix="fas" data-icon="user-circle" xmlns="http://www.w3.org/2000/svg" viewBox="0 0 496 512" class="Svg__Icon-sc-1hisztr-0 Svg-sc-1hisztr-1" aria-label="User profile icon"><path fill="currentColor" d="M248 8a248 248 0 100 496 248 248 0 000-496zm0 96a88 88 0 110 176 88 88 0 010-176zm0 344a191.6 191.6 0 01-146.5-68.2A111.5 111.5 0 01200 320c2.4 0 4.8.4 7.1 1.1 13 4.2 26.6 6.9 40.9 6.9 14.3 0 28-2.7 40.9-6.9 2.3-.7 4.7-1.1 7.1-1.1 42.9 0 79.7 24.4 98.5 59.8A191.6 191.6 0 01248 448z"></path></svg>
+      <div>
+        <%= @context.logged_in? ? @context.user.full_name : @context.username %>
+        <span class="caret"></span>
+      </div>
     </a>
     <ul class="dropdown-menu">
       <li><%= link_to "Profile", profile_path %></li>
       <% if @context.logged_in? %>
         <li><%= link_to "Public Profile", user_path(@context.username) %></li>
       <% end %>
+      <% if @context.logged_in? %>
+        <li>
+          <p data-bind="click: showCloudResourcesModal">
+            Cloud Resources
+          </p>
+        </li>
+      <% end %>
       <li><%= link_to "Manage Licenses", licenses_path %></li>
-      <% if @context.logged_in? && UserPolicy.access_notification_preference?(@context.user) %>
-        <li><a href="#" data-toggle="modal" data-target="#notification_settings_modal">Notification Settings</a></li>
+      <% if @context.logged_in? %>
+        <li><%= link_to "Notification Settings", '/account/notifications', data: { turbolinks: false } %></li>
       <% end %>
       <li role="separator" class="divider"></li>
-      <li><a href="<%= about_path %>"><span class="fa fa-fw fa-info-circle"></span> About</a></li>
+      <li><a href="<%= about_path %>" data-turbolinks="false"><span class="fa fa-fw fa-info-circle"></span> About</a></li>
       <li><a href="<%= guidelines_path %>"><span class="fa fa-fw fa-institution"></span> Guidelines</a></li>
       <li><a href="<%= docs_path %>"><span class="fa fa-fw fa-book"></span> Docs</a></li>
       <li role="separator" class="divider"></li>
-      <% if @context.can_administer_site? %>
+      <% if @context.logged_in? && @context.can_administer_site? %>
         <li><%= link_to "Admin Dashboard", admin_root_path %></li>
         <li role="separator" class="divider"></li>
       <% end %>
       <li><%= link_to "Log out", logout_path, method: :delete, data: { no_turbolink: true } %></li>
     </ul>
   </li>
-  <li><%= link_to image_tag(@context.gravatar_url, class: 'img-circle', height: '48px', alt: "Profile page"), profile_path %></li>
 </ul>
diff --git a/app/views/_partials/_navbar.html.erb b/app/views/_partials/_navbar.html.erb
index d7c6077e1..5c0b97531 100644
--- a/app/views/_partials/_navbar.html.erb
+++ b/app/views/_partials/_navbar.html.erb
@@ -11,7 +11,7 @@
           <span class="icon-bar"></span>
           <span class="icon-bar"></span>
         </button>
-        <%= link_to image_tag("precisionFDA.white.navbar.png", alt: "PrecisionFDA Home", height: "33px"), root_path, class: "navbar-brand" %>
+        <%= link_to image_tag("precisionFDA.white.navbar.png", alt: "PrecisionFDA Home", height: "33px"), root_path, class: "navbar-brand", data: { turbolinks: false } %>
       </div>
 
       <!-- Collect the nav links, forms, and other content for toggling -->
@@ -41,4 +41,5 @@
   <%= render "_partials/modal_notification_settings" %>
 <% end %>
 
-<%= render "_partials/modal_external_link_notify" %>
\ No newline at end of file
+<%= render "_partials/modal_external_link_notify" %>
+<%= render "_partials/cloud_resources_modal" %>
diff --git a/app/views/_partials/_selector_modal.html.erb b/app/views/_partials/_selector_modal.html.erb
index 897644782..0c95bc157 100644
--- a/app/views/_partials/_selector_modal.html.erb
+++ b/app/views/_partials/_selector_modal.html.erb
@@ -38,7 +38,7 @@
           <!-- Nav tabs -->
           <ul class="nav nav-pills nav-tabs-padded" role="tablist">
             <!-- ko foreach: objectLists -->
-            <li role="presentation" data-bind="attr: {'data-classname': className}">
+            <li role="presentation" data-bind="attr: {'data-classname': className}, click: clickTab">
               <a role="tab" data-toggle="tab" data-bind="attr: {href: '#tab-' + $parent.id + '-' + className}">
                 <span data-bind="text: name"></span>
                 <span class="badge" data-bind="visible: numFilteredObjects, text: numFilteredObjects"></span>
@@ -106,6 +106,11 @@
             <span data-bind="text: saving() ? 'Selecting...':'Select'"></span>
             <span class="badge" data-bind="visible: numSelected, text: numSelected"></span>
           </button>
+          <button type="button" class="btn btn-primary" 
+            data-bind="visible: (tabSelected() == 'file' && selectionType == 'checkbox') && numAllObjects, click: saveAll, css: {disabled: !canSaveAll()}, disable: !canSaveAll()">
+            <span data-bind="text: saving() ? 'Selecting...':'Select all'"></span>
+            <span class="badge" data-bind="visible: numAllObjects && !busy(), text: numAllObjects"></span>
+          </button>
         </div>
       </div><!-- /.modal-content -->
     </div><!-- /.modal-dialog -->
diff --git a/app/views/_partials/_upload_image_modal.html.erb b/app/views/_partials/_upload_image_modal.html.erb
index 5ab00f0e9..0c1853112 100644
--- a/app/views/_partials/_upload_image_modal.html.erb
+++ b/app/views/_partials/_upload_image_modal.html.erb
@@ -14,7 +14,7 @@
                   <span class="fa fa-file-image-o"></span> Browse image to upload... <input class="event-browse-files" type='file' accept="image/*" required />
                 </span>
 
-                <button class="btn btn-success btn-lg event-upload-image" style="display:none;" data-bind="visible: isUploadVisible, disable: disableActions">
+                <button class="btn btn-success btn-lg event-upload-image remediated-uploadbutton-color" style="display:none;" data-bind="visible: isUploadVisible, disable: disableActions">
                   <span class="fa fa-cloud-upload fa-fw"></span> Upload
                 </button>
                 <button class="btn btn-link btn-lg event-clear-files" style="display:none;" data-bind="visible: isClearVisible, disable: disableActions">
@@ -28,7 +28,7 @@
         <div class="container-fluid">
           <div class="section-files panel panel-info">
             <div class="panel-heading">
-              <span class="upload-state panel-title" data-bind="text: uploadStateDisplay"></span>
+              <span class="upload-state panel-title upload-modal-remediated-color" data-bind="text: uploadStateDisplay"></span>
             </div>
             <ul class="list-group list-files" data-bind="foreach: files">
               <li class='list-group-item' data-bind="css: classes">
diff --git a/app/views/_partials/_variant_result.html.erb b/app/views/_partials/_variant_result.html.erb
index 597224bbc..e978baa1c 100644
--- a/app/views/_partials/_variant_result.html.erb
+++ b/app/views/_partials/_variant_result.html.erb
@@ -19,7 +19,7 @@
     <% if defined?(input) and input %>
       <span class="text-muted"><%= input[1] %></span>
     <% elsif defined?(file) and file %>
-      <%= unilinkfw(file, scope_icon: true, icon_class: 'access-icon') %>
+      <%= unilinkfw(file, scope_icon: true, icon_class: 'access-icon', target: "_blank") %>
     <% else %>
       <span class="text-muted">not set</span>
     <% end %>
diff --git a/app/views/_partials/admin/_modal_image_uploader.html.erb b/app/views/_partials/admin/_modal_image_uploader.html.erb
index fcc7090b6..bbaf79927 100644
--- a/app/views/_partials/admin/_modal_image_uploader.html.erb
+++ b/app/views/_partials/admin/_modal_image_uploader.html.erb
@@ -17,7 +17,7 @@
                   <span class="fa fa-file-image-o"></span> Browse image to upload... <input class="event-browse-files" type='file' accept="image/*" required />
                 </span>
 
-                <button class="btn btn-success btn-lg event-upload-image" style="display:none;" data-bind="visible: modalUploader.isUploadVisible, disable: modalUploader.disableActions">
+                <button class="btn btn-success btn-lg event-upload-image remediated-uploadbutton-color" style="display:none;" data-bind="visible: modalUploader.isUploadVisible, disable: modalUploader.disableActions">
                   <span class="fa fa-cloud-upload fa-fw"></span> Upload
                 </button>
 
@@ -32,7 +32,7 @@
         <div class="container-fluid">
           <div class="section-files panel panel-info">
             <div class="panel-heading">
-              <span class="upload-state panel-title" data-bind="text: modalUploader.uploadStateDisplay"></span>
+              <span class="upload-state panel-title upload-modal-remediated-color" data-bind="text: modalUploader.uploadStateDisplay"></span>
             </div>
 
             <ul class="list-group list-files" data-bind="foreach: modalUploader.files">
diff --git a/app/views/account/index.html.erb b/app/views/account/index.html.erb
new file mode 100644
index 000000000..48406f2da
--- /dev/null
+++ b/app/views/account/index.html.erb
@@ -0,0 +1 @@
+<div id="app-root"></div>
diff --git a/app/views/admin/base/index.html.erb b/app/views/admin/base/index.html.erb
index 0388b9eaa..10aad6cb0 100644
--- a/app/views/admin/base/index.html.erb
+++ b/app/views/admin/base/index.html.erb
@@ -37,9 +37,6 @@
       <a class="btn btn-default" rel="nofollow" href="<%= admin_admin_memberships_path(group: :site) %>">
         <i class="fa fa-users" aria-hidden="true"></i> Admins
       </a>
-      <a class="btn btn-default" rel="nofollow" href="<%= admin_organizations_path %>">
-        <i class="fa fa-users" aria-hidden="true"></i> Organizations
-      </a>
       <%= link_to(content_tag(:span, "", class: "fa fa-file-excel-o") + " Generate report", run_report_path, method: 'post', class: 'btn btn-default') %>
       <a class="btn btn-default" rel="nofollow" href="<%= sidekiq_web_path %>" target="_blank">
         <i class="fa fa-bar-chart" aria-hidden="true"></i> Sidekiq
diff --git a/app/views/admin/comparator_settings/_grid.html.erb b/app/views/admin/comparator_settings/_grid.html.erb
index e021c8557..e49af1a81 100644
--- a/app/views/admin/comparator_settings/_grid.html.erb
+++ b/app/views/admin/comparator_settings/_grid.html.erb
@@ -2,7 +2,7 @@
   g.blank_slate partial: "_partials/empty_grid"
 
   g.column name: "Title", attribute: "title" do |app|
-    link_to app.title, app_path(app)
+    link_to app.title, home_path_to_item(app), target: "_blank", rel: "noopener noreferrer"
   end
 
   g.column name: "Name", attribute: "name", assoc: :app_series do |app|
diff --git a/app/views/admin/invitations/_disable_screen_modal.html.erb b/app/views/admin/invitations/_disable_screen_modal.html.erb
new file mode 100644
index 000000000..85c711154
--- /dev/null
+++ b/app/views/admin/invitations/_disable_screen_modal.html.erb
@@ -0,0 +1,12 @@
+<div class="modal right fade" id="disable-screen-modal">
+  <div class="modal-dialog">
+    <div class="modal-content text-info">
+      <div class="workflows">
+        <h1 class="modal-title" id="mapper-modal-label">
+          <i class="fa fa-spinner fa-spin"></i>
+          <span>Submitting...</span>
+        </h1>
+      </div>
+    </div>
+  </div>
+</div>
diff --git a/app/views/admin/invitations/_grid_modal.html.erb b/app/views/admin/invitations/_grid_modal.html.erb
new file mode 100644
index 000000000..e9ece0f19
--- /dev/null
+++ b/app/views/admin/invitations/_grid_modal.html.erb
@@ -0,0 +1,26 @@
+<div id="invitation_grid_modal" class="modal fade modal-with-loader wide-modal" data-bind="css: {loading: invitationGridLoading}">
+  <div class="modal-dialog">
+    <div class="modal-content">
+      <div class="modal-header">
+        <button type="button" class="close" data-dismiss="modal" aria-label="Close">
+          <span aria-hidden="true">&times;</span>
+        </button>
+        <h4 class="modal-title">Select Users</h4>
+      </div>
+      <div class="loader-container">
+        <div class="loader">
+          <i class="fa fa-spinner fa-spin"></i>
+        </div>
+      </div>
+      <div class="modal-body">
+        <div id="invitation_grid_container">
+          <%= render "admin/invitations/invitations_data_grid" %>
+        </div>
+      </div>
+      <div class="modal-footer">
+        <button class="btn btn-primary" data-bind="click: addSelectedUsers, enable: addSelectedEnabled()" tabindex="-1" >Select</button>
+        <button class="btn btn-default" data-dismiss="modal" tabindex="-1" >Close</button>
+      </div>
+    </div><!-- /.modal-content -->
+  </div><!-- /.modal-dialog -->
+</div><!-- /.modal -->
diff --git a/app/views/admin/invitations/_invitations_data_grid.html.erb b/app/views/admin/invitations/_invitations_data_grid.html.erb
new file mode 100644
index 000000000..9e14b7b8d
--- /dev/null
+++ b/app/views/admin/invitations/_invitations_data_grid.html.erb
@@ -0,0 +1,12 @@
+<table id="invitations_data_grid" class="table table-striped">
+  <thead>
+    <tr>
+      <th></th>
+      <th>First Name</th>
+      <th>Last Name</th>
+      <th>Email</th>
+      <th>DUNS</th>
+      <th>Requested At</th>
+    </tr>
+  </thead>
+</table>
diff --git a/app/views/admin/invitations/_invitations_table.html.erb b/app/views/admin/invitations/_invitations_table.html.erb
new file mode 100644
index 000000000..5e3ab40fe
--- /dev/null
+++ b/app/views/admin/invitations/_invitations_table.html.erb
@@ -0,0 +1,51 @@
+<table class="table table-striped">
+  <thead>
+    <th>First Name</th>
+    <th>Last Name</th>
+    <th>Email</th>
+    <th>DUNS</th>
+    <th></th>
+  </thead>
+  <tbody>
+  <!-- ko foreach: invitations -->
+    <tr>
+      <td>
+        <input type="text" class="form-control" data-bind="textInput: $data.firstName" />
+      </td>
+      <td>
+        <input type="text" class="form-control" data-bind="textInput: $data.lastName" />
+      </td>
+      <td>
+        <input type="text" class="form-control" data-bind="textInput: $data.email" />
+      </td>
+      <td>
+        <input type="text" class="form-control" data-bind="textInput: $data.duns" />
+      </td>
+      <td data-bind="click: $root.removeInvitation">
+        <button class="btn btn-danger">
+          <i class="fa fa-times"></i>
+        </button>
+      </td>
+    </tr>
+    <tr class="invitations-original-values">
+      <td data-bind="text: $data.original.first_name"></td>
+      <td data-bind="text: $data.original.last_name"></td>
+      <td data-bind="text: $data.original.email"></td>
+      <td data-bind="text: $data.original.duns"></td>
+      <td></td>
+    </tr>
+    <!-- ko if: $data.errors().length -->
+      <!-- ko foreach: $data.errors -->
+      <tr class='bg-danger text-danger'>
+        <td colspan="12" data-bind="text: $data"></td>
+      </tr>
+      <!-- /ko -->
+    <!-- /ko -->
+    <!-- ko if: $data.success() -->
+      <tr class='bg-success text-success'>
+        <td colspan="12">Request completed successfully.</td>
+      </tr>
+    <!-- /ko -->
+  <!-- /ko -->
+  </tbody>
+</table>
diff --git a/app/views/admin/invitations/index.html.erb b/app/views/admin/invitations/index.html.erb
new file mode 100644
index 000000000..cc4168a74
--- /dev/null
+++ b/app/views/admin/invitations/index.html.erb
@@ -0,0 +1,43 @@
+<% content_for :title, "Invitations" %>
+
+<div class="page-header">
+  <div class="page-title">Invitations</div>
+</div>
+
+<div class="pfda-padded invitations-search">
+  <div class="invitations-search-show-pending">
+    <button class="btn btn-success btn-lg" data-bind="click: showGridModal, disable: selectionDisabled">
+      Show all pending users
+    </button>
+    <div id="invitations-back-btn">
+      <button class="btn btn-sm">
+        <%= link_to "Back to the Admin Dashboard", admin_root_path, data: { turbolinks: false } %>
+      </button>
+    </div>
+    <%= render "admin/invitations/grid_modal" %>
+  </div>
+  <div id="invitations-search-input">
+    <input
+      type="text"
+      id="search_input"
+      class="form-control input-lg"
+      placeholder="Search user by First name, Last name or Email..."
+    />
+  </div>
+</div>
+
+<div class="alert alert-info invitations-search-info">
+  <i class="fa fa-info-circle"></i>
+  <span>Find users with search field or browse from user list. You can handle not more than <b>five</b> users at the same time.</span>
+</div>
+
+<!-- ko if: invitations().length -->
+<div class="pfda-padded invitations">
+  <%= render "admin/invitations/invitations_table" %>
+  <%= render "admin/invitations/disable_screen_modal" %>
+  <div class="pfda-padded-v">
+    <button class="btn btn-primary btn-lg" data-bind="click: provisionUsers">Submit</button>
+    <button class="btn btn-default btn-lg" data-bind="click: clearInvitations">Clear</button>
+  </div>
+</div>
+<!-- /ko -->
diff --git a/app/views/admin/users/index.html.erb b/app/views/admin/users/index.html.erb
index 16ebb1525..8827bc1ef 100644
--- a/app/views/admin/users/index.html.erb
+++ b/app/views/admin/users/index.html.erb
@@ -1,27 +1,3 @@
 <% content_for :title, "Users" %>
 
-<div class="page-header">
-  <div class="media">
-    <div class="media-body">
-      <div class="page-title">
-        <i class="fa fa-users" aria-hidden="true"></i>
-        Users
-      </div>
-    </div>
-  </div>
-</div>
-
-<div class="pfda-padded">
-  <a class="btn btn-primary" rel="nofollow" href="<%=provision_new_user_path%>">
-    <i class="fa fa-plus"></i>&nbsp;Provision new user
-  </a>
-</div>
-
-<div class="infoframe-outer">
-  <div class="infoframe-inner">
-    <h4 class="infoframe-title">Users Search</h4>
-    <div>
-      <%= render partial: "admin/users/grid", locals: { show_filters: :always } %>
-    </div>
-  </div>
-</div>
+<div id="app-root"></div>
diff --git a/app/views/analyses/new.html.erb b/app/views/analyses/new.html.erb
index e6adfe31b..d7a6f7991 100644
--- a/app/views/analyses/new.html.erb
+++ b/app/views/analyses/new.html.erb
@@ -3,7 +3,7 @@
 <div class="affix-spacer">
   <div class="affix-container">
     <div class="page-header clearfix">
-      <div class="page-title pull-left"><span class="fa fa-cube"></span> Run <%= link_to @workflow.title, workflow_path(@workflow.uid), target: "_blank" %></div>
+      <div class="page-title pull-left"><span class="fa fa-cube"></span> Run <%= link_to @workflow.title, home_path_to_item(@workflow), target: "_blank", rel: "noopener noreferrer" %></div>
       <div class="btn-group pull-right">
         <button class="btn btn-primary btn-lg " data-bind="text: isRunning()? 'Running...' : 'Run Workflow', disable: !canRunWorkflow() || isRunning(), click: function () { run_workflow(); }"><span class="fa fa-bolt"></span> <span ></span></button>
       </div>
diff --git a/app/views/apps/_editor.assets.html.erb b/app/views/apps/_editor.assets.html.erb
index 2e822cfe3..28c7b16e6 100644
--- a/app/views/apps/_editor.assets.html.erb
+++ b/app/views/apps/_editor.assets.html.erb
@@ -6,7 +6,7 @@
         <button type="button" class="close" data-dismiss="modal" aria-label="Close"><span aria-hidden="true">&times;</span></button>
         <h4 class="modal-title">
           Selected Assets for your VM Environment
-          <small><a href="<%= assets_path %>" target="_blank">Manage your assets <span class="fa fa-external-link"></span></a></small>
+          <small><a href="/home/assets" target="_blank">Manage your assets <span class="fa fa-external-link"></span></a></small>
         </h4>
       </div>
       <div class="modal-body modal-body-search-selector modal-body-padless">
@@ -48,7 +48,7 @@
           <div role="tabpanel" class="tab-pane tab-pane-preview active">
             <!-- ko if: previewedAsset() -->
               <div class="h2">
-                <a href="/assets/" data-bind="text: previewedAsset().name, attr: {href: '/app_assets/' + previewedAsset().uid}" target="_blank"></a>
+                <a href="/assets/" data-bind="text: previewedAsset().name, attr: {href: '/home/assets/' + previewedAsset().uid}" target="_blank"></a>
               </div>
               <hr>
               <!-- ko if: previewedAsset().descriptionDisplay() -->
diff --git a/app/views/apps/_editor.environment.html.erb b/app/views/apps/_editor.environment.html.erb
index f28a1ce1f..b95f4ef76 100644
--- a/app/views/apps/_editor.environment.html.erb
+++ b/app/views/apps/_editor.environment.html.erb
@@ -31,11 +31,11 @@
             <div class="list-group-item list-group-item-header">
               <button class="btn btn-default btn-block" data-toggle="modal" data-target="#assets-modal" data-bind="click: onOpenAssetsModal"><span class="fa fa-files-o"></span> Select assets...
               </button>
-              <p class="help-block text-right"><small><a href="<%= assets_path %>" target="_blank">Manage your assets <span class="fa fa-external-link"></span></a></small></p>
+              <p class="help-block text-right"><small><a href="/home/assets" target="_blank">Manage your assets <span class="fa fa-external-link"></span></a></small></p>
             </div>
             <!-- ko foreach: assets -->
             <div class="list-group-item list-group-item-removeable clearfix">
-              <a data-bind="attr: {href: '/assets/' + uid}" target="_blank"><span class="fa fa-file-zip-o"></span> <span data-bind="text: name"></span></a>  <a class="pull-right btn btn-link btn-link-danger fa fa-times" data-bind="click: $root.removeAsset"></a>
+              <a data-bind="attr: {href: '/home/assets/' + uid}" target="_blank"><span class="fa fa-file-zip-o"></span> <span data-bind="text: name"></span></a>  <a class="pull-right btn btn-link btn-link-danger fa fa-times" data-bind="click: $root.removeAsset"></a>
             </div>
             <!-- /ko -->
          </div>
diff --git a/app/views/apps/_grid.html.erb b/app/views/apps/_grid.html.erb
index 3b602cc4d..e5c3d4eee 100644
--- a/app/views/apps/_grid.html.erb
+++ b/app/views/apps/_grid.html.erb
@@ -10,7 +10,7 @@
   end
 
   g.column name: 'Title', attribute: 'title', assoc: :latest_version_app do |series|
-    unilink(series.latest_version_app, scope_icon: (defined?(scope_icon) ? scope_icon : true))
+    unilink(series.latest_version_app, scope_icon: (defined?(scope_icon) ? scope_icon : true), target: "_blank")
   end
 
   g.column name: 'Revision', attribute: 'revision', assoc: :latest_version_app do |series|
@@ -57,7 +57,7 @@
     elsif app_ids.present?
       "Not this revision"
     else
-      link_to "Try", new_app_job_path(series.latest_version_app), class: 'btn btn-primary btn-xs'
+      link_to "Try", new_app_job_path(series.latest_version_app)
     end
   end
 
diff --git a/app/views/apps/_import_cwl_wdl_modal.html.erb b/app/views/apps/_import_cwl_wdl_modal.html.erb
index a19d35049..c69ee9675 100644
--- a/app/views/apps/_import_cwl_wdl_modal.html.erb
+++ b/app/views/apps/_import_cwl_wdl_modal.html.erb
@@ -33,7 +33,7 @@
           <div>
             <span class="btn btn-primary btn-sm btn-browse-files">
               <span class="fa fa-files-o"></span>&nbsp;Select Docker Image
-              <input id="docker_image_file_input" type="file" accept=".tar.gz" data-bind="event: {change: dockerFileOnChangeHandler}">
+              <input id="docker_image_file_input" type="file" accept=".gz" data-bind="event: {change: dockerFileOnChangeHandler}">
             </span>
           </div>
           <!-- ko if: dockerImage() -->
diff --git a/app/views/apps/_import_cwl_wdl_success_modal.html.erb b/app/views/apps/_import_cwl_wdl_success_modal.html.erb
index 2e6f781d3..c849b8cc9 100644
--- a/app/views/apps/_import_cwl_wdl_success_modal.html.erb
+++ b/app/views/apps/_import_cwl_wdl_success_modal.html.erb
@@ -15,17 +15,17 @@
       <div class="modal-body">
         <p>
           <b>App URL:</b>
-          <a target="_blank" data-bind="text: newAppUid, attr: {href: newAppURL}"></a>
+          <a target="_blank" data-turbolinks="false" data-bind="text: newAppUid, attr: {href: newAppURL}"></a>
         </p>
         <!-- ko if: newAssetUid -->
         <p>
           <b>Asset URL:</b>
-          <a target="_blank" data-bind="text: newAssetUid, attr: {href: newAssetURL}"></a>
+          <a target="_blank" data-turbolinks="false" data-bind="text: newAssetUid, attr: {href: newAssetURL}"></a>
         </p>
         <!-- /ko -->
       </div>
       <div class="modal-footer">
-        <a data-bind="attr: {href: newAppURL}">
+        <a data-turbolinks="false" data-bind="attr: {href: newAppURL}, click: hideAppModal" target="_blank">
           <input type="button" class="btn btn-primary" tabindex="-1" value="Ok">
         </a>
       </div>
diff --git a/app/views/apps/batch_app.html.erb b/app/views/apps/batch_app.html.erb
index 731e46dc0..4aadeb1f3 100644
--- a/app/views/apps/batch_app.html.erb
+++ b/app/views/apps/batch_app.html.erb
@@ -137,7 +137,7 @@
                     <th></th>
                   </thead>
                   <tbody class="table-hover">
-                  <!-- ko if: !_.isArray(value()) -->
+                  <!-- ko if: !_.isArray(value()) && value().name -->
                     <tr>
                       <td ><span data-bind="text: $data.value().name"/></td>
                       <td class="io-field-remove text-right"><a class="btn btn-link btn-link-danger fa fa-times" data-bind="click: $root.removeItem"></a></td>
diff --git a/app/views/apps/index.html.erb b/app/views/apps/index.html.erb
index 8e8dfd023..6809ee75e 100644
--- a/app/views/apps/index.html.erb
+++ b/app/views/apps/index.html.erb
@@ -23,7 +23,7 @@
 <div class="pfda-toolbar">
   <div class="btn-group">
     <a class="btn btn-primary" href="<%= new_app_path %>"><span class="fa fa-plus-square fa-fw"></span> Create App</a>
-    <a class="btn btn-default" href="<%= assets_path %>"><span class="fa fa-file-zip-o fa-fw"></span> Manage Assets</a>
+    <a class="btn btn-default" href="/home/assets"><span class="fa fa-file-zip-o fa-fw"></span> Manage Assets</a>
   </div>
 </div>
 
diff --git a/app/views/apps/list.html.erb b/app/views/apps/list.html.erb
index 0c3a9ee59..ff8d7cb9e 100644
--- a/app/views/apps/list.html.erb
+++ b/app/views/apps/list.html.erb
@@ -24,7 +24,7 @@
   <a class="btn btn-primary" href="<%= new_app_path %>">
     <i class="fa fa-plus-square fa-fw"> </i> Create App
   </a>
-  <a class="btn btn-default" href="<%= assets_path %>">
+  <a class="btn btn-default" href="/home/assets">
     <i class="fa fa-file-zip-o fa-fw"> </i> Manage Assets
   </a>
 </div>
diff --git a/app/views/assets/new.html.erb b/app/views/assets/new.html.erb
index 2e88b3708..2973a108d 100644
--- a/app/views/assets/new.html.erb
+++ b/app/views/assets/new.html.erb
@@ -17,7 +17,7 @@
           <div class="pfda-help-block">
             <strong>Need to compile binaries in a compatible environment?</strong>
             <br>
-            <a target="_blank" class="btn btn-primary btn-sm" href="https://dl.dnanex.us/F/D/GQzjBj014vbqz0kyQBgy49YkqGx4gq54x3qx2qqz/precisionFDA-dev-50GB-vm-II-nopass-ssh.ova"><span class="fa fa-clone"></span> Download the precisionFDA virtual machine image</a> and load it into <a href="https://www.virtualbox.org/wiki/Downloads" target="_blank">VirtualBox</a> to instantiate an environment similar to the one that apps get when they run on the cloud. Power on the machine, and SSH into localhost (port 2222) as the <code>ubuntu</code> user (no password is required to log in).
+            <a target="_blank" class="btn btn-primary btn-sm" href="https://pfda-production-static-files.s3.amazonaws.com/vmi/precisionFDA-dev-50GB-vm-II-nopass-ssh.ova"><span class="fa fa-clone"></span> Download the precisionFDA virtual machine image</a> and load it into <a href="https://www.virtualbox.org/wiki/Downloads" target="_blank">VirtualBox</a> to instantiate an environment similar to the one that apps get when they run on the cloud. Power on the machine, and SSH into localhost (port 2222) as the <code>ubuntu</code> user (no password is required to log in).
           </div>
         </li>
         <li class="list-group-item">
@@ -28,19 +28,23 @@
           </p>
         </li>
         <li class="list-group-item">
-          <p class="list-group-item-heading lead">Step 3 <strong class="text-regular">Download the precisionFDA uploader</strong></p>
+          <p class="list-group-item-heading lead">Step 3 <strong class="text-regular">Download the precisionFDA CLI</strong></p>
           <p>
-            <a class="btn btn-primary btn-lg" href="/pfda-2.0.0.tar.gz">
+            <a class="btn btn-primary btn-lg" href="https://pfda-production-static-files.s3.amazonaws.com/cli/pfda-linux-2.1.2.tar.gz">
               <span class="fa fa-download"></span> Linux
             </a>
-            <a class="btn btn-primary btn-lg" href="/pfda-darwin-2.0.0.zip">
+            <a class="btn btn-primary btn-lg" href="https://pfda-production-static-files.s3.amazonaws.com/cli/pfda-darwin-2.1.2.tar.gz">
               <span class="fa fa-download"></span> Mac OS X
             </a>
-            <a class="btn btn-primary btn-lg" href="/pfda-windows-2.0.0.zip">
+            <a class="btn btn-primary btn-lg" href="https://pfda-production-static-files.s3.amazonaws.com/cli/pfda-windows-2.1.2.zip">
               <span class="fa fa-download"></span> Windows
             </a>
           </p>
           <p>Note: On Linux and Mac OS, after unzipping the downloaded file, you may need to run the following command to make the binary executable: <code>chmod +x pfda</code>.</p>
+          <p>Version 2.1.2 (8/03/2022): Fixed windows asset upload.</p>
+          <p>Version 2.1.1 (7/18/2022): Improvements to asset upload.</p>
+          <p>Version 2.1 (2/22/2022): Added download feature, upload to space, --cmd flag is now optional.</p>
+          <p>Version 2.0.1 (8/26/2021): Fix an issue uploading very large files.</p>
           <p>Version 2.0.0 (6/21/2018): TLS 1.2 and FIPS 140-2 support.</p>
           <p>Version 1.0.4 (1/5/2016): Reduced memory usage of each thread.</p>
           <p>Version 1.0.3 (12/14/2015): The uploader can now be used for both assets and files.</p>
@@ -56,12 +60,13 @@
           </p>
         </li>
         <li class="list-group-item">
-          <p class="list-group-item-heading lead">Step 5 <strong class="text-regular">Run the precisionFDA uploader</strong></p>
+          <p class="list-group-item-heading lead">Step 5 <strong class="text-regular">Run the precisionFDA CLI</strong></p>
           <p class="help-block">
             This command will archive the contents of the fake root into the named tarball, and upload it to precisionFDA along with the contents of the readme file (replace <strong>KEY</strong> below with the actual content of your authorization key copied from the page in step 4, and pasted directly in the command line):
           </p>
-          <p><code>./pfda --cmd upload-asset --key KEY --name my-asset.tar.gz --root /path/to/fake_root --readme my-asset.txt</code></p>
-          <p>TIP: The uploader saves your key in <code>$HOME/.config/precision-fda/config.json</code>, so after you have run it once, you don't need to specify the key in subsequent invocations.</p>
+          <p><code>./pfda upload-asset --key KEY --name my-asset.tar.gz --root /path/to/fake_root --readme my-asset.txt</code></p>
+          <p>TIP: The CLI saves your key in <code>$HOME/.pfda_config</code>, so after you have run it once, you don't need to specify the key in subsequent invocations.</p>
+          <p>TIP 2: The CLI can do a lot more than uploading assets, please see the <a href="/docs/cli">Command Line Interface documentation page</a></p>
         </li>
       </ul>
     </div>
diff --git a/app/views/challenges/_common_inputs.html.erb b/app/views/challenges/_common_inputs.html.erb
index 4c46ffaf9..4ecaeaef4 100644
--- a/app/views/challenges/_common_inputs.html.erb
+++ b/app/views/challenges/_common_inputs.html.erb
@@ -6,7 +6,7 @@
   </div>
 </div>
 <div class="form-group">
-  <%= f.label :description, "Description", class: 'control-label col-sm-2' %>
+  <%= f.label :description, "Description", class: 'control-label col-sm-2 challenges-description' %>
   <div class="col-sm-11 col-sm-offset-1">
     <%= f.text_area :description, class: "form-control", rows: 10,
       placeholder: "What is this challenge is about..." %>
@@ -28,7 +28,7 @@
     <%= f.select :app_owner_id,
       options_for_select(app_owners_for_select, @challenge.app_owner_id), {},
       selected: @challenge.app_owner_id,
-      class: "form-control",
+      class: "form-control disabledTextColor",
       required: "required",
       disabled: @challenge.started?
     %>
@@ -50,7 +50,7 @@
   <div class="col-sm-11 col-sm-offset-1">
     <%= f.text_field :end_at,
       value: @challenge.end_at.try(:to_s, :datepicker),
-      class: "form-control add-datetimepicker",
+      class: "form-control add-datetimepicker disabledTextColor",
       placeholder: 'Select date',
       required: "required",
       readonly: @challenge.over?
@@ -63,7 +63,7 @@
     <% if @challenge.new_record? %>
       <%= f.select :host_lead_dxuser, options_for_select(host_lead_dxusers), {}, class: "form-control", required: "required" %>
     <% else %>
-      <%= f.text_field :host_lead_dxuser, value: @challenge.space.host_lead_dxuser, disabled: true, readonly: true, class: "form-control" %>
+      <%= f.text_field :host_lead_dxuser, value: @challenge.space.host_lead_dxuser, disabled: true, readonly: true, class: "form-control disabledTextColor" %>
     <% end %>
   </div>
 </div>
@@ -73,7 +73,7 @@
     <% if @challenge.new_record? %>
       <%= f.select :guest_lead_dxuser, options_for_select(guest_lead_dxusers), {}, class: "form-control", required: "required" %>
     <% else %>
-      <%= f.text_field :host_lead_dxuser, value: @challenge.space.guest_lead_dxuser, disabled: true, readonly: true, class: "form-control" %>
+      <%= f.text_field :host_lead_dxuser, value: @challenge.space.guest_lead_dxuser, disabled: true, readonly: true, class: "form-control disabledTextColor", id: "challenge_guest_lead_dxuser" %>
     <% end %>
   </div>
 </div>
@@ -112,3 +112,11 @@
     %>
   </div>
 </div>
+<% if !@challenge.status.present? || @challenge.status_setup_or_pre_registration? %>
+  <div class="form-group required">
+    <%= f.label :pre_registration_url, "Pre-Registration Link", class: 'control-label col-sm-2' %>
+    <div class="col-sm-11 col-sm-offset-1">
+      <%= f.text_field :pre_registration_url, class: "form-control input-md", placeholder: "URL for challenge pre-registration" %>
+    </div>
+  </div>
+<% end %>
diff --git a/app/views/challenges/_edit_pre_registration.html.erb b/app/views/challenges/_edit_pre_registration.html.erb
new file mode 100644
index 000000000..3ab34bdaa
--- /dev/null
+++ b/app/views/challenges/_edit_pre_registration.html.erb
@@ -0,0 +1,5 @@
+<% if @context.can_administer_site? || @context.challenge_admin?%>
+  <div data-editable data-name="pre-registration" class="container container-padded" id="pre-registration">
+    <%= raw(challenge.regions["pre-registration"]) %>
+  </div>
+<% end %>
diff --git a/app/views/challenges/_treasure.html.erb b/app/views/challenges/_treasure.html.erb
index 09df7edbd..3a1ad450a 100644
--- a/app/views/challenges/_treasure.html.erb
+++ b/app/views/challenges/_treasure.html.erb
@@ -120,9 +120,9 @@
               <tr>
                 <td>Files</td>
                 <td>
-                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/files/file-F5VvyJ8059Qxvp0z3qXZ0Gzz"><span class="fa fa-file-o" aria-hidden="true"></span> NA12878MOD_1.fastq.gz</a>
+                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/home/files/file-F5VvyJ8059Qxvp0z3qXZ0Gzz"><span class="fa fa-file-o" aria-hidden="true"></span> NA12878MOD_1.fastq.gz</a>
                   <br>
-                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/files/file-F5Vqgqj059Qfpx8j0q2pyqq1"><span class="fa fa-file-o" aria-hidden="true"></span> NA12878MOD_2.fastq.gz</a>
+                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/home/files/file-F5Vqgqj059Qfpx8j0q2pyqq1"><span class="fa fa-file-o" aria-hidden="true"></span> NA12878MOD_2.fastq.gz</a>
                 </td>
               </tr>
               <tr>
diff --git a/app/views/challenges/consistency.html.erb b/app/views/challenges/consistency.html.erb
index 577e4eaf0..0b68e2090 100644
--- a/app/views/challenges/consistency.html.erb
+++ b/app/views/challenges/consistency.html.erb
@@ -69,7 +69,7 @@
   <% else %>
     <%= render "challenges/consistency/preview_results" %>
   <% end %>
-<% elsif params[:tab] == 'results-peek' && (@context.can_administer_site? || (ENV["DNANEXUS_BACKEND"] != "production")) %>
+<% elsif params[:tab] == 'results-peek' && (@context.can_administer_site? || !Rails.env.production?) %>
   <%= render "challenges/consistency/results" %>
 <% else %>
   <%= render "challenges/consistency/info" %>
diff --git a/app/views/challenges/consistency/_info.html.erb b/app/views/challenges/consistency/_info.html.erb
index 5275b2aad..3fe330af8 100644
--- a/app/views/challenges/consistency/_info.html.erb
+++ b/app/views/challenges/consistency/_info.html.erb
@@ -132,14 +132,14 @@
               <tr>
                 <td>Files</td>
                 <td>
-                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/files/file-Bk512Y00BpP45gyZG98KBqzQ"><span class="fa fa-file-o" aria-hidden="true"></span> NA12878-Garvan-Vial1_R1.fastq.gz</a>
+                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/home/files/file-Bk512Y00BpP45gyZG98KBqzQ"><span class="fa fa-file-o" aria-hidden="true"></span> NA12878-Garvan-Vial1_R1.fastq.gz</a>
                   <br>
-                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/files/file-Bk518Gj0Kpg3Xgzpg87Kx2jb"><span class="fa fa-file-o" aria-hidden="true"></span> NA12878-Garvan-Vial1_R2.fastq.gz</a>
+                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/home/files/file-Bk518Gj0Kpg3Xgzpg87Kx2jb"><span class="fa fa-file-o" aria-hidden="true"></span> NA12878-Garvan-Vial1_R2.fastq.gz</a>
                 </td>
                 <td>
-                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/files/file-Bq6P9k00qbVXjqGjv0364Y6q"><span class="fa fa-file-o" aria-hidden="true"></span> TSNano_1lane_L008_13801_NA12878_R1_001.fastq.gz</a>
+                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/home/files/file-Bq6P9k00qbVXjqGjv0364Y6q"><span class="fa fa-file-o" aria-hidden="true"></span> TSNano_1lane_L008_13801_NA12878_R1_001.fastq.gz</a>
                   <br>
-                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/files/file-Bq6ZpxQ0qbVy7x5f2GXpqzKx"><span class="fa fa-file-o" aria-hidden="true"></span> TSNano_1lane_L008_13801_NA12878_R2_001.fastq.gz</a>
+                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/home/files/file-Bq6ZpxQ0qbVy7x5f2GXpqzKx"><span class="fa fa-file-o" aria-hidden="true"></span> TSNano_1lane_L008_13801_NA12878_R2_001.fastq.gz</a>
                 </td>
               </tr>
               <tr>
@@ -325,22 +325,22 @@
                 <td>Accuracy Comparison #1a</td>
                 <td>Garvan VCF</td>
                 <td>-</td>
-                <td><a href="https://precision.fda.gov/files/file-Bk50V4Q0qVb65P0v2VPbfYPZ">NIST v2.19 VCF</a></td>
-                <td><a href="https://precision.fda.gov/files/file-Bk50V4Q0qVb4p8J8kkXpYZ4P">NIST v2.19 BED</a></td>
+                <td><a href="https://precision.fda.gov/home/files/file-Bk50V4Q0qVb65P0v2VPbfYPZ">NIST v2.19 VCF</a></td>
+                <td><a href="https://precision.fda.gov/home/files/file-Bk50V4Q0qVb4p8J8kkXpYZ4P">NIST v2.19 BED</a></td>
               </tr>
               <tr>
                 <td>Accuracy Comparison #1b</td>
                 <td>Garvan Rerun VCF</td>
                 <td>-</td>
-                <td><a href="https://precision.fda.gov/files/file-Bk50V4Q0qVb65P0v2VPbfYPZ">NIST v2.19 VCF</a></td>
-                <td><a href="https://precision.fda.gov/files/file-Bk50V4Q0qVb4p8J8kkXpYZ4P">NIST v2.19 BED</a></td>
+                <td><a href="https://precision.fda.gov/home/files/file-Bk50V4Q0qVb65P0v2VPbfYPZ">NIST v2.19 VCF</a></td>
+                <td><a href="https://precision.fda.gov/home/files/file-Bk50V4Q0qVb4p8J8kkXpYZ4P">NIST v2.19 BED</a></td>
               </tr>
               <tr>
                 <td>Accuracy Comparison #2</td>
                 <td>HLI VCF</td>
                 <td>-</td>
-                <td><a href="https://precision.fda.gov/files/file-Bk50V4Q0qVb65P0v2VPbfYPZ">NIST v2.19 VCF</a></td>
-                <td><a href="https://precision.fda.gov/files/file-Bk50V4Q0qVb4p8J8kkXpYZ4P">NIST v2.19 BED</a></td>
+                <td><a href="https://precision.fda.gov/home/files/file-Bk50V4Q0qVb65P0v2VPbfYPZ">NIST v2.19 VCF</a></td>
+                <td><a href="https://precision.fda.gov/home/files/file-Bk50V4Q0qVb4p8J8kkXpYZ4P">NIST v2.19 BED</a></td>
               </tr>
             </tbody>
           </table>
@@ -364,7 +364,7 @@
               <h4><span class="fa fa-area-graph" aria-hidden="true"></span> Accuracy comparisons</h4>
               <ul>
                 <li>are between each of your VCF files and the NIST v2.19 (Genome in a Bottle) benchmark VCF file, constrained within the coordinates of the accompanying NIST v2.19 BED file.</li>
-                <li>The precisionFDA website provides <a href="https://precision.fda.gov/files/file-Bk50V4Q0qVb65P0v2VPbfYPZ">NA12878-NISTv2.19.vcf.gz</a> (to be used as benchmark VCF) and <a href="https://precision.fda.gov/files/file-Bk50V4Q0qVb4p8J8kkXpYZ4P">NA12878-NISTv2.19.bed</a> (to be used as benchmark BED).</li>
+                <li>The precisionFDA website provides <a href="https://precision.fda.gov/home/files/file-Bk50V4Q0qVb65P0v2VPbfYPZ">NA12878-NISTv2.19.vcf.gz</a> (to be used as benchmark VCF) and <a href="https://precision.fda.gov/home/files/file-Bk50V4Q0qVb4p8J8kkXpYZ4P">NA12878-NISTv2.19.bed</a> (to be used as benchmark BED).</li>
                 <li>These comparisons are meant to estimate the accuracy of your pipeline within the “confident” regions of the Genome in a Bottle “gold standard” dataset – therefore you must leave the test BED entry blank.</li>
               </ul>
             </div>
diff --git a/app/views/challenges/consistency/_table_datasets.html.erb b/app/views/challenges/consistency/_table_datasets.html.erb
index 4d2127588..a7470c0c6 100644
--- a/app/views/challenges/consistency/_table_datasets.html.erb
+++ b/app/views/challenges/consistency/_table_datasets.html.erb
@@ -10,9 +10,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/eric.banks">ebanks-nist</a>*</td>
-      <td><a href="/files/file-Bq8B98003fJy7x5f2GXpvFqy">G1</a>,
-        <a href="/files/file-Bq8BF8j03fJf0xG3F0Y8QGKb">G2</a>,
-        <a href="/files/file-Bq8BJJj03fJgJ5YbPvJFKQGZ">H</a></td>
+      <td><a href="/home/files/file-Bq8B98003fJy7x5f2GXpvFqy">G1</a>,
+        <a href="/home/files/file-Bq8BF8j03fJf0xG3F0Y8QGKb">G2</a>,
+        <a href="/home/files/file-Bq8BJJj03fJgJ5YbPvJFKQGZ">H</a></td>
       <td><a href="/comparisons/113">R1</a>,
           <a href="/comparisons/114">R2</a>,
           <a href="/comparisons/118">A1a</a>,
@@ -22,9 +22,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/rafael.aldana">raldana-sentieon</a></td>
-      <td><a href="/files/file-BvFpJ9Q0xgF4bz8zqkJfv53Y">G1</a>,
-        <a href="/files/file-BvFpJ9Q0xgF0JgV6FJ508QzJ">G2</a>,
-        <a href="/files/file-BvFpJ9Q0xgF3bXZB8Q650v4J">H</a></td>
+      <td><a href="/home/files/file-BvFpJ9Q0xgF4bz8zqkJfv53Y">G1</a>,
+        <a href="/home/files/file-BvFpJ9Q0xgF0JgV6FJ508QzJ">G2</a>,
+        <a href="/home/files/file-BvFpJ9Q0xgF3bXZB8Q650v4J">H</a></td>
       <td><a href="/comparisons/471">R1</a>,
           <a href="/comparisons/472">R2</a>,
           <a href="/comparisons/479">A1a</a>,
@@ -34,9 +34,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/deepak.grover">dgrover-gatk</a></td>
-      <td><a href="/files/file-BvP364809V3vz9XV5Z6PxPPK">G1</a>,
-        <a href="/files/file-BvP364809V3k6JvQBV5597vb">G2</a>,
-        <a href="/files/file-BvP364809V3k8GK0QVz2QJ8z">H</a></td>
+      <td><a href="/home/files/file-BvP364809V3vz9XV5Z6PxPPK">G1</a>,
+        <a href="/home/files/file-BvP364809V3k6JvQBV5597vb">G2</a>,
+        <a href="/home/files/file-BvP364809V3k8GK0QVz2QJ8z">H</a></td>
       <td><a href="/comparisons/989">R1</a>,
           <a href="/comparisons/990">R2</a>,
           <a href="/comparisons/788">A1a</a>,
@@ -46,9 +46,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/jeremy.edwards">jedwards-sentieon</a></td>
-      <td><a href="/files/file-BvGPB1j0bpvGjJyZBQ66jXJZ">G1</a>,
-        <a href="/files/file-BvGPB1j0bpvJKyJpPV516Vfb">G2</a>,
-        <a href="/files/file-BvGPB1j0bpv60XvgZ5zBv8PG">H</a></td>
+      <td><a href="/home/files/file-BvGPB1j0bpvGjJyZBQ66jXJZ">G1</a>,
+        <a href="/home/files/file-BvGPB1j0bpvJKyJpPV516Vfb">G2</a>,
+        <a href="/home/files/file-BvGPB1j0bpv60XvgZ5zBv8PG">H</a></td>
       <td><a href="/comparisons/550">R1</a>,
           <a href="/comparisons/551">R2</a>,
           <a href="/comparisons/552">A1a</a>,
@@ -58,9 +58,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/changhoon.kim">ckim-gatk</a></td>
-      <td><a href="/files/file-BvGqJb008byY68x7QvJkK8ZG">G1</a>,
-        <a href="/files/file-BvGqXz008byq2zQg5k9vf781">G2</a>,
-        <a href="/files/file-BvGqbp808byQXY6K9k5GfYB8">H</a></td>
+      <td><a href="/home/files/file-BvGqJb008byY68x7QvJkK8ZG">G1</a>,
+        <a href="/home/files/file-BvGqXz008byq2zQg5k9vf781">G2</a>,
+        <a href="/home/files/file-BvGqbp808byQXY6K9k5GfYB8">H</a></td>
       <td><a href="/comparisons/597">R1</a>,
           <a href="/comparisons/601">R2</a>,
           <a href="/comparisons/590">A1a</a>,
@@ -70,9 +70,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/changhoon.kim">ckim-vqsr</a></td>
-      <td><a href="/files/file-BvGpxy008byQ98qyjvgykFqz">G1</a>,
-        <a href="/files/file-BvGqgV008bygk1Gq6Q69QQvb">G2</a>,
-        <a href="/files/file-BvGqkQ808byZbz8zqkJfv91Z">H</a></td>
+      <td><a href="/home/files/file-BvGpxy008byQ98qyjvgykFqz">G1</a>,
+        <a href="/home/files/file-BvGqgV008bygk1Gq6Q69QQvb">G2</a>,
+        <a href="/home/files/file-BvGqkQ808byZbz8zqkJfv91Z">H</a></td>
       <td><a href="/comparisons/598">R1</a>,
           <a href="/comparisons/602">R2</a>,
           <a href="/comparisons/583">A1a</a>,
@@ -82,9 +82,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/changhoon.kim">ckim-isaac</a></td>
-      <td><a href="/files/file-BvGq4jj08byzJYQkvkJX994B">G1</a>,
-        <a href="/files/file-BvGq74008byqyfYqF4pZpQFZ">G2</a>,
-        <a href="/files/file-BvGqFk008byzv5fqxxJj7yBj">H</a></td>
+      <td><a href="/home/files/file-BvGq4jj08byzJYQkvkJX994B">G1</a>,
+        <a href="/home/files/file-BvGq74008byqyfYqF4pZpQFZ">G2</a>,
+        <a href="/home/files/file-BvGqFk008byzv5fqxxJj7yBj">H</a></td>
       <td><a href="/comparisons/596">R1</a>,
           <a href="/comparisons/600">R2</a>,
           <a href="/comparisons/585">A1a</a>,
@@ -94,9 +94,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/changhoon.kim">ckim-dragen</a></td>
-      <td><a href="/files/file-BvGqyZ008byQGvzYg1zBPx34">G1</a>,
-        <a href="/files/file-BvGqzj808byQj68JX5z89BZ2">G2</a>,
-        <a href="/files/file-BvGv2K808bygy8YQ4v6822Kq">H</a></td>
+      <td><a href="/home/files/file-BvGqyZ008byQGvzYg1zBPx34">G1</a>,
+        <a href="/home/files/file-BvGqzj808byQj68JX5z89BZ2">G2</a>,
+        <a href="/home/files/file-BvGv2K808bygy8YQ4v6822Kq">H</a></td>
       <td><a href="/comparisons/599">R1</a>,
           <a href="/comparisons/603">R2</a>,
           <a href="/comparisons/593">A1a</a>,
@@ -106,9 +106,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/changhoon.kim">ckim-genalice</a></td>
-      <td><a href="/files/file-BvJ6p6008bygx9gxj0gj2qjb">G1</a>,
-        <a href="/files/file-BvJ6x0Q08byxb96YY5z4K7zJ">G2</a>,
-        <a href="/files/file-BvJ6yXQ08byzv0Qv9Q6J3b2X">H</a></td>
+      <td><a href="/home/files/file-BvJ6p6008bygx9gxj0gj2qjb">G1</a>,
+        <a href="/home/files/file-BvJ6x0Q08byxb96YY5z4K7zJ">G2</a>,
+        <a href="/home/files/file-BvJ6yXQ08byzv0Qv9Q6J3b2X">H</a></td>
       <td><a href="/comparisons/635">R1</a>,
           <a href="/comparisons/636">R2</a>,
           <a href="/comparisons/631">A1a</a>,
@@ -118,9 +118,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/mike.lin">mlin-fermikit</a></td>
-      <td><a href="/files/file-BvK9b880PJ941KZJ0bkqxGf8">G1</a>,
-        <a href="/files/file-BvK9kBQ08fZ67Y9Y14Zvpv6Z">G2</a>,
-        <a href="/files/file-BvK91380qYkyPQZj08Zgqq8Z">H</a></td>
+      <td><a href="/home/files/file-BvK9b880PJ941KZJ0bkqxGf8">G1</a>,
+        <a href="/home/files/file-BvK9kBQ08fZ67Y9Y14Zvpv6Z">G2</a>,
+        <a href="/home/files/file-BvK91380qYkyPQZj08Zgqq8Z">H</a></td>
       <td><a href="/comparisons/698">R1</a>,
           <a href="/comparisons/699">R2</a>,
           <a href="/comparisons/700">A1a</a>,
@@ -130,9 +130,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/christian.iseli">ciseli-custom</a></td>
-      <td><a href="/files/file-BvP0pf007Z868yVbk5JXQ5fB">G1</a>,
-        <a href="/files/file-BvP0pf007Z87x9gxj0gj3393">G2</a>,
-        <a href="/files/file-BvP0pf007Z8Pv0Qv9Q6J3qBQ">H</a></td>
+      <td><a href="/home/files/file-BvP0pf007Z868yVbk5JXQ5fB">G1</a>,
+        <a href="/home/files/file-BvP0pf007Z87x9gxj0gj3393">G2</a>,
+        <a href="/home/files/file-BvP0pf007Z8Pv0Qv9Q6J3qBQ">H</a></td>
       <td><a href="/comparisons/754">R1</a>,
           <a href="/comparisons/753">R2</a>,
           <a href="/comparisons/748">A1a</a>,
@@ -142,9 +142,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/aaron.statham">astatham-gatk</a></td>
-      <td><a href="/files/file-BvFzz4j0XBX6bP8Xb53k1vyX">G1</a>,
-        <a href="/files/file-BvFzyzj078B6bP8Xb53k1vy6">G2</a>,
-        <a href="/files/file-BvFzyJ803qvFPQ10Z93yJyQ4">H</a></td>
+      <td><a href="/home/files/file-BvFzz4j0XBX6bP8Xb53k1vyX">G1</a>,
+        <a href="/home/files/file-BvFzyzj078B6bP8Xb53k1vy6">G2</a>,
+        <a href="/home/files/file-BvFzyJ803qvFPQ10Z93yJyQ4">H</a></td>
       <td><a href="/comparisons/533">R1</a>,
           <a href="/comparisons/534">R2</a>,
           <a href="/comparisons/536">A1a</a>,
@@ -154,9 +154,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/adam.novak">anovak-vg</a></td>
-      <td><a href="/files/file-BvP6gX00KyGVG3YK38ZQjb04">G1</a>,
-        <a href="/files/file-BvP6gb80PxgyPQZj08ZjjJFv">G2</a>,
-        <a href="/files/file-BvP6ggj0p3vkFz5PYV3j6jz6">H</a></td>
+      <td><a href="/home/files/file-BvP6gX00KyGVG3YK38ZQjb04">G1</a>,
+        <a href="/home/files/file-BvP6gb80PxgyPQZj08ZjjJFv">G2</a>,
+        <a href="/home/files/file-BvP6ggj0p3vkFz5PYV3j6jz6">H</a></td>
       <td><a href="/comparisons/835">R1</a>,
           <a href="/comparisons/836">R2</a>,
           <a href="/comparisons/832">A1a</a>,
@@ -166,9 +166,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/marghoob.mohiyuddin">mmohiyuddin-mixed</a></td>
-      <td><a href="/files/file-BvP5x1Q0X24Y3vjGf5z5K6FY">G1</a>,
-        <a href="/files/file-BvZ1Zb00X24xQ0V341kkb211">G2</a>,
-        <a href="/files/file-BvP5x1Q0X24z59zQybP7P1jp">H</a></td>
+      <td><a href="/home/files/file-BvP5x1Q0X24Y3vjGf5z5K6FY">G1</a>,
+        <a href="/home/files/file-BvZ1Zb00X24xQ0V341kkb211">G2</a>,
+        <a href="/home/files/file-BvP5x1Q0X24z59zQybP7P1jp">H</a></td>
       <td><a href="/comparisons/996">R1</a>,
           <a href="/comparisons/859">R2</a>,
           <a href="/comparisons/821">A1a</a>,
@@ -178,9 +178,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/charles.chapple">cchapple-mixed</a></td>
-      <td><a href="/files/file-BvP8G100Kkz0XY6K9k5Gfxk0">G1</a>,
-        <a href="/files/file-BvP8GV00KkzJy28Xy197yB63">G2</a>,
-        <a href="/files/file-BvP8JP00Kkz0XY6K9k5Gfxk5">H</a></td>
+      <td><a href="/home/files/file-BvP8G100Kkz0XY6K9k5Gfxk0">G1</a>,
+        <a href="/home/files/file-BvP8GV00KkzJy28Xy197yB63">G2</a>,
+        <a href="/home/files/file-BvP8JP00Kkz0XY6K9k5Gfxk5">H</a></td>
       <td><a href="/comparisons/842">R1</a>,
           <a href="/comparisons/845">R2</a>,
           <a href="/comparisons/840">A1a</a>,
@@ -190,9 +190,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/adam.mark.2">amark-mixed</a></td>
-      <td><a href="/files/file-BvPBqvQ0KbffzZ9kykJqbG5G">G1</a>,
-        <a href="/files/file-BvPF59Q0KbfxKyJpPV516yjq">G2</a>,
-        <a href="/files/file-BvPF2380Kbfvz9XV5Z6PxV6Q">H</a></td>
+      <td><a href="/home/files/file-BvPBqvQ0KbffzZ9kykJqbG5G">G1</a>,
+        <a href="/home/files/file-BvPF59Q0KbfxKyJpPV516yjq">G2</a>,
+        <a href="/home/files/file-BvPF2380Kbfvz9XV5Z6PxV6Q">H</a></td>
       <td><a href="/comparisons/985">R1</a>,
           <a href="/comparisons/986">R2</a>,
           <a href="/comparisons/982">A1a</a>,
@@ -202,9 +202,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/jason.harris">jharris-gatk</a></td>
-      <td><a href="/files/file-BvP93qQ012GV1XBkv59P7Jfx">G1</a>,
-        <a href="/files/file-BvP93qQ012GbGjzbkbPGV9ZQ">G2</a>,
-        <a href="/files/file-BvP93qQ012GVZZK7b9z67zK7">H</a></td>
+      <td><a href="/home/files/file-BvP93qQ012GV1XBkv59P7Jfx">G1</a>,
+        <a href="/home/files/file-BvP93qQ012GbGjzbkbPGV9ZQ">G2</a>,
+        <a href="/home/files/file-BvP93qQ012GVZZK7b9z67zK7">H</a></td>
       <td><a href="/comparisons/847">R1</a>,
           <a href="/comparisons/848">R2</a>,
           <a href="/comparisons/849">A1a</a>,
@@ -214,9 +214,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/ayshwarya.subramanian">asubramanian-gatk</a></td>
-      <td><a href="/files/file-BvP0bk00Yf86zZ9kykJqbB1q">G1</a>,
-        <a href="/files/file-BvP0bk00Yf8Gz9XV5Z6PxP2G">G2</a>,
-        <a href="/files/file-BvP0vzj0Yf868yVbk5JXQ5gj">H</a></td>
+      <td><a href="/home/files/file-BvP0bk00Yf86zZ9kykJqbB1q">G1</a>,
+        <a href="/home/files/file-BvP0bk00Yf8Gz9XV5Z6PxP2G">G2</a>,
+        <a href="/home/files/file-BvP0vzj0Yf868yVbk5JXQ5gj">H</a></td>
       <td><a href="/comparisons/751">R1</a>,
           <a href="/comparisons/752">R2</a>,
           <a href="/comparisons/755">A1a</a>,
@@ -226,9 +226,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/erik.garrison">egarrison-hhga</a></td>
-      <td><a href="/files/file-BvPK1F80yG4Y7JGZg4gvvX27">G1</a>,
-        <a href="/files/file-BvPK1F80yG4y346p8k9bY6KJ">G2</a>,
-        <a href="/files/file-BvYkXzQ0f0fz7fyFq9KgB667">H</a></td>
+      <td><a href="/home/files/file-BvPK1F80yG4Y7JGZg4gvvX27">G1</a>,
+        <a href="/home/files/file-BvPK1F80yG4y346p8k9bY6KJ">G2</a>,
+        <a href="/home/files/file-BvYkXzQ0f0fz7fyFq9KgB667">H</a></td>
       <td><a href="/comparisons/868">R1</a>,
           <a href="/comparisons/1006">R2</a>,
           <a href="/comparisons/866">A1a</a>,
@@ -238,9 +238,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/xiang.li">xli-custom</a></td>
-      <td><a href="/files/file-BvGQg200Q6jF2zQg5k9vf66P">G1</a>,
-        <a href="/files/file-BvGQg200Q6j941Gv159bj065">G2</a>,
-        <a href="/files/file-BvGQg200Q6j5GjzbkbPGQzg4">H</a></td>
+      <td><a href="/home/files/file-BvGQg200Q6jF2zQg5k9vf66P">G1</a>,
+        <a href="/home/files/file-BvGQg200Q6j941Gv159bj065">G2</a>,
+        <a href="/home/files/file-BvGQg200Q6j5GjzbkbPGQzg4">H</a></td>
       <td><a href="/comparisons/1109">R1</a>,
           <a href="/comparisons/1110">R2</a>,
           <a href="/comparisons/558">A1a</a>,
@@ -250,9 +250,9 @@
 
     <tr>
       <td><a href="/discussions/1-precisionfda-consistency-challenge/answers/rene.lopez">rlopez-custom</a>**</td>
-      <td><a href="/files/file-Bvb8Bk007b4J44Fjx82zx3Zv">G1</a>,
-        <a href="/files/file-Bvb8ZZj07b4J19BZpQ2yKPbB">G2</a>,
-        <a href="/files/file-Bvb9z8007b4GB83FX02vGqfq">H</a></td>
+      <td><a href="/home/files/file-Bvb8Bk007b4J44Fjx82zx3Zv">G1</a>,
+        <a href="/home/files/file-Bvb8ZZj07b4J19BZpQ2yKPbB">G2</a>,
+        <a href="/home/files/file-Bvb9z8007b4GB83FX02vGqfq">H</a></td>
       <td><a href="/comparisons/1033">R1</a>,
           <a href="/comparisons/1045">R2</a>,
           <a href="/comparisons/1030">A1a</a>,
diff --git a/app/views/challenges/edit.html.erb b/app/views/challenges/edit.html.erb
index 03d9e5f05..a74f77e17 100644
--- a/app/views/challenges/edit.html.erb
+++ b/app/views/challenges/edit.html.erb
@@ -1,10 +1,10 @@
 <% content_for :title do %>Edit Challenge<% end %>
 
 <div class="page-header">
-  <div class="page-title">
+  <h1 class="page-title remediation-page-header">
     <span class="fa fa-trophy"></span>
     Edit Challenge
-  </div>
+  </h1>
 </div>
 
 <div class="container-fluid container-padded">
@@ -16,7 +16,7 @@
       <div class="col-sm-offset-3">
         <%= f.submit "Update", class: 'btn btn-primary', data: {disable_with: "Updating..."} %>
         <%- if @challenge.can_announce_result? %>
-          <%= link_to "Announce result", announce_result_challenge_path(@challenge), method: :post, class: "btn btn-warning" %>
+          <%= link_to "Announce result", announce_result_challenge_path(@challenge), method: :post, class: "btn btn-warning challenges-announce-result" %>
         <%- end %>
       </div>
     </div>
diff --git a/app/views/challenges/edit_page.html.erb b/app/views/challenges/edit_page.html.erb
index e93c29a3b..979561b26 100644
--- a/app/views/challenges/edit_page.html.erb
+++ b/app/views/challenges/edit_page.html.erb
@@ -7,14 +7,17 @@
         <div class="btn-group pull-right">
           <a class="btn btn-default btn-md" href="<%= show_challenge_path(@challenge, params[:tab]) %>"><span class="fa fa-reply fa-fw"></span> Return to Challenge Page</a>
         </div>
-        <li role="presentation" class="<%= !["challenge_results", "resources"].include?(params[:tab]) ? 'active':'' %>"><a href="<%= edit_page_challenge_path(@challenge) %>" data-no-turbolink="true" class="tab-label" aria-controls="info" role="tab">Challenge Info</a></li>
-        <li role="presentation" class="<%= ["challenge_results"].include?(params[:tab]) ? 'active':'' %>"><a href="<%= edit_page_challenge_path(@challenge, 'challenge_results') %>" data-no-turbolink="true" class="tab-label" aria-controls="challenge_results" role="tab">Challenge Results</a></li>
-        <li role="presentation" class="<%= ["resources"].include?(params[:tab]) ? 'active':'' %>"><a href="<%= edit_page_challenge_path(@challenge, 'resources') %>" class="tab-label" aria-controls="challenge_results" role="tab">Resources</a></li>
+        <li role="presentation" class="<%= !["challenge_results", "resources", "pre_registration"].include?(params[:tab]) ? 'active':'' %>"><a href="<%= edit_page_challenge_path(@challenge) %>" data-no-turbolink="true" class="tab-label navigation-header-grey" aria-controls="info" role="tab">Challenge Info</a></li>
+        <li role="presentation" class="<%= params[:tab] == "challenge_results" ? 'active':'' %>"><a href="<%= edit_page_challenge_path(@challenge, 'challenge_results') %>" data-no-turbolink="true" class="tab-label navigation-header-grey" aria-controls="challenge_results" role="tab">Challenge Results</a></li>
+        <li role="presentation" class="<%= params[:tab] == "resources" ? 'active':'' %>"><a href="<%= edit_page_challenge_path(@challenge, 'resources') %>" class="tab-label navigation-header-grey" aria-controls="challenge_results" role="tab">Resources</a></li>
+        <li role="presentation" class="<%= params[:tab] == "pre_registration" ? 'active':'' %>"><a href="<%= edit_page_challenge_path(@challenge, 'pre_registration') %>" class="tab-label navigation-header-grey" aria-controls="challenge_results" role="tab">Pre-Registration</a></li>
       </ul>
     </div>
-    <% if ['challenge_results'].include?(params[:tab]) %>
+    <% if params[:tab] == "challenge_results" %>
       <%= render "challenges/edit_results", challenge: @challenge, submissions_grid: @submissions_grid %>
-    <% elsif ['resources'].include?(params[:tab]) %>
+    <% elsif params[:tab] == "pre_registration" %>
+      <%= render "challenges/edit_pre_registration", challenge: @challenge %>
+    <% elsif params[:tab] == "resources" %>
       <div class="pfda-toolbar">
         <div class="btn-group">
           <%= link_to new_challenge_challenge_resource_path(@challenge), class: 'btn btn-primary btn-md' do %>
diff --git a/app/views/challenges/index.html.erb b/app/views/challenges/index.html.erb
index 37bcb0056..f27b376b2 100644
--- a/app/views/challenges/index.html.erb
+++ b/app/views/challenges/index.html.erb
@@ -1,21 +1,3 @@
 <% content_for :title do %>PrecisionFDA Challenges<% end %>
 
-<% @featured_challenges.each do |challenge| %>
-  <%= render "challenges/header", challenge: challenge, challenge_index_page: true %>
-<% end %>
-
-<div class="jumbotron jumbotron-news-landing">
-  <div class="container container-padded container-fluid">
-    <h2>
-      Previous PrecisionFDA Challenges
-      <% if @context.can_create_challenges? %>
-        <%= link_to new_challenge_path, class: "btn-right btn btn-primary btn-lg" do %>
-          <span class="fa fa-plus-square"></span> &nbsp;Create a new challenge
-        <% end %>
-      <% end %>
-    </h2>
-    <h4>Explore the results of previous challenges</h4>
-    <%= render "challenges/cards", challenges: @challenges %>
-    <br/><br/><br/>
-  </div>
-</div>
+<div id="app-root"></div>
diff --git a/app/views/challenges/new.html.erb b/app/views/challenges/new.html.erb
index 5fb1cf1c3..988fae23f 100644
--- a/app/views/challenges/new.html.erb
+++ b/app/views/challenges/new.html.erb
@@ -1,10 +1,10 @@
 <% content_for :title do %>Create New Challenge<% end %>
 
 <div class="page-header">
-  <div class="page-title">
+  <h2 class="page-title">
     <span class="fa fa-trophy"></span>
     Create a new Challenge
-  </div>
+  </h2>
 </div>
 
 <div class="container-fluid container-padded">
@@ -19,7 +19,7 @@
         } %>
       </div>
     </div>
-    <div class="col-sm-offset-3 text-muted pfda-padded-v" data-bind="visible: !imageUrl()">
+    <div class="col-sm-offset-3 text-muted pfda-padded-v challenge-upload-image-text" data-bind="visible: !imageUrl()">
       Please upload an image for the challenge.
     </div>
   <% end %>
diff --git a/app/views/challenges/show.html.erb b/app/views/challenges/show.html.erb
index 672858d1c..dd5d30eec 100644
--- a/app/views/challenges/show.html.erb
+++ b/app/views/challenges/show.html.erb
@@ -1,68 +1,3 @@
 <% content_for :title do %><%= @challenge.name %><% end %>
 
-<%= render "challenges/header", challenge: @challenge, challenge_index_page: false %>
-
-<div class="container container-padded">
-  <div class="row">
-    <div class="col-md-16">
-      <!-- Nav tabs -->
-      <ul class="nav nav-pills nav-pills-lg nav-tabs-contained" role="tablist">
-        <li role="presentation" class="<%= !["submissions", "my_entries", "results"].include?(params[:tab]) ? 'active':'' %>"><a href="<%= show_challenge_path(@challenge) %>" class="tab-label" aria-controls="info" role="tab">Introduction</a></li>
-        <li role="presentation" class="<%= params[:tab] == 'submissions' ? 'active':'' %>"><a href="<%= show_challenge_path(@challenge, 'submissions') %>" class="tab-label" aria-controls="submissions" role="tab">Submissions</a></li>
-        <li role="presentation" class="<%= params[:tab] == 'my_entries' ? 'active':'' %>"><a href="<%= show_challenge_path(@challenge, 'my_entries') %>" class="tab-label" aria-controls="my_entries" role="tab">My Entries</a></li>
-        <% if @challenge.can_show_results?(@context) %>
-          <li role="presentation" class="<%= params[:tab] == 'results' ? 'active':'' %>"><a href="<%= show_challenge_path(@challenge, 'results') %>" class="tab-label" aria-controls="results" role="tab">Results</a></li>
-        <% end %>
-      </ul>
-    </div>
-    <div class="col-md-8">
-      <% if @challenge.active? %>
-        <% unless @context.guest? %>
-          <% if !@context.logged_in? || !@challenge.followed_by?(@context.user) %>
-            <a class="btn btn-success btn-block btn-lg text-uppercase" href="<%= join_challenge_path(@challenge) %>" role="button">
-              <span class="fa fa-lg fa-user-plus" aria-hidden="true"></span>
-              &nbsp;Join Challenge
-            </a>
-          <% elsif @challenge.accepting_submissions? %>
-            <a class="btn btn-primary btn-block btn-lg text-uppercase" href="<%= new_challenge_submission_path(challenge_id: @challenge.id, app_dxid: @challenge.app) %>" role="button">
-              <span class="fa fa-lg fa-inbox" aria-hidden="true"></span>
-              &nbsp;Submit Challenge Entry
-            </a>
-          <% end %>
-        <% end %>
-      <% else %>
-        <% if @challenge.over? %>
-          <button type="button" class="btn btn-danger btn-block btn-lg text-uppercase" disabled>
-            <span class="fa fa-lg fa-trophy" aria-hidden="true"></span>
-            &nbsp;Challenge Closed
-          </button>
-        <% elsif @challenge.coming_soon? %>
-          <button type="button" class="btn btn-primary btn-block btn-lg text-uppercase" disabled>
-            <span class="fa fa-lg fa-trophy" aria-hidden="true"></span>
-            &nbsp;Challenge Launching Soon
-          </button>
-        <% end %>
-      <% end %>
-    </div>
-  </div>
-  <br/>
-
-  <div class="row">
-    <!-- TODO: case on challenge_id to ensure backwards compatibility once challenge kit is in place -->
-    <% if ['my_entries','submissions'].include?(params[:tab]) %>
-      <%= render "challenges/submissions", challenge: @challenge, submissions_grid: @submissions_grid, my_entries: @my_entries %>
-    <% elsif ['results'].include?(params[:tab]) %>
-      <% if @challenge.automated? %>
-        <%= render "challenges/automated_results", challenge: @challenge, submissions: @submissions %>
-      <% else %>
-        <%= render "challenges/results", challenge: @challenge, submissions: @submissions, vaf_results: @vaf_results, vaf_spotter_ids: @vaf_spotter_ids, csv_names: @csv_names, csv_ids: @csv_ids, csv: @csv, headers: @headers, keys: @keys %>
-      <% end %>
-    <% else %>
-      <% if @challenge.name == 'Hidden Treasures - Warm Up'%>
-        <%= render 'challenges/treasure' %>
-      <% else %>
-        <%= raw(@challenge.regions["intro"]) %>
-      <% end %>
-    <% end %>
-  </div>
-</div>
+<div id="app-root"></div>
diff --git a/app/views/challenges/treasure_old.html.erb b/app/views/challenges/treasure_old.html.erb
new file mode 100644
index 000000000..eac45d5bd
--- /dev/null
+++ b/app/views/challenges/treasure_old.html.erb
@@ -0,0 +1,56 @@
+<% content_for :title do %><%= @challenge.name %><% end %>
+
+<div class="container container-padded">
+  <div class="row">
+    <div class="col-md-16">
+      <!-- Nav tabs -->
+      <ul class="nav nav-pills nav-pills-lg nav-tabs-contained" role="tablist">
+        <li role="presentation" class="<%= !["submissions", "my_entries", "results"].include?(params[:tab]) ? 'active':'' %>"><a href="<%= show_challenge_path(@challenge) %>" class="tab-label" aria-controls="info" role="tab" data-turbolinks="false">Introduction</a></li>
+        <li role="presentation" class="<%= params[:tab] == 'submissions' ? 'active':'' %>"><a href="<%= show_challenge_path(@challenge, 'submissions') %>" class="tab-label" aria-controls="submissions" role="tab">Submissions</a></li>
+        <li role="presentation" class="<%= params[:tab] == 'my_entries' ? 'active':'' %>"><a href="<%= show_challenge_path(@challenge, 'my_entries') %>" class="tab-label" aria-controls="my_entries" role="tab">My Entries</a></li>
+        <% if @challenge.can_show_results?(@context) %>
+          <li role="presentation" class="<%= params[:tab] == 'results' ? 'active':'' %>"><a href="<%= show_challenge_path(@challenge, "results")  %>" class="tab-label" aria-controls="results" role="tab">Results</a></li>
+        <% end %>
+      </ul>
+    </div>
+    <div class="col-md-8">
+      <% if @challenge.active? %>
+        <% unless @context.guest? %>
+          <% if !@context.logged_in? || !@challenge.followed_by?(@context.user) %>
+            <a class="btn btn-success btn-block btn-lg text-uppercase" href="<%= join_challenge_path(@challenge) %>" role="button">
+              <span class="fa fa-lg fa-user-plus" aria-hidden="true"></span>
+              &nbsp;Join Challenge
+            </a>
+          <% elsif @challenge.accepting_submissions? %>
+            <a class="btn btn-primary btn-block btn-lg text-uppercase" href="<%= new_challenge_submission_path(challenge_id: @challenge.id, app_dxid: @challenge.app) %>" role="button">
+              <span class="fa fa-lg fa-inbox" aria-hidden="true"></span>
+              &nbsp;Submit Challenge Entry
+            </a>
+          <% end %>
+        <% end %>
+      <% else %>
+        <% if @challenge.over? %>
+          <button type="button" class="btn btn-danger btn-block btn-lg text-uppercase" disabled>
+            <span class="fa fa-lg fa-trophy" aria-hidden="true"></span>
+            &nbsp;Challenge Closed
+          </button>
+        <% elsif @challenge.coming_soon? %>
+          <button type="button" class="btn btn-primary btn-block btn-lg text-uppercase" disabled>
+            <span class="fa fa-lg fa-trophy" aria-hidden="true"></span>
+            &nbsp;Challenge Launching Soon
+          </button>
+        <% end %>
+      <% end %>
+    </div>
+  </div>
+  <br/>
+
+  <div class="row">
+    <% if ['results'].include?(params[:tab]) %>
+        <%= render "challenges/results", challenge: @challenge, submissions: @submissions, vaf_results: @vaf_results, vaf_spotter_ids: @vaf_spotter_ids, csv_names: @csv_names, csv_ids: @csv_ids, csv: @csv, headers: @headers, keys: @keys %>
+    <% else %>
+        <%= render 'challenges/treasure' %>
+
+    <% end %>
+  </div>
+</div>
diff --git a/app/views/challenges/truth.html.erb b/app/views/challenges/truth.html.erb
index 959828fe2..fe4047214 100644
--- a/app/views/challenges/truth.html.erb
+++ b/app/views/challenges/truth.html.erb
@@ -76,9 +76,9 @@
   <% else %>
     <%= render "challenges/truth/preview_results_explore" %>
   <% end %>
-<% elsif params[:tab] == 'results-peek' && (@context.can_administer_site? || (ENV["DNANEXUS_BACKEND"] != "production")) %>
+<% elsif params[:tab] == 'results-peek' && (@context.can_administer_site? || !Rails.env.production?) %>
   <%= render "challenges/truth/results" %>
-<% elsif params[:tab] == 'results-explore-peek' && (@context.can_administer_site? || (ENV["DNANEXUS_BACKEND"] != "production")) %>
+<% elsif params[:tab] == 'results-explore-peek' && (@context.can_administer_site? || !Rails.env.production?) %>
     <%= render "challenges/truth/results_explore" %>
 <% else %>
   <%= render "challenges/truth/info" %>
diff --git a/app/views/challenges/truth/_info.html.erb b/app/views/challenges/truth/_info.html.erb
index 9eb28089f..9eed0d923 100644
--- a/app/views/challenges/truth/_info.html.erb
+++ b/app/views/challenges/truth/_info.html.erb
@@ -132,14 +132,14 @@
               <tr>
                 <td>Files</td>
                 <td>
-                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/files/file-BvP0Ygj01vpFPQ10Z93QX2q6"><span class="fa fa-file-o" aria-hidden="true"></span> HG001-NA12878-50x_1.fastq.gz</a>
+                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/home/files/file-BvP0Ygj01vpFPQ10Z93QX2q6"><span class="fa fa-file-o" aria-hidden="true"></span> HG001-NA12878-50x_1.fastq.gz</a>
                   <br>
-                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/files/file-BvP0bqQ0Y286kqgkzbkPXkp5"><span class="fa fa-file-o" aria-hidden="true"></span> HG001-NA12878-50x_2.fastq.gz</a>
+                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/home/files/file-BvP0bqQ0Y286kqgkzbkPXkp5"><span class="fa fa-file-o" aria-hidden="true"></span> HG001-NA12878-50x_2.fastq.gz</a>
                 </td>
                 <td>
-                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/files/file-BvP0b3Q0Z8pJfQxYxbk8P2p0"><span class="fa fa-file-o" aria-hidden="true"></span> HG002-NA24385-50x_1.fastq.gz</a>
+                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/home/files/file-BvP0b3Q0Z8pJfQxYxbk8P2p0"><span class="fa fa-file-o" aria-hidden="true"></span> HG002-NA24385-50x_1.fastq.gz</a>
                   <br>
-                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/files/file-BvP0f600xKVyPQZj08ZjXPx4"><span class="fa fa-file-o" aria-hidden="true"></span> HG002-NA24385-50x_2.fastq.gz</a>
+                  <a class="btn btn-link" target="_blank" href="https://precision.fda.gov/home/files/file-BvP0f600xKVyPQZj08ZjXPx4"><span class="fa fa-file-o" aria-hidden="true"></span> HG002-NA24385-50x_2.fastq.gz</a>
                 </td>
               </tr>
               <tr>
@@ -307,8 +307,8 @@
                 <td>You</td>
                 <td>Your HG001 VCF</td>
                 <td>-</td>
-                <td><a href="https://precision.fda.gov/files/file-Bk50V4Q0qVb65P0v2VPbfYPZ">NIST v2.19 VCF</a></td>
-                <td><a href="https://precision.fda.gov/files/file-Bk50V4Q0qVb4p8J8kkXpYZ4P">NIST v2.19 BED</a></td>
+                <td><a href="https://precision.fda.gov/home/files/file-Bk50V4Q0qVb65P0v2VPbfYPZ">NIST v2.19 VCF</a></td>
+                <td><a href="https://precision.fda.gov/home/files/file-Bk50V4Q0qVb4p8J8kkXpYZ4P">NIST v2.19 BED</a></td>
               </tr>
               <tr>
                 <td>HG002</td>
diff --git a/app/views/challenges/truth/_table_datasets.html.erb b/app/views/challenges/truth/_table_datasets.html.erb
index 057efcc2e..dee9c3b34 100644
--- a/app/views/challenges/truth/_table_datasets.html.erb
+++ b/app/views/challenges/truth/_table_datasets.html.erb
@@ -11,10 +11,10 @@
       <tr>
         <td><a href="/discussions/6-precisionfda-truth-challenge/answers/<%= result[:'Answer id'] %>"><%= result[:'Label'] %></a></td>
         <td>
-          <%= link_to truncate(result[:'HG001 VCF filename'], length: 50), file_path(result[:'HG001 VCF file id']), title: result[:'HG001 VCF filename'] %>
+          <%= link_to truncate(result[:'HG001 VCF filename'], length: 50), "/home/files/#{result[:'HG001 VCF file id']}", title: result[:'HG001 VCF filename'] %>
         </td>
         <td>
-          <%= link_to truncate(result[:'HG002 VCF filename'], length: 50), file_path(result[:'HG002 VCF file id']), title: result[:'HG002 VCF filename'] %>
+          <%= link_to truncate(result[:'HG002 VCF filename'], length: 50), "/home/files/#{result[:'HG002 VCF file id']}", title: result[:'HG002 VCF filename'] %>
         </td>
       </tr>
     <% end %>
diff --git a/app/views/comments/_comments_wrapper.html.erb b/app/views/comments/_comments_wrapper.html.erb
index 585d1dc1d..082766e33 100644
--- a/app/views/comments/_comments_wrapper.html.erb
+++ b/app/views/comments/_comments_wrapper.html.erb
@@ -1,7 +1,5 @@
 <div class="container-fluid container-padded">
-    <% if !in_verified_space?(object)  %>
-      <%= render "comments/new_comment", url: url, object: object %>
-      <hr>
-    <% end %>
+    <%= render "comments/new_comment", url: url, object: object %>
+    <hr>
     <%= render "comments/comments", comments: comments, items_from_params: items_from_params %>
 </div>
diff --git a/app/views/comments/_nested_comments.html.erb b/app/views/comments/_nested_comments.html.erb
index 6b45d5a4e..ec3ce2f05 100644
--- a/app/views/comments/_nested_comments.html.erb
+++ b/app/views/comments/_nested_comments.html.erb
@@ -36,9 +36,7 @@
             <% end %>
             <div class="pfda-comment-body"><%= simple_format(comment.body) %></div>
             <ul class="pfda-comment-actions list-inline list-inline-bullets text-muted">
-              <% unless !comment.editable_by?(@context) && comment.commentable_type == "Task" %>
-                <li><a href="#" class="nested-comment--show-new-comment" data-parent-id="<%= comment.id %>">Reply</a></li>
-              <% end %>
+              <li><a href="#" class="nested-comment--show-new-comment" data-parent-id="<%= comment.id %>">Reply</a></li>
               <% if comment.editable_by?(@context) %>
                 <li><%= link_to "Edit", edit_polymorphic_path(items_from_params + [comment]) %></li>
                 <li><%= link_to "Delete", polymorphic_path(items_from_params + [comment]), method: :delete, data: { confirm: 'Are you certain you want to delete this?' } %></li>
diff --git a/app/views/comments/_new_comment.html.erb b/app/views/comments/_new_comment.html.erb
index 5aa401899..e73394d0b 100644
--- a/app/views/comments/_new_comment.html.erb
+++ b/app/views/comments/_new_comment.html.erb
@@ -2,7 +2,7 @@
 <div class="pfda-comment">
   <div class="media">
     <div class="media-left">
-      <%= link_to image_tag(@context.user.gravatar_url, class: 'img-circle', height: '25px'), user_path(@context.user.dxuser) %>
+      <%= link_to image_tag(@context.user.gravatar_url, alt:"Profile picture icon for #{@context.user.dxuser}", class: 'img-circle', height: '25px'), user_path(@context.user.dxuser) %>
     </div>
     <div class="media-body">
       <div class="pfda-comment-body">
diff --git a/app/views/comments/edit.html.erb b/app/views/comments/edit.html.erb
index 1043a2c32..fdf54110c 100644
--- a/app/views/comments/edit.html.erb
+++ b/app/views/comments/edit.html.erb
@@ -8,19 +8,5 @@
 </div>
 
 <div class="container-fluid container-padded">
-  <% if @item.klass == 'space' %>
-    <div class="pfda-comments-container">
-      <div class="pfda-comment">
-        <div class="pfda-comment--with-mentions">
-              <%= render "comments/nested_form",
-                comment: @comment,
-                url: polymorphic_path(@items_from_params + [@comment]),
-                hide_assoc_with: true
-              %>
-        </div>
-      </div>
-    </div>
-  <% else %>
-    <%= render "comments/form", comment: @comment, url: polymorphic_path(@items_from_params + [@comment]) %>
-  <% end %>
+  <%= render "comments/form", comment: @comment, url: polymorphic_path(@items_from_params + [@comment]) %>
 </div>
diff --git a/app/views/comparisons/_grid.html.erb b/app/views/comparisons/_grid.html.erb
index b124285ea..c27ddf3f6 100644
--- a/app/views/comparisons/_grid.html.erb
+++ b/app/views/comparisons/_grid.html.erb
@@ -44,7 +44,7 @@
       content_tag(:div) do
         [comparison.inputs.map do |file|
           content_tag(:div) do
-            unilinkfw(file.user_file) unless benchmark?(file.role)
+            unilinkfw(file.user_file, target: "_blank") unless benchmark?(file.role)
           end
         end,
 
@@ -61,7 +61,7 @@
       content_tag(:div) do
         [comparison.inputs.map do |file|
           content_tag(:div) do
-            unilinkfw(file.user_file) if benchmark?(file.role)
+            unilinkfw(file.user_file, target: "_blank") if benchmark?(file.role)
           end
         end,
 
diff --git a/app/views/comparisons/show.html.erb b/app/views/comparisons/show.html.erb
index 7970cea24..f5b99e5fd 100644
--- a/app/views/comparisons/show.html.erb
+++ b/app/views/comparisons/show.html.erb
@@ -51,7 +51,7 @@
       <li class="list-group-item">
         <h5 class="list-group-item-heading">Comparator App</h5>
         <p class="list-group-item-text">
-          <%= link_to(App.find_by(dxid: @comparison.app_dxid).name, "/home".concat(app_path(@comparison.app_dxid)))  %>
+          <%= link_to(@comparator_app.name, home_path_to_item(@comparator_app), target: "_blank", rel: "noopener noreferrer") %>
         </p>
       </li>
     <% else %>
@@ -303,10 +303,10 @@
   <div class="tab-pane" id="tab-outputs">
     <div class="comparison-outputs panel">
       <%= grid(@outputs_grid) do |g|
-        g.blank_slate partial:  "_partials/empty_grid"
+        g.blank_slate partial: "_partials/empty_grid"
 
         g.column name: 'Name' do |file|
-          unilinkfw(file)
+          unilinkfw(file, target: "_blank")
         end
 
         g.column name: 'Size' do |file|
diff --git a/app/views/docs/_apps.html.erb b/app/views/docs/_apps.html.erb
index ae421172e..7edd24e27 100644
--- a/app/views/docs/_apps.html.erb
+++ b/app/views/docs/_apps.html.erb
@@ -175,7 +175,7 @@ where inputs.json is a standard WDL input file definition (see https://software.
             </tr>
           </tbody>
         </table>
-        <p>The top section of the job details page displays additional information, including the job's instance type, duration and <strong>energy consumed</strong>. The energy consumed is calculated from a formula that takes into account the instance type as well as the duration. Jobs that run longer or that use more powerful instance types will consume more energy. Therefore, this metric can be used to compare pipelines in terms of their algorithmic efficiency.</p>
+        <p>The top section of the job details page displays additional information, including the job's instance type, duration and <strong>cost in dollars</strong>. The cost is calculated from a formula that takes into account the instance type as well as the duration. Jobs that run longer or that use more powerful instance types will consume more energy. Therefore, this metric can be used to compare pipelines in terms of their algorithmic efficiency.</p>
         <div class="alert alert-info">
           <span class="fa fa-lightbulb-o" aria-hidden="true"></span> <strong>TIP:</strong> Try to be green! Always optimize your workload by selecting the appropriate instance type when creating apps or launching jobs. Although the FDA is sponsoring your cloud usage, it may impose penalties if you end up wasting too much energy.
         </div>
diff --git a/app/views/docs/_cli.html.erb b/app/views/docs/_cli.html.erb
new file mode 100644
index 000000000..4f478803f
--- /dev/null
+++ b/app/views/docs/_cli.html.erb
@@ -0,0 +1,78 @@
+<div id="about-docs" class="bs-docs-container docs-content">
+  <div class="row">
+    <div class="col-sm-18">
+      <div id="files" class="h1">Command Line Interface (CLI)</div>
+      <div class="bs-docs-section">
+        <p>The precisionFDA CLI allows you to conveniently upload or download large files or assets to your home area or to a Space where you have access. You can also integrate this into your scripts to automate your workflow and do batch uploads and downloads.</p>
+      </div>
+      <div id="download" class="h2">Download the CLI</div>
+      <div class="bs-docs-section">
+        <p>
+          <a class="btn btn-primary btn-lg" href="https://pfda-production-static-files.s3.amazonaws.com/cli/pfda-linux-2.1.2.tar.gz" target="_blank">
+            <span class="fa fa-download"></span> Linux
+          </a>
+          <a class="btn btn-primary btn-lg" href="https://pfda-production-static-files.s3.amazonaws.com/cli/pfda-darwin-2.1.2.tar.gz" target="_blank">
+            <span class="fa fa-download"></span> Mac OS X
+          </a>
+          <a class="btn btn-primary btn-lg" href="https://pfda-production-static-files.s3.amazonaws.com/cli/pfda-windows-2.1.2.zip" target="_blank">
+            <span class="fa fa-download"></span> Windows
+          </a>
+        </p>
+      </div>
+      <div id="authorization-key" class="h2">Authorization Key</div>
+      <div class="bs-docs-section">
+        <p>
+        Visit the <a href="<%= new_asset_path %>">Create Assets</a> page and click on Generate Authorization Key button to generate a key that you will need when using the CLI.
+        </p>
+      </div>
+      <div id="uploading-files" class="h2">Uploading Files</div>
+      <div class="bs-docs-section">
+        <p>
+        The CLI can be used to upload files to your My Home area or to a Space where you have access. Currently you can only upload single files and not a folder, but you can embed the command in a script to do batch uploads.
+        </p>
+        <p>To upload a file to your precisionFDA My Home<br/><code>./pfda upload-file --key KEY --file /path/to/file</code></p>
+        <p>To upload a file to a folder in your My Home area<br/><code>./pfda upload-file --key KEY --file /path/to/file --folder-id FOLDER_ID</code></p>
+        <div class="alert alert-info">
+          <span class="fa fa-lightbulb-o" aria-hidden="true"></span> <strong>TIP:</strong> To find FOLDER_ID, inspect the URL when browsing the contents of the target folder
+        </div>
+        <p>To upload a file to a Space<br/><code>./pfda upload-file --key KEY --file /path/to/file --space-id SPACE_ID</code></p>
+        <p>To upload a file to a folder in a Space<br/><code>./pfda upload-file --key KEY --file /path/to/file --folder-id FOLDER_ID --space-id SPACE_ID</code></p>
+        <div class="alert alert-info">
+          <span class="fa fa-lightbulb-o" aria-hidden="true"></span> <strong>TIP:</strong> To find SPACE_ID, inspect the URL when browsing a Space.<br>For example, in the URL "https://precision.fda.gov/spaces/225/files", the Space ID is 225.
+        </div>
+      </div>
+      <div id="uploading-assets" class="h2">Uploading Assets</div>
+      <div class="bs-docs-section">
+        <p>
+        To upload an asset to precisionFDA, prepare a folder path of the asset contents and a readme file, and run the following command with the desired asset name (must end in .tar or .tar.gz)
+        </p>
+        <p><code>./pfda upload-asset --key KEY --name NAME{.tar or .tar.gz} --root /PATH/TO/ROOT/FOLDER --readme README{.txt or .md}></code></p>
+      </div>
+      <div id="downloading-files" class="h2">Downloading Files</div>
+      <div class="bs-docs-section">
+        <p>
+        To download files from My Home or a Space, you simply need the unique id for the file which is of the form <code>file-ABCDEF1234567890-1</code>
+        </p>
+        <p>Download a file to the current directory using its original name<br/><code>./pfda download --key KEY --file-id FILE_ID</code></p>
+        <p>Download a file to the specified file path, ignoring its original name<br/><code>./pfda download --key KEY --file-id FILE_ID --output /OUTPUT_PATH/DESIRED_FILENAME</code></p>
+        <p>Download a file to the specified output directory using its original name<br/><code>./pfda download --key KEY --file-id FILE_ID --output /OUTPUT/PATH/</code></p>
+        <div class="alert alert-info">
+          <span class="fa fa-lightbulb-o" aria-hidden="true"></span> <strong>NOTE:</strong> The trailing slash indicates a directory
+        </div>
+      </div>
+    </div>
+
+    <!-- SIDEBAR NAVIGATION -->
+    <div class="col-sm-6">
+      <nav class="bs-docs-sidebar hidden-print hidden-xs hidden-sm">
+        <ul class="nav bs-docs-sidenav right-sidebar-nav">
+          <li><a href="#download">Download the CLI</a></li>
+          <li><a href="#authorization-key">Authorization Key</a></li>
+          <li><a href="#uploading-files">Uploading Files</a></li>
+          <li><a href="#uploading-assets">Uploading Assets</a></li>
+          <li><a href="#downloading-files">Downloading Files</a></li>
+        </ul>
+      </nav>
+    </div>
+  </div>
+</div>
diff --git a/app/views/docs/_creating_apps.html.erb b/app/views/docs/_creating_apps.html.erb
index 5ec0b739d..0e7ccb96c 100644
--- a/app/views/docs/_creating_apps.html.erb
+++ b/app/views/docs/_creating_apps.html.erb
@@ -213,31 +213,31 @@
             <tr>
               <td>Baseline 2</td>
               <td>2</td>
-              <td>3.8 GB</td>
+              <td>4 GB</td>
               <td>32 GB</td>
             </tr>
             <tr>
               <td>Baseline 4</td>
               <td>4</td>
-              <td>7.5 GB</td>
+              <td>8 GB</td>
               <td>80 GB</td>
             </tr>
             <tr>
               <td>Baseline 8</td>
               <td>8</td>
-              <td>15 GB</td>
+              <td>16 GB</td>
               <td>160 GB</td>
             </tr>
             <tr>
               <td>Baseline 16</td>
               <td>16</td>
-              <td>30 GB</td>
+              <td>32 GB</td>
               <td>320 GB</td>
             </tr>
             <tr>
               <td>Baseline 36</td>
               <td>36</td>
-              <td>60 GB</td>
+              <td>72 GB</td>
               <td>640 GB</td>
             </tr>
             <tr>
@@ -246,31 +246,31 @@
             <tr>
               <td>High Mem 2</td>
               <td>2</td>
-              <td>15 GB</td>
+              <td>16 GB</td>
               <td>32 GB</td>
             </tr>
             <tr>
               <td>High Mem 4</td>
               <td>4</td>
-              <td>30.5 GB</td>
+              <td>32 GB</td>
               <td>80 GB</td>
             </tr>
             <tr>
               <td>High Mem 8</td>
               <td>8</td>
-              <td>61 GB</td>
+              <td>64 GB</td>
               <td>160 GB</td>
             </tr>
             <tr>
               <td>High Mem 16</td>
               <td>16</td>
-              <td>122 GB</td>
+              <td>128 GB</td>
               <td>320 GB</td>
             </tr>
             <tr>
               <td>High Mem 32</td>
               <td>32</td>
-              <td>244 GB</td>
+              <td>256 GB</td>
               <td>640 GB</td>
             </tr>
             <tr>
@@ -306,6 +306,15 @@
               <td>60 GB</td>
               <td>2880 GB</td>
             </tr>
+            <tr>
+              <td colspan=4></td>
+            </tr>
+            <tr>
+              <td>GPU 8</td>
+              <td>8</td>
+              <td>60 GB</td>
+              <td>160 GB</td>
+            </tr>
           </tbody>
         </table>
       </div>
@@ -409,7 +418,7 @@ https://github.com/samtools/htslib/releases/tag/1.2.1</pre>
         <p>The tool requires an "authorization key" in order to authenticate the client against the precisionFDA system. You can get a key by clicking the respective link in the "Add Assets" page. Copy the key from that page and paste it in the command below where it says <strong>KEY</strong>. For your security, the key is valid for 24h.</p>
         <p>Run <code>./pfda --cmd upload-asset --key KEY --name my-asset.tar.gz --root /path/to/fake_root --readme my-asset.txt</code>. This command will archive the contents of the fake root into the named tarball, and upload it to precisionFDA along with the contents of the readme file. The tarball name must end in either <code>.tar.gz</code> or <code>.tar</code> (in which latter case it will not be compressed).</p>
         <div class="alert alert-info">
-          <span class="fa fa-lightbulb-o" aria-hidden="true"></span> <strong>TIP:</strong> The uploader saves your key in <code>$HOME/.config/precision-fda/config.json</code>, so after you have run it once, you don't need to specify the key in subsequent invocations.
+          <span class="fa fa-lightbulb-o" aria-hidden="true"></span> <strong>TIP:</strong> The uploader saves your key in <code>$HOME/.pfda_config</code>, so after you have run it once, you don't need to specify the key in subsequent invocations.
         </div>
 
       </div>
diff --git a/app/views/docs/_files.html.erb b/app/views/docs/_files.html.erb
index 759c0986d..e97dede10 100644
--- a/app/views/docs/_files.html.erb
+++ b/app/views/docs/_files.html.erb
@@ -29,15 +29,16 @@
 
         <p>For large files that are accessible over the Internet, we suggest running the "Fetch file from URL" app, which has been provided by the precisionFDA team. The app allows you to fetch a file from a given URL.</p>
 
-        <p>For large files that are on your computer, we suggest using the <strong>precisionFDA uploader</strong>, a command-line tool capable of uploading with multiple threads and more resilient to transient errors.
-        The precisionFDA uploader can be used for both files and app assets, and it's available through the <a href="<%= new_asset_path %>">Create Assets</a> page.</p>
+        <p>For large files that are on your computer, we suggest using the <strong>precisionFDA CLI</strong>, a command-line tool capable of uploading with multiple threads and more resilient to transient errors.
+        The precisionFDA CLI can be used for both files and app assets, and it's available through the <a href="<%= new_asset_path %>">Create Assets</a> page.</p>
 
-        <p>Visit that page and download the precisionFDA uploader for your operating system and architecture by clicking the respective button under "Step 3".</p>
+        <p>Visit that page and download the precisionFDA CLI for your operating system and architecture by clicking the respective button under "Step 3".</p>
         <p>The tool requires an "authorization key" in order to authenticate the client against the precisionFDA system. You can get a key by clicking the respective button under "Step 4" in the "Add Assets" page. Copy the key from that page and paste it in the command below where it says <strong>KEY</strong>. For your security, the key is valid for 24h.</p>
-        <p>Run <code>./pfda --cmd upload-file --key KEY --file /path/to/file</code>. This command will upload the file to precisionFDA.</p>
+        <p>Run <code>./pfda upload-file --key KEY --file /path/to/file</code>. This command will upload the file to precisionFDA.</p>
         <div class="alert alert-info">
-          <span class="fa fa-lightbulb-o" aria-hidden="true"></span> <strong>TIP:</strong> The uploader saves your key in <code>$HOME/.config/precision-fda/config.json</code>, so after you have run it once, you don't need to specify the key in subsequent invocations.
+          <span class="fa fa-lightbulb-o" aria-hidden="true"></span> <strong>TIP:</strong> The CLI saves your key in <code>$HOME/.pfda_config</code>, so after you have run it once, you don't need to specify the key in subsequent invocations.
         </div>
+        <p>The CLI can do a lot more than uploading assets, please see the <a href="/docs/cli">Command Line Interface documentation page</a></p>
       </div>
       <div class="bs-docs-section bs-docs-media-section">
         <%= video_iframe(videos[:files_upload][:url], videos[:files_upload][:title]) %>
diff --git a/app/views/docs/_intro.html.erb b/app/views/docs/_intro.html.erb
index 82affd7a8..f23e5630c 100644
--- a/app/views/docs/_intro.html.erb
+++ b/app/views/docs/_intro.html.erb
@@ -7,6 +7,8 @@
 
         <p>We are excited to have you on board, and have prepared this guide to help you make the most out of the precisionFDA platform. We hope that this guide will answer many of your questions and provide you with additional insights to further empower you to use the system. If your favorite topic is not covered, please don't hesitate to <a href="mailto:precisionfda@fda.hhs.gov">contact us</a>, and we'll make sure to expand the guide accordingly.</p>
 
+        <p>The first step to unlocking the features of precisionFDA is creating an account. You can sign up for a precisionFDA account by clicking "Request Access" on the front page, or by <%= link_to "clicking here", request_access_path, "aria-label" => "Request access to precisionFDA" %>. During the sign-up process, you will need a phone or other multi-factor authentication (MFA) device; you can find <a href="/docs/PrecisionFDA_Okta_Verify_MFA_instructions.pdf" target="_blank" aria-label='Instructions on setting up your device'>instructions on setting up your device by clicking here</a>.</p>
+
         <p>Select a topic on the left to read more about it. We've also recorded short videos to demonstrate some aspects of the system, so make sure to check those as well.</p>
 
         <div class="alert alert-info">
diff --git a/app/views/docs/_publishing.html.erb b/app/views/docs/_publishing.html.erb
index 6ae6dedfa..d7e2d7bb9 100644
--- a/app/views/docs/_publishing.html.erb
+++ b/app/views/docs/_publishing.html.erb
@@ -25,7 +25,7 @@
             </tr>
             <tr>
               <td>File</td>
-              <td>The file will appear in everyone's list of available files. Users will be able to download the file or use it as input in their jobs.</td>
+              <td>The file will appear in everyone's list of available files. Users will be able to download the file or use it as input in their jobs.</td> <strong>NOTE:</strong> only files in root folder can be published.</td>
             </tr>
             <tr>
               <td>Job</td>
diff --git a/app/views/docs/_spaces.html.erb b/app/views/docs/_spaces.html.erb
index b0d752171..19db848fa 100644
--- a/app/views/docs/_spaces.html.erb
+++ b/app/views/docs/_spaces.html.erb
@@ -13,7 +13,7 @@
       <div class="bs-docs-section">
         <p>
           A <strong>review space</strong> provides two private areas - one for the reviewer, and one for the sponsor organization.
-          Both groups also have access to a shared, cooperative space, where they may both interact with common files, run apps, examine jobs, and create tasks to be assigned to specific members or groups.
+          Both groups also have access to a shared, cooperative space, where they may both interact with common files, run apps and examine jobs.
         </p>
       </div>
       <div id="review-space-create" class="h2">Creating the Review Space</div>
@@ -55,7 +55,7 @@
       <div class="bs-docs-section">
         <p>
           Once the review space has been accepted by both groups, it will activate, and both the review lead and the sponsor org administrator may log into their <strong>confidential spaces</strong>.
-          From here, they may add files, apps, jobs, and notes, they may add other members to the space, and they can create tasks to assign to either themselves or other members of their confidential spaces.
+          From here, they may add files, apps, jobs and notes, and they may add other members to the space.
         </p>
       </div>
       <div class="bs-docs-section bs-docs-media-section bs-docs-media-img">
@@ -67,12 +67,6 @@
           To invite other users to a space, you can click on the <strong>Members</strong> tab, located in the middle of the page, and add them by username.
           When adding new members, you may also set their permissions level for the space.
         </p>
-        <p>
-          Tasks are a method of assigning jobs to yourself or other members of the space.
-          When you click on one of the Tasks options, you’ll see a button labeled <strong>New Task</strong>, that allows you to create a new task.
-          When you assign a task to someone else, they will receive an email alerting them.
-          They can choose to either accept or decline the task.
-          They can then mark the task complete when they choose to do so.
       </div>
       <div id="review-space-cooperative" class="h2">Using the Cooperative Review Space</div>
       <div class="bs-docs-section">
@@ -86,7 +80,7 @@
       <div class="bs-docs-section">
         <p>
           <strong>The cooperative space</strong> appears very similar to the private space, and includes all of the same features.
-          You can create tasks, add files, notes, assets, apps, and jobs, and run apps in this space.
+          You can add files, notes, assets, apps and jobs, and run apps in this space.
           Here, however, you’ll note that the members of both spaces have access - any data objects you add to this space can be accessed by both parties, so make sure you only add objects that you wish to share!
         </p>
         <p>
diff --git a/app/views/docs/_workstations.html.erb b/app/views/docs/_workstations.html.erb
new file mode 100644
index 000000000..e1dd79e78
--- /dev/null
+++ b/app/views/docs/_workstations.html.erb
@@ -0,0 +1,122 @@
+<div id="about-docs" class="bs-docs-container docs-content">
+  <div class="row">
+    <div class="col-sm-18">
+      <div id="workstation" class="h1">Workstation Apps</div>
+      <div class="bs-docs-section">
+        <p>Workstations are a class of apps on precisionFDA that are "interactive". Most apps on precisionFDA are
+          non-interactive: you provide inputs, the app follows a set script, and creates outputs if it finishes
+          successfully. Workstations are interactive; they create an environment where the user may enter any command
+          they choose.</p>
+      </div>
+      <div id="workstation-types" class="h2">Workstation Types</div>
+      <div class="bs-docs-section">
+        <p>There are currently two types of Workstations on precisionFDA:</p>
+        <p>1) <strong>TTYD</strong> - this Workstation provides an Ubuntu command-line terminal interface.</p>
+        <p>2) <strong>JupyterLab</strong> - this Workstation provides a JupyterLab server graphical interface. The
+          Jupyter interface supports running Python or R notebooks, as well as a built-in terminal.</p>
+      </div>
+      <div id="workstation-access" class="h2">Access to Workstations</div>
+      <div class="bs-docs-section">
+        <p>In order to run a Workstation, your account needs additional authorization. You can request Workstations
+          authorization by sending an email to precisionFDA Support (precisionfda-support@dnanexus.com).</p>
+        <p>If you do not have authorization, you will receive an error message when you click "Run" on a Workstation
+          app.</p>
+      </div>
+      <div id="workstation-launching" class="h2">Launching a Workstation</div>
+      <div class="bs-docs-section">
+        <p>Workstations may be found in the public Apps repository, similar to other apps.</p>
+        <p>Here are links to current Workstations:</p>
+        <p><a href="https://precision.fda.gov/home/apps/app-G1gY2BQ0KJ893JfK3jBYP2v5-1">TTYD Workstation, for command
+          line access</a></p>
+        <p><a href="https://precision.fda.gov/home/apps/app-G1gY5900XgB9pFq87g5bgz92-1">JupyterLab Workstation, for
+          creating and running Jupyter notebooks</a></p>
+        <p>When you launch a Workstation, it will take 2-5 minutes for the worker to initialize. Once the Execution page
+          states that the execution is "Running", you may access the Workstation. A link will appear in the middle of
+          the page, labeled "Open."
+        <p>
+      </div>
+      <div class="bs-docs-section bs-docs-media-section bs-docs-media-img">
+        <%= image_tag("running_workstation.png", alt: "Running Workstation page") %>
+      </div>
+      <p>Clicking on this "Open" link will open the Workstation in a new tab, bringing up a terminal interface
+        (<strong>TTYD</strong> Workstation) or the Jupyter interface (<strong>JupyterLab</strong> Workstation).</p>
+      <div id="workstation-accessing" class="h2">Accessing files and data on Workstations</div>
+      <div class="bs-docs-section">
+        <p>When you run a Workstation, you have full admin access on the worker, as well as unrestricted internet
+          access.</p>
+        <p>You may install packages with "sudo pip" or "sudo apt-get".</p>
+        <p><code>sudo apt-get install pigz</code></p>
+        <p>You may install Python packages with pip.</p>
+        <p><code>sudo pip install numpy</code></p>
+        <p>You may download any public-facing file with wget.</p>
+        <p><code>wget http://www.usadellab.org/cms/uploads/supplementary/Trimmomatic/Trimmomatic-0.36.zip</code></p>
+        <p>You can pull GitHub repositories with Git.</p>
+        <p><code>git clone https://github.com/lh3/bwa.git</code></p>
+      </div>
+      <div id="workstation-accessing-pfda" class="h4">Accessing data on precisionFDA</div>
+      <div class="bs-docs-section">
+        <p>Workstations have full access to your private files in your precisionFDA cloud environment. You can interact
+          with these files using <code>dx</code> commands:</p>
+        <pre style="white-space: pre-line;">
+   dx ls
+   dx download
+   dx upload
+        </pre>
+        <p><code>dx ls</code> will show all files on your private precisionFDA area.</p>
+        <p><code>dx download <$filename></code> will download a file from precisionFDA to the local worker. You may use
+          an asterisk to indicate multiple files.</p>
+        <p><code>dx upload <$filename></code> will upload a file from the local worker to your precisionFDA private
+          area. You may upload multiple files using an asterisk.</p>
+        <p><i>NOTE: your files will not appear on precisionFDA until file syncing occurs, which happens either by clicking the "Sync Now" button on the Execution detail page, or automatically upon termination of the Workstation execution.</i></p>
+      </div>
+      <div id="workstation-snapshots" class="h2">Creating snapshots on Workstations</div>
+      <div class="bs-docs-section">
+        <p>Workstations support the ability to create a snapshot, which takes a picture of all modifications to the
+          Workstation since it was launched and can be seen as a "save point". The snapshot action creates a tarball
+          that contains all modified files, which is placed in a user's precisionFDA private area as a *.snapshot data
+          object.</p>
+        <p>After a snapshot file is created, a new execution of a Workstation may be launched, with the snapshot data
+          object as an optional input. If a snapshot is provided as input, it will be unpacked on the worker instance
+          and all files will be placed in the locations where they were located when the snapshot was created.</p>
+        <p>To take a snapshot in the TTYD Workstation, run the command:</p>
+        <p><code>dx-create-snapshot</code></p>
+        <p>To take a snapshot with the JupyterLab Workstation, click on the "snapshot" option under the "precisionFDA"
+          menu in the top menu bar.</p>
+        <p>Once created and synched (via termination of the Workstation), a snapshot file will appear in your private
+          Files area. You can recognize these files, as they will end in ".snapshot". This file may be an optional input
+          to a new Workstation execution.</p>
+        <p><i>NOTE: In order to run the snapshot generation command, Python2.7 must be included in the $PYTHONPATH
+          variable. Installing Python managers, such as Conda/BioConda, may alter this path. If you see a failure to
+          generate the snapshot, check to see if this path has been changed by running
+          <code>echo $PYTHONPATH</code>.</i></p>
+      </div>
+      <div id="workstation-terminating" class="h2">Terminating Workstations</div>
+      <div class="bs-docs-section">
+        <p><strong>TTYD</strong> Workstations will terminate after 30 days.</p>
+
+        <p><strong>Jupyter</strong> Workstations will terminate after 4 hours (240 minutes) by default. This timeout can
+          be adjusted, either by providing a custom duration as an input or by using the "Adjust Duration" option in the
+          Jupyter interface.</p>
+        <p>You can terminate a Workstation at any time by selecting "Terminate" from the Execution detail page.</p>
+
+        <p>Any uploaded files on a Workstation, pushed to the cloud using `dx upload`, will <strong>not</strong> appear
+          on precisionFDA in your private area until the execution is synced, or until it is terminated.  This syncing will happen automatically upon execution termination, but can be triggered to happen earlier by clicking on "Sync now" on the Execution detail page.</p>
+        <p>Note that after a Workstation is terminated, any files on the worker are no longer accessible! Make sure to
+          upload your work, or take a snapshot of the worker, before terminating.</p>
+      </div>
+    </div>
+    <!-- SIDEBAR NAVIGATION -->
+    <div class="col-sm-6">
+      <nav class="bs-docs-sidebar hidden-print hidden-xs hidden-sm affix-top">
+        <ul class="nav bs-docs-sidenav right-sidebar-nav">
+          <li><a href="#workstation-types">Workstation Types</a></li>
+          <li><a href="#workstation-access">Access to Workstations</a></li>
+          <li><a href="#workstation-launching">Launching a Workstation</a></li>
+          <li><a href="#workstation-accessing">Accessing files and data on Workstations</a></li>
+          <li><a href="#workstation-snapshots">Creating snapshots on Workstations</a></li>
+          <li><a href="#workstation-terminating">Terminating Workstations</a></li>
+        </ul>
+      </nav>
+    </div>
+  </div>
+</div>
diff --git a/app/views/experts/_disclaimer.html.erb b/app/views/experts/_disclaimer.html.erb
index 8d3bad400..58573fc3d 100644
--- a/app/views/experts/_disclaimer.html.erb
+++ b/app/views/experts/_disclaimer.html.erb
@@ -1,4 +1,4 @@
-<div class="text-muted">
+<div class="text-muted remediated-text-grey">
   <hr/>
   The questions, answers and comments posted under this Expert Q&A forum reflect the views of the author(s) and should not be construed to represent views or policies held by the FDA. Experts answer questions at their discretion and thus not all questions may be addressed. The Expert Q&A forum is also not intended to address questions pertaining to medical advice, diagnosis or treatment.
 </div>
diff --git a/app/views/experts/_form_fields.html.erb b/app/views/experts/_form_fields.html.erb
index 7ecc21b41..e9409bb0e 100644
--- a/app/views/experts/_form_fields.html.erb
+++ b/app/views/experts/_form_fields.html.erb
@@ -13,42 +13,42 @@
     <%= render "_partials/upload_image_button" %>
     <input type="hidden" name="expert[_image_id]" data-bind="value: modalUploader.fileId" required="required" />
     <br/><br/>
-    <img class="img-thumbnail" data-bind="attr: {src: modalUploader.imageUrl}, visible: modalUploader.imageUrl" />
+    <img class="img-thumbnail" alt="Expert's profile picture" data-bind="attr: {src: modalUploader.imageUrl}, visible: modalUploader.imageUrl" />
   </div>
 </div>
 <div class="form-group">
-  <%= f.label :_prefname, "Preferred Name", class: 'control-label col-sm-2' %>
+  <%= f.label :_prefname, "Preferred Name", class: 'control-label col-sm-2 ff-label-color' %>
   <div class="col-sm-11 col-sm-offset-1">
     <%= f.text_area :_prefname, class: "form-control", rows: 1, placeholder: "Preferred title to display other than 'First name Last name'" %>
   </div>
 </div>
 <div class="form-group">
-  <%= f.label :_about, "About", class: 'control-label col-sm-2' %>
+  <%= f.label :_about, "About", class: 'control-label col-sm-2 ff-label-color' %>
   <div class="col-sm-11 col-sm-offset-1">
     <%= f.text_area :_about, class: "form-control", rows: 6, placeholder: "About the Expert..." %>
   </div>
 </div>
 <div class="form-group">
-  <%= f.label :_blog_title, "Blog Title", class: 'control-label col-sm-2' %>
+  <%= f.label :_blog_title, "Blog Title", class: 'control-label col-sm-2 ff-label-color' %>
   <div class="col-sm-11 col-sm-offset-1">
     <%= f.text_area :_blog_title, class: "form-control", rows: 2, placeholder: "Title for expert's blurb/blog..." %>
   </div>
 </div>
 <div class="form-group">
-  <%= f.label :_blog, "Blog", class: 'control-label col-sm-2' %>
+  <%= f.label :_blog, "Blog", class: 'control-label col-sm-2 ff-label-color' %>
   <div class="col-sm-11 col-sm-offset-1">
     <%= f.text_area :_blog, class: "form-control", rows: 10, placeholder: "Expert blurb/blog..." %>
   </div>
 </div>
 <div class="form-group">
-  <%= f.label :_challenge, "Blog Preview", class: 'control-label col-sm-2' %>
+  <%= f.label :_challenge, "Blog Preview", class: 'control-label col-sm-2 ff-label-color' %>
   <div class="col-sm-11 col-sm-offset-1">
     <%= f.text_area :_challenge, class: "form-control", rows: 6, placeholder: "Text from blog to include in front page..." %>
   </div>
 </div>
 <% if @context.can_administer_site? %>
   <div class="form-group">
-    <%= f.label :scope, "Visibility", class: 'control-label col-sm-2' %>
+    <%= f.label :scope, "Visibility", class: 'control-label col-sm-2 ff-label-color' %>
     <div class="col-sm-11 col-sm-offset-1">
       <%= f.select :scope, options_for_select({ "Private" => "private", "Public" => "public" }, "Private"), {}, class: "form-control" %>
     </div>
diff --git a/app/views/experts/_header_dashboard.html.erb b/app/views/experts/_header_dashboard.html.erb
index 65257a7ae..fa7755109 100644
--- a/app/views/experts/_header_dashboard.html.erb
+++ b/app/views/experts/_header_dashboard.html.erb
@@ -1,22 +1,22 @@
-<div class="page-title">
+<h2>
   Your Expert Q&A Dashboard
-</div>
+</h2>
 <p>
   <br/>
-  <%= image_tag(@expert.image, class: 'img-rounded', height: '350px') %>
+  <%= image_tag(@expert.image, class: 'img-rounded', height: '350px', alt: "Expert's profile picture") %>
 </p>
 
 <p>
   <% if @expert.open? %>
-    <span class="label label-success"><span class="fa fa-check"></span> Open</span>
+    <span class="label label-success open-button"><span class="fa fa-check"></span> Open</span>
   <% else %>
-    <span class="label label-default"><span class="fa fa-lock"></span> Closed</span>
+    <span class="label label-default closed-button"><span class="fa fa-lock"></span> Closed</span>
   <% end %>
   <% if @expert.editable_by?(@context) %>
     <% if @expert.is_public? %>
       <span class="label label-primary"><span class="fa fa-eye"></span> Public</span>
     <% else %>
-      <span class="label label-warning"><span class="fa fa-eye-slash"></span> Private</span>
+      <span class="label label-warning private-button"><span class="fa fa-eye-slash"></span> Private</span>
     <% end %>
   <% end %>
 </p>
diff --git a/app/views/experts/_header_public.html.erb b/app/views/experts/_header_public.html.erb
index 9f75216a0..65901dd60 100644
--- a/app/views/experts/_header_public.html.erb
+++ b/app/views/experts/_header_public.html.erb
@@ -2,7 +2,7 @@
   <div class="row vertical-align">
     <div class="col-sm-5 col-md-5">
       <p>
-        <%= image_tag(@expert.image, class: 'img-rounded img-responsive center-block', style: 'max-height:500px') %>
+        <%= image_tag(@expert.image, class: 'img-rounded img-responsive center-block', style: 'max-height:500px', alt: "Expert's profile picture") %>
       </p>
       <br/>
       <%= link_to(content_tag(:span, "", class: "fa fa-newspaper-o") + " Read Expert Blog Post", blog_expert_path(@expert), class: 'btn btn-default btn-block') %>
@@ -17,19 +17,19 @@
       </div>
       <p>
         <% if @expert.open? %>
-          <span class="label label-success"><span class="fa fa-check"></span> Open</span>
+          <span class="label label-success open-button"><span class="fa fa-check"></span> Open</span>
         <% else %>
-          <span class="label label-default"><span class="fa fa-lock"></span> Closed</span>
+          <span class="label label-default closed-button"><span class="fa fa-lock"></span> Closed</span>
         <% end %>
         <% if @expert.editable_by?(@context) %>
           <% if @expert.is_public? %>
             <span class="label label-primary"><span class="fa fa-eye"></span> Public</span>
           <% else %>
-            <span class="label label-warning"><span class="fa fa-eye-slash"></span> Private</span>
+            <span class="label label-warning private-button"><span class="fa fa-eye-slash"></span> Private</span>
           <% end %>
         <% end %>
       </p>
-      <%= simple_format(@expert._about, {class: "expert-intro lead text-left"}) %>
+      <%= simple_format(@expert._about, {class: "expert-intro lead text-left introduction-text"}) %>
       <% if @expert.askable? %>
         <hr/>
         <a class="btn btn-primary btn-lg" data-toggle="modal" data-target="#ask-question-modal">
diff --git a/app/views/experts/_modal_ask_question.html.erb b/app/views/experts/_modal_ask_question.html.erb
index e42918814..bf3529a05 100644
--- a/app/views/experts/_modal_ask_question.html.erb
+++ b/app/views/experts/_modal_ask_question.html.erb
@@ -18,11 +18,11 @@
               <% end %>
           </div>
           <div class="form-group required">
-            <%= f.text_area (:question), rows: 4, class: "form-control input-lg", placeholder: "Ask a question...", required: "required"  %>
+            <%= f.text_area (:question), rows: 4, class: "form-control input-lg", placeholder: "Ask a question...",  required: "required", "aria-label" => "Enter question to ask Expert" %>
           </div>
-          <% if !@context.logged_in? %>
-            <%= recaptcha_tags %>
-          <% end %>
+          <% if !@context.logged_in? && !Utils.development_or_test? %>
+            <%= recaptcha_v3(action: 'question') %>
+          <% end %> 
         </div>
         <div class="modal-footer">
           <button type="button" class="btn btn-default" data-dismiss="modal" tabindex="-1">Cancel</button>
diff --git a/app/views/experts/_modal_new_question.html.erb b/app/views/experts/_modal_new_question.html.erb
index 5d4a04901..f113cc1ab 100644
--- a/app/views/experts/_modal_new_question.html.erb
+++ b/app/views/experts/_modal_new_question.html.erb
@@ -13,7 +13,7 @@
             Submitting as:&nbsp;&nbsp;<%= user_link(@expert.user) %>
           </div>
           <div class="form-group required">
-            <%= f.text_area (:question), rows: 4, class: "form-control input-lg", placeholder: "Submit a question...", required: "required"  %>
+            <%= f.text_area (:question), rows: 4, class: "form-control input-lg", placeholder: "Submit a question...", required: "required", "aria-label" => "Ask a question to submit to Expert" %>
           </div>
         </div>
         <div class="modal-footer">
diff --git a/app/views/experts/blog.html.erb b/app/views/experts/blog.html.erb
index e83b7b90e..398ad780b 100644
--- a/app/views/experts/blog.html.erb
+++ b/app/views/experts/blog.html.erb
@@ -1,37 +1,3 @@
 <% content_for :title do %><%= user_title(@expert.user) %><% end %>
 
-<div class="pfda-toolbar">
-  <%= link_to expert_path(@expert), class: "btn btn-default" do %>
-    <span class="fa fa-chevron-left"></span> Back to questions
-  <% end %>
-</div>
-
-<div class="page-header text-center">
-  <div class="container-fluid">
-    <div class="row">
-      <div class="col-md-20 col-md-offset-2">
-        <p>
-          <%= image_tag(@expert.image, class: 'img-rounded', height: '300px') %>
-        </p>
-        <br/>
-        <div class="expert-blog-text">
-          <div class=strong>
-            <%= @expert._blog_title %>
-          </div>
-          <p>
-            <%= link_to(@expert.title, user_url(@expert.user.username)) %>
-            <% if !@expert.user.singular? %>
-              <br/><%= @expert.user.org.name %>
-            <% end %>
-          </p>
-        </div>
-        <br/>
-        <div class="expert-blog-text text-left" data-bind="html: blogDisplay"></div>
-        <div class="text-muted text-left">
-          <hr/>
-          The views expressed are those of the author(s) and should not be construed to represent views or policies held by the FDA.
-        </div>
-      </div>
-    </div>
-  </div>
-</div>
+<div id="app-root"></div>
diff --git a/app/views/experts/blogPrev.html.erb b/app/views/experts/blogPrev.html.erb
new file mode 100644
index 000000000..e83b7b90e
--- /dev/null
+++ b/app/views/experts/blogPrev.html.erb
@@ -0,0 +1,37 @@
+<% content_for :title do %><%= user_title(@expert.user) %><% end %>
+
+<div class="pfda-toolbar">
+  <%= link_to expert_path(@expert), class: "btn btn-default" do %>
+    <span class="fa fa-chevron-left"></span> Back to questions
+  <% end %>
+</div>
+
+<div class="page-header text-center">
+  <div class="container-fluid">
+    <div class="row">
+      <div class="col-md-20 col-md-offset-2">
+        <p>
+          <%= image_tag(@expert.image, class: 'img-rounded', height: '300px') %>
+        </p>
+        <br/>
+        <div class="expert-blog-text">
+          <div class=strong>
+            <%= @expert._blog_title %>
+          </div>
+          <p>
+            <%= link_to(@expert.title, user_url(@expert.user.username)) %>
+            <% if !@expert.user.singular? %>
+              <br/><%= @expert.user.org.name %>
+            <% end %>
+          </p>
+        </div>
+        <br/>
+        <div class="expert-blog-text text-left" data-bind="html: blogDisplay"></div>
+        <div class="text-muted text-left">
+          <hr/>
+          The views expressed are those of the author(s) and should not be construed to represent views or policies held by the FDA.
+        </div>
+      </div>
+    </div>
+  </div>
+</div>
diff --git a/app/views/experts/dashboard.html.erb b/app/views/experts/dashboard.html.erb
index 2ff812df9..7cca3d08e 100644
--- a/app/views/experts/dashboard.html.erb
+++ b/app/views/experts/dashboard.html.erb
@@ -15,7 +15,7 @@
           Open Questions (<%= @open_questions.count %>)
         </div>
         <% @open_questions.each do |q|%>
-          <%= link_to q.body ? q.body : q._original, expert_edit_question_path(@expert.id, q.id), class: "list-group-item #{'active' if @selected_question && @selected_question.id == q.id }" %>
+          <%= link_to q.body ? q.body : q._original, expert_edit_question_path(@expert.id, q.id), class: "remediated-question-blue list-group-item #{'active' if @selected_question && @selected_question.id == q.id }" %>
         <% end %>
       <% end %>
 
@@ -24,7 +24,7 @@
           Answered Questions (<%= @answered_questions.count %>)
         </div>
         <% @answered_questions.each do |q|%>
-          <%= link_to q.body ? q.body : q._original, expert_edit_question_path(@expert.id, q.id), class: "list-group-item #{'active' if @selected_question && @selected_question.id == q.id }" %>
+          <%= link_to q.body ? q.body : q._original, expert_edit_question_path(@expert.id, q.id), class: "remediated-question-blue list-group-item #{'active' if @selected_question && @selected_question.id == q.id }" %>
         <% end %>
       <% end %>
 
@@ -33,7 +33,7 @@
           Ignored Questions (<%= @ignored_questions.count %>)
         </div>
         <% @ignored_questions.each do |q|%>
-          <s><%= link_to q.body ? q.body : q._original, expert_edit_question_path(@expert.id, q.id), class: "list-group-item #{'active' if @selected_question && @selected_question.id == q.id }" %></s>
+          <s><%= link_to q.body ? q.body : q._original, expert_edit_question_path(@expert.id, q.id), class: "remediated-question-blue list-group-item #{'active' if @selected_question && @selected_question.id == q.id }" %></s>
         <% end %>
       <% end %>
 
diff --git a/app/views/experts/edit.html.erb b/app/views/experts/edit.html.erb
index 4afa82bee..366e4fa3b 100644
--- a/app/views/experts/edit.html.erb
+++ b/app/views/experts/edit.html.erb
@@ -1,9 +1,11 @@
 <% content_for :title do %>Edit <%= user_title(@expert.user) %><% end %>
 
 <div class="page-header">
-  <div class="page-title">
-    <span class="fa fa-groups"></span>
-    Edit Expert Information
+  <div class="page-title expert-header-remediation">
+    <h1>
+      <span class="fa fa-groups"></span>
+      Edit Expert Information
+    </h1>
   </div>
 </div>
 
diff --git a/app/views/experts/index.html.erb b/app/views/experts/index.html.erb
index a240dee65..14d715c85 100644
--- a/app/views/experts/index.html.erb
+++ b/app/views/experts/index.html.erb
@@ -1,27 +1,3 @@
 <% content_for :title do %>Experts<% end %>
 
-<% if @context.can_administer_site? %>
-<div class="pfda-toolbar text-center">
-  <div class="btn-group">
-    <%= link_to new_expert_path, class: 'btn btn-primary' do %>
-      <span class="fa fa-plus-square fa-fw"></span> Create a new expert
-    <% end %>
-  </div>
-</div>
-<% end %>
-
-<%= render "experts/cards", experts: @experts %>
-
-<div class="text-center alert alert-info">
-  <% if @experts.empty? %>
-    No experts are currently being featured.
-    <br/><br/>
-  <% end %>
-  Your community wants to hear from you!
-
-  If you would like to suggest or nominate a colleague to be featured in an Expert Q&A session, please <strong><%= mail_to "precisionfda@fda.hhs.gov", "let us know" %></strong>.
-
-  <br/>
-  Thank you for supporting and being part of the PrecisionFDA community!
-</div>
-
+<div id="app-root"></div>
diff --git a/app/views/experts/new.html.erb b/app/views/experts/new.html.erb
index 710ff0d09..09d13f742 100644
--- a/app/views/experts/new.html.erb
+++ b/app/views/experts/new.html.erb
@@ -1,9 +1,11 @@
 <% content_for :title do %>Create a new Expert of the Month<% end %>
 
 <div class="page-header">
-  <div class="page-title">
-    <span class="fa fa-groups"></span>
-    Create a new <strong>Expert of the Month</strong>
+  <div class="page-title expert-header-remediation">
+    <h1>
+      <span class="fa fa-groups"></span>
+      Create a new <strong>Expert of the Month</strong>
+    </h1>
   </div>
 </div>
 
@@ -15,7 +17,7 @@
     <div class="form-group">
       <div class="col-sm-offset-3">
         <%= f.submit "Create Expert", class: 'btn btn-primary', data: { disable_with: "Creating...", bind: "enable: modalUploader.imageUrl" } %>
-        <div class="text-muted" data-bind="visible: !modalUploader.imageUrl()"><br/>Please upload an image for the expert.</div>
+        <div class="text-muted expert-upload-image-text" data-bind="visible: !modalUploader.imageUrl()"><br/>Please upload an image for the expert.</div>
       </div>
     </div>
   <% end %>
diff --git a/app/views/experts/qa.html.erb b/app/views/experts/qa.html.erb
new file mode 100644
index 000000000..307e9cf3d
--- /dev/null
+++ b/app/views/experts/qa.html.erb
@@ -0,0 +1,50 @@
+<% content_for :title do %><%= user_title(@expert.user) %><% end %>
+
+<%= render 'experts/header', { is_dashboard: false } %>
+
+<div class="pfda-pane container-padded container-fluid">
+  <div class="pfda-pane-content pfda-pane-content-padded-xl">
+    <% if @answered_questions.count > 0 %>
+      <% @answered_questions.each do |q|%>
+        <div class="expert-question">
+          <%= link_to expert_expert_question_path(@expert, q) do %>
+            <h3 class="expert-question-body"><%= q.body %></h3>
+            <h6 class="expert-question-footer text-muted remediated-text-grey">
+              Answered <%= time_ago(q.expert_answer.updated_at) %>
+            </h6>
+          <% end %>
+        </div>
+      <% end %>
+    <% else %>
+      No questions have been answered yet.
+    <% end %>
+    <%= render "experts/disclaimer" %>
+
+  </div>
+  <div class="pfda-pane-sidebar pfda-pane-sidebar-minimal pfda-pane-sidebar-padded-v">
+    <ul class="list-group">
+      <% if @context.logged_in? %>
+        <li class="list-group-item list-group-item-header">
+          Your Questions (<%= @user_questions.count %>)
+        </li>
+        <% if @user_questions.count > 0 %>
+          <% @user_questions.each do |q|%>
+            <li class="list-group-item">
+              <%= q._original %>
+            </li>
+          <% end %>
+        <% end %>
+      <% else %>
+        <li class="list-group-item list-group-item-header">
+          Your Questions
+        </li>
+        <li class="list-group-item">
+          Please <strong><%= link_to "login", "#{HOST}/login" %></strong> or <strong><%= link_to "request access", "#{HOST}/request_access" %></strong> to track and see your question history.
+        </li>
+      <% end %>
+      <br/>
+    </ul>
+  </div>
+</div>
+
+<%= render "experts/modal_ask_question" %>
diff --git a/app/views/experts/show.html.erb b/app/views/experts/show.html.erb
index d9865cd11..398ad780b 100644
--- a/app/views/experts/show.html.erb
+++ b/app/views/experts/show.html.erb
@@ -1,51 +1,3 @@
 <% content_for :title do %><%= user_title(@expert.user) %><% end %>
 
-<%= render 'experts/header', { is_dashboard: false } %>
-
-<div class="pfda-pane container-padded container-fluid">
- <div class="pfda-pane-content pfda-pane-content-padded-xl">
-    <% if @answered_questions.count > 0 %>
-      <% @answered_questions.each do |q|%>
-        <div class="expert-question">
-          <%= link_to expert_expert_question_path(@expert, q) do %>
-            <h3 class="expert-question-body"><%= q.body %></h3>
-            <h6 class="expert-question-footer text-muted">
-              Answered <%= time_ago(q.expert_answer.updated_at) %>
-            </h6>
-          <% end %>
-        </div>
-      <% end %>
-    <% else %>
-      No questions have been answered yet.
-    <% end %>
-
-    <%= render "experts/disclaimer" %>
-
-  </div>
-  <div class="pfda-pane-sidebar pfda-pane-sidebar-minimal pfda-pane-sidebar-padded-v">
-    <ul class="list-group">
-     <% if @context.logged_in? %>
-        <li class="list-group-item list-group-item-header">
-          Your Questions (<%= @user_questions.count %>)
-        </li>
-        <% if @user_questions.count > 0 %>
-          <% @user_questions.each do |q|%>
-            <li class="list-group-item">
-              <%= q._original %>
-           </li>
-          <% end %>
-        <% end %>
-      <% else %>
-        <li class="list-group-item list-group-item-header">
-          Your Questions
-        </li>
-       <li class="list-group-item">
-          Please <strong><%= link_to "login", "#{HOST}/login" %></strong> or <strong><%= link_to "request access", "#{HOST}/request_access" %></strong> to track and see your question history.
-        </li>
-      <% end %>
-      <br/>
-    </ul>
-  </div>
-</div>
-
-<%= render "experts/modal_ask_question" %>
+<div id="app-root"></div>
diff --git a/app/views/files/_grid.html.erb b/app/views/files/_grid.html.erb
index 1737a8e42..406650702 100644
--- a/app/views/files/_grid.html.erb
+++ b/app/views/files/_grid.html.erb
@@ -27,7 +27,7 @@
   end
 
   g.column name: 'Name', attribute: 'name' do |file|
-    unilinkfw(file, scope_icon: (defined?(scope_icon) ? scope_icon : true), nolink: file.blocked?)
+    unilinkfw(file, scope_icon: (defined?(scope_icon) ? scope_icon : true), nolink: file.blocked?, target: "_blank")
   end
 
   g.column name: toggle_all_descriptions do |file|
@@ -61,11 +61,11 @@
 
   g.column name: 'Origin' do |file|
     if file.klass == "folder"
-      nil
+      file.https? ? unilinkfw(file.parent) : nil
     elsif file.parent_type == "Node" && file.parent.blank?
       "Copied"
     elsif file.parent_type != "User"
-      unilinkfw(file.parent)
+      unilinkfw(file.parent, target: "_blank")
     else
       "Uploaded"
     end
diff --git a/app/views/jobs/_grid.html.erb b/app/views/jobs/_grid.html.erb
index bf5df5bfd..b1a51bcd5 100644
--- a/app/views/jobs/_grid.html.erb
+++ b/app/views/jobs/_grid.html.erb
@@ -47,7 +47,7 @@
     humanize_seconds(job.runtime)
   end
 
-  g.column name: 'Energy Consumption' do |job|
+  g.column name: 'Cost in dollars' do |job|
     content_tag(:span, " ", class: "fa fa-industry fa-fw") + " " + job.energy_string
   end
 
diff --git a/app/views/jobs/log.html.erb b/app/views/jobs/log.html.erb
index 10db1562f..8f8b122c8 100644
--- a/app/views/jobs/log.html.erb
+++ b/app/views/jobs/log.html.erb
@@ -13,13 +13,13 @@
     <% else %>
       <span class="label label-warning"> <%= @job.state.upcase %></span>
     <% end %>
-    <span class="name"><%= link_to @job.name, job_path(@job) %></span>
+    <span class="name"><%= link_to(@job.name, home_path_to_item(@job), data: { turbolinks: "false" }) %></span>
   </div>
 </div>
 
 <div class="pfda-toolbar">
   <div class="btn-group pull-left">
-    <%= link_to log_job_path(@job), class: "btn btn-default", data: {no_turbolink: true} do %>
+    <%= link_to log_job_path(@job), class: "btn btn-default", data: {turbolinks: "false"} do %>
       <span class="fa fa-refresh"></span> Refresh
     <% end %>
   </div>
@@ -27,7 +27,7 @@
   <% if @job.user_id == @context.user_id %>
     <div class="btn-group pull-right">
       <% if !@job.terminal? %>
-        <%= link_to job_path(@job), method: :delete, data: { confirm: 'Are you certain you want to Terminate this?' }, class: "btn btn-danger" do %>
+        <%= link_to job_path(@job), method: :delete, data: { confirm: 'Are you certain you want to Terminate this?', turbolinks: "false" }, class: "btn btn-danger" do %>
           <span class="fa fa-times-circle"></span> Terminate
         <% end %>
       <% end %>
@@ -35,4 +35,4 @@
   <% end %>
 </div>
 
-<div class="container-fluid"><div class="job-log panel panel-default"><%= @log_contents.join("\n") %></div></div>
+<%if @log_contents%> <div class="container-fluid"> <div class="job-log panel panel-default"><%= @log_contents.join("\n")%></div> </div> <% end %> 
diff --git a/app/views/jobs/new.html.erb b/app/views/jobs/new.html.erb
index f4375b869..d53ccd480 100644
--- a/app/views/jobs/new.html.erb
+++ b/app/views/jobs/new.html.erb
@@ -3,7 +3,7 @@
 <div class="affix-spacer">
   <div class="affix-container">
     <div class="page-header clearfix">
-      <div class="page-title pull-left"><span class="fa fa-cube"></span> Run <%= link_to @app.title, app_path(@app.uid), target: "_blank" %></div>
+      <div class="page-title pull-left"><span class="fa fa-cube"></span> Run <%= link_to @app.title, home_path_to_item(@app), target: "_blank", rel: "noopener noreferrer" %></div>
       <div class="btn-group pull-right">
         <!-- ko if: isInSpace -->
           <button
@@ -48,14 +48,14 @@
       <div class="panel-body">
         <div class="form-group required">
           <label class= "col-sm-4 control-label" for="name">Job Name</label>
-          <div class="col-sm-10 col-sm-offset-1">
+          <div class="col-sm-9 col-sm-offset-1">
             <input type="text" name="name" class="form-control" placeholder="Enter a name for this job" data-bind="textInput: name">
           </div>
         </div>
         <!-- ko if: isInSpace -->
           <div class="form-group required">
             <label class= "col-sm-4 control-label" for="space_id">Space scope</label>
-            <div class="col-sm-10 col-sm-offset-1">
+            <div class="col-sm-9 col-sm-offset-1">
               <select name="space_id" class="form-control" data-bind="options: selectableSpaces,
                    optionsText: 'label',
                    optionsValue: 'value',
@@ -67,13 +67,24 @@
         <!-- /ko -->
         <div class="form-group">
           <label class= "col-sm-4 control-label" for="instance_type">Instance Type</label>
-          <div class="col-sm-10 col-sm-offset-1">
+          <div class="col-sm-9 col-sm-offset-1">
             <select name="instance_type" class="form-control" data-bind="options: availableInstances,
                    optionsText: 'label',
                    optionsValue: 'value',
                    value: instanceType,
                    optionsCaption: 'Choose...'"></select>
           </div>
+          <label class= "col-sm-4 control-label" for="job_limit">Execution Cost Limit ($)</label>
+          <div class="col-sm-2">
+            <input
+              type="number"
+              step="0.01"
+              placeholder="$"
+              name="job_limit"
+              class="form-control"
+              data-bind="textInput: jobLimit, disable: $root.busy, attr: { max: maxJobLimit }"
+            >
+          </div>
         </div>
       </div>
     </div>
diff --git a/app/views/jobs/show.html.erb b/app/views/jobs/show.html.erb
index d3debfad8..09bc076b7 100644
--- a/app/views/jobs/show.html.erb
+++ b/app/views/jobs/show.html.erb
@@ -22,7 +22,7 @@
     <%= render "_partials/metadata_access", item: @job %>
     <li class="list-group-item">
       <h5 class="list-group-item-heading">App</h5>
-      <p class="list-group-item-text"><%= unilink(@job.app) %></p>
+      <p class="list-group-item-text"><%= unilink(@job.app, @context.user) %></p>
     </li>
     <li class="list-group-item">
       <h5 class="list-group-item-heading">Launched by</h5>
@@ -47,9 +47,19 @@
       <p class="list-group-item-text"><%= humanize_seconds(@job.runtime) %></p>
     </li>
     <li class="list-group-item">
-      <h5 class="list-group-item-heading">Energy Consumed</h5>
+      <h5 class="list-group-item-heading">Cost In Dollars</h5>
       <p class="list-group-item-text"><span class="fa fa-industry"></span> <%= @job.energy_string %></p>
     </li>
+    <% if @job.https? && @job.running? %>
+      <li class="list-group-item">
+        <h5 class="list-group-item-heading">Job URL</h5>
+        <p class="list-group-item-text">
+          <%= link_to(open_external_api_job_path(@job), "data-turbolinks" => false) do %>
+            <span class="fa fa-external-link"></span> open
+          <% end %>
+        </p>
+      </li>
+    <% end %>
   </ul>
 </div>
 
diff --git a/app/views/layouts/application.html.erb b/app/views/layouts/application.html.erb
index b40453f33..0b23d3b9d 100644
--- a/app/views/layouts/application.html.erb
+++ b/app/views/layouts/application.html.erb
@@ -4,7 +4,7 @@
   <%= render "_partials/head" %>
 </head>
   <!-- revision: <%= @context.token %> /-->
-<!-- revision: <%= git_revision %> /-->
+  <!-- revision: <%= git_revision %> /-->
   <body class="pfda-controller-<%= controller_name %> pfda-action-<%= action_name %> <% if !@context.logged_in_or_guest? %>pfda-guest<% else %>pfda-user<% end %>" <%= yield(:body_attributes) %> <% if !@context.logged_in_or_guest? %>data-no-turbolink<% end %> >
   <header>
     <%= render "_partials/navbar" %>
diff --git a/app/views/layouts/react.html.erb b/app/views/layouts/react.html.erb
new file mode 100644
index 000000000..6d90b4f64
--- /dev/null
+++ b/app/views/layouts/react.html.erb
@@ -0,0 +1,16 @@
+<!DOCTYPE html>
+<html lang="en-US">
+<head>
+  <%= render "_partials/head_react" %>
+</head>
+  <!-- revision: <%= @context.token %> /-->
+  <!-- revision: <%= git_revision %> /-->
+  <body>
+  <main role="main">
+    <noscript>This website requires JavaScript</noscript>
+    <!-- TODO(samuel) temporary workaround for server-side errors, should be migrated to toastify -->
+    <%= render partial: "_partials/messages", flash: flash %>
+    <%= content_for?(:content) ? yield(:content) : yield %>
+  </main>
+</body>
+</html>
diff --git a/app/views/licenses/items.html.erb b/app/views/licenses/items.html.erb
index 6ea23bffb..9b5cad4dc 100644
--- a/app/views/licenses/items.html.erb
+++ b/app/views/licenses/items.html.erb
@@ -18,7 +18,7 @@
       <% if @items_count > 0 %>
         <% @items.each do |item| %>
           <li class="list-group-item clearfix">
-            <span class="label label-info text-uppercase"><%= item.licenseable.klass %></span> <%= unilinkfw(item.licenseable) %>
+            <span class="label label-info text-uppercase"><%= item.licenseable.klass %></span> <%= unilinkfw(item.licenseable, target: "_blank") %>
             <% if @license.editable_by?(@context) %>
             <div class="btn-group pull-right">
               <%= link_to "Detach", remove_item_license_path(@license.id, item.licenseable.uid), method: :post %>
diff --git a/app/views/main/_landing.html.erb b/app/views/main/_landing.html.erb
index 7807b4921..7688b2805 100644
--- a/app/views/main/_landing.html.erb
+++ b/app/views/main/_landing.html.erb
@@ -50,18 +50,18 @@
       </div>
       <div class="col-sm-8 col-md-8 landing-btn">
         <% if Challenge.current.present? && Challenge.current.active? %>
-          <a class="btn accessible-btn-success btn-lg btn-block" href="<%= challenge_path(Challenge.current) %>" style="white-space: normal">
+          <a class="btn accessible-btn-success btn-lg btn-block" href="<%= challenge_path(Challenge.current) %>" style="white-space: normal" data-turbolinks="false">
             <span class="fa fa-user-plus"></span>
             &nbsp;Participate in the Current Challenge
           </a>
           <br/>
-          <a class="btn accessible-btn-primary btn-md btn-block" href="/challenges" style="white-space: normal">
+          <a class="btn accessible-btn-primary btn-md btn-block" href="/challenges" style="white-space: normal" data-turbolinks="false">
             <span class="fa fa-info-circle"></span>
             &nbsp;Learn About Previous Challenges
           </a>
         <% else %>
           <div class="h1">
-            <a class="btn accessible-btn-danger btn-lg btn-block" href="/challenges">Learn About Challenges</a>
+            <a class="btn accessible-btn-danger btn-lg btn-block" href="/challenges" data-turbolinks="false">Learn About Challenges</a>
           </div>
         <% end %>
       </div>
@@ -82,7 +82,7 @@
       </div>
       <div class="col-sm-8 col-md-8 landing-btn">
         <div class="h1">
-          <a class="btn accessible-btn-default btn-lg btn-block" href="<%= news_path %>">
+          <a class="btn accessible-btn-default btn-lg btn-block" href="<%= news_path %>" data-turbolinks="false">
             <span class="fa fa-newspaper-o"></span> &nbsp;View News
           </a>
         </div>
diff --git a/app/views/main/about.html.erb b/app/views/main/about.html.erb
index 3d392b071..1103dbe1e 100644
--- a/app/views/main/about.html.erb
+++ b/app/views/main/about.html.erb
@@ -1,184 +1,3 @@
 <% content_for :title do %>About precisionFDA<% end %>
 
-<div class="accessible">
-  <div class="page-header">
-    <div class="page-title text-center">
-      About precisionFDA
-    </div>
-  </div>
-
-  <div class="container-fluid">
-    <!-- Nav tabs -->
-    <ul class="nav nav-tabs nav-tabs-padded nav-tabs-lg nav-justified" role="tablist">
-      <li role="presentation" class="<% if !params[:section].present? || params[:section] == 'why' %>active<% end %>">
-        <a href="<%= about_path %>/why" aria-controls="why" role="tab">
-          <span class="tab-label">Why?</span>
-          <span class="tab-help">Background and motivation</span>
-        </a>
-      </li>
-      <li role="presentation" class="<% if params[:section] == 'what' %>active<% end %>">
-        <a href="<%= about_path %>/what" aria-controls="what" role="tab">
-          <span class="tab-label">What?</span>
-          <span class="tab-help">A genomics community and platform</span>
-        </a>
-      </li>
-      <li role="presentation" class="<% if params[:section] == 'who' %>active<% end %>">
-        <a href="<%= about_path %>/who" aria-controls="who" role="tab">
-          <span class="tab-label">Who?</span>
-          <span class="tab-help">The team behind the initiative</span>
-        </a>
-      </li>
-      <li role="presentation" class="<% if params[:section] == 'how' %>active<% end %>">
-        <a href="<%= docs_path %>" aria-controls="how" role="tab">
-          <span class="tab-label">How?</span>
-          <span class="tab-help">Learn how to use the features</span>
-        </a>
-      </li>
-    </ul>
-  </div>
-
-  <div class="container">
-    <!-- Tab panes -->
-    <div class="tab-content">
-      <% if !params[:section].present? || params[:section] == 'why' %>
-      <div role="tabpanel" class="tab-pane tab-pane-padded tab-pane-padded-xl active" id="why">
-        <div class="row">
-          <div class="lead lead-intro text-primary">
-            The Food and Drug Administration (FDA) plays an integral role in precision medicine, which foresees the day when an individual’s medical care will be tailored in part based on their unique characteristics and genetic make-up.
-          </div>
-          <hr>
-          <div class="col-md-12">
-            <p class="lead">To accelerate progress towards this vision, in July 2014, FDA’s Chief Health Informatics Officer (CHIO), <a href="http://www.fda.gov<%= about_path %>FDA/CentersOffices/ucm349836.htm">Taha Kass-Hout, M.D.</a>, began investigating the concept of a research and development portal that would allow community members to test, pilot, and validate existing and new bioinformatics approaches for processing the vast amount of genomic data that is collected using Next Generation Sequencing (NGS) technology.
-            </p>
-            <p class="lead">
-              After conducting market research, collaborating with FDA’s <a href="http://www.fda.gov<%= about_path %>FDA/CentersOffices/OfficeofMedicalProductsandTobacco/CDRH/">Center for Devices and Radiological Health</a> and assembling a project team, the precisionFDA project was initiated on July 22, 2015 with a scheduled beta launch date of December 15, 2015.
-            </p>
-          </div>
-          <div class="col-md-11 col-md-offset-1">
-            <p class="text-center">
-              <img src="/assets/beta-release.png" class="img-responsive img-thumbnail" alt="Beta release Timeline: Beta launch on Dec 2015">
-            </p>
-          </div>
-        </div>
-      </div>
-      <% end %>
-      <% if params[:section] == 'what' %>
-      <div role="tabpanel" class="tab-pane tab-pane-padded tab-pane-padded-xl active" id="what">
-        <div class="lead lead-intro text-primary">
-          PrecisionFDA provides the genomics community with a secure, cloud-based platform where participants can access and share datasets, analysis pipelines, and bioinformatics tools, in order to benchmark their approaches and advance regulatory science.
-        </div>
-        <hr>
-        <p class="lead">
-          While precisionFDA does not serve a regulatory role, it is expected to generate knowledge to inform future regulatory pathways and decision making.
-        </p>
-        <p class="lead">
-          PrecisionFDA provides a private area where participants (individuals or organizations) can conduct genome analysis and comparison against reference material, and a community area where they can publish and share results, reference materials, and tools. The precisionFDA community continues to grow and includes:
-        </p>
-
-        <ul class="lead lead-regular">
-          <li>Genome Test or Software Providers</li>
-          <li>Standards-making Bodies</li>
-          <li>Pharmaceutical &amp; Biotechnology Companies</li>
-          <li>Healthcare Providers</li>
-          <li>Academic Medical Centers</li>
-          <li>Researchers</li>
-          <li>Patients</li>
-          <li>FDA &amp; Other Government Agencies</li>
-        </ul>
-      </div>
-      <% end %>
-      <% if params[:section] == 'who' %>
-      <div role="tabpanel" class="tab-pane tab-pane-padded tab-pane-padded-xl active" id="who">
-        <div class="lead lead-intro text-primary">
-          PrecisionFDA is an initiative in the Office of Health Informatics (OHI) at the Food and Drug Administration led by the Chief Health Informatics Officer (CHIO), Dr. Taha Kass-Hout, MD, MS.
-        </div>
-        <hr>
-        <p class="lead">
-          The core project team consists of the following individuals, in alphabetical order:
-        </p>
-
-        <ul class="list list-inline list-bricks lead lead-bold">
-          <li>George Asimenos*</li>
-          <li>Ruth Bandler</li>
-          <li>Adam Berger</li>
-          <li>Pamella Tater*</li>
-          <li>Elaine Johanson</li>
-          <li>Taha Kass-Hout</li>
-          <li>Xueying (Sharon) Liang</li>
-          <li>David Litwack</li>
-          <li>Elizabeth Mansfield</li>
-          <li>Omar Serang*</li>
-          <li>Sam Westreich*</li>
-          <li>Zivana Tezak</li>
-        </ul>
-
-        <hr>
-
-        <p class="lead">
-          The team also wishes to thank the following individuals for their significant contributions to the effort:
-        </p>
-
-        <ul class="list list-inline list-bricks lead lead-regular">
-          <li>Vincent Amatrudo</li>
-          <li>Angela Anderson*</li>
-          <li>Rob Califf</li>
-          <li>Mohammed (Sohail) Chaudhry</li>
-          <li>Caroline Clode*</li>
-          <li>Stephanie Devaney</li>
-          <li>Amber Griffin</li>
-          <li>Letria Hall</li>
-          <li>Walter Harris</li>
-          <li>Sally Howard</li>
-          <li>Sean Hanlon</li>
-          <li>Farhan Khan</li>
-          <li>Bruce Kuhlik</li>
-          <li>Margaret Leizear</li>
-          <li>DJ Patil</li>
-          <li>Shawn Porter</li>
-          <li>Karen Riley</li>
-          <li>Alyson Saben</li>
-          <li>Jeff Shuren</li>
-          <li>Vahan Simonyan</li>
-          <li>Todd Simpson</li>
-          <li>Sean Wybenga</li>
-        </ul>
-
-        <br>
-        <p class="text-muted">*Contractor to FDA’s Office of Health Informatics</p>      <hr />
-        <div>
-          Media asset attributions:
-          <ul class="text-muted">
-            <li>
-              <%= link_to "MediaLoot", "http://medialoot.com/" %>
-            </li>
-          </ul>
-        </div>
-      </div>
-
-      <% end %>
-      <% if params[:section] == 'how' %>
-      <div role="tabpanel" class="tab-pane tab-pane-padded tab-pane-padded-xl active" id="how">
-        <%= render "main/docs" %>
-      </div>
-      <% end %>
-    </div>
-  </div>
-
-  <% if !@context.logged_in_or_guest? %>
-  <hr>
-
-  <div class="container">
-    <div class="panel panel-info text-center">
-      <div class="panel-body">
-        <p class="lead lead-bold">This program is in production at this time.</p>
-        <p class="lead">For further information and to express interest in participating please submit our request access form.</p>
-      </div>
-      <div class="panel-body">
-        <a class="btn accessible-btn-success btn-lg" href="/request_access"><span class="fa fa-user-plus" aria-hidden="true"></span> Request Access</a>
-      </div>
-    </div>
-  </div>
-  <% end %>
-</div>
-
-<%= render "_partials/fda_footer" %>
+<div id="app-root"></div>
diff --git a/app/views/main/index.html.erb b/app/views/main/index.html.erb
index 5f68182b1..56cc62040 100644
--- a/app/views/main/index.html.erb
+++ b/app/views/main/index.html.erb
@@ -1,217 +1,5 @@
 <% content_for :title do %>Overview<% end %>
 
 <%= render "_partials/browser_support_script" %>
-<% if !@context.logged_in_or_guest? %>
-  <%= render "main/landing" %>
-<% else %>
-  <% if @context.guest? %>
-    <div class="jumbotron jumbotron-landing">
-      <div class="container">
-        <h1>WELCOME to precisionFDA</h1>
-        <p class="lead lead-bold"><%= t('main.header') %></p>
-      </div>
-    </div>
-  <% else %>
-    <div class="jumbotron jumbotron-overview">
-      <div class="container">
-        <h1>WELCOME to precisionFDA</h1>
-      </div>
-    </div>
-    <% if non_singular_org_admin?(@context.user) %>
-      <div class="container-fluid">
-        <div class="alert alert-success">
-          In an effort to streamline the processes of creating and managing user accounts, as of October 2019,
-          the use of organizations in precisionFDA will be eliminated. All new users will be provisioned
-          as self-representing. Existing organizations will remain in place, but org members can choose to move
-          from the organization to become self-representing.
-          Additional information can be found at
-          <a href="<%= doc_path("organizations_deprecation") %>">documentation</a>.
-        </div>
-      </div>
-    <% end %>
-  <% end %>
 
-  <div class="container-fluid container-padded">
-    <% if @event.present? && !@event[:past] %>
-      <%= render "_partials/event", event: @event %>
-    <% end %>
-
-    <div class="row">
-      <div class="col-md-24">
-        <ul class="list-inline">
-          <li class="overview-header">
-            Get Started
-          </li>
-          <li><a class="btn btn-sm btn-default" href="<%= docs_path %>"><span class="fa fa-fw fa-book"></span> Docs</a></li>
-          <li><a class="btn btn-sm btn-default" href="<%= show_docs_path('video_tutorials') %>"><span class="fa fa-fw fa-film"></span> Tutorials</a></li>
-        </ul>
-
-        <% if @context.guest? %>
-          <div class="pfda-cards pfda-tutorial text-left">
-            <% @tutorials.each do |tutorial| %>
-            <div class="pfda-card pfda-card-padded pfda-card-rounded pfda-card-default">
-              <div class="pfda-card-title">
-                <a href="<%= tutorial[:path] %>"><%= tutorial[:title] %></a>
-                <a class="link-muted pull-right" href="<%= tutorial[:help_path] %>"><%= tutorial[:help_label] %></a>
-              </div>
-              <div class="pfda-card-body">
-                <%= tutorial[:description] %>
-              </div>
-            </div>
-            <% end %>
-          </div>
-        <% else %>
-          <ul class="pfda-cards pfda-tutorial text-left">
-            <%= render partial: "main/get_started_box", collection: @get_started_boxes %>
-          </ul>
-        <% end %>
-      </div>
-    </div>
-
-    <hr />
-
-    <div class="row">
-      <div class="col-md-16">
-          <% if @experts.count > 0 %>
-          <div class="overview-header">
-              Expert Spotlight
-          </div>
-          <%= render "experts/landing_cards", experts: @experts %>
-          <% end %>
-          
-          <%= render "main/stay_up_to_date" %>
-      </div>
-
-      <div class="col-md-7 col-md-offset-1">
-        <div class="overview-header">Latest Activity</div>
-          <%= render "_partials/feed", feed: @feed %>
-        <br/>
-      </div>
-    </div>
-    <div class="row">
-      <div class="overview-header">Learn More</div>
-      <div class="main-section pfda-cards pfda-cards-news">
-        <% @challenges.each do |challenge| %>
-          <a class="pfda-card pfda-card-padded pfda-card-light pfda-card-rounded pfda-card-bordered" href="<%= challenge_path(challenge) %>">
-            <div class="pfda-card-header lead text-center">
-              <%= challenge.active? ? 'Participate in the' : 'Read about the' %>
-            </div>
-            <div class="pfda-card-body pfda-card-body-icon">
-              <span class="fa fa-trophy" aria-hidden="true"></span>
-            </div>
-            <div class="pfda-card-title lead lead-bold text-center">
-              <%= challenge.modified_name(challenge.name) %>
-            </div>
-          </a>
-        <% end %>
-        <% if @appathons_challenge[:launched] %>
-          <a class="pfda-card pfda-card-padded pfda-card-light pfda-card-rounded pfda-card-bordered" href="<%= @appathons_challenge[:path] %>">
-            <div class="pfda-card-header lead text-center">
-              <%= @appathons_challenge[:active] ? 'Participate in the' : 'Read about the' %>
-            </div>
-            <div class="pfda-card-body pfda-card-body-icon">
-              <span class="fa fa-trophy" aria-hidden="true"></span>
-            </div>
-            <div class="pfda-card-title lead lead-bold text-center">
-              <%= @appathons_challenge[:title] %> Challenge
-            </div>
-          </a>
-        <% end %>
-        <% if @truth_challenge[:launched]  %>
-          <a class="pfda-card pfda-card-padded pfda-card-light pfda-card-rounded pfda-card-bordered" href="<%= truth_challenges_path %>">
-            <div class="pfda-card-header lead text-center">
-              <%= @truth_challenge[:active] ? 'Participate in the' : 'Read about the' %>
-            </div>
-            <div class="pfda-card-body pfda-card-body-icon">
-              <span class="fa fa-trophy" aria-hidden="true"></span>
-            </div>
-            <div class="pfda-card-title lead lead-bold text-center">
-              Truth Challenge
-            </div>
-          </a>
-        <% end %>
-        <% if @consistency_challenge[:launched]  %>
-          <a class="pfda-card pfda-card-padded pfda-card-light pfda-card-rounded pfda-card-bordered" href="<%= consistency_challenges_path %>">
-            <div class="pfda-card-header lead text-center">
-              <%= @consistency_challenge[:active] ? 'Participate in the' : 'Read about the' %>
-            </div>
-            <div class="pfda-card-body pfda-card-body-icon">
-              <span class="fa fa-trophy" aria-hidden="true"></span>
-            </div>
-            <div class="pfda-card-title lead lead-bold text-center">
-              Consistency Challenge
-            </div>
-          </a>
-        <% end %>
-      </div>
-    </div>
-    <div class="row">
-      <div class="main-section pfda-cards pfda-cards-news">
-        <%= render partial: "_partials/news_blocks", locals: { isAdmin: false } %>
-      </div>
-    </div>
-    <br/>
-  </div>
-<% end %>
-
-<% if !@context.logged_in_or_guest? %>
-  <div class="below-fold-actions">
-    <a class="btn accessible-btn-primary btn-lg" href="<%= docs_path %>">
-      <span class="fa fa-info-circle" aria-hidden="true"></span> Learn more about precisionFDA
-    </a>
-    <br>
-    <a class="btn accessible-btn-link btn-lg" href="mailto:precisionfda@fda.hhs.gov"><span class="fa fa-fw fa-commenting-o" aria-hidden="true"></span> Feedback</a>
-    <a class="btn accessible-btn-link btn-lg hide" href="https://docs.google.com/forms/d/1zfGoy-4C9kLbHHg0Y-6iQoI3fdGq1IfugV9fXCqOBfY/viewform" target="_blank"><span class="fa fa-fw fa-commenting-o" aria-hidden="true"></span> Feedback</a>
-  </div>
-<% end %>
-
-<!-- Modal -->
-<div class="modal fade" id="guidelines-modal" tabindex="-1" role="dialog" aria-labelledby="guidelines-modal">
-  <div class="modal-dialog modal-lg" role="document">
-    <div class="modal-content">
-      <div class="modal-header text-center">
-        <h3 class="modal-title"><span class="fa fa-institution" aria-hidden="true"></span> Community Guidelines</h3>
-      </div>
-      <div class="modal-body">
-        <div id="guidelines-carousel" class="carousel carousel-text carousel-text-padded-lg slide" data-interval="false" data-wrap="false">
-          <!-- Wrapper for slides -->
-          <div class="row">
-            <div class="col-md-offset-3 col-md-18">
-              <!-- Indicators -->
-              <ol class="carousel-indicators">
-                <li data-target="#guidelines-carousel" class="carousel-indicator-green active"></li>
-                <li data-target="#guidelines-carousel" class="carousel-indicator-blue"></li>
-                <li data-target="#guidelines-carousel" class="carousel-indicator-red"></li>
-              </ol>
-
-              <br>
-
-              <%= render "_partials/guidelines_content" %>
-
-              <br>
-
-              <!-- Controls -->
-              <div class="guideline-controls text-right">
-                <a class="btn btn-lg btn-link btn-previous hide" href="#guidelines-carousel" role="button" data-slide="prev">
-                  <span class="carousel-control-text">Previous</span>
-                </a>
-                <a class="btn btn-lg btn-primary btn-next" href="#guidelines-carousel" role="button" data-slide="next">
-                  <span class="carousel-control-text">Next</span>
-                </a>
-                <a type="button" class="btn btn-lg btn-success btn-done hide" data-dismiss="modal">I Agree</a>
-              </div>
-            </div>
-          </div>
-        </div>
-        <hr>
-        <div class="row">
-          <div class="col-sm-offset-6 col-sm-12">
-            <div class="help-block">Additional information available in our <%= link_to "Terms of Service", terms_path %>.</div>
-          </div>
-        </div>
-      </div>
-    </div>
-  </div>
-</div>
-
-<%= render "_partials/fda_footer" %>
+<div id="app-root"></div>
diff --git a/app/views/main/news.html.erb b/app/views/main/news.html.erb
index 7d6de4fb1..850b7953d 100644
--- a/app/views/main/news.html.erb
+++ b/app/views/main/news.html.erb
@@ -1,35 +1,3 @@
 <% content_for :title do %>News<% end %>
 
-<div class="page-header">
-  <div class="page-title text-center">
-    <div class="h1">
-      <span class="fa fa-lg fa-newspaper-o"></span> &nbsp;precisionFDA News
-    </div>
-  </div>
-</div>
-
-<div class="container container-padded">
-  <div class="row">
-    <div class="col-md-20 col-md-offset-2">
-
-      <% @news_items.each do |i|  %>
-        <div class="news-item">
-          <%= link_to i.href, class: "lead-intro" do %>
-            <%= i.title %>
-            <br/>
-            <h4 class="text-muted"><%= i.created_at.strftime("%B #{i.created_at.day.ordinalize}, %Y")%></h4>
-            <hr>
-            <div class="lead">
-              <%= i.content %>
-            </div>
-            <% unless i.video.blank? %>
-              <div class="embed-responsive embed-responsive-16by9">
-                <iframe src="<%= i.video %>" class="embed-responsive-item" style="display: block" rameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
-              </div>
-            <% end %>
-          <% end %>
-        </div>
-      <% end %>
-    </div>
-  </div>
-</div>
+<div id="app-root"></div>
diff --git a/app/views/main/publish.html.erb b/app/views/main/publish.html.erb
index eb6e4cac7..8d22a876d 100644
--- a/app/views/main/publish.html.erb
+++ b/app/views/main/publish.html.erb
@@ -5,13 +5,20 @@
   <div class="container container-padded-v">
     <!-- ko if: !isScopeASpace() -->
     <div class='pfda-help-block'>
-      <span class='fa fa-exclamation-triangle' aria-hidden='true'></span> Publishing items makes them publicly visible. <%= link_to("Review important information about publishing, and learn why it's a good idea to also publish related items.", "#{show_docs_path('publishing')}", target: '_blank') %>
+      <span class='fa fa-exclamation-triangle' aria-hidden='true'></span>
+      <div class='alert-help-remediated'>
+        Publishing items makes them publicly visible.
+      </div>
+      <%= link_to("Review important information about publishing, and learn why it's a good idea to also publish related items.", "#{show_docs_path('publishing')}", target: '_blank', class: 'review-doc-text') %>
     </div>
     <!-- /ko -->
     <!-- ko if: isScopeASpace() -->
     <div class='pfda-help-block'>
       <span class='fa fa-exclamation-triangle' aria-hidden='true'></span>
-      Sharing items makes them visible to the members of the selected Space. <%= link_to("Review important information about publishing, and learn why it's a good idea to also publish related items.", "#{show_docs_path('publishing')}", target: '_blank') %>
+      <div class='alert-help-remediated'>
+        Sharing items makes them visible to the members of the selected Space.
+      </div>
+      <%= link_to("Review important information about publishing, and learn why it's a good idea to also publish related items.", "#{show_docs_path('publishing')}", target: '_blank', class: 'review-doc-text' ) %>
     </div>
     <!-- /ko -->
     <div class="list-group">
diff --git a/app/views/main/request_access.html.erb b/app/views/main/request_access.html.erb
index b75ad5fc9..47a418c00 100644
--- a/app/views/main/request_access.html.erb
+++ b/app/views/main/request_access.html.erb
@@ -50,13 +50,13 @@
         <div class="form-group form-group-lg">
           <%= f.label :first_name, "First name", class: 'control-label col-sm-4 request_access_form_font_color' %>
           <div class="col-sm-offset-1 col-sm-10">
-            <%= f.text_field :first_name, class: 'form-control input-lg', placeholder: '', required: 'required' %>
+            <%= f.text_field :first_name, class: 'form-control input-lg', placeholder: '', required: 'required', minlength: 2 %>
           </div>
         </div>
         <div class="form-group form-group-lg">
           <%= f.label :last_name, "Last name", class: 'control-label col-sm-4 request_access_form_font_color' %>
           <div class="col-sm-offset-1 col-sm-10">
-            <%= f.text_field :last_name, class: 'form-control input-lg', required: 'required' %>
+            <%= f.text_field :last_name, class: 'form-control input-lg', required: 'required', minlength: 2 %>
           </div>
         </div>
         <div class="form-group form-group-lg">
@@ -65,62 +65,6 @@
             <%= f.email_field :email, class: 'form-control input-lg', required: 'required' %>
           </div>
         </div>
-        <div class="form-group form-group-lg">
-          <%= f.label :address1, "Address 1", class: 'control-label col-sm-4 request_access_form_font_color' %>
-          <div class="col-sm-offset-1 col-sm-10">
-            <%= f.text_field :address1, class: 'form-control input-lg', required: 'required' %>
-          </div>
-        </div>
-        <div class="form-group form-group-lg">
-          <%= f.label :address2, "Address 2", class: 'control-label col-sm-4 request_access_form_font_color' %>
-          <div class="col-sm-offset-1 col-sm-10">
-            <%= f.text_field :address2, class: 'form-control input-lg', placeholder: 'Optional' %>
-          </div>
-        </div>
-        <div class="form-group form-group-lg">
-          <%= f.label :city, "City", class: 'control-label col-sm-4 request_access_form_font_color' %>
-          <div class="col-sm-offset-1 col-sm-10">
-            <%= f.text_field :city, class: 'form-control input-lg', required: 'required' %>
-          </div>
-        </div>
-        <div class="form-group form-group-lg">
-          <%= f.label :country_id, "Country", class: 'control-label col-sm-4 request_access_form_font_color' %>
-          <div class="col-sm-offset-1 col-sm-10">
-            <%= f.select :country_id, @countries, {include_blank: true}, {class: 'form-control input-lg', required: 'required'} %>
-          </div>
-        </div>
-        <div class="form-group form-group-lg">
-          <%= f.label :postal_code, "Postal Code", class: 'control-label col-sm-4 request_access_form_font_color' %>
-          <div class="col-sm-offset-1 col-sm-10">
-            <%= f.text_field :postal_code, class: 'form-control input-lg', required: 'required' %>
-          </div>
-        </div>
-        <div class="form-group form-group-lg">
-          <%= f.label :us_state, "US State", class: 'control-label col-sm-4 request_access_form_font_color' %>
-          <div class="col-sm-offset-1 col-sm-10">
-            <%= f.select :us_state, @us_states_list, {include_blank: true}, {class: 'form-control input-lg', required: 'required', disabled: true} %>
-          </div>
-        </div>
-        <div class="form-group form-group-lg">
-          <%= f.label :phone_country_id, "Country Code", class: 'control-label col-sm-4 request_access_form_font_color' %>
-          <div class="col-sm-offset-1 col-sm-3">
-            <%= f.select :phone_country_id, @dial_codes, {include_blank: true}, {class: 'form-control input-lg', required: 'required'} %>
-          </div>
-          <!--<div class="col-sm-offset-1 col-sm-6">-->
-          <%#= <button class="btn btn-lg btn-primary hidden" data-bind="click: showConfirmPhoneModal, disable: disableConfirmPhoneButton, css: {
-              hidden: !showConfirmPhoneButton()
-            }">Request text validation code</button>
-            <div class="text-success hidden phone-confirmed" data-bind="css: {hidden: !phoneConfirmed()}">Phone number has been validated</div> %>
-          <!--</div>-->
-        </div>
-        <div class="form-group form-group-lg">
-          <%= f.label :phone, "Phone #", class: 'control-label col-sm-4 request_access_form_font_color', id: 'phone_label' %>
-           
-          <div class="col-sm-offset-1 col-sm-10">
-            <%= f.telephone_field :phone, class: 'form-control input-lg', required: 'required', "aria-labelledby": 'phone_label' %>
-            <input type="hidden" name="invitation[phone_confirmed]" id="invitation_phone_confirmed" value="true" />
-          </div>
-        </div>
         <div class="form-group form-group-lg form-group-optional">
           <%= f.label :duns, "DUNS #", class: 'control-label col-sm-4 request_access_form_font_color' %>
           <div class="col-sm-offset-1 col-sm-10">
@@ -188,7 +132,7 @@
             <%= f.text_field :req_software, class: 'form-control input-lg', placeholder: 'Optional' %>
           </div>
         </div>
-        <div class="form-group form-group-lg">
+        <div class="intended-use form-group form-group-lg">
           <div class="col-sm-offset-5 col-sm-10">
             Ultimately, what do you see as your intended use for precisionFDA?
             <div class="checkbox">
@@ -203,8 +147,6 @@
             </div>
           </div>
         </div>
-        <br>
-        <br>
 
         <div class="form-group form-group-lg">
           <div class="col-sm-offset-5 col-sm-10">
@@ -212,15 +154,9 @@
           </div>
         </div>
 
-        <hr>
-
-        <div class="form-group form-group-lg">
-          <div class="col-sm-offset-5 col-sm-10">
-            <strong>Prove you are not a robot:</strong>
-            <br>
-            <%= recaptcha_tags %>
-          </div>
-        </div>
+        <% unless Utils.development_or_test? %> 
+              <%= recaptcha_v3(action: 'registration') %>
+        <% end %> 
 
         <div class="form-group form-group-lg">
             <div class="col-sm-offset-5 col-sm-10">
diff --git a/app/views/main/track.html.erb b/app/views/main/track.html.erb
index 2bf0c4e68..b4a20b42a 100644
--- a/app/views/main/track.html.erb
+++ b/app/views/main/track.html.erb
@@ -1,7 +1,7 @@
 <% content_for :title do %>Track <%= @item.title %><% end %>
 
 <div class="page-header">
-  <div class="page-title"><span class="fa fa-flip-vertical fa-sitemap"></span> Track  <small><%= unilink(@item) %></small></div>
+  <div class="page-title"><span class="fa fa-flip-vertical fa-sitemap"></span> Track  <small><%= unilink(@item, { current_user: @context.user }) %></small></div>
 </div>
 
 <div class="container-fluid container-padded">
@@ -11,7 +11,7 @@
 
   <div class="panel panel-default">
     <div class="track-canvas-wrapper">
-      <svg class="track-canvas"><g></g></svg>
+      <svg class="track-canvas" alt="Stack of files denoting an app execution"><g></g></svg>
     </div>
   </div>
 </div>
diff --git a/app/views/notes/_note.html.erb b/app/views/notes/_note.html.erb
index 26ba002f0..5c8a80f45 100644
--- a/app/views/notes/_note.html.erb
+++ b/app/views/notes/_note.html.erb
@@ -19,7 +19,7 @@
                 </div>
                 <div class="media-body word-break-all">
                   <!-- ko if: path -->
-                    <a class="item-name" data-bind="text: name, attr: {href: path}" tabindex="-1" ></a>
+                    <a class="item-name" data-bind="text: name, attr: {href: path}" tabindex="-1" target="_blank"></a>
                   <!-- /ko -->
                   <!-- ko ifnot: path -->
                     <span class="item-name" data-bind="text: uid" tabindex="-1" ></span>
diff --git a/app/views/notifications_mailer/challenge_proposal_received.html.inky b/app/views/notifications_mailer/challenge_proposal_received.html.inky
new file mode 100644
index 000000000..724eaa352
--- /dev/null
+++ b/app/views/notifications_mailer/challenge_proposal_received.html.inky
@@ -0,0 +1,37 @@
+<wrapper>
+  <div class="hidden-email-preview">
+    <%= @subject %>
+  </div>
+  <spacer size="16"></spacer>
+  <container class="header">
+    <row>
+      <columns>
+        <a class="brand" href="<%= HOST %>" title="precisionFDA">
+          <img class="header-image" src="<%= HOST %>/assets/precisionFDA.email.dark.png" />
+        </a>
+      </columns>
+      <columns>
+        <p class="header-title text-right">New challenge proposal</p>
+      </columns>
+    </row>
+  </container>
+  <container class="radius">
+    <row>
+      <columns>
+        <p><%= @subject %></p>
+        <p><em>Name:</em> <%= @proposal[:name] %>
+        <p><em>Contact Email:</em> <%= @proposal[:email] %></p>
+        <p><em>Organisation/Institute:</em> <%= @proposal[:organisation] %></p>
+        <p><em>Do you have specific scientific question driving the challenge?</em> <%= @proposal[:specific_question] %></p>
+        <% if @proposal[:specific_question] == "Yes" %>
+          <p><em>Please provide details:</em> <%= @proposal[:specific_question_text] %></p>
+        <% end %>
+        <p><em>Do you have access to data for the challenge?</em> <%= @proposal[:data_details] %></p>
+        <% if @proposal[:data_details] == "Yes" %>
+          <p><em>Please provide details about the data (e.g. data type, sample number, etc):</em> <%= @proposal[:data_details_text] %></p>
+        <% end %>
+      </columns>
+    </row>
+  </container>
+  <spacer size="16"></spacer>
+</wrapper>
diff --git a/app/views/notifications_mailer/external_user_invited_to_space_email.html.inky b/app/views/notifications_mailer/external_user_invited_to_space_email.html.inky
index c3864da1a..a0822b5e2 100644
--- a/app/views/notifications_mailer/external_user_invited_to_space_email.html.inky
+++ b/app/views/notifications_mailer/external_user_invited_to_space_email.html.inky
@@ -25,7 +25,7 @@
         </p>
 
         <p>Role: <strong><%= @role %></strong></p>
-        <p>Side: <strong><%= member_side(@space, @admin) %></strong></p>
+        <p>Side: <strong><%= @admin.side_alias %></strong></p>
 
         <p>
           Space's let you move data from your private area and share to the space members to access.
diff --git a/app/views/notifications_mailer/guest_access_email.html.inky b/app/views/notifications_mailer/guest_access_email.html.inky
index e5bef761c..722e00908 100644
--- a/app/views/notifications_mailer/guest_access_email.html.inky
+++ b/app/views/notifications_mailer/guest_access_email.html.inky
@@ -20,11 +20,11 @@
       <columns>
         <p>Dear <%= @invitation.first_name %> <%= @invitation.last_name %>,</p>
 
-        <p>Thank you for your interest in the precisionFDA production project. As a first step, we have granted you "browse access" to the precisionFDA community. Below you will find your personal link, which you can use to browse the public areas of precisionFDA for the next 30 days -- no user account is required. This link is personal; if you know of others who need access, please ask them to file their own requests.</p>
+        <p>Thank you for your interest in the precisionFDA production project. While the provisioning of your full account is pending, we have granted you "browse access" to the precisionFDA community. Below you will find your personal link, which you can use to browse the public areas of precisionFDA for the next 30 days -- no user account is required. This link is personal; if you know of others who need access, please ask them to file their own requests.</p>
 
         <p><button class="radius" href="<%= HOST %>/browse_access?code=<%= @invitation.code %>">Click here to browse precisionFDA</button></p>
 
-        <callout class="primary">Note: PrecisionFDA is a production regulatory research sandbox and is intended to inform a broad community. As you browse precisionFDA, you may become interested in obtaining a precisionFDA user account, in order to be able to actively contribute. In that case, please contact PrecisionFDA@fda.hhs.gov with your plan. Community members who have committed to providing information and programs that can be useful in our initial focus of NGS Clinical Test Development and Validation will be assessed for contributor level access.</callout>
+        <callout class="primary">Note: PrecisionFDA is a production regulatory research platform and is intended to inform a broad community. Your request for a full account is pending and will be provisioned by the administrators. This may take several days. If more than two weeks have elapsed and your full access account has not been provisioned, please contact PrecisionFDA@fda.hhs.gov.</callout>
 
         <p>We are looking forward to seeing you on-line!</p>
         <p>&mdash;The precisionFDA team</p>
diff --git a/app/views/notifications_mailer/space_activation_email.html.inky b/app/views/notifications_mailer/space_activation_email.html.inky
index f04dec7fb..a803daded 100644
--- a/app/views/notifications_mailer/space_activation_email.html.inky
+++ b/app/views/notifications_mailer/space_activation_email.html.inky
@@ -1,6 +1,6 @@
 <wrapper>
   <div class="hidden-email-preview">
-    Space activation request for <%= @space.title %> as <%= "#{member_side(@space, @membership)} #{@membership.role}" %>
+    Space activation request for <%= @space.title %> as <%= @activation_request_lead %>
   </div>
   <spacer size="16"></spacer>
   <container class="header">
@@ -19,11 +19,11 @@
     <row>
       <columns>
         <p>
-          The space <strong><%= link_to @space.title, _space_url(@space) %></strong> was provisioned and listed you as <%= "#{member_side(@space, @membership)} #{@membership.role}" %>.
+          The space <strong><%= link_to @space.title, _space_url(@space) %></strong> was provisioned and listed you as <%= @activation_request_lead %>.
         </p>
 
         <p>
-          To start adding data to this space both <%= @space.review? ? 'reviewer and sponsor' : 'host and guest' %> lead admin's must accept the invitation. Please visit the space and click on "Accept space".
+          To start adding data to this space both <%= @space.review? ? 'reviewer and sponsor' : @leads_names %> lead admin's must accept the invitation. Please visit the space and click on "Accept space".
         </p>
         <button class="radius" href="<%= _space_url(@space) %>">View Space Invitation</button>
       </columns>
diff --git a/app/views/notifications_mailer/space_invitation_email.html.inky b/app/views/notifications_mailer/space_invitation_email.html.inky
index 421e2ad62..44ce6f233 100644
--- a/app/views/notifications_mailer/space_invitation_email.html.inky
+++ b/app/views/notifications_mailer/space_invitation_email.html.inky
@@ -23,7 +23,7 @@
         </p>
 
         <p>Role: <strong><%= @membership.role %></strong></p>
-        <p>Side: <strong><%= member_side(@space, @membership) %></strong></p>
+        <p>Side: <strong><%= @membership.side_alias %></strong></p>
 
         <p>
           Space's let you move data from your private area and share to the space members to access. You can then publish the data out of the space to the precisionFDA community.
diff --git a/app/views/profile/_profile_contacts_form.html.erb b/app/views/profile/_profile_contacts_form.html.erb
index e6adf2e99..9d26d2d51 100644
--- a/app/views/profile/_profile_contacts_form.html.erb
+++ b/app/views/profile/_profile_contacts_form.html.erb
@@ -30,76 +30,12 @@
     </form>
     <hr> %>
     <form class="form-horizontal" id="profile_form">
-      <div  class="row">
-        <div class="form-group required col-sm-6">
-          <div class="row">
-            <div class="col-sm-3">
-              <label for="profile_phone" class="control-label">Phone:</label>
-            </div>
-            <div class="col-sm-offset-9 col-sm-6">
-              <%= select 'profile', 'phone_country_id', dial_codes, { include_blank: true }, {
-                  class: 'form-control',
-                  required: 'required',
-                  data: {bind: 'value: contacts.phoneCountryCode'}
-              } %>
-            </div>
-          </div>
-        </div>
-        <div class="form-group required col-sm-offset-1 col-sm-5">
-            <input type="text" class="form-control" name="profile[phone]" id="profile_phone" required/>
-        </div>
-      </div>
       <div class="form-group required">
         <label for="profile_email" class="col-sm-3 control-label">Email address:</label>
         <div class="col-sm-8">
           <input type="email" class="form-control" name="profile[email]" id="profile_email" required data-bind="value: contacts.email">
         </div>
       </div>
-      <div class="form-group required">
-        <label for="profile_address1" class="col-sm-3 control-label">Address 1:</label>
-        <div class="col-sm-8">
-          <input type="text" class="form-control" name="profile[address1]" id="profile_address1" required data-bind="value: contacts.address1">
-        </div>
-      </div>
-      <div class="form-group required">
-        <label for="profile_address2" class="col-sm-3 control-label">Address 2:</label>
-        <div class="col-sm-8">
-          <input type="text" class="form-control" name="profile[address2]" id="profile_address2"  data-bind="value: contacts.address2">
-        </div>
-      </div>
-      <div class="form-group required">
-        <label for="profile_city" class="col-sm-3 control-label">City:</label>
-        <div class="col-sm-8">
-          <input type="text" class="form-control" name="profile[city]" id="profile_city" required data-bind="value: contacts.city">
-        </div>
-      </div>
-      <div class="form-group required">
-        <label for="profile_country" class="col-sm-3 control-label">Country:</label>
-        <div class="col-sm-8">
-          <%= select 'profile', 'country_id', countries, { include_blank: true }, {
-            class: 'form-control',
-            required: 'required',
-            data: { bind: 'value: contacts.country' }
-          } %>
-        </div>
-      </div>
-      <div class="form-group required">
-        <label for="profile_state" class="col-sm-3 control-label">US State:</label>
-        <div class="col-sm-8">
-          <%= select 'profile', 'us_state', Country.us_states_list, { include_blank: true }, {
-            class: 'form-control',
-            required: 'required',
-            data: { bind: 'value: contacts.state' },
-            disabled: true
-          } %>
-        </div>
-      </div>
-      <div class="form-group required">
-        <label for="profile_postal_code" class="col-sm-3 control-label">Postal Code:</label>
-        <div class="col-sm-8">
-          <input type="text" class="form-control" name="profile[postal_code]" id="profile_postal_code" required data-bind="value: contacts.postalCode">
-        </div>
-      </div>
       <div class="form-group">
         <div class="col-sm-3"></div>
         <div class="col-sm-8">
diff --git a/app/views/profile/index.html.erb b/app/views/profile/index.html.erb
index fa297df73..5f4f53395 100644
--- a/app/views/profile/index.html.erb
+++ b/app/views/profile/index.html.erb
@@ -48,14 +48,16 @@
         <span class="fa fa-fw fa-image"></span> Set Profile Gravatar
       <% end %>
       <%= link_to(content_tag(:span, "", class: "fa fa-fw fa-legal") + "Manage Licenses", licenses_path, class: 'btn btn-default') %>
+      <% if params[:permissionsDebug]=='true' %>
+       <%= link_to(content_tag(:span, "", class: "fa fa-fw fa-refresh") + "Check spaces permissions ", check_spaces_permissions_path, method: 'post', class: 'btn btn-default') %>
+       <% end  %>
     </div>
   </div>
 </div>
 
-<div class="infoframe-outer contact-information">
+<div class="infoframe-outer contact-information" data-bind="css: {hidden: !contacts.isEditing(), loading: contacts.isLoading()}">
   <div class="infoframe-inner">
     <h4 class="infoframe-title">Contact Information</h4>
-      <%= render 'profile/profile_contacts_view' %>
       <%= render 'profile/profile_contacts_form' %>
       <%#= render '_partials/phone_confirmation_modal' %>
       <%= render '_partials/auth_credentials_modal' %>
diff --git a/app/views/spaces/index.html.erb b/app/views/spaces/index.html.erb
index e136134bc..0420daa86 100644
--- a/app/views/spaces/index.html.erb
+++ b/app/views/spaces/index.html.erb
@@ -1,15 +1,3 @@
 <% content_for :title do %>Spaces<% end %>
 
 <div id="app-root"></div>
-
-<%# <%= render '_partials/space_navigation_tabs' %>
-
-<%# <% if @context.can_create_spaces? %>
-  <%# <div class="pfda-padded">
-    <%= link_to new_space_path, class: 'btn btn-primary' do %>
-      <%# <span class="fa fa-plus fa-fw"></span> Provision a Space
-    <% end %>
-  <%# </div> %>
-<%# <% end %>
-
-<%# <%= render "spaces/grid", spaces_grid: @spaces_grid %>
diff --git a/app/views/submissions/_grid.html.erb b/app/views/submissions/_grid.html.erb
index 0d9e74faf..cddda850b 100644
--- a/app/views/submissions/_grid.html.erb
+++ b/app/views/submissions/_grid.html.erb
@@ -21,7 +21,7 @@
     content_tag(:ul, "", class: "submission-ul") do
       submission.job.input_files.enum_for(:each_with_index).collect do |file, index|
         if file.present?
-          content_tag(:li, unilinkfw(file))
+          content_tag(:li, unilinkfw(file, target: "_blank"))
         else
           content_tag(:li,
             content_tag(:span, " ", class: "fa fa-file-o fa-fw") + " " + submission._inputs[index]
diff --git a/app/views/submissions/_my_grid.html.erb b/app/views/submissions/_my_grid.html.erb
index 24f1e8408..1921a03d6 100644
--- a/app/views/submissions/_my_grid.html.erb
+++ b/app/views/submissions/_my_grid.html.erb
@@ -40,7 +40,7 @@
     content_tag(:ul, "", class: "submission-ul") do
       submission.job.input_files.enum_for(:each_with_index).collect do |file, index|
         if file.present?
-          content_tag(:li, unilinkfw(file))
+          content_tag(:li, unilinkfw(file, target: "_blank"))
         else
           content_tag(:li,
             content_tag(:span, " ", class: "fa fa-file-o fa-fw") + " " + submission._inputs[index]
diff --git a/app/views/submissions/edit.html.erb b/app/views/submissions/edit.html.erb
index f901ee1e8..55d331b63 100644
--- a/app/views/submissions/edit.html.erb
+++ b/app/views/submissions/edit.html.erb
@@ -37,7 +37,7 @@
 
 <div class="pfda-toolbar clearfix">
   <div class="pull-right">
-    <%= link_to "Back to your entries", show_challenge_path(@submission.challenge, "my_entries"), class: "btn btn-link" %>
+    <%= link_to "Back to your entries", "/challenges/#{@submission.challenge.id}#my_entries", class: "btn btn-link" %>
     <a class="btn btn-primary" data-bind="click: save, css: {disabled: !isFormReady()}, text: saveBtnText"></a>
   </div>
 </div>
diff --git a/app/views/submissions/new.html.erb b/app/views/submissions/new.html.erb
index 8a2875daf..daaa1d12d 100644
--- a/app/views/submissions/new.html.erb
+++ b/app/views/submissions/new.html.erb
@@ -40,11 +40,6 @@
     <div class="panel-heading">
       <h4>Submission Input Data</h4>
     </div>
-    <div role="tabpanel" class="tab-pane tab-pane-padded active" id="app-job">
-      <div class="alert alert-warning">
-        <span class="fa fa-info-circle"></span> When you submit a challenge entry, the input file will be published as a PrecisionFDA <a href="/home/files/everybody">public file</a>, available to the community to access and download. If any of your input files are private, you will be asked to confirm this on the next page.
-      </div>
-    </div>
     <div class="panel-body">
       <form class="form form-horizontal">
         <!-- ko foreach: inputModels -->
diff --git a/app/views/users/show.html.erb b/app/views/users/show.html.erb
index 9a4fb5bad..ea3e302c0 100644
--- a/app/views/users/show.html.erb
+++ b/app/views/users/show.html.erb
@@ -108,14 +108,14 @@
   <% end %>
   <% if @counts[:comparisons] > 0 %>
   <li role="presentation" class="<%= params[:tab] == 'comparisons' ? 'active' : '' %>">
-    <a href="<%= user_path(@user.dxuser, 'comparisons') %>" aria-controls="tab-comparisons"><span class="fa fa-fw fa-area-chart"></span>
+    <a href="<%= user_path(@user.dxuser, 'comparisons') %>" aria-label="CLick to view Comparisons"><span class="fa fa-fw fa-area-chart"></span>
       <span class="tab-label">Comparisons <span class="badge"><%= @counts[:comparisons] %></span></span>
     </a>
   </li>
   <% end %>
   <% if @counts[:apps] > 0 %>
   <li role="presentation" class="<%= params[:tab] == 'apps' ? 'active' : '' %>">
-    <a href="<%= user_path(@user.dxuser, 'apps') %>" aria-controls="tab-apps"><span class="fa fa-fw fa-cube"></span>
+    <a href="<%= user_path(@user.dxuser, 'apps') %>" aria-label="Click to view Apps"><span class="fa fa-fw fa-cube"></span>
       <span class="tab-label">Apps <span class="badge"><%= @counts[:apps] %></span></span>
     </a>
   </li>
diff --git a/app/views/worker_mailer/node_copy_email.html.inky b/app/views/worker_mailer/node_copy_email.html.inky
new file mode 100644
index 000000000..e1ebaad3d
--- /dev/null
+++ b/app/views/worker_mailer/node_copy_email.html.inky
@@ -0,0 +1,47 @@
+<wrapper>
+  <div class="hidden-email-preview">
+    <%= @subject %>
+  </div>
+  <spacer size="16"></spacer>
+  <container class="header">
+    <row>
+      <columns>
+        <a class="brand" href="<%= HOST %>" title="precisionFDA">
+          <img class="header-image" src="<%= HOST %>/assets/precisionFDA.email.dark.png" />
+        </a>
+      </columns>
+      <columns>
+        <p class="header-title text-right"><%= @subject %></p>
+      </columns>
+    </row>
+  </container>
+  <container class="radius">
+    <row>
+      <columns>
+        <p><%= @subject %></p>
+          <% if @not_copied_folders.present? %>
+            <p>
+              The following folders haven't been copied since they already exist in <%= @destination %>:
+              <ul>
+                <% @not_copied_folders.each do |folder| %>
+                  <li><%= folder.name %>
+                <% end %>
+              </ul>
+            </p>
+          <% end %>
+          <% if @not_copied_files.present? %>
+            <p>
+              The following files haven't been copied since they already exist in <%= @destination %>:
+              <ul>
+                <% @not_copied_files.each do |file| %>
+                  <li><%= file.name %>
+                <% end %>
+              </ul>
+            </p>
+          <% end %>
+        </p>
+      </columns>
+    </row>
+  </container>
+  <spacer size="16"></spacer>
+</wrapper>
diff --git a/app/views/workflows/_detail.html.erb b/app/views/workflows/_detail.html.erb
index 3d5b76180..8cede0338 100644
--- a/app/views/workflows/_detail.html.erb
+++ b/app/views/workflows/_detail.html.erb
@@ -104,10 +104,8 @@
       <%= link_to new_workflow_analysis_path(@workflow), class: "btn btn-primary" do %>
         Run Workflow&nbsp;&nbsp;<span class="badge rev-badge"><%= "rev#{@workflow.revision}" %></span>
       <% end %>
-      <% if @workflow.allow_batch_run? %>
-        <%= link_to batch_workflow_workflow_path(@workflow), class: "btn btn-primary" do %>
-          Run Batch Workflow&nbsp;&nbsp;<span class="badge rev-badge"><%= "rev#{@workflow.revision}" %></span>
-        <% end %>
+      <%= link_to batch_workflow_workflow_path(@workflow), class: "btn btn-primary" do %>
+        Run Batch Workflow&nbsp;&nbsp;<span class="badge rev-badge"><%= "rev#{@workflow.revision}" %></span>
       <% end %>
     <% end %>
     <%= render "_partials/btn_copy", item: @workflow %>
diff --git a/app/views/workflows/batch_workflows/_spec_rows.html.erb b/app/views/workflows/batch_workflows/_spec_rows.html.erb
index 1e27dfa1d..4cd396260 100644
--- a/app/views/workflows/batch_workflows/_spec_rows.html.erb
+++ b/app/views/workflows/batch_workflows/_spec_rows.html.erb
@@ -53,7 +53,6 @@
             <div data-bind="template: { name: 'pfda_app_input_template', data: $data }"></div>
           </td>
           <td>
-            <!-- ko if: $data.showBatchInput -->
               <div class="radio">
                 <label data-bind="attr: {for: $data.id + '_batch_input_1'}">
                   <input
@@ -70,10 +69,8 @@
                   <span data-bind="text: $data.type"></span>
                 </label>
               </div>
-            <!-- /ko -->
           </td>
           <td>
-            <!-- ko if: $data.showBatchInput -->
               <div class="radio">
                 <label data-bind="attr: {for: $data.id + '_batch_input_2'}">
                   <input
@@ -91,7 +88,6 @@
                   <span data-bind="text: $data.type"></span>
                 </label>
               </div>
-            <!-- /ko -->
           </td>
         </tr>
       <!-- /ko -->
diff --git a/app/views/workflows/cwl_wdl_import.1/_import_cwl_wdl_modal.html.erb b/app/views/workflows/cwl_wdl_import.1/_import_cwl_wdl_modal.html.erb
index a19d35049..c69ee9675 100644
--- a/app/views/workflows/cwl_wdl_import.1/_import_cwl_wdl_modal.html.erb
+++ b/app/views/workflows/cwl_wdl_import.1/_import_cwl_wdl_modal.html.erb
@@ -33,7 +33,7 @@
           <div>
             <span class="btn btn-primary btn-sm btn-browse-files">
               <span class="fa fa-files-o"></span>&nbsp;Select Docker Image
-              <input id="docker_image_file_input" type="file" accept=".tar.gz" data-bind="event: {change: dockerFileOnChangeHandler}">
+              <input id="docker_image_file_input" type="file" accept=".gz" data-bind="event: {change: dockerFileOnChangeHandler}">
             </span>
           </div>
           <!-- ko if: dockerImage() -->
diff --git a/app/views/workflows/cwl_wdl_import.1/_import_cwl_wdl_success_modal.html.erb b/app/views/workflows/cwl_wdl_import.1/_import_cwl_wdl_success_modal.html.erb
index ec2707d5e..1f18783fc 100644
--- a/app/views/workflows/cwl_wdl_import.1/_import_cwl_wdl_success_modal.html.erb
+++ b/app/views/workflows/cwl_wdl_import.1/_import_cwl_wdl_success_modal.html.erb
@@ -25,7 +25,7 @@
         <!-- /ko -->
       </div>
       <div class="modal-footer">
-        <a data-bind="attr: {href: newWorkflowURL}">
+        <a data-bind="attr: {href: newWorkflowURL}" target="_blank">
           <input type="button" class="btn btn-primary" tabindex="-1" value="Ok">
         </a>
       </div>
diff --git a/app/views/workflows/cwl_wdl_import/_import_cwl_wdl_modal.html.erb b/app/views/workflows/cwl_wdl_import/_import_cwl_wdl_modal.html.erb
index d9212929e..9b8d59f96 100644
--- a/app/views/workflows/cwl_wdl_import/_import_cwl_wdl_modal.html.erb
+++ b/app/views/workflows/cwl_wdl_import/_import_cwl_wdl_modal.html.erb
@@ -33,7 +33,7 @@
           <div>
             <span class="btn btn-primary btn-sm btn-browse-files">
               <span class="fa fa-files-o"></span>&nbsp;Add Docker Image
-              <input id="docker_image_file_input" type="file" accept=".tar.gz" data-bind="event: {change: dockerFileOnChangeHandler}">
+              <input id="docker_image_file_input" type="file" accept=".gz" data-bind="event: {change: dockerFileOnChangeHandler}">
             </span>
           </div>
           <!-- ko if: dockerImagesArray().length -->
diff --git a/app/views/workflows/cwl_wdl_import/_import_cwl_wdl_success_modal.html.erb b/app/views/workflows/cwl_wdl_import/_import_cwl_wdl_success_modal.html.erb
index 9af177f60..44d584b82 100644
--- a/app/views/workflows/cwl_wdl_import/_import_cwl_wdl_success_modal.html.erb
+++ b/app/views/workflows/cwl_wdl_import/_import_cwl_wdl_success_modal.html.erb
@@ -15,22 +15,22 @@
       <div class="modal-body">
         <p>
           <b>Workflow URL:</b>
-          <a target="_blank" data-bind="text: newWorkflowUid, attr: {href: newWorkflowURL}"></a>
+          <a target="_blank" data-bind="text: newWorkflowUid, attr: {href: newWorkflowURL}, click: hideWorkflowModal"></a>
         </p>
         <!-- ko if: newAssetUids().length > 0 -->
-          <p>
-            <b>Asset URLs:</b>
-          </p>
+        <p>
+          <b>Asset URLs:</b>
+        </p>
 
-          <!-- ko foreach: newAssetUids() -->
-            <p>
-              <a target="_blank" data-bind="text: $data, attr: {href: '/assets/' + $data}"></a>
-            </p>
-          <!-- /ko -->
+        <!-- ko foreach: newAssetUids() -->
+        <p>
+          <a target="_blank" data-bind="text: $data, attr: {href: '/home/assets/' + $data}, click: hideAssetModal"></a>
+        </p>
+        <!-- /ko -->
         <!-- /ko -->
       </div>
       <div class="modal-footer">
-        <a data-bind="attr: {href: newWorkflowURL}">
+        <a data-bind="attr: {href: newWorkflowURL}, click: hideWorkflowModal">
           <input type="button" class="btn btn-primary" tabindex="-1" value="Ok">
         </a>
       </div>
diff --git a/app/workers/file_copy_worker.rb b/app/workers/file_copy_worker.rb
index 4d652191e..2646c8995 100644
--- a/app/workers/file_copy_worker.rb
+++ b/app/workers/file_copy_worker.rb
@@ -33,8 +33,8 @@ def remove_failed_files(job)
 
       begin
         api.project_remove_objects(project, files.map(&:dxid))
-      rescue Net::HTTPClientException => e
-        raise e unless e.message =~ /^404/
+      rescue DXClient::Errors::NotFoundError
+        # do nothing
       end
 
       files.destroy_all
diff --git a/app/workers/node_copy_worker.rb b/app/workers/node_copy_worker.rb
new file mode 100644
index 000000000..bdbd01906
--- /dev/null
+++ b/app/workers/node_copy_worker.rb
@@ -0,0 +1,77 @@
+# Copies files and folders to private scope or space in the background.
+class NodeCopyWorker < ApplicationWorker
+  sidekiq_retries_exhausted do |job, _ex|
+    notify_user(job)
+    rollback_platform_files(job)
+  end
+
+  class << self
+    # Notifies user if there was any error with copying.
+    # @param job [Sidekiq::Job] A sidekiq job.
+    def notify_user(job)
+      scope = job["args"].first
+      context = build_context(job)
+
+      subject = "An error occurred during the copying to scope '#{scope}'"
+      message = "#{subject}: #{job['error_message']}"
+
+      Rails.logger.error(message)
+
+      WorkerMailer.alert_email(context.user.email, message, subject).deliver_now
+    end
+
+    # Removes files from the new project where they were copied to.
+    # @param job [Sidekiq::Job] Current job.
+    def rollback_platform_files(job)
+      context = build_context(job)
+      scope = job["args"].first
+      nodes_ids = job["args"].second
+      project = UserFile.publication_project!(context.user, scope)
+      nodes_dxids = UserFile.where(id: nodes_ids).pluck(:dxid)
+      persisted_dxids =
+        UserFile.where(dxid: nodes_dxids, scope: scope, project: project).pluck(:dxid)
+
+      (nodes_dxids - persisted_dxids).each_slice(1000) do |dxids|
+        context.api.project_remove_objects(project, dxids, force: true)
+      end
+    end
+
+    # Builds user context.
+    # @param job [Sidekiq::Job] Current job.
+    # @return [Context] A user context.
+    def build_context(job)
+      Context.build(job["args"].last)
+    end
+  end
+
+  # Copies files and folders.
+  #
+  # @param scope [String] A destination scope (private, space-xxx).
+  # @param nodes_ids [Array<Integer>] Files or folders IDs to copy.
+  # @param session_auth_params [Hash] User session auth params.
+  def perform(scope, nodes_ids, session_auth_params)
+    @context = Context.build(session_auth_params)
+    nodes = Node.where(id: nodes_ids)
+    copies = copy_service.copy(nodes, scope)
+    notify_user(copies, scope)
+  end
+
+  private
+
+  # Notifies users if some items weren't copied.
+  # @param copies [CopyService::Copies] The collection of copied files and sources.
+  # @param scope [String] The destination scope.
+  def notify_user(copies, scope)
+    return if copies.all?(&:copied)
+
+    WorkerMailer.node_copy_email(
+      @context.user.email,
+      copies,
+      scope,
+    ).deliver_now
+  end
+
+  def copy_service
+    @copy_service ||= CopyService::NodeCopier.new(api: @context.api, user: @context.user)
+  end
+end